Progress in Forensic Genetics: New Markers Validation Studies and Population Data

P og ess in Fo ensic Gene ics:
New Ma ke s Valida ion S udies
and Popula ion Da a
Anna Ba ba o
PhD Academic Thesis
2012
P og ess in Fo ensic Gene ics:
New Ma ke s Valida ion S udies
and Popula ion Da a
Dedica ed o
My belo ed Aysha
Anna Ba ba o
Academic hesis submi ed o he
“P og ama de Dou o amen o in Ciencias Fo enses e Pa oloxía”
Academic Yea 2011-2012
UNIVERSIDADE DE SANTIAGO DE COMPOSTELA
FACULTADE DE MEDICINA
DEPARTAMENTO DE ANATOMÍA PATOLÓXICA
La Doc o a Ma ía Vic o ia La eu Huidob o y el Doc o Ángel Ca acedo
Ál a ez, Ca ed á icos de Medicina Legal de la Uni e sidad de San iago de
Compos ela
CERTIFICAN
Que la p esen e memo ia que lle a po í ulo P og ess in Fo ensic Gene ics: New
Ma ke s Valida ion S udies and Popula ion Da a ealizada p o la licenciada Anna
Ba ba o, ha sido ealziada bajo nues a di ección, conside ándola en condiciones
pa a op a al G ado de Doc o y au o izándola pa a su p esen ación y de ensa
an e el T ibunal co espondien e.
Y pa a que así cons e i mamos la p esen e ce i icación en San iago de
Compos ela a 20 de julio de 2012
Fdo. D a.Ma ía Vic o ia La eu Huidob o Fdo. D . Ángel Ca acedo Ál a ez
Fdo. Dª Anna Ba ba o
INDEX
Aims and ou line o he hesis.........................................................................................1
Jus i icación y obje i os de la esis.................................................................................4
Chap e I :Gene al In oduc ion abou Fo ensic DNA Typing
1. A b ie His o y............................................................................................................7
2. RFLPs (Res ic ion F agmen s Polymo phisms)analysis...........................................8
2.1 Polyme ase Chain Reac ion (PCR)...................................................................10
2.2 Applica ions o DNA yping…..………..………..………...............................12
3. How DNA yping wo ks:s a is ical e alua ions.…..……………….…...…...……..13
3.1 C iminal casewo ks...........................................................................................13
3.2 Pa e ni y Tes ....................................................................................................16
4. DNA da abases..........................................................................................................18
5. Re e ences.................................................................................................................25
Chap e II : DNA Ma ke s:Sho Tandem Repea s Loci(STRs)
1. Au osomal STRs Ma ke s.........................................................................................27
1.1 In oduc ion....................................................................................................27
1.2 A b ie His o y...............................................................................................29
2. Al e na i e STRs Ma ke s:Y-STRs..........................................................................31
2.1 In oduc ion....................................................................................................32
2.2 Y-STRs applica ions......................................................................................32
2.3 Popula ion S udy............................................................................................36
3. Al e na i e STRs Ma ke s:X STRs...........................................................................38
3.1 In oduc ion....................................................................................................38
3.2 X-STRs applica ions......................................................................................39
3.3 Popula ion S udy............................................................................................41
4. Al e na i e STRs Ma ke s:Mini STRs......................................................................44
4.1 In oduc ion....................................................................................................44
4.2 Mini-STRs applica ions.................................................................................46
5. Re e ences.................................................................................................................49
Chap e III: DNA Ma ke s:Single Nucleo ide Polymo phisms (SNPS)
1. In oduc ion...............................................................................................................54
2. SNPs Resea ch P ojec ..............................................................................................58
3. Rele an SNPs Classes..............................................................................................60
3.1 Au osomal SNPs..............................................................................................60
3.2 SNPs on Ch omosome Y.................................................................................61
3.3 SNPs on Ch omosome X.................................................................................63
3.4 Mi ochond ial SNPs.........................................................................................65
4.Fo ensic Applica ions.................................................................................................66
5.Re e ences..................................................................................................................76
Chap e IV : DNA P ocedu e S anda diza ion
1. In oduc ion...............................................................................................................82
1.1 Quali y Assu ance............................................................................................84
1.2 Labo a o y Acc edi a ion.................................................................................87
2. T oubleshoo ing:DNA Con amina ion......................................................................88
3. Re e ences.................................................................................................................93
Chap e V : Resul s.....................................................................................................95
a) Valida ion o New STRs Mul iplex.......................................................................95
1.C.Phillips,A.Ba ba o,L.Fe nandez-Fo moso, Á.Ca acedo, M.V.La eu,De elopmen
and alida ion o a nex gene a ion-STR pen aplex, Fo ensic Sci. In . Gene . Suppl.
2 (2009) 25-26 …………………………………………………….………………….96
2. A.Ba ba o, L.Fe nandez-Fo moso, C.Phillips, Á. Ca acedo, M.V. La eu, Casewo k
applica ion o a s andalone pen aplex assay o ex ended-ESS STRs, Legal
Medicine, in p ocess. ……….…………………………………………………..…….98


3. A Ba ba o, P.Co maci, S.Vo ano, G.Falcone, Valida ion S udy o AmpFlSTR
NGM SElec ™ PCR Ampli ica ion Ki , Jou nal o Fo ensic and Legal Medicine, in
p ocess…………………………………...…………………………………………..108
b) Popula ion S udy o o ensic s a is ical e alua ions………………...………..120
1. S.P esciu ini, N, Ce i, S Tu ina, B Penna o, M Alù, A Asmundo, A Ba ba o, I
Boschi, L. Buscemi, L. Caenazzo, E.Ca ne ali, D. De Leo, C. Di Nunno, R. Domenici,
M.Maniscalco, G. Peloso, S. Pelo i, A. Piccinini, D. Podini, U.Ricci, C.Robino, L
Sa a o, A.Ve zele i, M.Ven u i, A.Tagliab acci, Valida ion o a la ge I alian
Da abase o 15 STR loci, Fo ensic Sci In .156 (2006):266-268................................121
2. L. Fe nandez-Fo moso, C.Phillips, A.Rod iguez, R. Cal o, A. Ba ba o, M.V. La eu,
Á.Ca acedo, Allele equencies o 20 STRs om No hwes Spain (Galicia),
Fo ensic Sci. In . Gene . 6 (2012) 149–150…………………………….……………124
3. A.Ba ba o C.Phillips,L.Fe nandez-Fo moso, M.V. La eu Á.Ca acedo, Dis ibu ion
o allele equencies o 20 STRs loci in a popula ion sample om Calab ia,
Sou he n I aly, Fo ensic Sci. In . Gene . 6 (2012) 137–138………………………..126
4.A.Ba ba o, M.Cassa , P.Co maci, J.C.G ech,Va iabili y o SE33 Locus in 2
Medi e anean Popula ions, Jou nal o Fo ensic and Legal Medicine (2012), in
p ocess……………………………………………………………………………….128
5. A Ba ba o, P.Co maci, G.Falcone, S.Vo ano, A La Ma ca, Dis ibu ion o 8 X
ch omosomal STR loci in an I alian popula ion sample (Calab ia) Fo ensic Sci.
In .Gene .(2012),doi:10.1016/j. sigen.2012.05.011....................................................133
6. V. Rod íguez, C.Tomàs, J.J Sánchez, J.A.Cas o, M.M. Ramon, A Ba ba o, N
Mo ling, A Pico nell, Gene ic sub-s uc u e in wes e n Medi e anean popula ions
e ealed by 12 Y-ch omosome STR loci, In J Legal Med.123 (2009)137-
41.................................................................................................................................135
7. S. Pelo i, C. Bini, A. Ba ba o, L. Caenazzo, E. Ca ne ali, N. Ce i, R. Domenici, G.
Fe i, M. Maniscalco, V. Ono i, A. Piccinini, C. P e ide e`, U. Ricci, C. Robino, F.
Sca nicci, F. To icelli, M. Ven u i, S. P esciu ini Mic ogeog aphic a ia ion o Y-
ch omosome haplo ypes in I aly,Fo ensic Sci. In . Gene . Suppl. Se ies 1(2008) 239–
241.................................................................................................................................140

8. A. Ba ba o C. Phillips, M.Fonde ila, M.V. La eu, Á.Ca acedo, S udy abou he
gene ic a iabili y o he SNP o ID 52-plex panel in I alian popula ion samples
Fo ensic Sci.In .Gene .(2012),DOI:10.1016/j. sigen.2012.07.002...............................143
Chap e VI : Gene al Discussion
1. In oduc ion ………………………………………………………………………145
1.1 Valida ion o New STRs Mul iplex…………………………………………146
1.2 Popula ion S udy o o ensic s a is ical e alua ions ……………..…….…...155
Chap e VII
Conclusions..................................................................................................................166
1. Valida ion o New STRs Mul iplex.........................................................................166
2. Popula ion S udy o o ensic s a is ical e alua ions................................................166
Conclusiones................................................................................................................169
1. Validación de nue os mul iplex de STRs.................................................................169
2. Es udio Demog á ico pa a e aluaciones o enses es adís icas.................................169
Chap e VIII:Fu u e Pe spec i e.............................................................................172
Acknowledgemen s....................................................................................................177
AIMS
1
Aims and ou line o he hesis
Mo e han 20 yea s passed om he i s applica ion o DNA inge p in s in
o ensics and DNA analysis has played a c ucial ole in he in es iga ion and
esolu ion o housands o iolen c imes.
In he las yea s DNA analysis is apidly de eloped in pa icula a e he in oduc ion
o o ensic DNA da abases use ul in he igh agains c ime. DNA has become a
powe ul o ensic ool o sol ing cases such as linking a suspec o a c ime scene,
esol ing biological ela ionship issues and iden i ying disas e ic ims.
Th ee di e en ypes o DNA ma ke , Sho Tandem Repea s (STRs), Single
Nucleo ide Polymo phisms (SNPs) and DNA sequence da a, ep esen he absolu e
majo i y o polymo phisms used in o ensic gene ic applica ions.
They all ha e cha ac e is ics, making hem especially use ul o sol ing c iminal cases
and o ela ionship es ing.
Sho andem epea s (STRs) a e he mos widely used ma ke s o o ensic DNA
es ing, because o hei high di e en ia ing powe , good esolu ion o alleles and he
abili y o p ocess samples apidly using mul iplexed polyme ase chain eac ion (PCR).
13 STRs ha e been chosen as he co e loci upon which he FBI’s Combined DNA
Index Sys em (CODIS) da abase has been buil .
Bu o he gene ic polymo phisms, such as hose ound in he mi ochond ial DNA
(m DNA) genome and he X o Y ch omosome, ha e been shown o p o ide e ec i e
esul s ha can imp o e adi ional STR da a.
The demand o ools and echnologies in o ensic DNA es ing, is con inuous:
common p oblems in o ensics a e conce ning he gene ic iden i ica ion o deg aded
biological samples such as he ones collec ed om c ime scenes o mass disas e ha
may ha e been exposed o ha sh en i onmen al condi ions (sunligh , humidi y, e c.)
ha damage DNA s uc u e, o he p esence o inhibi o s in e e ing wi h he abili y o
ob ain a ull DNA p o ile om a biological e idence.
AIMS
2
To o e come hese p oblems, new ma ke s has been selec ed in he las yea s,
in o de o eco e as mo e in o ma ion as possible om smalle egions o DNA,
which a e mo e likely o be in ac ollowing DNA damage.
These include mini-STRs and single nucleo ide polymo phisms (SNPs).
In his pe spec i e, no only he ange o gene ic ma ke s used is widely inc eased bu
also new sophis ica ed analy ical me hods (au oma ion, minia u iza ion, high-
h oughpu pe o mance) ha e been adop ed in o de o gi e o in es iga o s as mo e
in o ma ions as possible abou a pe pe a o solely on he biological e idence le a
he c ime scene.
Mo eo e , mo e ecen ly, he analysis o genes use ul o physical cha ac e is ics
de e mina ion (such as hai , eye o skin colou ) ha e been in oduced and his
applica ion may ha e in he nea u u e a undamen al ole in o ensics. The abili y o
pe o m gene ic yping o biological aces collec ed a he c ime scene, in o de o
ob ain in o ma ion abou a dono ’s physical cha ac e is ics, is a e y a ac i e
p ospec o o ensic analysis and i could po en ially o e a powe ul new ool o
c ime scene in es iga ions.
Ob iously be o e he in oduc ion in ou ine casewo k analysis, i ’s ele an o
he o ensic communi y o es ablish which ma ke s may be use ul o ca ching up he
p ocedu e o a le el accep able o o ensic applica ion and han o alida e p o ocols
wi h su icien analysis epea a es. Mo eo e in o de o calcula e he co ec
ep esen a i e weigh o DNA e idence, p io knowledge abou he DNA ma ke s o a
ele an popula ion sample is equi ed. Impo an p ope ies such as how equen ly
ce ain DNA- a ian s (i.e. alleles) occu in he popula ion, he di e ences in such
equencies be ween popula ions and he o ensic e iciency o he DNA ma ke s in
casewo k should be s udied o de e mine he p obabili y ha a pa icula geno ype
migh occu a andom in a popula ion.
