73
Alha bi e al.
In . J. Biosci.
2020
RESEARCH PAPER OPEN ACCESS
Molecula iden i ica ion o
Salmonella en ica
se o a s in
eady- o-ea as oods using mul iplex-PCR
Sami A. Alha bi, Mamdouh H. Abdel-Gha a , Kadha Ni as R*
Depa men o Medical Labo a o y Science, College o Applied Medical Sciences, Al-Quwayiyah,
Shaq a Uni e si y, Kingdom o Saudi A abia
Key wo ds: Ready- o-ea (RTE) as oods, Mul iplex PCR, Salmonella en ica Se o a s Typhimu ium and
En e i idis.
h p://dx.doi.o g/10.12692/ijb/16.6.73-79
A icle published on June 16, 2020
Abs ac
Foodbo ne pa hogens a e becoming a globally o midable heal h complica ion and pe cei ed as a majo heal h
conce n in he Kingdom o Saudi A abia (KSA). In ou p e ious s udy, 23 o Salmonella en ica we e isola ed
om eady- o-ea (RTE) as oods included shawa ma, ala el, ege able salad and kib ha, om i een di e en
ood co ne s in Al-Quwayiyah, Riyadh Region o Saudi A abia. Iden i ica ion was based on con en ional cul u e,
biochemical and se ological echniques. The objec i e o he cu en s udy is o con i m iden i ica ion he
se o a s o S. en ica isola es using mul iplex-PCR. Fo his pu pose, wo speci ic oligonucleo ide p ime pai s
we e used o ampli y lic and se A genes o S.en ica se o a s Typhimu ium and En e idi is. The esul s
e ealed ha 5 o S. Typhimu ium and 3 o S. En e idi is we e ob ained om 8 posi i e Salmonella spp. In
shawa ma samples, 2 o S. Typhimu ium and 1 o S. En e idi is we e ob ained om 3 posi i e Salmonella spp. In
alah el samples, 6 o S. Typhimu ium and 2o S. En e idi is we e ob ained om 8 posi i e Salmonella spp. In
ege able salad samples, only 2 o S. Typhimu ium and 2 o S. En e idi is we e ob ained om 4 posi i e
Salmonella spp. in Kib ha samples. These esul s highligh he impo ance o he mul iplex PCR o e se o ype
o he apid de ec ion o Salmonella om RTE as ood samples.
* Co esponding Au ho : Kadha Ni as R kni a[email p o ec ed]
In e na ional Jou nal o Biosciences | IJB |
ISSN: 2220-6655 (P in ), 2222-5234 (Online)
h p://www.innspub.ne
Vol. 16, No. 6, p. 73-79, 2020
74
Alha bi e al.
In . J. Biosci.
2020
In oduc ion
In oday's wo ld he as ood indus y has g own e y
as because o busy and hec ic li e schedule has
opened o he people. Ready- o-ea (RTE) as ood is
one o he mos liked and p e e ed includes ea en
shawa ma, ala el, ege able salad and kib ha sold in
as ood es au an s in Saudi A abia. Consump ion o
e ined mea is app eciably la ge in Saudi A abia,
especially is chicken. T adi ionally, lamb, goa and
camel mea had been cus oma y in he die s o Saudis
and Eu opean Commission EC (Eu opean
Commission, 2017).
Foodbo ne diseases endu e a majo p oblem in
de eloping coun ies because o lack o pe sonal
hygiene and ood sa e y measu es. As much as 70% o
dia heal diseases in de eloping coun ies a e
belie ed o be o oodbo ne o igin (Amany e al.,
2013).
The e a e many incidences o oodbo ne diseases
which ha e been epo ed in di e en ci ies o Saudi
A abia. Recen s udies in sulyyel, Riyadh, showed
ha people o en complained o gas i is 21 hou s
a e ha ing he lunch/dinne in he ma iage pa y
was due o Salmonella spp. (Khalil Mohamed e al.,
2017).
