scieee Science in your language
[en] (orig)

Supplementary material 1 from: Chwalińska M, Karlicki M, Romac S, Not F, Karnkowska A (2025) From short to long reads: enhanced protist diversity profiling via Nanopore metabarcoding. Metabarcoding and Metagenomics 9: e163750. https://doi.org/10.3897/mbmg.9.163750

Author: Chwalińska, Małgorzata; Karlicki, Michał; Romac, Sarah; Not, Fabrice; Karnkowska, Anna
Publisher: Zenodo
DOI: 10.3897/mbmg.9.163750.suppl1
Source: https://zenodo.org/records/17310919/files/oo_1433293.pdf
F om sho o long eads: enhanced p o2s di e si y p ofiling ia Nanopo e
me aba coding
Małgo za a Chwalińska1, Michał Ka licki1, Sa ah Romac2, Fab ice No 2, Anna Ka nkowska1*
1 Uni e si y o Wa saw, InsE u e o E oluEona y Biology, Facul y o Biology, Poland
2 So bonne Uni e si é, CNRS, UMR7144 Adap aEon and Di e si y in Ma ine En i onmen
(AD2M) Labo a o y, Ecology o Ma ine Plank on eam, S aEon Biologique de Roscoff, Place
Geo ges Teissie , Roscoff, F ance
* co esponding au ho ; email: a.ka [email protected]
De ailed ma e ials and me hods
1. Amplifica+on o 18S RNA gene agmen o C yp omonas gy opy enoidosa SAG 25.80 s ain
To ampli y 18S RNA gene om C yp omonas gy opy enoidosa SAG 25.80 s ain we used SA (5’
AACCTGGTTGATCCTGCCAGT 3’) and EukB (5’ TGATCCTTCTGCAGGTTCACCTAC 3’) (Medlin e al., 1988)
p ime s (each a he final concen aMon o 0.2 µM). The 25 µl PCR mix u e con ained also 1µl o DNA
empla e, 0.8 mM o mix o dNTPs, 1X o Phusion HF Buffe and 0.25 μl o Phusion High-Fideli y DNA
polyme ase (The moFishe ). The p og am included: iniMal dena u aMon a 98oC o 30 s, 27 cycles o
10 s a 98oC, 30 s a 67oC, 1 m a 72oC and final elongaMon a 72oC o 5 m.
2. Amplifica+on o V4-18S RNA gene agmen om eshwa e samples and mock communi y
The amplificaMon o he V4 egion o 18S RNA gene was pe o med in h ee eplica es pe sample in
a 25 µl PCR mix u e con aining TAReuk454FWD1 (5’ CCAGCASCYGCGGTAATTCC 3’) and TAReukREV3
(5’ ACTTTCGTTCTTGATYRA 3’) (S oeck e al., 2010) p ime s (each a final concen aMon o 0.2 µM), 1µl
(5 ng/µl) o DNA empla e, 0.8 mM o mix o dNTPs, 1X o Phusion GC Buffe and 0.25 μl o Phusion
High-Fideli y DNA polyme ase (The moFishe ). The p og am conMned ollowing s eps: iniMal
dena u aMon a 98oC o 30 s, 12 cycles o 10 s a 98oC, 30 s a 53oC, 30 s a 72oC, 18 cycles o 10 s a
98oC, 30 s a 48oC, 30 s a 72oC and final elongaMon a 72oC o 10 m.
3. Amplifica+on o 18S – D2 28S RNA gene om eshwa e and ma ine samples and mock
communi y
We used SA (5’ TTTCTGTTGGTGCTGATATTGCAACCTGGTTGATCCTGCCAGT 3’) (Medlin e al., 1988) and
D2C-R (5’ ACTTGCCTGTCGCTCTATCTTCCCTTGGTCCGTGTTTCAAGA 3’) (Scholin e al., 1994) p ime s o
ampli y a agmen om he beginning o 18S o D2 agmen o 28S DNA. The p ime s a e ex ended
by an adap e sequence (bold), which is equi ed by he PCR Ba coding Expansion 1-12 (EXP-PBC001)
ki . The 25 µl PCR mix u e con ained p ime s in final concen aMon o 0.2 µM, 1µl (5 ng/µl) o DNA
empla e, 1.6 mM o mix o dNTPs, 0.25 μl o Phusion High-Fideli y DNA polyme ase (The moFishe ,
Finnzymes) and 1X o Phusion HF Buffe o Phusion GC Buffe especM ely o eshwa e and ma ine
samples. The p og am conMned ollowing s eps: iniMal dena u aMon a 98oC o 30 s, 27 cycles o 10 s
a 98oC, 30 s a 59oC o eshwa e samples o 55oC o ma ine samples, 30 s - 2 m a 72oC and final
elongaMon a 72oC o 10 m. The eacMon was pe o med in h ee eplica es pe sample.
Re e ences
Medlin, L., Elwood, H. J., SMckel, S., & Sogin, M. L. (1988). The cha ac e izaMon o enzymaMcally
amplified euka yoMc 16S-like RNA-coding egions. Gene, 71(2), 491–499.
Scholin, C. A., He zog, M., Sogin, M., & Ande son, D. M. (1994). IdenMficaMon o g oup-and s ain-
specific geneMc ma ke s o globally dis ibu ed Alexand ium (Dinophyceae). Ii. Sequence
analysis o a agmen o he LSU RNA gene 1. Jou nal o Phycology, 30(6), 999–1011.
S oeck, T., Bass, D., Nebel, M., Ch is en, R., Jones, M. D. M., B eine , H., & Richa ds, T. A. (2010).
MulMple ma ke pa allel ag en i onmen al DNA sequencing e eals a highly complex
euka yoMc communi y in ma ine anoxic wa e . Molecula Ecology, 19(s1), 21–31.
hjps://doi.o g/10.1111/j.1365-294X.2009.04480.x
Supplemen a y figu es
Supplemen a y Figu e 1 Numbe o axa de ec ed a di0e en axonomic anks in he
mock communi y de e mined by cell coun and using Illumina and Nanopo e
sequencing. The figu e shows he numbe o axa iden ified sepa a ely in he Illumina
and Nanopo e da ase s, as well as he numbe o axa sha ed by bo h me hods.
Supplemen a y Figu e 2 Rela i e abundance o species in he mock communi y
classified as “O he ” a he subdi ision le el, as de e mined by all sequencing
app oaches.
Supplemen a y Figu e 3 Ra e ac ion cu es showing he numbe o obse ed species
pe eshwa e sample sequenced wi h Illumina echnology.
Supplemen a y Figu e 4 Ra e ac ion cu es showing he numbe o obse ed species
pe ma ine sample sequenced wi h Illumina echnology.
Supplemen a y Figu e 5 Ra e ac ion cu es showing he numbe o obse ed species
pe eshwa e sample sequenced wi h Nanopo e echnology.
Supplemen a y Figu e 6 Ra e ac ion cu es showing he numbe o obse ed species
pe ma ine sample sequenced wi h Nanopo e echnology.