The aims o his hesis a e:
- o alida e a nex gene a ion pen aplex, p e iously we de eloped, including he new
i e loci ecommended by he Eu opean Union Council o he expansion o he
INTRODUCTION
9
DNA agmen s ob ained by es ic ion enzymes we e sepa a ed in size by elec opho
esis in aga gel and han ans e ed o a il e memb ane o subsequen de ec ion by
adioac i ely labelled p obes using a p ocedu e called Sou he n blo ing. [4]
Je eys p o ed ha , e en i VNTRs loci a e e y simila be ween closely ela ed
humans, howe e he small cu agmen s o DNA molecules we e so a iable ha
un ela ed indi iduals a e ex emely unlikely o ha e he same VNTRs, so hey we e
i ually unique o indi iduals.
Wi h app op ia e d ama ic lai , he called he p ocess he in en ed "DNA
inge p in ing," a e m mos o ensic scien is s dislike because i is con using and can
be misleading. Wi h his co-wo ke s, he also demons a ed ha o ensic samples, d ied
s ains se e al yea s old, con ained su icien DNA o yield conclusi e esul s.
Like he inge p in s ha came in o use by de ec i es and police labs du ing he 1930s,
each pe son has a unique DNA inge p in . Unlike a con en ional inge p in ha
occu s only on he inge ips and can be al e ed by su ge y, a DNA inge p in is he
same o e e y cell, issue and o gans o a pe son and i canno be al e ed by any
known ea men . Consequen ly, DNA inge p in ing apidly became he p ima y
me hod o iden i ying and dis inguishing among indi idual human beings.
DNA inge p in ing was i s used as a police o ensic es o iden i y he apis
and kille o wo eenage s, Lynda Mann and Dawn Ashwo h, who we e bo h
mu de ed in Na bo ough Leices e shi e, in 1983 and 1986 espec i ely. A young man
Colin Pi ch o k, was iden i ied and con ic ed o mu de a e samples aken om him
ma ched semen samples aken om he wo dead gi ls. [5]
This u ned ou o be a speci ically impo an iden i ica ion o wi hou i , B i ish
Au ho i ies belie e ha Richa d Buckland, he main suspec , would ha e ine i ably
been con ic ed. The e o e, no only did Je ey's wo k in his case p o e who he eal
kille was, bu exone a e someone who likely would ha e spen his li e in p ison
o he wise. This p ocedu e was also used o help in some English immig a ion cases.[6]
Un o una ely his me hod, while powe ul in i s abili y o di e en ia e indi iduals,
was limi ed by he quan i y and quali y o DNA equi ed o an unambiguous esul
because i equi ed a la ge amoun s o un-deg aded sample DNA and in addi ion i was
labo ious o he amoun o ime i ook o ob ain a esul .

INTRODUCTION
10
In summa y RFLP analysis o VNTRs has se e al d awbacks, including:
 The p ocess is ex emely labo ious and ime-consuming
 Radioac i e p obes pose heal h and disposal isks (al hough chemiluminescen
echnology elimina ed his isk)
 A ela i ely la ge amoun o sample is equi ed o pe o m he es s
 The me hod equi es high molecula weigh , un-deg aded DNA
 The use o yield gels is an essen ial, bu ime consuming, s ep in he analysis no
only o es ima e he amoun o DNA eco e ed bu also o de e mine he
sui abili y o he sample o analysis
1.2 Polyme ase Chain Reac ion (PCR)
The ield o molecula biology was e olu ionized by he in en ion o he
polyme ase chain eac ion (PCR), echnology ha is ideally sui ed o he analysis o
o ensic DNA samples because i ’s sensi i e and apid and no has limi ed by he
quali y/quan i y o DNA as he RFLPs me hod. This e olu iona y me hod was
de eloped in Ap il 1983 by Ka y Mullis and some membe s o he Human Gene ics
g oup a he Ce us Co po a ion (now Roche Molecula Sys ems) Mullis ecei ed in
1993 he Nobel p ize o i . [7]
The me hod elies on he mal cycling consis ing o cycles o epea ed hea ing
and cooling o he eac ion o DNA mel ing and enzyma ic eplica ion o he DNA.
P ime s con aining sequences complemen a y o he a ge egion along wi h a DNA
polyme ase a e key componen s o enable selec i e and epea ed ampli ica ion. As
PCR p og esses, he DNA gene a ed is i sel used as a empla e o eplica ion, se ing
in mo ion a chain eac ion in which he DNA empla e is exponen ially ampli ied.
Each cycle has h ee s eps:
- The wo DNA s ands a e dena u ed by hea .
- The sample is hen cooled o allow he p ime s o anneal o he DNA segmen s.
- The empe a u e is aised o allow he DNA polyme ase o add nucleo ides o ex end
he p ime s o p oduce a copy o each DNA empla e s and
INTRODUCTION
11
Fig.2 Polyme ase Chain Reac ion s eps
The PCR p oduc is some imes e e ed o as an amplicon. Each cycle esul s in he
doubling o amplicons. The esul is an exponen ial accumula ion o he speci ic a ge
agmen , app oxima ely 2n, whe e “n” is he numbe o cycles o ampli ica ion
pe o med. Howe e , he p ocess loses e iciency a highe cycle numbe s. A e 30
cycles, app oxima ely a billion copies o he a ge DNA empla e a e gene a ed.
Polyme ase chain eac ion (PCR) is used o make millions o exac copies o
DNA om a biological sample. DNA ampli ica ion wi h PCR allows DNA analysis on
biological samples as small as a ew skin cells. The abili y o PCR o ampli y such iny
quan i ies o DNA enables e en highly deg aded samples o be analyzed. G ea ca e,
howe e , mus be aken o p e en con amina ion wi h o he biological ma e ials
du ing he iden i ying, collec ing, and p ese ing o a sample.
The PCR p ocess was o iginally pe o med manually. The he molabile Klenow
DNA polyme ase was used and had o be eplenished a he beginning o each cycle.
INTRODUCTION
12
The subsequen in oduc ion o The mus aqua icus (Taq) polyme ase, a he mos able
DNA polyme ase, ep esen ed a conside able ad ance. Taq DNA polyme ase is he
mos widely used polyme ase in o ensic DNA analysis and is a ailable om mul iple
endo s ac i i y. Ampli Taq Gold® DNA Polyme ase (supplied by Applied
Biosys ems) is a chemically modi ied o m o Taq DNA Polyme ase, which is
deli e ed in an inac i e s a e and equi es a p e-PCR hea ing s ep o be ac i a ed. [8,9]
PCR is now a common and o en indispensable echnique used in medical and
biological esea ch labs o a a ie y o applica ions. Mo e han one egion can be
copied simul aneously by adding mo e han one p ime se o he eac ion his is known
as mul iplexing. P ime design and he op imiza ion o he mal cycling pa ame e s a e
mo e complex wi h mul iplex eac ions han o a single-locus eac ion.
Wi h he in oduc ion o PCR i became possible o analyze ano he ype o ma ke s
called Sho Tandem Repea (STRs).[10]
1.3 Applica ions o DNA yping
Since 1987, FBI and police labs a ound he U.S. ha e begun o use DNA
inge p in s o link suspec s o biological e idence - blood o semen s ains, hai , o
i ems o clo hing - ound a he scene o a c ime, so since ha ime, human iden i y
es ing using DNA yping me hods has been widesp ead. The pas 15 yea s ha e seen
emendous g ow h in he use o DNA e idence in c ime scene in es iga ions as well
as pa e ni y es ing. DNA yping has become he mos impo an ool o he
iden i ica ion. Today public o ensic labo a o ies and p i a e pa e ni y es ing
labo a o ies conduc hund eds o housands o DNA es annually and a lo o cases
ha e been decided wi h he assis ance o DNA inge p in e idence. DNA yping has
g ea ly expanded he sou ces o e idence ha can be es ed, while simul aneously
educing he amoun o e idence necessa y o pe o m a conclusi e es . DNA p o iles
can be ob ained om any sou ce o biological ma e ial, p o ided, i con ains nuclea ed
cells. Fu he mo e, DNA is esis an o many condi ions ha would des oy o he
compounds o o ensic in e es such as polymo phic p o eins and blood g oup
subs ances.[11,12]
INTRODUCTION
13
P ac ical applica ions o o ensic DNA yping include :
a) C iminal Iden i ica ion and Fo ensics
DNA isola ed om blood, hai , skin cells, o o he gene ic e idence le a he scene
o a c ime can be compa ed, wi h he DNA o a c iminal suspec o de e mine guil o
innocence. DNA p o iles a e also use ul in es ablishing he iden i y o a homicide
ic im, ei he om DNA ound as e idence o om he body i sel .
b) Pe sonal Iden i ica ion
Like he inge p in s ha came in o use by de ec i es and police labs du ing he 1930s,
each pe son has a unique DNA p o ile. Unlike a con en ional inge p in can be
al e ed by su ge y, a DNA inge p in is he same o e e y cell, issue, and o gan o a
pe son. I canno be al e ed by any known ea men . Consequen ly, DNA
inge p in ing is apidly became he p ima y me hod o iden i ying and dis inguishing
among indi idual human beings in pa icula in Disas e Vic im Iden i ica ion cases.
c) Pa e ni y and Ma e ni y
Because a pe son inhe i s his/he DNA om pa en s, STRs pa e ns a e so speci ic and
can be used o es ablish pa e ni y and ma e ni y as well as mo e complica ed cases o
con i ming legal na ionali y and, in ins ances o adop ion, biological pa en hood.
2. How DNA yping wo ks : s a is ical e alua ions
2.1 C iminal Casewo ks
DNA o ensic scien is s a e p esen ed wi h he si ua ion we e hey a e gi en wo
samples ela ed o a c ime scene, abou which hey know no hing in ad ance, and a e
asked whe he o no hey a e iden ical. Only one- en h o a single pe cen o DNA
(abou 3 million bases) di e s om one pe son o he nex . These a iable egions a e
used o gene a e a DNA p o ile o an indi idual, using samples om blood, bone, hai ,
and o he body issues and p oduc s. In c iminal cases, his gene ally in ol es ob aining
INTRODUCTION
14
samples om c ime-scene e idence and a suspec , ex ac ing he DNA, and analyzing
i o he p esence o a se o speci ic DNA egions (ma ke s). [13,14]
DNA p o iles a e compa ed o de e mine whe he he suspec 's sample ma ches
he e idence sample ound a c ime scene. A ma ke by i sel usually is no unique o
an indi idual; i , howe e , wo DNA samples a e alike a some egions, odds a e g ea
ha he samples a e om he same pe son. I he sample p o iles don' ma ch, he
pe son did no con ibu e he DNA a he c ime scene. I he pa e ns ma ch, he
suspec may ha e con ibu ed he e idence sample. The possibili y o a close ela i e
( ypically a b o he ) o he accused being in he pool o po en ial con ibu o s o c ime
scene e idence should be conside ed in case-speci ic con ex . I is no app op ia e o
p o e ha a close ela i e is a po en ial con ibu o o he e idence when he e a e no
ac s in e idence o sugges his ins ance is ele an . Howe e , i a ela i e had access
o a c ime scene and he e is eason o belie e he/she could ha e been a con ibu o o
he e idence, hen he bes ac ion o ake is o ob ain a e e ence sample om he
ela i e. A e all, his scena io should be su icien p obable cause o ob aining a
e e ence sample. Typing wi h he same ba e y o sho andem epea (STR) loci will
esol e he ques ion o whe he o no he ela i e ca ies he same DNA p o ile as he
accused. A ypical DNA case in ol es he compa ison o wo samples – an unknown
o e idence sample and a known o e e ence sample, such as a blood/sali a sample
om a suspec . I DNA p o iles ob ained om he wo samples a e indis inguishable
( hey "ma ch"), ha o cou se is e idence o he cou ha he samples ha e a
common sou ce.
• I he DNA p o ile ob ained om he wo samples a e dis inguishable ( hey “ NOT
ma ch"), ha o cou se is e idence o he cou ha he samples ha e a di e en
sou ce
• I he DNA p o ile ob ained om he wo samples a e indis inguishable ( hey
"ma ch"), ha o cou se is e idence o he cou ha he samples ha e a common
sou ce

INTRODUCTION
15
Once an indi idual's STR p o ile is iden i ied, i is s a is ically imp obable ha anyone
else in he wo ld will ha e he same p o ile, unless ha pe son has an iden ical win.
Iden ical wins ( wins de i ed om a single e ilized egg) ha e iden ical STR DNA
p o iles. Fo e idence yielding ull single sou ce DNA p o iles, i ’s possible o
calcula e he andom ma ch p obabili ies and likelihood a io.
a) Random ma ch p obabili y
I ’s he chance o a andom DNA p o ile ma ch wi hin a gi en popula ion and
is he ecip ocal o he DNA p o ile equency.
PI = he p obabili y ha a ma ch would occu by chance.