Foodbo ne pa hogens we e ecen ly epo ed o high
mo bidi y in Hail and Abha, 39 cases o
S aphylococcus au eus and 26 cases o Salmonella
en e i idis espec i ely (Khalil Mohamed e al., 2017).
Al hough oodbo ne diseases do no always esul in
acu e gas oen e i is, ood ep esen s an impo an
ehicle o pa hogens causing acu e gas o
gas oen e i is. Dia heal diseases a e he commones
mani es a ion o ood poisoning and in some cases, i
is e y le hal oo.
Con en ional cul u e me hods ha e adi ionally been
conside ed as he “gold s anda d” o he isola ion
and iden i ica ion o oodbo ne bac e ial pa hogens.
They consis o a se ies o s eps ha include
nonselec i e en ichmen , selec i e en ichmen ,
selec i e/di e en ial pla ing and, inally,
mo phological, biochemical and se ological
con i ma ion. This s anda dized classical cul u e
me hod is known o be sensi i e and inexpensi e, bu
cul u e me hods a e labo -in ensi e and ime-
consuming, because hey equi e a leas , h ee
wo king days o p oduce a nega i e esul and i e o
en wo king days o con i med posi i e esul s.
Mo eo e , due o en i onmen al ac o s, a ia ions in
gene exp ession o mic oo ganisms can occu and
may a ec he esul s o biochemical es s.
Fu he mo e, iable bu non cul i able cells a e no
de ec ed by he con en ional me hodology. Rapid
me hods o he de ec ion o Salmonella in ood ha e
been de eloped, o example, elec ical echniques,
immunoassays and nucleic acid p obe analyses, bu
he e a e s ill p oblems wi h hei sensi i i y and
speci ici y (Oma B Ahmed e al., 2014).
Salmonella en e ica se o a s En e i idis and
Typhimu ium which a e ep esen he mos
p edominan isola ed o ganisms in mos cases
associa ed wi h he consump ion o con amina ed
poul y, po k and bee p oduc s (Doaa e al., 2013).
In ecen yea s, PCR-based me hods ha e been
epo ed as a apid, speci ic and sensi i e al e na i e,
and ha e been inc easingly used o iden i y se e al
mic obial species om oods (Ja osla Pochop e al.,
2013). PCR has become an impo an de ec ion ool
o pa hogens in oods; PCR can also iden i y s ain
di e ences by a ge ing gene(s) o sequences
exhibi ing polymo phisms o a iabili y in i s
dis ibu ion wi hin he bac e ial popula ion
(Mahmoud Elha i i e al., 2017).
In ou ecen ly s udy (Sami A. Alha bi e al., 2019),
23 S. en ica we e isola ed om 155 RTE as ood
samples i.e. shawa ma, ala el, ege able salad and
Kib ha collec ed om di e en 15 es au an s a Al-
Quwayiyah ci y e ealed ha , KSA.
These isola es we e mo phologically, biochemically
and se ologically iden i ied. The e o e, he objec i e
o his s udy is o iden i y he se o a s o he 23 S.
en ica using mul iplex PCR.
75
Alha bi e al.
In . J. Biosci.
2020
Ma e ials and me hods
DNA ex ac ion
Isola es o 23 Salmonella en ica; which iden i ied
using con en ional cul u e, biochemical and
se ological echniques in ou p e ious s udy (Sami A.
Alha bi e al., 2019), we e g own in 10 ml Xylose
Lysine Desoxychola e (XLD) a 37oC o 24h. The
o e nigh cul u es we e cen i uged a 3000 pm o 5
min and he supe na an we e decan ed ca e ully. The
bac e ial pelle s we e washed h ee imes wi h
phospha e bu e saline pH 7.2 and esuspended in
400μl is-EDTA bu e (pH 8.0) and hea ed in wa e
ba h a 100oC o 20 min. The e we e le o cool a
oom empe a u e and cen i uged a 14,000 pm o
10 min. An aliquo o 5μl o he supe na an was used
as empla e DNA in he mul iplex PCR (Moussa IM e
al., 2010).
