Molecular identification of Salmonella entrica serovars in ready-to-eat fast foods using multiplex-PCR

73 Alharbi et al. Int. J. Biosci. 2020 RESEARCH PAPER OPEN ACCESS Molecular identification of Salmonella entrica serovars in ready-to-eat fast foods using multiplex-PCR Samir A. Alharbi, Mamdouh H. Abdel-Ghaffar, Kadhar Nivas R* Department of Medical Laboratory Science, College of Applied Medical Sciences, Al-Quwayiyah, Shaqra University, Kingdom of Saudi Arabia Key words: Ready-to-eat (RTE) fast foods, Multiplex PCR, Salmonella entrica Serovars Typhimurium and Enteritidis. http://dx.doi.org/10.12692/ijb/16.6.73-79 Article published on June 16, 2020 Abstract Foodborne pathogens are becoming a globally formidable health complication and perceived as a major health concern in the Kingdom of Saudi Arabia (KSA). In our previous study, 23 of Salmonella entrica were isolated from ready-to-eat (RTE) fast foods included shawarma, falafel, vegetable salad and kibtha, from fifteen different food corners in Al-Quwayiyah, Riyadh Region of Saudi Arabia. Identification was based on conventional culture, biochemical and serological techniques. The objective of the current study is to confirm identification the serovars of S. entrica isolates using multiplex-PCR. For this purpose, two specific oligonucleotide primer pairs were used to amplify flic and sefA genes for S.entrica serovars Typhimurium and Enteriditis. The results revealed that 5 of S. Typhimurium and 3 of S. Enteriditis were obtained from 8 positive Salmonella spp. In shawarma samples, 2 of S. Typhimurium and 1 of S. Enteriditis were obtained from 3 positive Salmonella spp. In falahfel samples, 6 of S. Typhimurium and 2of S. Enteriditis were obtained from 8 positive Salmonella spp. In vegetable salad samples, only 2 of S. Typhimurium and 2 of S. Enteriditis were obtained from 4 positive Salmonella spp. in Kibtha samples. These results highlight the importance of the multiplex PCR over serotype for the rapid detection of Salmonella from RTE fast food samples. * Corresponding Author: Kadhar Nivas R  kniva[email protected] International Journal of Biosciences | IJB | ISSN: 2220-6655 (Print), 2222-5234 (Online) http://www.innspub.net Vol. 16, No. 6, p. 73-79, 2020 74 Alharbi et al. Int. J. Biosci. 2020 Introduction In today's world the fast food industry has grown very fast because of busy and hectic life schedule has opened of the people. Ready-to-eat (RTE) fast food is one of the most liked and preferred includes eaten shawarma, falafel, vegetable salad and kibtha sold in fast food restaurants in Saudi Arabia. Consumption of refined meat is appreciably large in Saudi Arabia, especially is chicken. Traditionally, lamb, goat and camel meat had been customary in the diets of Saudis and European Commission EC (European Commission, 2017). Foodborne diseases endure a major problem in developing countries because of lack of personal hygiene and food safety measures. As much as 70% of diarrheal diseases in developing countries are believed to be of foodborne origin (Amany et al., 2013). There are many incidences of foodborne diseases which have been reported in different cities of Saudi Arabia. Recent studies in sulyyel, Riyadh, showed that people often complained of gastritis 21 hours after having the lunch/dinner in the marriage party was due to Salmonella spp. (Khalil Mohamed et al., 2017). Foodborne pathogens were recently reported of high morbidity in Hail and Abha, 39 cases of Staphylococcus aureus and 26 cases of Salmonella enteritidis respectively (Khalil Mohamed et al., 2017). Although foodborne diseases do not always result in acute gastroenteritis, food represents an important vehicle for pathogens causing acute gastro gastroenteritis. Diarrheal diseases are the commonest manifestation of food poisoning and in some