A DNA p o ile equency is es ima ed by de e mining he geno ype equency o each
locus and hen mul iplying he equency ac oss all loci. Ra e geno ypes p o ide
s onge e idence, and popula ion da abases so ed by ace will yield somewha
di e en esul s, bu i is impo an o unde s and ha his is a ep esen a ion o how
a e a DNA p o ile is in a ep esen a i e popula ion.
Popula ion da a wi h allele equencies o used ma ke s a e collec ed o di e en
popula ions and con ain only DNA p o iles om anonymous dono s o speci ic
popula ions es ed.
b) Likelihood Ra io
A likelihood a io (LR) is a a io o wo p obabili ies o he same e idence
unde wo mu ually exclusi e hypo heses, speci ically he posi ion o he p osecu ion
and he posi ion o he de ence. I con eys he ela i e suppo o he weigh o DNA
e idence unde he hypo hesis ha he de endan is he sou ce o he DNA p o ile,
e sus an un ela ed indi idual om he popula ion a la ge.
While in e p e a ion o he s eng h o he s a is ical alue can be a iable, and should
ul ima ely be conside ed in con ex wi h all case ci cums ances
INTRODUCTION
16
c) Combined P obabili y o Exclusion
The combined p obabili y o exclusion can be used o conse a i ely in e p e
complex DNA mix u es. This calcula ion p o ides an es ima e o he po ion o he
popula ion ha has a geno ype o a leas one allele no obse ed in he DNA mix u e.
This is a conse a i e app oach since all o he alleles no obse ed a e conside ed and
an indi idual can be excluded i he has any allele a any locus ha is no de ec ed in
he mix u e.
2.2 Pa e ni y Tes
In pa e ni y es s o de e mine i he alleged a he is he ue biological a he ,
he DNA p o iles o he child, mo he , and alleged a he a e compa ed. A child
inhe i s wo di e en alleles a each gene ic locus—one om he mo he and one om
he a he . I a child has an allele ha he mo he does no ha e, his obliga e allele has
o come om he biological a he .
I he es ed man (alleged a he ) does no ha e he gene ic cha ac e is ics necessa y o
be he biological a he o he child, he esul is an exclusion ( he alleged a he is no
he biological a he ).
I he es ed man's DNA has he same allele as he obliga e allele does, he esul is an
inclusion. In his las case he alleged a he has he same allele as he obliga e allele
and a Pa e ni y Index (PI) can be calcula ed. This is he ela i e p obabili y ha he
alleged a he and no an un ela ed, andomly selec ed male o he same e hnic
backg ound ansmi ed he obliga e allele o he child.
This is a likelihood a io and is p esen ed in he o mula X/Y, whe e X is he chance
ha he alleged a he could ansmi he obliga e allele and Y is he chance ha an
un ela ed man o he same ace could ha e he allele.
X is assigned he alue o 1 i he alleged a he is homozygous o he allele o
in e es and 0.5 i he alleged a he is he e ozygous.
The p obabili y o an un ela ed, andomly selec ed man possessing he obliga e
allele is de e mined by using a da abase ha lis s he equency dis ibu ion o
indi idual alleles. I he e is mo e han one obliga e allele, he indi idual pa e ni y
INTRODUCTION
17
indexes can be mul iplied and he o al ac oss all loci is called he Combined Pa e ni y
Index (CPI). This is a measu e o he s eng h o he gene ic e idence and is an odds
a io, no a p obabili y.
CPI can ange om 0 o in ini y, an in e p e a ion o he CPI is as ollows:
- I CPI is be ween 0-1, he gene ic e idence is mo e consis en wi h non-pa e ni y han
pa e ni y.
- I CPI>1, he gene ic e idence is mo e consis en wi h pa e ni y han non-pa e ni y
I is no mal p ac ice o es ablish a h eshold alue o CPI, abo e which i is accep ed
ha he es ed man is he ue biological a he . This h eshold is 1000 in Eu ope, bu
can be as low as 100 in he USA.
Some imes a likelihood a io is con e ed in o a p obabili y. This p obabili y is known
as he p obabili y o pa e ni y. This o mula es s he hypo hesis ha he alleged a he
is indeed he biological a he o he child. Fo example, a alue o 99% e lec s a 99%
p obabili y ha he hypo hesis is co ec and a 1% p obabili y ha i is no .
PI some imes is called L and he p obabili y o pa e ni y is W ( om he Ge man wo d
Wah scheinlichkei , "p obabili y").
W and L a e ela ed as :
W = L / (1+L), o L = W / (1-W).
P obabili y o pa e ni y is no widely used in he Uni ed S a es. A mo e common
app oach, simila o he p obabili y o exclusion, is he Random Man No Excluded
(RMNE) s a is ic. This is he p opo ion o he popula ion ha could con ibu e all o
he obliga e alleles and he e o e could no be excluded, o would be alsely included.
A single locus RMNE is calcula ed by 1-(1-p)2.
Combining he RMNE s a is ics o e all loci gi es he combined RMNE (CRMNE)
which is equi alen o he CPI.
The alue o he CRMNE is ypically small (less han one), and is analogous o 1-
CRMNE o exclusiona y powe (PE). PE ep esen s he p obabili y o excluding a
alsely accused man.
INTRODUCTION
18
3. DNA da abases
DNA analysis is a powe ul c ime- igh ing ool o p osecu ing c iminals and
exone a ing he innocen . A na ional DNA da abase is a go e nmen da abase o DNA
p o iles which can be used by law en o cemen agencies o iden i y suspec s o c imes.
The i s go e nmen da abase was se up by he Uni ed Kingdom in Ap il 1995, The
second one in New Zealand, and han in F ance in 1998. [15,16]
The g owing public app o al o DNA da abases has seen he c ea ion and expansion
o many s a es' own DNA da abases. Cali o nia cu en ly main ains he hi d la ges
DNA da abase in he wo ld. The size o DNA da abase, and i s a e o g ow h, is
gi ing conce n o ci il libe ies and poli ical g oups in he UK, whe e police ha e
wide- anging powe s o ake samples and e ain hem e en in he e en o acqui al.
O iginally in ended o sex o ende s, hey ha e since been ex ended o
include almos any c iminal o ende .DNA da abases a e e ec i e because a majo i y
o c imes a e commi ed by epea o ende s. In ac has been e alua ed ha six y
pe cen o hose indi iduals eleased om p ison o iolen o enses and
subsequen ly eleased we e e-a es ed o a simila o ense in less han 3 yea s.
The alue o he DNA da abase is in i s abili y o app ehend c iminals ha a e
no di ec suspec s in a case and o p e en u he ic ims om c imes commi ed by
hose indi iduals.
In pa icula :
• Link an unknown sample o a con ic ed o ende . This gi es he in es iga o he
name o a p e iously uniden i ied suspec .
• Link an unknown sample o a sol ed case. This would also iden i y a suspec o he
in es iga o .
• Link wo o mo e unsol ed cases. Linking unsol ed cases can help an in es iga o
look o simila i ies in he c imes, de ine geog aphical a eas, compa e ic im
INTRODUCTION
25
4. Re e ences
[1]Wa son J.D. and C ick F.H.C. (1953),A S uc u e o Deoxy ibose Nucleic Acid,
Na u e 171: 737-738
[2]Je eys A.J., Wilson V., Thein S.W.(1984), Hype a iable 'minisa elli e' egions in
human DNA, Na u e 314: 67–73.
[3]Je eys AJ, Wilson V, Thein SL.(1985), Indi idual-speci ic ' inge p in s' o human
DNA, Na u e, 316: 76
[4]Sou he n E.M.(1975),De ec ion o speci ic sequences among DNA agmen s
sepa a ed by gel elec opho esis, J Mol Biol., 98:503-517.
[5]Sande s J.(2000),Fo ensic Casebook o C ime, London: T ue C ime Lib a y, Fo um
P ess. pp. 229.
[6]Je eys A.J., B ook ield J.F., Semeono R., (1985) Posi i e iden i ica ion o an
immig a ion es -case using human DNA inge p in s, Na u e 6: 317
[7]Mullis K. (1990), The unusual o igin o he polyme ase chain eac ion, Scien i ic
Ame ican 262 (4): 56–61, 64–5.
[8]Samb ook J. and Russel D.W. (2001), Molecula Cloning: A Labo a o y Manual
(3 d ed.). Cold Sp ing Ha bo , N.Y.: chap e 8: In i o Ampli ica ion o DNA by he
Polyme ase Chain Reac ion
[9]Saiki, RK; Gel and DH, S o el S, Scha SJ, Higuchi R, Ho n GT, Mullis KB,
E lich HA (1988), P ime -di ec ed enzyma ic ampli ica ion o DNA wi h a
he mos able DNA polyme ase,Science 239: 487–91.

INTRODUCTION
26
[10]Bu le J, (2005),Fo ensic DNA Typing – Biology, Technology, and Gene ics o
STR Ma ke s, Academic P ess, ISBN 0-12-147952-8
[11]Houck M.M., Siegel J.A.(2006),Fundamen als o o ensic science. Bu ling on,
MA : Else ie Academic P ess, 2 - Chap e 1
[12]Kiely T.F., (2006),Fo ensic e idence: science and he c iminal law, CRC P ess,
Taylo & F ancis.
[13]E e IW, Wei BS (1998),In e p e ing DNA E idence, Sinaue Associa es. ISBN
0-87983-155-4
[14]Buckle on J, T iggs CM, Walsh SJ (2005),Fo ensic DNA E idence In e p e a ion
CRC P ess, 534
[15] Schneide PM, Ma in PD (2001),C iminal DNA da abase: he Eu ope si ua ion,
in Fo ensic Sci In .119(2):232-8.
[16]Linac e A.,(2003),The UK na ional DNA da abase, The Lance , 361:1842
[17]DNA-Da abase Managemen Re iew and Recommenda ion ENFSI DNA Wo king
G oup - Ap il 2010
INTRODUCTION
27
Chap e II
DNA MARKERS : SHORT TANDEM REPEATS LOCI (STRs)
1. AUTOSOMAL STRs MARKERS
1.1 In oduc ion
The human genome is ull o epea ed DNA sequences ha a e widesp ead
h oughou almos e e y ch omosome in he genome. su ounding he ch omosomal
cen ome e. These epea ed sequences come in a ious sizes and a e classi ied
acco ding o he leng h o he co e epea uni s, he numbe o con iguous epea uni s,
and/o he o e all leng h o he epea egion.Minisa elli es ( a iable numbe o
andem epea s, VNTRs) ha e co e epea s wi h 9-80 bp, while mic osa elli es (sho
andem epea s, STRs) con ain 2-5 bp epea s and a e ypically in he non-coding
in on egion. An indi idual inhe i s one copy o an STR om each pa en , which may
o may no ha e simila epea sizes.
The numbe o epea s in STR ma ke s can be highly a iable among
indi iduals, he a ie y o alleles (gene ally mo e han 10 alleles o he commonly
used STRs) p esen in a popula ion is such ha a high deg ee o disc imina ion among
indi iduals in he popula ion may be ob ained when mul iple STR loci a e examined.
Tha means a mul i locus STR DNA p o ile is unique.
Fig.1: example o STRs s uc u e
INTRODUCTION
28
The e a e hund eds o STR sys ems which ha e been mapped h oughou he
human genome. Se e al dozen ha e been in es iga ed o applica ion o human
iden i y es ing. This make hese STRs ha e become impo an in se e al ields
including gene ic mapping, linkage analysis, and human iden i y es ing. I is o en
challenging o ob ain PCR ampli ica ion p oduc s om o ensic samples because
ei he he DNA in hose samples is deg aded, o mixed, such as in a sexual assaul
case.
STRs ha e become popula DNA ma ke s o he o ensic communi y because
hey a e easily ampli ied by polyme ase chain eac ion (PCR) and show se e al
bene i s ha make hem especially sui able o human iden i ica ion, such as:
 high he e ozygosi y
 egula epea uni
 dis inguishable alleles
 obus ampli ica ion
 low mu a ion a e
The smalle size o STR alleles make STR ma ke s be e candida es o use in
o ensic applica ions, in which deg aded DNA is common. PCR ampli ica ion o
deg aded DNA samples can be be e accomplished wi h smalle a ge p oduc sizes.
Mo eo e because o hei smalle size, STR alleles can also be sepa a ed om o he
ch omosomal loca ions mo e easily o ensu e closely linked loci a e no chosen.
Closely linked loci do no ollow he p edic able pa e n o andom dis ibu ion in he
popula ion, making s a is ical analysis di icul . [1]
Because o hese cha ac e is ics, STRs wi h highe powe o disc imina ion a e chosen
o human iden i ica ion in o ensic cases on a egula basis. I is used o iden i y
ic im, pe pe a o , missing pe sons, and o he s. I makes hem e ec i e o human
iden i ica ion applica ion since o his pu pose, i is impo an o ha e DNA ma ke s
ha exhibi he highes possible a ia ion in o de o disc imina e be ween samples.