Oligonucleo ide p ime s
Th ee speci ic oligonucleo ide p ime pai s we e used
o mul iplex PCR. The i s was ST11 o ST15 p ime s
we e selec ed which ampli y agmen o 429 bp ha
is speci ic Salmonella spp. (LailaNim i e al., 2014).
The second was Fli15-Tym p ime s we e speci ic o
he liC genes o S. Typhimu ium o p oduce amplicon
size o 559 bp (Moussa IM e al., 2012). The hi d was
Se 167 o Se 478 p ime s speci ic o he se A gene
ound in S. En e i idis which ampli y agmen o 312
bp. All speci ic p ime s we e syn hesized by Sigma in
Ge many acco ding o (Hannan A, e al., 2014).
DNA ampli ica ion
PCR ampli ica ions we e pe o med in a inal olume
o 50 μl in mic o-ampli ica ion ubes. The eac ion
mix u es consis ed o 5 μl o he DNA empla e, 5 μl
10X PCR bu e (75mM T is-HCL, pH 9.0, 2mM
MgCl2, 50mM KCl, 20mM (NH4)2SO4), 1μl dNTPs
(40μM), 1μl (1U Ampli Taq DNA polyme ase) 1μl
(25pmol) om he o wa d and e e se o h ee se s
o p ime s and he olume o he eac ion mix u e
was comple ed o 50μl using deionized dis illed wa e .
The he mal cycle (C1000 TouchTM he mal cycle
(CFX96, BIO-RAD, USA)) was adjus ed acco ding o
(Moussa IM e al., 2012) as ollows: ini ial
dena u a ion a 94oC o 5 min, ollowed by 35 cycles
o (dena u a ion a 94oC o 1min, annealing a 56oC
o 1min and ex ension a 72oC o 1min). Final
ex ension was ca ied ou a 72oC o 10 min.
Aga ose gel elec opho esis
Ten mic oli e s o he PCR p oduc s as well as 100 bp
molecula ma ke (Sigma, Ge many) we e loaded in o
1% aga ose gel con aining 1 μg o e hidium b omide
pe ml and DNA bands we e cap u ed and images
we e analysed wi h he Molecula Analys /PC
So wa e (Bio- ad, USA) om he Bio- ad Uni e sal
Hood II Sys ems o Gel Doc TM and ChemiDocTM
Imaging sys ems.
Resul s
Con i ma ion o he Salmonella isola es using
Mul iplex PCR
Mul iplex PCR was used o con i m he se o a s o 23
Salmonella en ica. Using p ime s speci ic o genus
Salmonella, o S. En e idi is (se A gene) and S.
Typhimu ium ( liC gene) se o a s. All posi i e
Salmonella se o a s samples o ampli ica ion o 429
bp agmen s, Fu he mo e, S. Typhimu ium and S.
En e idi is isola es we e posi i e o ampli ica ion o
559 bp and 312 bp shown in (Table 1) espec i ely.
Table 1. P ime used o he mul iplex PCR de ec ion o Salmonella Typhimu ium and En idi is se o a s.
Ta ge
P ime se s
sequence 5'→3'
Size (bp)
Salmonella genus
(Random sequence)
ST11( F)
ST15 ( R )
GCCAACCATTGCTAAATTGGCGCA
GGTAGAAATTCCCAGCGGGTACTGG
429
S.Typhimu ium
( lic gene)
Fli15( F)
Tym (R)
CGGTGTTGCCCAGGTTGGTAAT
ACTCTTGCTGGCGGTGCGACTT
559
S. En idi is
(se A gene )
Se 167(F)
Se 478(R)
AGGTTCAGGCAGCGGTTACT
GGGACATTTAGCGTTTCTTG
312
F: o wa d p ime
R: e e se P ime
76
Alha bi e al.
In . J. Biosci.
2020
The esul s e ealed ha 5 o S. Typhimu ium and 3
o S. En e idi is we e ob ained om 8 posi i e
Salmonella spp. in shawa ma samples (Fig. 1), 2 o S.