cases, it is very lethal too. Conventional culture methods have traditionally been considered as the “gold standard” for the isolation and identification of foodborne bacterial pathogens. They consist of a series of steps that include nonselective enrichment, selective enrichment, selective/differential plating and, finally, morphological, biochemical and serological confirmation. This standardized classical culture method is known to be sensitive and inexpensive, but culture methods are labor-intensive and timeconsuming, because they require at least, three working days to produce a negative result and five to ten working days for confirmed positive results. Moreover, due to environmental factors, variations in gene expression of microorganisms can occur and may affect the results of biochemical tests. Furthermore, viable but non cultivable cells are not detected by the conventional methodology. Rapid methods for the detection of Salmonella in food have been developed, for example, electrical techniques, immunoassays and nucleic acid probe analyses, but there are still problems with their sensitivity and specificity (Omar B Ahmed et al., 2014). Salmonella enterica serovars Enteritidis and Typhimurium which are represent the most predominant isolated organisms in most cases associated with the consumption of contaminated poultry, pork and beef products (Doaa et al., 2013). In recent years, PCR-based methods have been reported as a rapid, specific and sensitive alternative, and have been increasingly used to identify several microbial species from foods (JaroslavPochop et al., 2013). PCR has become an important detection tool for pathogens in foods; PCR can also identify strain differences by targeting gene(s) or sequences exhibiting polymorphisms or variability in its distribution within the bacterial population (Mahmoud Elhariri et al., 2017). In our recently study (Samir A. Alharbi et al., 2019), 23 S. entrica were isolated from 155 RTE fast food samples i.e. shawarma, falafel, vegetable salad and Kibtha collected from different 15 restaurants at AlQuwayiyah city revealed that, KSA. These isolates were morphologically, biochemically and serologically identified. Therefore, the objective of this study is to identify the serovars of the 23 S. entrica using multiplex PCR. 75 Alharbi et al. Int. J. Biosci. 2020 Materials and methods DNA extraction Isolates of 23 Salmonella entrica; which identified using conventional culture, biochemical and serological techniques in our previous study (Samir A. Alharbi et al., 2019), were grown in 10 ml Xylose Lysine Desoxycholate (XLD) at 37oC for 24h. The overnight cultures were centrifuged at 3000rpm for 5 min and the supernatant were decanted carefully. The bacterial pellets were washed three times with phosphate buffer saline pH 7.2 and resuspended in 400μl tris-EDTA buffer (pH 8.0) and heated in water bath at 100oC for 20 min. There were left to cool at room temperature and centrifuged at 14,000rpm for 10 min. An aliquot of 5μl of the supernatant was used as template DNA in the multiplex PCR (Moussa IM et al., 2010). Oligonucleotide primers Three specific oligonucleotide primer pairs were used for multiplex PCR. The first was ST11 to ST15 primers were selected which amplify fragment of 429 bp that is specific Salmonella spp. (LailaNimri et al., 2014). The second was Fli15-Tym primers were specific for the fliC genes of S. Typhimurium to produce amplicon size of 559 bp (Moussa IM et al., 2012). The third was Sef167 to Sef478 primers specific for the sefA gene found in S. Enteritidis which amplify fragment of 312 bp. All specific primers were synthesized by Sigma in Germany according to (Hannan A, et al., 2014). DNA amplification PCR amplifications were performed in a final volume of 50 μl in micro-amplification tubes. The reaction