In Oc obe 1993, he DNA Commission o he In e na ional Socie y o Fo ensic
Gene ics (ISFG) ecommended he nomencla u e o STR sys ems which is commonly
used oday. Alleles a e gene ally named by he numbe o epea s which hey con ain.
INTRODUCTION
29
When an allele does no con o m o he s anda d epea mo i o he sys em in
ques ion, i should be designa ed by he numbe o comple e epea uni s and he
numbe o base pai s o he pa ial epea . [2-4]
1.2 A b ie His o y
Beginning in 1996, he FBI Labo a o y launched a na ionwide o ensic science
e o o es ablish co e STR loci o inclusion wi hin he na ional da abase known as
CODIS (Combined DNA Index Sys em). The 13 CODIS loci a e CSF1PO, FGA,
TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539,
D18S51 and D21S11. These loci a e na ionally and in e na ionally ecognized as he
s anda d o human iden i ica ion.
In 1999 he DNA wo king g oup o he Eu opean Ne wo k o Fo ensic Science
Ins i u es (ENFSI) decided on a Eu opean S anda d Se (ESS), which includes se en
loci: TH01, WA, FGA, D21S11, D3S1358, D8S1179 and D18S51. These loci ha e
been con i med by a esolu ion o he Eu opean Council in 2001 and now o m he
co e o all na ional DNA da abases in Eu ope.
Due o he o e whelming success o DNA da abases, a poli ical p ocess was
ini ia ed by a numbe o Eu opean coun ies o es ablish a legal basis o exchanging
DNA da abase p o iles be ween coun ies in c iminal in es iga ions. This led o he
T ea y o P üm, which was signed in 2005 wi h he pu pose o s epping up c oss-
bo de coope a ion, pa icula ly in comba ing e o ism, c oss-bo de c ime and illegal
mig a ion. Subsequen ly, he ENFSI DNA wo king g oup has es ablished ecom
menda ions o DNA da abase managemen , including c i e ia o including and
dele ing DNA p o iles, ma ching ules, and handling o pa ial p o iles. Fu he mo e,
he occu ence o ad en i ious ma ches be ween DNA p o iles ha ha e no case-
ela ed connec ion has been add essed in de ail. When massi e exchanges o DNA
p o iles a e unde aken ollowing he implemen a ion o he T ea y o P üm, he se en
ESS loci will no be su icien because he chance o ad en i ious ma ches will no
longe be negligible. In addi ion, each DNA da abase con ains a signi ican po ion o
pa ial p o iles wi h an e en highe p obabili y o ma ch andomly.
INTRODUCTION
30
The ENFSI and EDNAP g oups me in Glasgow in 2005 and discussed
ex ension o he ESS and ecommenda ions o addi ional Eu opean STR sys ems.
Since he ESS loci a e ypically pa o la ge mul iplexes wi h 10–15 loci, which a e
al eady used in o ensic labo a o ies h oughou Eu ope, i would ha e been
s aigh o wa d o choose among hese loci. Howe e , a he same mee ing, he esul s
o a collabo a i e exe cise ca ied ou by he EDNAP g oup o examine yping o
hea ily deg aded DNA samples we e p esen ed This exe cise add esses he ac ha
many casewo k samples include only minimal amoun s o DNA o DNA ha is
deg aded due o en i onmen al A decision was adop ed by he ENFSI and EDNAP
g oups o inc ease he numbe o ESS loci and a ecommenda ion was published o
include mo e obus loci wi h sho amplicons, a he han al eady es ablished STRs
which equen ly ail o gi e esul s, and/o ha e a poo powe o disc imina ion.
In pa icula Eu ope adop ed 5 new loci D2S441 D10S1248, D22S1045, D1S1656,
and D12S391.[5]
Sho andem epea s (STRs) loca ed on au osomes a e he gene ic ma ke s o
choice in pa e ni y in es iga ion and hey a e also he mos widely used in o he cases
o kinship analysis. Ne e heless, in some complex cases, independen o he numbe
o polymo phisms being yped, au osomal ma ke s con ey e y li le in o ma ion.
Depending on he pa en age cons ella ion a ailable o he analysis, as well as he
gende o he subjec s, his p oblem can some imes be sol ed by using ma ke s wi h
di e en modes o ansmission.
The e o e, mos o ensic labo a o ies a e nowadays p epa ed o analyze lineage
ma ke s (Y-ch omosome and mi ochond ial DNA) and many ha e ecen ly in oduced
he analysis o X-STR ma ke s in hei ou ine.

INTRODUCTION
31
2. ALTERNATIVE STRS MARKERS : Y- STRs
2.1 In oduc ion
Y-STRs a e Sho Tandem Repea s ound on he male-speci ic Y Ch omosome.
The human Y-ch omosome has o en been conside ed an e olu iona y elic o he X
ch omosome. The Y-ch omosome has e ained he abili y o dic a e gende bu has
li le o he unc ional signi icance. Recen s udies ha e demons a ed ha i possesses
nume ous unc ional genes, including some ha appea o be c i ical o no mal male
de elopmen . App oxima ely 300 million yea s ago, he X and Y-ch omosomes we e
ue homologues, compa able in size and gene ic con en . Th ough he passage o ime,
he Y-ch omosome unde wen a se ies o dele ion mu a ions educing i o i s p esen
size o app oxima ely 50 megabases (Mg). This no wi hs anding, signi ican X
ch omosome sequence homology s ill pe sis s.
The ch oma in o he Y-ch omosome exis s in a leas h ee unc ionally di e en
o ms including:
• Pseudoau osomal egions (PARs)
• Euch oma in
• He e och oma in
The PARs, loca ed in he elome ic egions o he ch omosome, pai and
ecombine wi h he X-ch omosome du ing male meiosis. The euch oma in (con aining
he unc ional genes) and he ansc ip ionally ine he e och oma in o m he non-
ecombining egion (NRY) o he Y-ch omosome. Sequencing o he euch oma ic
egion has e ealed a pa chwo k o h ee dis inc sequence classes.
The coding genes, mos ly ound on he sho a m o he Y Ch omosome, a e i al o
male sex de e mina ion, spe ma ogenesis and o he male ela ed unc ions.
The NRY egion o he Y-ch omosome is inhe i ed in a pa ilineal manne in which a
haplo ype o physically linked gene ic ma ke s is ansmi ed unchanged, ba ing he
occasional a e mu a ion, om a he o son. Reduced gene ic a iabili y esul s om:
INTRODUCTION
32
• Non-independen seg ega ion o gene ic ma ke s on he Y-ch omosome
• Enhanced gene ic d i po en ial (due o he smalle e ec i e popula ion size o
he Y-ch omosome – one- ou h ha o au osomes)
Thus, signi ican ly mo e Y-ch omosome ma ke s would be equi ed o p o ide he
same abili y o disc imina e indi iduals ( he disc imina ing powe ) as ha ob ained by
au osomal STR ma ke s
The Y-STRs a e polymo phic among un ela ed males and a e inhe i ed h ough
he pa e nal line and emains i ually unchanged h ough many gene a ions.
By examining speci ic loca ions on he Y ch omosome, we can gene a e a Y-STR
p o ile o each male es ed. Males who a e ela ed h ough hei a he s will end o
ha e he same o simila Y-STR p o iles, and males who a e no ela ed will likely
ha e di e en Y-STR p o iles.
In humans, he Y ch omosome spans abou 58 million base pai s and ep esen s
app oxima ely 2% o he o al DNA in a male cells. The human Y ch omosome
con ains 86 genes, which code o only 23 dis inc p o eins. T ai s ha a e inhe i ed ia
he Y ch omosome a e called holand ic ai s.
The human Y ch omosome is unable o ecombine wi h he X ch omosome, excep o
small pieces o pseudoau osomal egions a he elome es (which comp ise abou 5%
o he ch omosome's leng h). These egions a e elics o ancien homology be ween
he X and Y ch omosomes. The bulk o he Y ch omosome which does no ecombine
is called he "NRY" o non- ecombining egion o he Y ch omosome [6].
2.2Y-STRs applica ions
The analysis o Y-ch omosome sho andem epea s (YSTRs) has become a
e y use ul ool, bo h in e olu iona y s udies and o ensic casewo k. [7-9]
Al hough mo e han h ee hund ed STR loci ha e been desc ibed on he Y-
ch omosome a much mo e limi ed numbe ha e been app op ia ely e alua ed o
o ensic casewo k use and some o hese ha e p esen ed a pa icula challenge o
assay design. The Y-STR loci comp ise di-, i-, e a-, and pen a-nucleo ide epea s
INTRODUCTION
33
wi h he di-nucleo ides exhibi ing he mos polymo phism bu an excessi ely high
le el o s u e a i ac s.
The abili y o iden i y male-speci ic DNA ende s polymo phic Y-ch omoso
mal sequences an in aluable addi ion o he s anda d panel o au osomal loci used in
o ensic gene ics. Y-STR haplo yping is pa icula ly impo an o sensi i e yping o
male DNA in mixed s ains as well as o apid asso men o biological c ime scene
e idence. Males commi he majo i y o iolen c imes. Fo example, he U.S. Bu eau
o Jus ice S a is ics epo s ha males commi abou 80% o all iolen c imes and
95% o sexual o enses in he Uni ed S a es. Many imes au osomal STR (Sho
Tandem Repea s) ma ke s a e able o ully disc imina e be ween un ela ed indi iduals,
bu he e a e se e al ci cums ances in which Y-ch omosome polymo phisms a e use ul
in o ensic analysis.
In a sexual assaul case, e idence, such as aginal swabs, con ain bo h emale
and male DNA. Di e en ial ex ac ion is o en used o sepa a e he male componen
om he emale componen , bu some imes, he wo componen s canno be sepa a ed
comple ely. As a esul , he emale componen could exis p ominen ly e en in he
male componen a e sepa a ion. When he sample unde goes he PCR ampli ica ion
p ocess, he emale DNA componen is ampli ied as well, some imes masking he
male DNA, which makes analysis di icul . This masking e ec ob iously does no
occu when Y-STRs a e examined.
Since he e is no Y-STR in he emale e idence, he only con ibu ion o Y-STR can
only come om he assailan (s) in a sexual assaul case. So he male componen is
easily de ec ed, since only his pa o DNA will be ampli ied. Thus he abili y o
speci ically de ec a male p o ile could ob ia e he need o he ime-consuming and
equen ly ine icien di e en ial ex ac ion p ocedu e o he sepa a ion o spe m and
non-spe m ac ions
The Y-STRs analysis is especially help ul when he e a e mo e han one
assailan since he mixed pa e n in he e idence can help o iden i y hem.
Y ch omosome speci ic sys ems may p o e in aluable o he iden i ica ion o he
gene ic p o ile o he male componen in mixed male/ emale specimens om non-
sexual assaul cases, in which he emale po ion is p esen in o e whelming
INTRODUCTION
34
quan i ies, (no balanced mix u e) whe e he e’s a masking e ec due o e y small
quan i y o male DNA in he sample. Pe o ming Y-STR es ing can help o iden i y all
males who ha e con ibu ed o he e idence.
Male speci ic sys ems may also aid in he in es iga ion o cases in ol ing
mix u es o deg aded DNA specimens (displaying pa ial au osomal STR p o iles) by
p o iding addi ional s a is ical disc imina ing powe , bu in some ci cums ances, Y-
STR da a migh be he only da a ha can be ob ained. I is impo an o no e ha a Y-
STR haplo ype is sha ed by males om he same pa e nal lineage. This ac mus be
aken in o accoun when d awing conclusions. In ac wo indi iduals ha sha e he
same Y-STR haplo ype a e e y likely ela ed h ough he same pa e nal line.
STRs loci a e loca ed on he non- ecombining pa o he Y-ch omosome and,
he e o e, should be conside ed linked as a single locus because hey a e inhe i ed as a
block o linked haplo ypes, so es ima es o he mul i-locus equency canno p oceed
by he p oduc ule.[10,11] Al hough mo e han h ee hund ed STR loci ha e been
desc ibed on he Y-ch omosome a much mo e limi ed numbe ha e been app op ia ely
e alua ed o o ensic casewo k use and some o hese ha e p esen ed a pa icula
challenge o assay design. The Y-STR loci comp ise di-, i-, e a-, and pen a-
nucleo ide epea s wi h he di-nucleo ides exhibi ing he mos polymo phism bu an
excessi ely high le el o s u e a i ac s.
Fig.2 : example o Y-STRs ma ke s
INTRODUCTION
41
Conside , o example, a case whe e wo sis e s a e es ed o es ablish whe he o no
hey ha e he same a he , and whe e DNA p o iles a e only a ailable o he sis e s. In
such ins ances, au osomal DNA ma ke s canno exclude pa e ni y, since wo sis e s
can inhe i di e en alleles despi e being ull siblings. The use o X-ch omosome
ma ke s can, howe e , exclude pa e ni y, since wo sis e s would sha e he same
pa e nal allele i hey ha e he same a he .