Typhimu ium and 1 o S. En e idi is we e ob ained
om 3 posi i e Salmonella spp. in alah el samples as
shown in (Fig. 2). Fig. 3 shows 6 o S. Typhimu ium
and 2 o S. En e idi is we e ob ained om 8 posi i e
Salmonella spp. in ege able salad samples, while
only 2 o S. Typhimu ium and 2 o S. En e idi is we e
ob ained om 4 posi i e Salmonella spp. in kib ha
samples as shown in (Fig. 4) and Incidence o 23
Salmonella Se o a s by using Mul iplex PCR and
shown in (Table 2) espec i ely.
Table 2. Incidence o 23 Salmonella Se o a s by using Mul iplex PCR.
Iden i ied se o a s o S. en ica
RTE as ood samples
To al
Fig.1
Fig. 2
Fig. 3
Fig. 4
Shawa ma
Falah el
Vege able salad
Kib ha
No
No
No
No
No
%
S. Typhimu ium
5
2
6
2
15
65%
S. En e i idis
3
1
2
2
8
35%
To al
8
3
8
4
23
100%
Discussion
The p esen da a e ealed ha 23 Salmonella isola es
om RTE as ood samples such as shawa ma,
ala el, ege able salad and Kib ha. I is clea 15 S.
Typhimu ium and 8 S. En e i idis we e iden i ied
se ologically wi h incidence o 65.22% and 34.78%
espec i ely, lowe esul s epo ed by (Dhahe FH e
al., 2011). The wo mos commonly iden i ied
causa i e agen s o ood bo ne salmonellosis a e
Salmonella en e ica se o ypes Typhimu ium and
En e i idis (Galis AM e al., 2013). Bo h se o ypes
ha e he abili y o colonize he ep oduc i e o gans o
hens and a e majo causes o ood bo ne illness
(Whiley H e al., 2015).
Fig. 1. Mul iplex PCR on Aga ose gel elec opho esis showing ampli ica ion o 429, 559 and 312 bp agmen s
om he ex ac ed DNA o Salmonella isola es om shawa ma. Lane M: 100 bp DNA ma ke , Lanes 1, 2, 6, 7 and
9: posi i e ampli ica ion o 559 bp agmen o S. Typhimu ium isola es, Lanes 3, 5 AND 8: posi i e ampli ica ion
o 312 bp agmen s o S. En e i idis isola es, Lane 4: posi i e con ol S. Typhimu ium (ATCC 14028), Lanes 10
nega i e con ol (dis illed s e ile wa e ).
77
Alha bi e al.
In . J. Biosci.
2020
Salmonella is de ec ed by s anda d bac e iological,
biochemical and se ological es s. These es s a e
gene ally ime-consuming, edious and cos ly as hey
equi e hund eds o an ise a as well as well ained
echnicians (No i EM e al., 2010). The Di ec -PCR
will educe he ime equi ed o he decision abou
he Salmonella posi i e samples. Ampli ica ion o
DNA sequences unique o an o ganism u ilizing he
PCR enhances bo h he de ec ion speed and he le el
o sensi i i y a which o ganisms can be dis inguished
and has been inc easingly used o iden i y se e al
bac e ial species om ood and clinical samples
(Mahmoud Elha i i e al., 2017).
Fig. 2. The speci ic p ime a e Mul iplex PCR on Aga ose gel elec opho esis showing ampli ica ion o 429, 559
and 312 bp agmen s om he ex ac ed DNA o Salmonella isola es om alah el. Lane M: 100 bp DNA ma ke ,
Lanes 1, 3 posi i e ampli ica ion o 559 bp agmen o S. Typhimu ium isola es, Lanes 4 posi i e ampli ica ion o
312 bp agmen s o S. En e i idis isola es, Lane 2: posi i e con ol S. Typhimu ium (ATCC 14028) , Lanes 5
nega i e con ol (dis illed s e ile wa e ).
