Supplementary material 1 from: Chwalińska M, Karlicki M, Romac S, Not F, Karnkowska A (2025) From short to long reads: enhanced protist diversity profiling via Nanopore metabarcoding. Metabarcoding and Metagenomics 9: e163750. https://doi.org/10.3897/mbmg.9.163750

From short to long reads: enhanced pro2st diversity profiling via Nanopore metabarcoding Małgorzata Chwalińska1, Michał Karlicki1, Sarah Romac2, Fabrice Not2, Anna Karnkowska1* 1 University of Warsaw, InsEtute of EvoluEonary Biology, Faculty of Biology, Poland 2 Sorbonne Université, CNRS, UMR7144 AdaptaEon and Diversity in Marine Environment (AD2M) Laboratory, Ecology of Marine Plankton team, StaEon Biologique de Roscoff, Place Georges Teissier, Roscoff, France * corresponding author; email: [email protected] Detailed materials and methods 1. Amplifica+on of 18S rRNA gene fragment of Cryptomonas gyropyrenoidosa SAG 25.80 strain To amplify 18S rRNA gene from Cryptomonas gyropyrenoidosa SAG 25.80 strain we used SA (5’ AACCTGGTTGATCCTGCCAGT 3’) and EukB (5’ TGATCCTTCTGCAGGTTCACCTAC 3’) (Medlin et al., 1988) primers (each at the final concentraMon of 0.2 µM). The 25 µl PCR mixture contained also 1µl of DNA template, 0.8 mM of mix of dNTPs, 1X of Phusion HF Buffer and 0.25 μl of Phusion High-Fidelity DNA polymerase (ThermoFisher). The program included: iniMal denaturaMon at 98oC for 30 s, 27 cycles of 10 s at 98oC, 30 s at 67oC, 1 m at 72oC and final elongaMon at 72oC for 5 m. 2. Amplifica+on of V4-18S rRNA gene fragment from freshwater samples and mock community The amplificaMon of the V4 region of 18S rRNA gene was performed in three replicates per sample in a 25 µl PCR mixture containing TAReuk454FWD1 (5’ CCAGCASCYGCGGTAATTCC 3’) and TAReukREV3 (5’ ACTTTCGTTCTTGATYRA 3’) (Stoeck et al., 2010) primers (each at final concentraMon of 0.2 µM), 1µl (5 ng/µl) of DNA template, 0.8 mM of mix of dNTPs, 1X of Phusion GC Buffer and 0.25 μl of Phusion High-Fidelity DNA polymerase (ThermoFisher). The program conMned following steps: iniMal denaturaMon at 98oC for 30 s, 12 cycles of 10 s at 98oC, 30 s at 53oC, 30 s at 72oC, 18 cycles of 10 s at 98oC, 30 s at 48oC, 30 s at 72oC and final elongaMon at 72oC for 10 m. 3. Amplifica+on of 18S – D2 28S rRNA gene from freshwater and marine samples and mock community We used SA (5’ TTTCTGTTGGTGCTGATATTGCAACCTGGTTGATCCTGCCAGT 3’) (Medlin et al., 1988) and D2C-R (5’ ACTTGCCTGTCGCTCTATCTTCCCTTGGTCCGTGTTTCAAGA 3’) (Scholin et al., 1994) primers to amplify a fragment from the beginning of 18S to D2 fragment of 28S rDNA. The primers are extended by an adapter sequence (bold), which is required by the PCR Barcoding Expansion 1-12 (EXP-PBC001) kit. The 25 µl PCR mixture contained primers in final concentraMon of 0.2 µM, 1µl (5 ng/µl) of DNA template, 1.6 mM of mix of dNTPs, 0.25 μl of Phusion High-Fidelity DNA polymerase (ThermoFisher, Finnzymes) and 1X of Phusion HF Buffer or Phusion GC Buffer respecMvely for freshwater and marine samples. The program conMned following steps: iniMal denaturaMon at 98oC for 30 s, 27 cycles of 10 s at 98oC, 30 s at 59oC for freshwater samples or 55oC for marine samples, 30 s - 2 m at 72oC and final elongaMon at 72oC for 10 m. The reacMon was performed in three replicates per sample. References Medlin, L., Elwood, H. J., SMckel, S., & Sogin, M. L. (1988). The characterizaMon of enzymaMcally amplified eukaryoMc 16S-like rRNA-coding regions. Gene, 71(2), 491–499. Scholin, C. A., Herzog, M., Sogin, M., & Anderson, D. M. (1994). IdenMficaMon of group-and strainspecific geneMc markers for globally distributed Alexandrium (Dinophyceae). Ii. Sequence analysis of a fragment of the LSU rRNA gene 1. Journal of Phycology, 30(6), 999–1011. Stoeck, T., Bass, D., Nebel, M., Christen, R., Jones, M. D. M., Breiner, H., & Richards, T. A. (2010). MulMple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryoMc community in marine anoxic water. Molecular Ecology, 19(s1), 21–31. hjps://doi.org/10.1111/j.1365-294X.2009.04480.x Supplementary figures Supplementary Figure 1 Number of taxa detected at di0erent taxonomic ranks in the mock community determined by cell count and using Illumina and Nanopore sequencing. The figure shows the number of taxa identified separately in the Illumina and Nanopore datasets, as well as the number of taxa shared by both methods. Supplementary Figure 2 Relative abundance of species in the mock community classified as “Other” at the subdivision level, as determined by all sequencing approaches. Supplementary Figure 3 Rarefaction curves showing the number of observed species per freshwater sample sequenced with Illumina technology. Supplementary Figure 4 Rarefaction curves showing the number of observed species per marine sample sequenced with Illumina technology. Supplementary Figure 5 Rarefaction curves showing the number of observed species per freshwater sample sequenced with Nanopore technology. Supplementary Figure 6 Rarefaction curves showing the number of observed species per marine sample sequenced with Nanopore technology.