DNA ma ke s on he X-ch omosome ha e been shown o be powe ul ools o
assigning pedig ee membe s o e long dis ances wi h espec o X-ch omosomal
acks. Howe e , hey ail i X-ch omosomal lines a e in e up ed by a a he –son
ela ionship. I emale indi iduals ha e he same a he , hey always sha e he same
pa e nal Ch X. An in es iga ion o Ch X ma ke s o wo sis e s o s epsis e s can hus
exclude pa e ni y, e en i DNA o he pa en s is no a ailable. So yping o Ch X STR
clus e s p o ides a powe ul ool.
In pa e ni y cases in ol ing close blood- ela i es as pu a i e a he s, he
exclusion powe o STRs is conside ably educed and Ch X STRs may be supe io o
AS ma ke s. Fo example, i wo alleged a he s a e a he and son, hey would no
sha e any X-ch omosomal alleles iden ical by descen , and hence Ch X ma ke s
would be mo e e icien han AS ma ke s.
B o he s, in con as , sha e a gi en ma e nal Ch X allele wi h a p obabili y o 0.5,
which co esponds o he p obabili y o exac ly one allele sha ed ibd a an AS locus.
A speci ic eques o kinship es s in which only emo e ela i es a e a ailable o
es ing can be expec ed o a ise, pa icula ly om he need o ejoin amilies in he
con ex o he iden i ica ion o wa s and mass disas e s ic ims o also o wo ld-wide
mig a ion.
3.3 Popula ion S udy
The X-ch omosome has ea u es ha make i a good sou ce o in o ma ion o
popula ion gene ic s udies. The X-ch omosome is p esen in a single copy in males,
which makes i possible o de e mine he X-ch omosome haplo ypes in men.
Compa ed wi h au osomes, he X-ch omosome has lowe ecombina ion a e, lowe

INTRODUCTION
42
mu a ion a e and smalle e ec i e popula ion size esul ing in a as e gene ic d i . In
consequence, bo h linkage disequilib ium (LD) and popula ion s uc u e in he X
ch omosome a e expec ed o be s onge han hose in au osomes. Two hi ds o he X-
ch omosome his o y has been spen in emales. Thus, X ch omosome polymo phisms
mainly e lec he his o y o emales. Due o ecombina ion, X ch omosome ma ke s in
emales p o ide a mul ilocus sys em, while he m DNA and Y-ch omosome a e linked
haplo ypes.
Thus, X-ch omosome ma ke s a e aluable o popula ion gene ic s udies.[23-26]
Fu he mo e, i o he scien i ic disciplines such as e olu iona y an h opology will
ocus hei a en ion also a Ch X ma ke s, hey would need eliable da a o Ch X
ma ke s ound in di e en e hnics all o e he wo ld. Due o he qui e di e en
inhe i ance mode, he Ch X yping can ne e achie e he same signi icance in his
ield as Ch Y ma ke esea ch has ob ained.
In males, he Ch X ma ke appea s in hemizygous s a e. Hence, Ch X yping o
ma ke clus e s au oma ically p o ides haplo ypes. Since e y closely linked ma ke s
egula ly exhibi a linkage disequilib ium, hence, equencies o haplo ypes canno be
calcula ed by mul iplica ing he equencies single alleles o he haplo ypes in ol ed
bu hey mus be es ima ed by he analysis o popula ion samples. I wo o mo e STR
loci a e used, he coun o haplo ypes may ex end se e al hund eds o e en mo e han
housand haplo ypes.
Thus a X-STR da abase mus consis o haplo ype equencies a he han only allele
equencies. A websi e (h p://www.ch x-s .o g/) accessible o he o ensic
communi y was es ablished in o de o p o ide a e e ence da abase o Ch X STRs
and Ch X STR haplo ypes comp ising published popula ion da a o popula ions om
se e al coun ies.
.
INTRODUCTION
43
Fig.4 : X- ch omosome ideog am
INTRODUCTION
44
4. ALTERNATIVE STRS MARKERS : MINI STRs
4.1 In oduc ion
Deg aded DNA samples a e commonly obse ed in o ensic in es iga ions
in ol ing biological e idence: o ensic DNA labo a o y o en has o deal wi h DNA
samples ha a e less han ideal. The biological ma e ial se ing as e idence o a c ime
may been le exposed o a ha sh en i onmen o days, mon hs o e en yea s such as
in he case o he in es iga ions o missing pe son. The ic ims o homicides a e
ypically aken o ou o he way places whe e hey emain un il hei bodies a e
disco e ed. Ins ead o being p ese ed in a eeze away om caus ic chemicals ha
can b eak i down, he DNA molecule may ha e been le in di ec sunligh o in damp
woods. Rega dless o he si ua ion, he DNA molecules om a c ime scene come om
a less han p is ine en i onmen ha is no mally ound in molecula biology
labo a o ies. Jus as impo an is he ac ha he e ie ed biological sample may be
limi ed in quan i y. Thus accu a e sample analysis is c i ical since a o ensic scien is
may only ob ain enough e idence o one a emp a analysis. [27]
The e sa ili y and he unequalled sensi i i y o he DNA es has es ablished
i s use in many o ensic case scena io’s. The implemen a ion o he DNA echnology
has a g ea impac on how a scene o a ic im o c ime mus be in es iga ed.
In es iga o s ha e o look o biological aces so iny ha hey canno be de ec ed.
In cases whe e DNA e idence is limi ed, ei he in quan i y o quali y, such as highly
deg aded samples ha a e exposed o en i onmen al insul s o inhibi o s, s anda d
STR es ing is o en inadequa e. Analysis o hese comp omised DNA samples o en
esul in d opou o he la ge STR loci om he sample, and only a pa ial DNA
p o ile can be ob ained.. The p oblem is u he exace ba ed when la ge mul iplex PCR
eac ions a e used due o he wide size ange o PCR p oduc s gene a ed.
Pa ial DNA p o iles gene ally do no p o ide he powe o disc imina ion o
include o exclude a po en ial con ibu o o he sample. Reco e y o in o ma ion om
hese deg aded samples is o en enhanced by analyzing smalle PCR p oduc s called
Mini-STRs. This inno a i e app oach exploi s he abili y o specially designed
INTRODUCTION
45
p ime s ha p e e en ially a ge he la ge STR loci. Reduced-size STR amplicons can
be c ea ed by mo ing he o wa d and e e se PCR p ime s in close o he STR epea
egion. In ac while s anda d STR p ime s a ge longe sequences ha include he
STR loci, mini-STR p ime s “zoom in” on he STR locus so ha he esul ing DNA
p oduc is smalle , he eby inc easing he chances o success ul ampli ica ion o he
la ge loci. This echnology d ama ically inc eases he sensi i i y o DNA de ec ion
and op imizes he oppo uni y o ob ain a DNA p o ile om comp omised samples
helping o eco e in o ma ion om deg aded DNA samples ha ypically p oduce
pa ial p o iles and a o al loss o in o ma ion om la ge STR amplicons.
Fig.5 : Mini S s p ime s
Because o he abili y o ype e y deg aded samples, mini-STR echnology p o ides a
use ul ool o ob aining da a om samples wi h ex emely low DNA quali y and
INTRODUCTION
46
quan i y, ha ypically p oduce pa ial p o iles and a o al loss o in o ma ion om
la ge STR amplicons.[28-30]
Thus, many p e iously unsol able human iden i y cases may be esol ed wi h mini-
STR echnology. MiniSTRs had a ai ly macab e in oduc ion in o he wo ld o
o ensics, as hey we e i s used ex ensi ely in a o ensic lab o help iden i y he
ic ims o he Wo ld T ade Cen e disas e . They we e needed because many o he
emains collec ed om he deb is le whe e he Twin Towe s once s ood we e
ho ibly deg aded om i e, hea , and some imes bac e ial deg ada ion.
The majo i y o he bone samples we e able o be analyzed and yped ia con en ional
STR analysis. Bu he e was a po ion o he samples ha we e in such poo condi ion
ha li le o no DNA esul s could be ob ained. Minia u ized STRs p ime s we e a ha
ime in de eloping by John Bu le and B uce McCo d o he Na ional Ins i u e o
Science and Technology (NIST).
These "MiniSTRs", as hey came o be known, we e shown o be e y success ul a
ampli ying DNA om highly deg aded samples—and became eally help ul wi h he
mos deg aded emains om he WTC si e in la e 2002. [31]
4.2 Mini-STRs applica ions
DNA agmen s c ea ed h ough Mini STRs ampli ica ion a e much smalle
han adi ional STR analysis, he ypes o samples ha can bene i om his
echnology a e hose ha a e deg aded o inhibi ed. Deg aded samples ypically can
include bones, ee h, bu n i ems, i ems exposed o hea and humidi y, e c and consis
o DNA ha is highly agmen ed o b oken down. T adi ional STR yping can wo k
wi h sligh ly deg aded samples, bu as he agmen a ion inc eases e en adi ional
STR ma ke s (la ge amplicons) may yield a nega i e esul . In addi ion, o ensic
samples o en con ain some subs ance ha slows o inac i a es he PCR eac ion
(inhibi o s). Many inhibi o s a e known o o ensic scien is s.
These include: ce ain dyes (such as he indigo dye in denim ab ics), humic
acid p esen in some soils, heme om blood samples, melanin om skin and hai
samples, and annins om lea he . While adi ional STR es ing wo ks bes wi h abou

INTRODUCTION
47
1-2 nanog ams o DNA, Mini-STRs a e mo e sensi i e.( o example Mini ile ki
wo ks be ween 0.25-0.5 nanog ams o DNA and has been shown o yield usable
esul s wi h e en less han his amoun o DNA). This sensi i i y allows analys s o
ob ain esul s om samples wi h e y li le DNA quan i y. T ace biological e idence
a ising om casual handling o objec s (‘ ouch DNA’) is inc easingly being eco e ed
om c ime scenes. Many o hese ‘ ouch DNA’ samples con ain low amoun o
DNA. Reco e y o gene ic p o iles om LCN samples is di icul using s anda d STR
me hods and such a emp s o en esul in o al ailu e o eco e y o pa ial p o iles.
The echnology o Mini-STRs, using educed-size STR amplicons, can help o eco e
in o ma ion om hese samples, inc easing he success a e in di icul sample yping.
One p ime a ea o MiniSTR es ing is uniden i ied emains in missing pe sons cases
(DVI). Bones ha ha e been loca ed in sub-op imal condi ions, such as bu ied,
unde wa e , o in loca ions wi h high hea and humidi y a e pe ec o MiniSTR
analysis. Typically hese samples would be analyzed in combina ion wi h he
adi ional STR es ing. T adi ional es ing could allow he analys o ob ain esul s
om he majo i y o he loci es ed, and MiniSTR yping could p o ide many o he
loci ha may be missing om he adi ional esul s. Cold cases can also bene i om
MiniSTR es ing. Samples ha e en a yea o wo ago would no be conside ed good
candida es o DNA es ing may now yield esul s wi h his ex emely sensi i e
sys ems. Howe e , one mus ake in o accoun he condi ion and handling o he
sample p io o i s a i al in he lab. MiniSTR yping is so sensi i e i is possible o
pick up DNA om o ice s o o he s who may ha e handled he i em yea s ago.
MiniSTR yping opens he doo s o a whole new gen e o samples in he o ensic
DNA labo a o y. In ac a collabo a i e s udy wi h he Eu opean DNA P o iling G oup
e alua ed se e al me hods o analysis o assess how e ec i e each was o geno yping
deg aded DNA. STR sys ems (miniSTR assays and s anda d STR ki s) and single
nucleo ide polymo phisms we e compa ed and in gene al, miniSTR sys ems we e
obse ed o be he mos e ec i e in he analysis o deg aded.
One majo ad an age o hese smalle STRs, o “miniSTRs,” is ha da abase
compa ibili y can be main ained wi h con ic ed o ende samples p ocessed using
comme cial STR mul iplexes. In ac 3 new miniSTR loci (D10S1248, D2S441, and
INTRODUCTION
48
D22S1045) ha e been ecommended o adop ion by he Eu opean DNA communi y
as new co e loci The addi ion o new loci in o he ESS dec eases he chance o
ob aining alse posi i e ma ches wi h c oss-bo de DNA da a exchanges – especially
when he e a e pa ial (incomple e) p o iles, whils he small amplicon sizes o he new
loci inc eases he chance o ampli ica ion in deg aded sample, whe e DNA may be
agmen ed and/o in low quan i y. In addi ion, hese miniSTR ma ke s ha e he
po en ial o p o ide addi ional disc imina ion in complex pa e ni y cases o missing
pe sons cases. [32,33]
INTRODUCTION
49
5. Re e ences
[1]John M. Bu le , Ad anced Topics in Fo ensic DNA Typing Me hodology (2011)
CRC Accademic P ess.