Fig. 3. The speci ic p ime a e Mul iplex PCR on Aga ose gel elec opho esis showing ampli ica ion o 429, 559
and 312 bp agmen s om he ex ac ed DNA o Salmonella isola es om ege able salad. Lane M: 100 bp DNA
ma ke , Lanes 1, 2, 6 and 7, 9, 10: posi i e ampli ica ion o 559 bp agmen o S. Typhimu ium isola es, Lanes 3,
5: posi i e ampli ica ion o 312 bp agmen s o S. En e i idis isola es, Lane 8 : posi i e con ol S. Typhimu ium
(ATCC 14028) , Lanes 4 nega i e con ol (dis illed s e ile wa e ).
78
Alha bi e al.
In . J. Biosci.
2020
The esul s e ealed ha 15 (65%) o S. Typhimu ium
and 8 (35%) o S. En idi is we e mos equen
among he o al 23 Salmonella isola es. The o al o
23 Salmonella isola es we e s udied by bac e iological
analysis, biochemical, se ological and con i med by
Mul iplex PCR.
All isola es we e subjec ed o Salmonella en ica
andom sequence (ST11, ST 15) and we e con i med
as Salmonella posi i e by he p edic ed p oduc o
429 bp DNA agmen s. The esul s ob ained in he
p esen s udy we e in acco dance wi h (Laila Nim i e
al., 2014; Moussa IM e al., 2012; Jakeen EI Jakee e
al., 2016). The abili y o Salmonella speci ic p ime s
o de ec Salmonella species apidly and accu a ely in
he p esen s udy is p ima ily due o he p ime
sequences ha a e selec ed om he gene andom
sequence (ST11, ST 15) and lic o S. Typhimu ium
showed ampli ica ion o 429bp and 559bp agmen s
as epo ed ( Doaa MA e al., 2013; Moussa IM e al.,
2012; Jakeen EI Jakee e al., 2016) While all S.
En idi is showed ampli ica ion o 429bp and 312bp
agmen s using Salmonella spp. andom sequence
(ST11, ST 15) and se A. The esul s ob ained in he
p esen s udy we e in acco dance wi h (Moussa IM e
al., 2012; Jakeen EI Jakee e al., 2016).
Fig. 4. The speci ic p ime a e Mul iplex PCR on Aga ose gel elec opho esis showing ampli ica ion o 429, 559
and 312 bp agmen s om he ex ac ed DNA o Salmonella isola es om li e . Lane M: 100 bp DNA ma ke ,
Lanes 1 and 6: posi i e ampli ica ion o 559 bp agmen o S. Typhimu ium isola es, Lanes 2 and 5 : posi i e
ampli ica ion o 312 bp agmen s o S. En e i idis isola es, Lane 3: posi i e con ol S. Typhimu ium (ATCC
14028) , Lanes 4 nega i e con ol (dis illed s e ile wa e ).
These esul s highligh he impo ance o he
mul iplex PCR o e se o ype o he apid de ec ion o
Salmonella om RTE as ood samples. To bes ou
knowledge, his is he i s mul iplex PCR assay o
simul aneously de ec Salmonella genus, Salmonella
subsp. S. Typhimu ium and S. En idi is om RTE
as oods.
Acknowledgemen
The au ho s a e hank ul o Deanship o Scien i ic
Resea ch, Shaq a Uni e si y, KSA o p o iding
inancial suppo and assis ance o his p ojec (No.:
D170501/G01/N003).
Con lic o in e es s a emen
We decla e ha we ha e no con lic o in e es .
Re e ences
Amany MA. 2013. Knowledge, a i udes, and
p ac ices o ood se ice s a abou ood hygiene in
hospi als in Makkah a ea Saudi A abia. Li e Science
Jou nal 10(3), 1079-1085.
Doaa MA. 2013. De ec ion o Salmonella
79
Alha bi e al.
In . J. Biosci.
2020
Typhimu ium in e ail chicken mea and chicken
gible s. Asian Pac J T op Biomed. 678-681.