mixtures consisted of 5 μl of the DNA template, 5 μl 10X PCR buffer (75mM Tris-HCL, pH 9.0, 2mM MgCl2, 50mM KCl, 20mM (NH4)2SO4), 1μl dNTPs (40μM), 1μl (1U Ampli Taq DNA polymerase) 1μl (25pmol) from the forward and reverse of three sets of primers and the volume of the reaction mixture was completed to 50μl using deionized distilled water. The thermal cycler (C1000 TouchTM thermal cycler (CFX96, BIO-RAD, USA)) was adjusted according to (Moussa IM et al., 2012) as follows: initial denaturation at 94oC for 5 min, followed by 35 cycles of (denaturation at 94oC for 1min, annealing at 56oC for 1min and extension at 72oC for 1min). Final extension was carried out at 72oC for 10 min. Agarose gel electrophoresis Ten microliters of the PCR products as well as 100 bp molecular marker (Sigma, Germany) were loaded into 1% agarose gel containing 1 μg of ethidium bromide per ml and DNA bands were captured and images were analysed with the Molecular Analyst/PC Software (Bio-rad, USA) from the Bio-rad Universal Hood II Systems for Gel Doc TM and ChemiDocTM Imaging systems. Results Confirmation of the Salmonella isolates using Multiplex PCR Multiplex PCR was used to confirm the serovars of 23 Salmonella entrica. Using primers specific for genus Salmonella, for S. Enteriditis (sefA gene) and S. Typhimurium (fliC gene) serovars. All positive Salmonella serovars samples for amplification of 429 bp fragments, Furthermore, S. Typhimurium and S. Enteriditis isolates were positive for amplification of 559 bp and 312 bp shown in (Table 1) respectively. Table 1. Primer used for the multiplex PCR detection of Salmonella Typhimurium and Entriditis serovars. Target Primer sets sequence 5'→3' Size (bp) Salmonella genus (Random sequence) ST11( F) ST15 ( R ) GCCAACCATTGCTAAATTGGCGCA GGTAGAAATTCCCAGCGGGTACTGG 429 S.Typhimurium ( flic gene) Fli15( F) Tym (R) CGGTGTTGCCCAGGTTGGTAAT ACTCTTGCTGGCGGTGCGACTT 559 S. Entriditis (sefA gene ) Sef167(F) Sef478(R) AGGTTCAGGCAGCGGTTACT GGGACATTTAGCGTTTCTTG 312 F: forward primer R: reverse Primer 76 Alharbi et al. Int. J. Biosci. 2020 The results revealed that 5 of S. Typhimurium and 3 of S. Enteriditis were obtained from 8 positive Salmonella spp. in shawarma samples (Fig. 1), 2 of S. Typhimurium and 1 of S. Enteriditis were obtained from 3 positive Salmonella spp. in falahfel samples as shown in (Fig. 2). Fig. 3 shows 6 of S. Typhimurium and 2 of S. Enteriditis were obtained from 8 positive Salmonella spp. in vegetable salad samples, while only 2 of S. Typhimurium and 2 of S. Enteriditis were obtained from 4 positive Salmonella spp. in kibtha samples as shown in (Fig. 4) and Incidence of 23 Salmonella Serovars by using Multiplex PCR and shown in (Table 2) respectively. Table 2. Incidence of 23 Salmonella Serovars by using Multiplex PCR. Identified serovars of S. entrica RTE fast food samples Total Fig.1 Fig. 2 Fig. 3 Fig. 4 Shawarma Falahfel Vegetable salad Kibtha No No No No No % S. Typhimurium 5 2 6 2 15 65% S. Enteritidis 3 1 2 2 8 35% Total 8 3 8 4 23 100% Discussion The present data revealed that 23 Salmonella isolates from RTE fast food samples such as shawarma, falafel, vegetable salad and Kibtha. It is clear 15 S. Typhimurium and 8 S. Enteritidis were identified serologically with incidence of 65.22% and 34.78% respectively, lower results reported by (Dhaher FH et al., 2011). The two most commonly identified causative agents of food borne salmonellosis are Salmonella enterica serotypes Typhimurium and Enteritidis (Galis AM et al., 2013). Both serotypes have the ability to colonize the reproductive organs of hens and are major causes of food borne illness (Whiley H et al., 2015). Fig. 1. Multiplex PCR on Agarose gel electrophoresis showing amplification of 429, 559 and 312 bp fragments from the extracted DNA of Salmonella isolates from shawarma. Lane M: 100 bp DNA marker, Lanes 1, 2, 6, 7 and 9: positive amplification of 559 bp fragment of S. Typhimurium isolates, Lanes 3, 5 AND 8: positive amplification of 312 bp fragments of S. Enteritidis isolates, Lane 4: positive control S. Typhimurium (ATCC 14028), Lanes 10 negative control (distilled sterile water). 