[2]Bä W., B inkmann B., Lincoln P., May W., Rossi U., Budowle B., Eisenbe g A.,
Fou ney R., Gill P., Rand S. (1992), Edi o ial: Recommenda ions o he DNA
Commission o he In e na ional Socie y o Fo ensic Haemogene ics ela ing o he
use o PCR-based polymo phisms, Fo ensic Sci. In . 55, 1-3
[3]Bä W., B inkmann B., Budowle B., Ca acedo A., Gill P., Lincoln P., May W.,
Olaisen B. (1997), DNA ecommenda ions. Fu he epo o he DNA Commission o
he ISFG ega ding he use o sho andem epea sys ems, Fo ensic Sci In . 87(3),
179-4
[4]Bä W., B inkmann B., Lincoln P., May W., Rossi U., Budowle B., Fou ney R.,
Gill P., Rand S. (1993), Edi o ial: S a emen by DNA Commission o he In e na ional
Socie y o Fo ensic Haemogene ics conce ning he Na ional Academy o Sciences
epo on DNA Technology in Fo ensic Science in he USA, Fo ensic Sci.In .59(1),1-2
[5]G a es, J.A.M. (2006),Sex ch omosome specializa ion and degene a ion in
mammals, Cell 124 (5): 901–914.
[6]de Knij P., Kayse M., Caglia A., Co ach D., F e well N., Geh ig C., G aziosi G.,
Heido n F., He mann S., He zog B., Hidding M., Honda K., Jobling M., K awczak,
M., Leim K., Meuse S., Meye E., Oes e eich W., Pandya A., Pa son W., Penacino,
G., Pe ez-Lezaun, A., Piccinini, A., P inz M., Schmi , C., Schneide ,P.M., Szibo R.,
Tei el-G eding J., Weichhold G. M., and Roewe , L. (1997) Ch omosome Y
mic osa elli es: popula ion gene ic and e olu iona y aspec s, In .J.Legal Med. 110(3):
134-140
INTRODUCTION
50
[7]Kayse M., de Knij P., Diel jes P., K awczak M., Nagy M., Ze jal T., Pandya A.,
Tyle -Smi hC.,and Roewe ,L.(1997),Applica ions o mic osa elli e-based Y
ch omosome haplo yping, Elec opho esis. 18: 1602-1607.
[8]Bu le ,J.M.,Kline,M.C.,Decke ,A.E.(2008),Add essingY-ch omosome sho andem
epea (Y-STR) allele nomencla u e.Jou nal o Gene ic Genealogy 4(2):125-148
[9]Gill P., B enne C., B inkmann B., Budowle B., Ca acedo A., Jobling MA., De
Knij P., Kayse M., K awczak M., May WR., Mo ling N., Olaisen B., Pascali V.,
P inz M., Roewe L., Schneide PM., Sajan ila A., Tyle Smi h C. (2001),DNA
Commission o he In e na ional Socie y o Fo ensic Gene ics: ecommenda ions on
o ensic analysis using Y-ch omosome STRs., Fo ensic Sci In 124(1), 5-10
[10]Gusmao L., Bu le JM., Ca acedo A., Gill P., Kayse M., May WR., Mo ling N.,
P inz M., Roewe L., Tyle Smi h C., Schneide PM. (2006), DNA Commission o he
In e na ional Socie y o Fo ensic Gene ics (ISFG): an upda e o he ecommenda ions
on he use o Y-STRs in o ensic analysis, Fo ensic Sci In 157: 187-97
[11]Kayse , M., K uge , C., Nagy, M., Gese ick, G., de Knij , P., and Roewe , L.
(1998),Y-ch omosomal DNA-analysis in pa e ni y es ing: expe iences and
ecommenda ions, Ad ances in Fo ensic Gene ics 7: 494-496.
[12]Roewe L., K awczak M., Willuwei S.,Nagy M., Al es C., Amo im A., Anslinge
K., Augus in C., Be z A., Bosch E., Caglia A., Ca acedo Kayse M. e al. (2001),
Online e e ence da abase o Eu opean Y-ch omosomal sho andem epea (STR)
haplo ypes, Fo ensic Sci In 118: 106-13
[13]Willuwei S., Roewe L.(2007), Y ch omosome haplo ype e e ence da abase
(YHRD): Upda e, Fo ensic Science In e na ional: Gene ics 1(2), 83-7
INTRODUCTION
57
Single nucleo ide polymo phisms wi hin a gene egion ha e o en been s udied
o e alua e hei e ec on pheno ype. Al hough a single base pai change can p oduce
a pheno ypic change, howe e a pheno ype is o en in luenced by he p esence o
mul iple polymo phisms and hei ela i e posi ions wi hin a gi en egion. This means
ha i is essen ial o s udy he haplo ype, o he combina ion o mul iple SNPs alleles
on each ch omosome in o de o associa e genomic changes wi h a pa icula
pheno ype.
SNP ma ke s a e p e e ed o e mic osa elli e ma ke s o associa ion s udies
because o hei abundance along he human genome (SNPs wi h mino allele
equency > 10% occu in 1 o e e y 600 bp), he low mu a ion a e and he po en ial
o high- h oughpu geno yping.
Di e en geno yping applica ions equi e sc eening o di e en numbe s o SNPs.
The de e mina ion o a single SNP can be su icien o sc een o he p esence
o a Mendelian disease e en i o accu a ely e alua e whe he mu a ions wi hin a class
o genes con ibu e o a disease, hund eds o housands o SNPs mus be s udied in
associa ion s udies. In ac he numbe o SNPs equi ed o genomewide associa ion
s udies depends on he LD pa e n. Recen s udies ha e shown ha he human genome
can be pa i ioned in o disc e e blocks o high LD and ela i ely limi ed haplo ype
di e si y, sepa a ed by sho e egions o low LD. One o he p ac ical implica ions o
his obse a ion is ha only a small ac ion o all he single-nucleo ide
polymo phisms (SNPs) ( e e ed as “ ag SNPs”) is su icien o cap u e mos o
haplo ype s uc u e o he human genome in each block. So i can be ex emely use ul
o associa ion s udies in which i is no necessa y o geno ype all SNPs since i
pe mi s signi ican ly o educe geno yping e o . [4-6]
Many e o s in bo h he public (Human Genome P ojec ) as well as he p i a e
(The SNP Conso ium) sec o s ha e been made unde way o gene a e high-densi y
SNPs maps ha could p o ide he amewo k o esea ch s udies designed o iden i y
genes in ol ed in he physiology o mul igenic diseases, as well as diagnos ic ma ke s
o esponsible o di e en indi idual esponse o d ug o pha maceu icals.

INTRODUCTION
58
2. SNPs RESEARCH PROJECT
In he pas yea s, se e al esea ch g oups wo ked o c ea e SNP maps o he
human genome. Among hese we e he U.S. Human Genome P ojec (HGP) and a
g oup o companies called he SNP Conso ium.
The U.S. Human Genome P ojec was a 13-yea e o coo dina ed by he U.S.
Depa men o Ene gy (DOE) and he Na ional Ins i u es o Heal h (NIH) wi h he aim
o disco e all he es ima ed 20,000-25,000 human genes and make hem accessible o
u he biological s udy. [7]
The p ojec begun in Oc obe 1990 and o iginally was planned o las 15 yea s, bu
apid echnological ad ances accele a ed he comple ion da e o 2003.
In 1998, as a pa o he las i e yea s esea ch plans, he DOE and NIH es ablished
he ollowing goals abou Human Genome Sequence Va ia ion:
• De elop echnologies o apid, la ge-scale iden i ica ion and/o sco ing o single
nucleo ide polymo phisms and o he DNA sequence a ian s.
• Iden i y common a ian s in he coding egions o he majo i y o iden i ied genes
du ing his i e-yea pe iod.
• C ea e a SNP map o a leas 100,000 ma ke s.
• De elop he in ellec ual ounda ions o s udies o sequence a ia ion.
• C ea e public esou ces o DNA samples and cell lines.
The ini ial aim was b ie ly eached and widely exceeded since in Feb ua y
2003 we e mapped 3.7 million human SNPs. All da a in o ma ions a e s o ed in a
public da abase accessible as a common esou ce o scien i s. The SNP Conso ium
(TSC) was es ablished in ap il 1999 unde he leading o A hu L. Holden as a
collabo a ion o en la ge pha maceu ical companies and he U.K. Wellcome T us
philan h opy.The goal was o disco e in wo yea s 300,000 SNPs and o p oduce a
public widely accep ed, high-quali y SNPs map esou ce. [8]
The in e na ional membe companies APBio ech, As aZeneca G oup PLC, A en is,
Baye G oup AG, B is ol-Mye s Squibb Co., F. Ho mann-La Roche, Glaxo Wellcome
PLC, IBM, Mo o ola, No a is AG, P ize Inc., Sea le, and Smi hKline Beecham PLC
INTRODUCTION
59
con ibui ed a leas $30 million o he conso ium while he Wellcome T us ga e
a ound $14 million. Labo a o ies unded by hese companies o iden i y SNPs a e
loca ed a he Whi ehead Ins i u e, Sange Cen e, Washing on Uni e si y (S . Louis),
and S an o d Uni e si y. Da a managemen and analysis ake place a Cold Sp ing
Ha bo Labo a o y.
The inal esul s la gely exceeded he ini ial pu pose and a high-densi y map wi h 1.8
million SNPs was c ea ed. Now ha he i s phase o he TSC p ojec is essen ially
comple e, he cu en goal is o de e mine he o he allele equency/geno ype
equency o ce ain SNPs in he majo wo ld popula ions.
A public websi e (h p://snp.cshl.o g), main ained a Cold Sp ing Ha bo
Labo a o y, was es ablished o make all TSC p ojec da a a ailable o he esea ch
communi y, o p o ide in o ma ion abou he p ojec i sel and also o imp o e exis ing
da a b owsing and sea ching acili ies.
The mapping o he human genome has made possible o de elop a haplo ype
map in o de o be e de ine human SNP a iabili y. The haplo ypes map o
‘‘HapMap’’ (www. hapmap.o g) is a powe ul ool ha allow esea che s o ind genes
and gene ic a ia ions ha a ec heal h and disease. The In e na ional HapMap P ojec
is a mul i-coun y e o s a ed on Oc obe 2002 as a collabo a ion among scien is s
om public and p i a e o ganiza ions in six coun ies (Canada, China, Japan, Nige ia,
Uni ed S a es, Uni ed Kingdom). The goal o he p ojec is o compa e he gene ic
sequences o di e en indi iduals o iden i y he common pa e ns o gene ic a ia ion
in humans. This includes he ch omosome egions wi h se s o s ongly associa ed
SNPs, he haplo ypes in hose egions, he SNPs ha ag hem, he iden i ica ion o
egions whe e associa ions among SNPs a e weak.
All o he in o ma ion gene a ed by he P ojec a e eleased in o he public domain, in
o de o help esea che s in inding genes ha a ec heal h, disease, and indi idual
esponses o he apeu ic d ugs and en i onmen al ac o s. By Oc obe 2007 mo e han
3 millions SNPs we e ound and disco e y s ill con inues. [9,10]
Geno yping quali y was assessed by using duplica e samples, since all cen e s
geno yped a s anda d se o SNPs and checked some o he geno ypes p oduced by
o he cen e s.
INTRODUCTION
60
3. RELEVANT SNPs CLASSES
2.1 Au osomal SNPs
Highly deg aded DNA p esen s a majo challenge o he s anda d iden i ica ion
ma ke s a ailable o o ensic analyses; hough sho ening he ampli ied agmen s
gene a ed in PCR ma kedly imp o es geno yping success. The a e o DNA
deg ada ion is accele a ed by he e ec o en i onmen al ac o s including
empe a u e, humidi y, ul a iole adia ion, pH, p esence o mic oo ganisms and he
localized geochemical p ope ies o he soil. All hese ac o s ha e a g ea e bea ing on
he condi ion o DNA han he ime since deposi ion o dea h. Chemical eac ions
a ec ing DNA s abili y and consequen ly PCR e iciency, can be ca ego ized in o
h ee g oups: hyd olysis leading o base loss, oxida ion leading o base modi ica ion
and single/ double s and b eakage. Pos mo em, a co pse is subjec o he ac ion o a
ange o bac e ial enzymes o igina ing om he gas o-in es inal ac and om he
immedia e en i onmen . The p incipal ca aly ic ac i i y o bac e ial enzymes is o
clea e DNA o gene a e a pool o small oligonucleo ides whe e a e age agmen sizes
and hei ange o 80–200 base pai s (bp) all wi hin mos o ensic ma ke s’ in e -
p ime leng hs and he e o e comp omise PCR ampli ica ion e iciency. Sho Tandem
Repea s (STRs) ep esen he i s -choice ma ke s o o ensic iden i ica ion due in
la ge pa o hei high disc imina ion powe . Howe e STR analysis o highly
deg aded samples is o en inadequa e in e ms o p o ile comple eness and his
comp omises he disc imina ion powe ha can be expec ed om geno yping o hese
ma ke s alone. The need o dec ease amplicon sizes o he smalles possible
ampli iable agmen s has led o he de elopmen o se e al al e na i e ma ke se s
speci ically aimed a analyzing highly deg aded DNA.
These include: mini-STRs, and single nucleo ide polymo phism (SNPs) [11].
SNPs o e ideal candida e loci o yping deg aded DNA due o hei
simpli ied bina y polymo phisms ha allow la ge-scale mul iplexing as well as hei
ob ious po en ial o designing PCR amplicon sizes in a easible ange o 50–120 bp.