Dhahe FH, Awni MN, Mahmood MM, Jamil
HS. 2011. Isola ion and diagnosis o Salmonellain
animal o igin ood, impo eed in Baghdad local
ma ke s and local poul y a ms. I aqi Academic
Jou nal o Science 5, 1-19.
EC (Eu opean Commission). 2017. P ac ical
Guide o he Ma ke in Saudi A abia o Eu opean
Ag i- ood P oduc s and P oduc s wi h Geog aphical
Indica ions. Eu opean Union, July.
h ps://www.iz oznookno.si/Dokumen i/Ma ke %20
En y%20Handbook.pd ,
Galis AM, Ma cq C, Ma lie D, Po e elle D,
Van I. 2013. Con ol o Salmonella con amina ion o
shell eggs-P eha es and pos ha es me hods: A
e iew. Comp ehensi e Re iews in Food Science and
Food Sa e y 12, 155-182.
Hannan A, Rehman R. 2014. Mic obiological
analysis o Ready-To-Ea salads a ailable a di e en
ou le s in Laho e, Pakis an. In e na ional Food
Resea ch Jou nal 21(5), 1797-1800.
Ja osla Pochop, Mi osla a Kačánio á. 2013. A
Real-Time PCR De ec ion o Genus Salmonella in
Mea and Milk Samples. Animal Science and
Bio echnologies 46(1).
Jakeen El Jakee, Diaa El Din Gad Khel a. 2016.
Mul iplex PCR-based de ec ion o S. Typhimu ium
and S. En e i idis in Speci ic Pa hogen F ee (SPF) and
Comme cial Eggs. Clin Mic obiol 5, 2.
Khalil Mohamed, Mohamed Bak i, Fowzi AA,
Saleh AF, Saeed AT, Mohand Nabag, Magdi.
2017. Ha oon Food Hygiene in Pas Ten Yea s in
Saudi A abia. EC Mic obiology 7(1), 04-13.
Laila Nim i, Fa inaabu Al-dahab. 2014. Food
bo ne bac e ial pa hogens eco e ed om
con amina ed shawa ma mea in no he n Jo dan.
Jou nal o In ec ion in De eloping Coun ies 8(11),
1407-1414.
Mahmoud Elha i i, Yos a Samy Aleslamboly,
2017. Rapid Salmonella De ec ion in Di e en Food
Samples by Di ec -PCR. Bioscience Resea ch. 1005-
1010.
Moussa IM, Gassem MA, Al-Doss AA,
Mahmoud WAS, Abdel Mawgood AL. 2010.
Using molecula echniques o apid de ec ion o
Salmonella se o a s in ozen chicken and chicken
p oduc s collec ed om Riyadh, Saudi A abia. A ican
Jou nal o Bio echnology 9(5), 612-619.
Moussa IM, Ashgan MH. 2012. Rapid de ec ion
and cha ac e iza ion o Salmonella en ica se o a s
by mul iplex polyme ase chain eac ion assay. A ican
Jou nal o Bio echnology 11(14), 3452-3458.
No i EM, Thong KL. 2010. Di e en ia ion o
Salmonella en ica based on PCR de ec ion o selec ed
soma ic and lagella an igen. A ican jou nal o
mic obiology esea ch 4(9), 871-879.
Oma B, Ahmed A i H, Asgha , Ib ahim HA,
Abd El-Rahim, Hegazy AI. 2014. De ec ion o
Salmonella in Food Samples by Cul u e and
Polyme ase Chain Reac ion Me hods. Jou nal o
Bac e iology & Pa asi ology 5, 3.
Sami A, Alha bi Mamdouh H, Abdel-Gha a ,
Kadhe Ni as R. 2019. Isola ion and Iden i ica ion
o Pa hogenic Bac e ia om Ready- 0-Ea Foods in
Al-Quwayiyah, Kingdom o Saudi A abia. A ican
Jou nal o Food, Ag icul u e, Nu i ion and
De elopmen 19(3), 14739-14751.
Whiley H, Ross K. 2015. Salmonella and eggs: om
p oduc ion o pla e. In J En i on Res Public Heal h.
12, 2543-2556.