77 Alharbi et al. Int. J. Biosci. 2020 Salmonella is detected by standard bacteriological, biochemical and serological tests. These tests are generally time-consuming, tedious and costly as they require hundreds of antisera as well as well trained technicians (Nori EM et al., 2010). The Direct-PCR will reduce the time required for the decision about the Salmonella positive samples. Amplification of DNA sequences unique to an organism utilizing the PCR enhances both the detection speed and the level of sensitivity at which organisms can be distinguished and has been increasingly used to identify several bacterial species from food and clinical samples (Mahmoud Elhariri et al., 2017). Fig. 2. The specific primer after Multiplex PCR on Agarose gel electrophoresis showing amplification of 429, 559 and 312 bp fragments from the extracted DNA of Salmonella isolates from falahfel. Lane M: 100 bp DNA marker, Lanes 1, 3 positive amplification of 559 bp fragment of S. Typhimurium isolates, Lanes 4 positive amplification of 312 bp fragments of S. Enteritidis isolates, Lane 2: positive control S. Typhimurium (ATCC 14028) , Lanes 5 negative control (distilled sterile water). Fig. 3. The specific primer after Multiplex PCR on Agarose gel electrophoresis showing amplification of 429, 559 and 312 bp fragments from the extracted DNA of Salmonella isolates from vegetable salad. Lane M: 100 bp DNA marker, Lanes 1, 2, 6 and 7, 9, 10: positive amplification of 559 bp fragment of S. Typhimurium isolates, Lanes 3, 5: positive amplification of 312 bp fragments of S. Enteritidis isolates, Lane 8 : positive control S. Typhimurium (ATCC 14028) , Lanes 4 negative control (distilled sterile water). 78 Alharbi et al. Int. J. Biosci. 2020 The results revealed that 15 (65%) of S. Typhimurium and 8 (35%) of S. Entriditis were most frequent among the total 23 Salmonella isolates. The total of 23 Salmonella isolates were studied by bacteriological analysis, biochemical, serological and confirmed by Multiplex PCR. All isolates were subjected to Salmonella entrica random sequence (ST11, ST 15) and were confirmed as Salmonella positive by the predicted product of 429 bp DNA fragments. The results obtained in the present study were in accordance with (Laila Nimri et al., 2014; Moussa IM et al., 2012; Jakeen EI Jakee et al., 2016). The ability of Salmonella specific primers to detect Salmonella species rapidly and accurately in the present study is primarily due to the primer sequences that are selected from the gene random sequence (ST11, ST 15) and flic of S. Typhimurium showed amplification of 429bp and 559bp fragments as reported ( Doaa MA et al., 2013; Moussa IM et al., 2012; Jakeen EI Jakee et al., 2016) While all S. Entriditis showed amplification of 429bp and 312bp fragments using Salmonella spp. random sequence (ST11, ST 15) and sefA. The results obtained in the present study were in accordance with (Moussa IM et al., 2012; Jakeen EI Jakee et al., 2016). Fig. 4. The specific primer after Multiplex PCR on Agarose gel electrophoresis showing amplification of 429, 559 and 312 bp fragments from the extracted DNA of Salmonella isolates from liver. Lane M: 100 bp DNA marker, Lanes 1 and 6: positive amplification of 559 bp fragment of S. Typhimurium isolates, Lanes 2 and 5 : positive amplification of 312 bp fragments of S. Enteritidis isolates, Lane 3: positive control S. Typhimurium (ATCC 14028) , Lanes 4 negative control (distilled sterile water). These results highlight the importance of