INTRODUCTION
61
Un o una ely in he case o iden i ica ion, he disad an age, howe e , is ha since he
numbe o alleles pe locus is limi ed, he in o ma ion con en is low. The amoun o
in o ma ion om one STR ma ke is he same as om app oxima ely ou SNPs
(Sob ino e al., 2005).
A SNP wi h high he e ozygosi y and essen ially iden ical allele equencies in all
popula ions would be ideal because he ma ch p obabili y would be nea ly cons an
i espec i e o popula ion. High he e ozygosi y maximizes he in o ma ion a each
SNP and low Fs minimizes he chance e ec s be ween popula ions.
Thus, i should be possible o selec SNPs ha a e use ul o human
iden i ica ion pu poses in he majo i y o popula ions, and o supplemen hese wi h
SNPs showing highly con as ing allele equency dis ibu ions in pa icula
popula ions. These la e SNPs can p o ide aluable in o ma ion o popula ion
admix u e de ec ion, in addi ion o he es ima ion o biogeog aphical ances y.
In addi ion au osomal single nucleo ide polymo phisms (SNPs) a e widely in es iga ed
as ma ke s o biogeog aphical ances y due o hei low mu a ion a e, high abundance
in he genome and wide ange o allele equencies amongs popula ions.
The de elopmen o au osomal SNP-based o ensic assays which can in e
ances al o igin om biological e idence samples has conside able po en ial in
o ensic in elligence bu is ela i ely limi ed, pa icula ly wi h espec o popula ions
s udied. In e ences o ances y could be u ilized o na ow, o c ea e, a pool o suspec s
pa icula ly when STR p o iling has been unsuccess ul and when eyewi nesses a e
una ailable. Such echniques could also assis in he iden i ica ion o ic ims in mass
disas e s and enable mo e e icien use o police and o ensic esou ces in he ea ly
s ages o an in es iga ion.
2.2 SNPs on Ch omosome Y
Males ha e one X ch omosome and one Y ch omosome, ha con ains a gene
which igge s he emb yonic de elopmen as a male.
Since some yea s, Y ch omosome analysis has became a common me hod o acing
human e olu ion h ough male lineages as well as applica ion o male iden i ica ion in
INTRODUCTION
62
o ensic si ua ions. In ac he abili y o sepa a e and iden i y he male componen om
e idences con aining mix u es o male and emale DNA is s ongly use ul in many
o ensic si ua ions.
In ac , o example in case o sexual assaul , he use o Y ch omosome speci ic
p ime s can imp o e he chances o de ec ing low le els o he pe p e a o ’s DNA in a
high backg ound o he emale ic im’s DNA wi hou any p ocedu e o di e en ial
DNA ex ac ion be ween male and emale cells. Y ch omosome analysis can also
bene i pa e ni y es ing when a male o sp ing is in ques ion: in ac since a he s pass
hei Y ch omosome on o hei sons unchanged (excep o an occasional mu a ion), all
males in a pa e nal lineage will possess a common Y ch omosome haplo ype.
The lack o ecombina ion along mos o he Y-ch omosome makes i a use ul ool in
di icul pa e ni y analysis o econs uc ion o male linage o applica ion in kinship
analysis, in human e olu iona y s udies and o assessing male mig a ion pa e ns .
To assess he eliabili y o a da abase as ep esen a ion o ac ual popula ion haplo ype
equencies, howe e he ex en o s uc u e among popula ions also needs o be
conside ed in pa icula because Y ch omosome haploid and pa e nal mode o
inhe i ance makes i mo e sensi i e o gene ic d i han he au osomes.
Ex ensi e s udies a e s ill pe o med o iden i y nume ous single nucleo ide
polymo phisms (SNPs) on he Y ch omosome. A a ie y o polymo phic gene ic
ma ke s ha e been iden i ied in he euch oma in po ion o he Y-ch omosome,
including a numbe o STR and SNPs loci. These SNPs a e single base changes o
inse ion/dele ions, which a e slowly e ol ing in compa ison wi h he sho andem
epea ma ke s, which e ol e mo e apidly.
The analysis o single nucleo ide polymo phisms loca ed wi hin he male-
speci ic egion o he Y-ch omosome (MSY) is widely used as a powe ul ool o
e olu iona y s udies and o measu ing he a iabili y be ween popula ions. E e y
man can ace his Y- ch omosome back o an ances o who li ed in Eas A ica a ound
140.000 yea s ago. DNA has changed sligh ly du ing yea s: i one b o he had a SNP
mu a ion, and ano he didn' , he b o he s go sepa a e ways. Because each o hei
espec i e sons had hese di e en mu a ions and all o hei descendan s, a he end
wo la ge b anches o he Y-ch omosome ee we e c ea ed.

INTRODUCTION
63
Roughly 80 housand yea s ago men decided o mo e, i s jus wi hin A ica, bu hen
o e e y pa o he globe and hey ook his Y-ch omosome mu a ion, (and hus he
iden i ying b anch) wi h hem. When men adap ed o new su oundings many new
mu a ions in he DNA s and ha e occu ed. Se ies o mu a ions o m molecula
lineages and each SNP mu a ion may de ine a se o speci ic Y ch omosomes called
haplog oups. Because o he special ea u e o Y-DNA (no ecombina ion) mu a ions
emain ixed in place on bo h ypes o DNA and he his o ical sequence o hese
mu a ions can be in e ed.
In ac due o he speci ic dis ibu ion o Y-haplog oups among popula ions, Y-SNP
pe mi o in e he o igin, e olu ion, and his o y o humans by acing back male
ini ia ed pa e ns o mig a ion om mode n human popula ions. The non- andom
dis ibu ion o he Y ch omosome lineages wo ldwide pe mi s an accu a e
cha ac e isa ion o haplog oups associa ed wi h speci ic geog aphic a eas. [12,13].
A he p esen day, he e a e many o hese la ge b anches 'haplog oups' (called A
ough o R) in di e en egions a ound he globe.
E en i he alida ion o he Y ch omosome SNPs mul iplexes desc ibed o
o ensic applica ion is s ill in p og ess, howe e SNP yping could in a nea u u e
signi ican ly con ibu e o o ensic in es iga ion by p o iding in o ma ion on he
e hnic o igin o a male DNA sample and combined wi h STR ma ke s, could be a
powe ul ool o mass disas e s o e o is a acks being able o iden i y people om
a ious geog aphical a eas in ol ed. [14,15]
2.3 SNPs on Ch omosome X
The X-ch omosome is p esen in a single copy in males, who inhe i hei one
X-Ch om hei mo he , while emale indi iduals ecei e one X om he mo he and
he o he one om he a he . So, emale indi iduals a he ed by he same man sha e
hei pa e nal Ch omosome X. Female indi iduals a he ed by he same man sha e
hei pa e nal Ch omosome X.
INTRODUCTION
64
X ch omosome analysis ha e been p o en o be use ul in case o de iciency pa e ni y
es ing and in e ec i e mo he -son kinship and a he -daugh e es ing.
Hence in case o de iciency pa e ni y in which he mo he is a ailable o yping, he
possible X alleles o he pu a i e a he can be de e mined and he pa e nal p o ile can
be econs uc ed. [16]
The X-ch omosome has ea u es ha make i a good sou ce o in o ma ion o
popula ion gene ic s udies. I has a lowe ecombina ion and mu a ion a e han
au osomes and also a small popula ion size ha esul s in a as e gene ic d i . As
consequence he linkage disequilib ium (LD) and popula ion s uc u e in he X
ch omosome a e s onge han in au osomes.
X ch omosome polymo phisms e lec he his o y o emales: ollowing o
ecombina ion, X-ch omosome ma ke s in emales p o ide a mul ilocus sys em, while
he m DNA and Y-ch omosome a e linked haplo ypes.
The ansmission pa e n o he human X ch omosome educes i s popula ion size
ela i e o he au osomes, subjec s i o disp opo iona e in luence by emale
demog aphy, and lea es X-linked mu a ions exposed o selec ion in males. As a esul ,
he analysis o X-linked genomic a ia ion can p o ide insigh s in o he in luence o
demog aphy and selec ion on he human genome.
X ch omosomes end o be mo e di e en ia ed be ween human popula ions
han au osomes wi h se e al no able excep ions. Compa isons be ween gene ically
dis an popula ions also showed an excess o X-linked SNPs wi h la ge allele
equency di e ences. The ela ionship be ween male and emale demog aphic
his o ies is likely o be complex as e idence suppo ing di e en conclusions can be
ound in he same da ase . Al hough demog aphy may ha e con ibu ed o he excess
o SNPs wi h la ge allele equency di e ences obse ed on he X ch omosome,
howe e he selec ion is a leas pa ially esponsible.
X-ch omosome SNPs ma ke s can be used o complemen he esul s ob ained
om STR ma ke s since hey show some ad an ages compa ed o STRs such as he
low mu a ion a e, he high numbe in he human genome and he abili y o be yped
also in pa ly deg aded samples: all ea u es ha makes hem pa icula ly use ul in
o ensic casewo ks, complex kinship analysis o immig a ion case. [17,18].
INTRODUCTION
65
2.4 Mi ochond ial SNPs
Mi ochond ial genome is highly polymo phic, making i use ul o human
iden i ica ion. The as majo i y o he human genome is loca ed wi hin he nucleus o
each cell, howe e also mi ochond ia which a e placed in he cy oplasm, con ain a
small ci cula genome.
Human m -DNA was i s sequenced in 1981 in he labo a o y o F ede ick Sange in
Camb idge, England. The o iginal sequence is he e e ence sequence o which new
sequences a e compa ed and is commonly known as he Ande son sequence o he
Camb idge e e ence sequence.
M -DNA is useul o he o ensic DNA communi y because i can be e icien ly
ampli ied om limi ed o se e aly deg aded biological ma e ial.
The likelihood o eco e ing m DNA in small o deg aded biological samples is
g ea e han o nuclea DNA because m DNA molecules a e p esen in high copy
numbe (hund eds o housands) in each cell compa ed o he nuclea complemen o
wo copies pe cell. The e o e samples ha lack su icien nuclea DNA as shed hai s,
old bones and in gene al sca ce human emains, e en i deg aded by en i onmen al
insul o ime, may p o ide enough ma e ial o yping he m DNA locus.
Unlike nuclea DNA, which is passed om bo h mo he and a he o he o sp ing,
m DNA is only ma e nally inhe i ed so ha in si ua ions whe e an indi idual is no
a ailable o a di ec compa ison wi h a biological sample, any ma e nally ela ed
indi idual may p o ide a e e ence sample. Mo eo e i has a ela i ely in equen
mu a ion a e and i emains he same h ough many gene a ions. Thus, m -DNA
analysis will no di e en ia e women ha a e in he same ma e nal lineage o child en
wi h he same mo he .[19,20]
Since conside able e o and expense a e equi ed o ob ain a ull HVI
(posi ions 16024–16365 ) and HVII (posi ions 73–340) m DNA sequence so se e al
m DNA sc eening me hods ha e been de eloped ha pe mi apid esolu ion o non-
ma ching samples.Mo eo e he disc imina ion powe o an m DNA analysis is limi ed
because common haplo ypes exis in HVI/HVII m DNA sequences ha can educe he
abili y o di e en ia e wo un ela ed samples.
INTRODUCTION
66
In all his cases i can be use ul he analysis o some coding egion a ia ions in
addi ion o he non-coding polimo physms. The sequence analysis o he coding egion
equi e mo e ma e ial han he one gene ally p esen in o ensic samples and o ha
an al e na i e SNP analysis app oach is possible in o de o analyze SNPs
polymo phisms wi hin he hype a iable egion as well as in he coding egion. E en
hough he numbe o ma ke s in he cu en sys em is limi ed, i can easily be
ex ended o yield a g ea e powe o disc imina ion. When ully de eloped, mic oa ay
analysis p o ides a p omising sys em o e icien sensi i e SNP analysis o o ensic
samples in he u u e.
The yping o mi hocond ial SNPs allows he di e en ia ion be ween
indi iduals possessing an iden ical HV1/HV2 sequence.[21]
Mul iplex SNPs panels a e in de elopmen o esol e mi o ypes in some popula ions
such as Caucasian, Hispanic, and A ican Ame ican.
Fo example a se o 11 SNPs has been selec ed by NIST ese ache s o dis inguishing
indi iduals o he mos common Caucasian HV1/HV2 mi o ype.
Resolu ion and de ec ion o p oduc s we e achie ed by elec opho esis on a capilla y
sequence The de elopmen o he m SNP 11-plex assay is ian accu a e me hod o
yping sequence a ian m SNPs on a pla o m common o almos all o ensic
labo a o ies. Cu en ly a e in de eloping addi ional mul iplex SNP panels o esol e
o he common mi o ypes such as Caucasian, Hispanic, and A ican Ame ican. [22,23].