the multiplex PCR over serotype for the rapid detection of Salmonella from RTE fast food samples. To best our knowledge, this is the first multiplex PCR assay to simultaneously detect Salmonella genus, Salmonella subsp. S. Typhimurium and S. Entriditis from RTE fast foods. Acknowledgement The authors are thankful to Deanship of Scientific Research, Shaqra University, KSA for providing financial support and assistance of this project (No.: D170501/G01/N003). Conflict of interest statement We declare that we have no conflict of interest. References Amany MA. 2013. Knowledge, attitudes, and practices of food service staff about food hygiene in hospitals in Makkah area Saudi Arabia. Life Science Journal 10(3), 1079-1085. Doaa MA. 2013. Detection of Salmonella 79 Alharbi et al. Int. J. Biosci. 2020 Typhimurium in retail chicken meat and chicken giblets. Asian Pac J Trop Biomed. 678-681. Dhaher FH, Awni MN, Mahmood MM, Jamil HS. 2011. Isolation and diagnosis of Salmonellain animal origin food, import feed in Baghdad local markets and local poultry farms. Iraqi Academic Journal of Science 5, 1-19. EC (European Commission). 2017. Practical Guide to the Market in Saudi Arabia for European Agri-food Products and Products with Geographical Indications. European Union, July. https://www.izvoznookno.si/Dokumenti/Market%20 Entry%20Handbook.pdf, Galis AM, Marcq C, Marlier D, Portetelle D, Van I. 2013. Control of Salmonella contamination of shell eggs-Preharvest and postharvest methods: A review. Comprehensive Reviews in Food Science and Food Safety 12, 155-182. Hannan A, Rehman R. 2014. Microbiological analysis of Ready-To-Eat salads available at different outlets in Lahore, Pakistan. International Food Research Journal 21(5), 1797-1800. Jaroslav Pochop, Miroslava Kačániová. 2013. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples. Animal Science and Biotechnologies 46(1). Jakeen El Jakee, Diaa El Din Gad Khelfa. 2016. Multiplex PCR-based detection of S. Typhimurium and S. Enteritidis in Specific Pathogen Free (SPF) and Commercial Eggs. Clin Microbiol 5, 2. Khalil Mohamed, Mohamed Bakri, Fowzi AA, Saleh AF, Saeed AT, Mohand Nabag, Magdi. 2017. Haroon Food Hygiene in Past Ten Years in Saudi Arabia. EC Microbiology 7(1), 04-13. Laila Nimri, Fatinaabu Al-dahab. 2014. Food borne bacterial pathogens recovered from contaminated shawarma meat in northern Jordan. Journal of Infection in Developing Countries 8(11), 1407-1414. Mahmoud Elhariri, Yosra Samy Aleslamboly, 2017. Rapid Salmonella Detection in Different Food Samples by Direct-PCR. Bioscience Research. 10051010. Moussa IM, Gassem MA, Al-Doss AA, Mahmoud WAS, Abdel Mawgood AL. 2010. Using molecular techniques for rapid detection of Salmonella serovars in frozen chicken and chicken products collected from Riyadh, Saudi Arabia. African Journal of Biotechnology 9(5), 612-619. Moussa IM, Ashgan MH. 2012. Rapid detection and characterization of Salmonella entrica serovars by multiplex polymerase chain reaction assay. African Journal of Biotechnology 11(14), 3452-3458. Nori EM, Thong KL. 2010. Differentiation of Salmonella entrica based on PCR detection of selected somatic and flagellar antigen. African journal of microbiology research 4(9), 871-879. Omar B, Ahmed Atif H, Asghar, Ibrahim HA, Abd El-Rahim, Hegazy AI. 2014. Detection of Salmonella in Food Samples by Culture and Polymerase Chain Reaction Methods. Journal of Bacteriology & Parasitology 5, 3. Samir A, Alharbi Mamdouh H, Abdel-Ghaffar, Kadher Nivas R. 2019. Isolation and Identification of Pathogenic Bacteria from Ready-t0-Eat Foods in Al-Quwayiyah, Kingdom of Saudi Arabia. African Journal of Food, Agriculture, Nutrition and Development 19(3), 14739-14751. Whiley H, Ross K. 2015. Salmonella and eggs: from production to plate. Int J Environ Res Public Health. 12, 2543-2556.