The e o e, he o ensic gene ics ields ha e been inc easingly in e es ed in
s udying hese polymo phisms, assembling in o ma ion on gene ic a ia ion o human
popula ions and hei his o y and also using SNPs o indi idual iden i ica ion
pu poses. Coding egion SNPs can ul il a use ul ole o sepa a ing common
HV1/HV2 mi ochond ial DNA ypes and assays ha e been de eloped o eliably
examine m DNA coding egion SNP a ia ion
3. Fo ensic Applica ions
Since many yea s o ensic labo a o ies commonly use sho andem epea s
(STRs) as he s anda d DNA iden i ica ion me hod, because hey ha e been widely
INTRODUCTION
73
SBE, capilla y elec opho esis and mul icolo de ec ion me hods can be applied o
o ensic casewo ks. [29-31].
b) Lineage In o ma i e SNPs
Lineage SNPs a e placed on he Y ch omosome o in mi ochond ial DNA genome.
They show a lack o ecombina ion and a low mu a ion a e, so hey a e in o ma i e
o e olu iona y s udies and kinship analyses, in pa icula in complex cases when he
e idence and he e e ence sample a e sepa a ed by se e al gene a ions.
In ac he mos use ul o ensic applica ion o lineage SNPs is o missing pe son o
mass disas e iden i ica ions, e en i he success o analysis in kinship es is limi ed
by he amoun o DNA in samples, he numbe o amily membe s a ailable o
compa ison, and he cha ac e is ics o he used gene ic ma ke s.
In ac he lineage ma ke s, cu en ly a ailable ha e a limi ed powe o disc imina ion.
Coble e al. selec ed o lineage o ensic applica ions 59 SNPs ha ha e been sub-
di ided in o 8 di e en mul iplex panels a ge ing 18 speci ic common Caucasian
HVI/HVII ypes. [32,33]
Howe e o he s udies a e in p og ess o selec mo e SNPs ei he on Y ch omosome
and m -DNA han on he au osomes ha all oge he may se e as lineage-based
ma ke s. [34,35]
c) Ances y In o ma i e SNPs
In all cases whe e no suspec s a e a ailable o a compa ison wi h an
e iden ia y sample o no ma ch is ound agains a DNA da abase , i may be use ul,
o in es iga i e pu pose, o de ine he gene ic bio geog aphical ances y o a
pe pe a o .
Fo ensic STR loci a e powe ul iden i y ma ke s, bu hey a e poo in o ma i e as
ances y ma ke s because o he high deg ee o allele-sha ing among di e en
popula ions. Y ch omosome and m -DNA ma ke s used o e olu iona y pu poses may
gi e some in o ma ions also abou he gene ic ances y e en hey' e no good
candida es o ances y s udies because o hei unipa en al inhe i ance (haplo ypes)
and limi ed ep esen a ion o he human genome.

INTRODUCTION
74
Ances y in o ma i e ma ke s (AIMs) a e SNPs ha e eal ances al o igin o a
sample dono bu no iden i y di ec ly physical cha ac e is ics.
They a e dis ibu ed h oughou all he human genome and show di e en equencies
in di e en popula ions .
Tes s ha in e he ances al o igin o a DNA sample may ha e a conside able
po en ial in he de elopmen o o ensic ools ha can assis c ime in es iga ion.
Since his me hod is based on he co ela ion o pheno ypic exp ession wi h ce ain
elemen s o popula ion ances y s uc u e, hus i s ongly equi es he assessmen o
he gene ic a ia ion ha co ela es wi h speci ic popula ions and he de elopmen o
speci ic da abases o quan i y AIMs.
Mo eo e a complex s a is ical classi ica ion algo i hm based on maximum likelihood,
is equi ed o p edic ances al o igin om he p o iles ob ained.
A eliable o ensic es o assigning he mos likely ances y can be achie ed om
mul iplexed assays by choosing SNPs ha exhibi signi ica i e allele equency
di e ences be ween popula ion so o cha ac e ize sequences o DNA ha a e mo e
p e alen in people om one con inen han ano he .
The in es iga ion o a se ies o i e unsol ed se ial mu de s in sou he n
Louisiana be ween Sep embe 2001 and Ma ch 2003 was aided by he use o AIM-
SNPs. P io o hei use, psychological p o iling had indica ed he likelihood ha a
Caucasian male was he culp i . Howe e , AIM-SNP analysis e ealed ha he kille
was likely o be o A ican-Ame ican ances y. Ac ing upon his lead, in es iga o s
e en ually a es ed an A ican-Ame ican suspec , De ek Todd Lee and ied him o
he mu de o Cha lo e Mu ay Pace. Lee was subsequen ly linked by DNA e idence
o se en o he homicides om 1998 o 2003.
d) Pheno ype In o ma i e SNPs
The associa ion be ween gene ic a ia ion and pheno ypic ea u es has been
explo ed in se e al s udies. The abili y o pe o m gene ic yping o biological aces
collec ed a he c ime scene, in o de o ob ain in o ma ion abou a dono ’s physical
cha ac e is ics, is a e y a ac i e p ospec o o ensic analysis and i could
po en ially o e a powe ul new ool o c ime scene in es iga ions.
INTRODUCTION
75
SNPs can be aken in o conside a ion as DNA ma ke s o pheno ypic ai s
(eye colou , hai , skin, e c) ha enable a gene ic p edic ion o appea ance o
in es iga i e pu pose o iden i y he pe pe a o o a c ime. They also may ha e alue
in an h opology s udies o he econs uc ion o unknown human emains. AIMs
p o ide use ul in o ma ion ega ding he likely appea ance o a suspec connec ed
only wi h biogeog aphic ances y, so hey can be indi ec measu es o he pheno ype o
an indi idual. [36]
S udies a e pe o med o de e mine he gene ic polymo phisms, simple and
complex, esponsible o hese di e en pheno ypic ai s, SNPs in a numbe o
pigmen a ion genes ha e been associa ed wi h a ious human hai , skin, and eye
colou pheno ypes.This equi es an assessmen o a se o SNPs ha s ongly a ec s a
speci ic pheno ype as well as de elopmen o da abases o ela e hese a ian s o he
speci ic ai s. To da e mos wo k on pheno ype SNPs has concen a ed on
pigmen a ion, since he gene ic basis o hai , skin and eye colou is well unde s ood
om animal model s udies.[37,38]
Thus, hey ha e e y limi ed alue o desc ibing he physical appea ance o an
indi idual and he in o ma i e alue mus be aken in o conside a ion on a case-by
case basis. DNA ma ke s ha desc ibe pheno ypic ai s would enable a mo e p ecise
gene ic p edic ion o appea ance o in es iga i e leads o iden i y he pe pe a o o a
c ime. They also may be o alue in an h opology s udies o he acial econs uc ion
o unknown human emains (i.e., he skull).
DNA e idence le by a pe p e o a a c ime scene o on a ic im’s body can be
analyzed o ob ain physical in o ma ions abou he dono in o de o cons uc a
physical po ai o he pe son , gi ing an high imp o emen o he in es iga ion.
The mos ob ious desc ip o s o an indi idual’s appea ance a e colou ing, heigh , and
acial ea u es, which a e all highly he i able I should he e o e be possible o
de e mine esponsible o di e en pheno ypic ai s a ia ion. [39,40]
INTRODUCTION
76
5. REFERENCES
[1]Mille , R.D., P. Taillon-Mille , and P.Y. Kwok. (2001), Regions o Low Single-
Nucleo ide Polymo phism Incidence in Human and O angu an Xq: Dese s and Recen
Coalescences,Genomics 71: 78-88.
[2]Thi d In e na ional Mee ing on Single Nucleo ide Polymo phism and Complex
Genome Analysis (2000) Eu . J. Hum. Gene . 9, 316-18.
[3]Weine MP, Hudson TJ (2002),In oduc ion o SNPs: Disco e y o Ma ke s o
Disease. BioTechniques Suppl:4-7, 12-3
[4]Wang N, Akey JM, Zhang K, Chak abo y R, Jin L(2002), Dis ibu ion o
ecombina ion c osso e s and he o igin o haplo ype blocks: he in e play o
popula ion his o y, ecombina ion and mu a ion,Am J Hum Gene 71:1227–1234
[5]Daly MJ, Rioux JD, Scha ne SF, Hudson TJ, Lande ES (2001),High- esolu ion
haplo ype s uc u e in he human genome,Na Gene 29:229–232
[6]Gab iel SB, Scha ne SF, Nguyen H, Moo e JM, Roy J, Blumens iel B, Higgins J,
De Felice M, Lochne A, Fagga M, Liu-Co de o SN, Ro imi C, Adeyemo A, Coope
R, Wa d R, Lande ES, Daly MJ, Al shule D (2002), The s uc u e o haplo ype
blocks in he human genome,Science 296:2225–2229
[7]In e na ional_Human_Genome_Sequencing_Conso ium (2001), Ini ial sequencing
and analysis o he human genome. Na u e 409: 860-921.
[8]The SNP Conso ium Websi e: Pas , P esen , and Fu u e (2003),Nucleic Acids
Resea ch 31(1), 124-27.
INTRODUCTION
77
[9]TheIn e na ional HapMap Conso ium (2007), A second gene a ion human
haplo ype - map o o e 3.1 million SNPs ,Na u e 449: 851-861
[10]The_In e na ional_SNP_Map_Wo king_G oup.(2001),A map o human genome
sequence a ia ion con aining 1.42 million single nucleo ide polymo phisms,Na u e
409: 928-933.
[11]Gill P.(2001),An assessmen o he u ili y o single nucleo ide polymo phisms
(SNPs) o o ensic pu poses. In J Legal Med 114(4–5):204–10.
[12]Sob ino B. and Ca acedo A. (2005), SNP Typing in Fo ensic Gene ics, Fo ensic
DNA Typing P o ocols, 297: 1064-3745
[13]Blanco-Ve ea A, B ion, M.. Ramos-Luis E,. La eu, M.V Ca acedo A. (2008),
Fo ensic alida ion and implemen a ion o Y-ch omosome SNP mul iplexes, Fo .Sci.
In . Gene ics Suppl. Se ies 1 181–183
[14]B ion M., Sanchez J.J.,. Balogh K, Thacke C., Blanco-Ve ea A., Bø s ing C.,.
S admann-Bellinghausen B,. Bogus M, Synde combe-Cou D., Schneide P.M., A.
Ca acedo, N. Mo ling (2006), Analysis o 29 Y-ch omosome SNPs in a single
mul iplex use ul o p edic he geog aphic o igin o male lineages. ICS 1288, 13– 15
[15]Bouakaze C., Keyse C., Amo y S., C ubézy E. and Ludes B.(2007), Fi s
success ul assay o Y-SNP yping by SNaPsho minisequencing on ancien DNA
In J Legal Med, 121 (6):493-9
[16]Tomas C.,Sanchez J.J.,Cas o J.A., Bø s ing C.,Mo ling N.,U ili y o X-ch omoso
me SNPs in ela ionship es ing, (2008) Fo . Sci. In . Gene ics Supplemen Se ies 1:
528–530
INTRODUCTION
78
[17] M.T. Za abei ia, V.Mija es and J.A.Riancho (2007),Fo ensic e iciency o
mic osa elli es and single nucleo ide polymo phisms on he X ch omosome, In J
Legal Med, 121 (6), 433-437
[18]Tomas C.,Sanchez J.J.,Cas o J.A.,Bø s ing C.,Mo ling N.(2010), Fo ensic
use ulness o a 25 X-ch omosome single-nucleo ide polymo phism ma ke se ,
T ans usion 50: 2258–2265
[19]Kimbe ly A. S., Coble M. D., Ba i . S. M., Pa sons T. J., Jus R. S. (2008),The
applica ion o m DNA SNPs o a o ensic case, Fo . Sci. In . Gene ics Supplemen
Se ies 1 :295–297
[20]Jus , R.S., I win, J.A., O'Callaghan, J.E., Saunie , J.L., Coble, M.D., Vallone,
P.M., Bu le , J.M., Ba i , S.M., and Pa sons, T.J. (2004), Towa d inc eased u ili y o
m DNA in o ensic iden i ica ions. Fo ensic Sci. In . 146S: S147-S149
[21]Kline, M.C., Vallone, P.M., Redman, J.W., Duewe , D.L., Calloway, C.D., and
Bu le , J.M. (2005),Mi ochond ial DNA yping sc eens wi h con ol egion and coding
egion SNPs, J. Fo ensic Sci. 50(2): 377-385
[22]Vallone, P.M., Jus , R.S., Coble, M.D., Bu le , J.M., and Pa sons, T.J. (2004),
A mul iplex allele-speci ic p ime ex ension assay o o ensically in o ma i e SNPs
dis ibu ed h oughou he mi ochond ial genome, In . J. Legal Med. 118: 147-157
[23]Coble, M.D., Jus , R.S., O'Callaghan, J.E., Le manyi, I.H., Pe e son, C.T., I win,
J.A., Pa sons, T.J. (2004),Single nucleo ide polymo phisms o e he en i e m DNA
genome ha inc ease he powe o o ensic es ing in Caucasians,In . J. Legal Med.
118: 137-146.
[24]Bu le J.M., Coble M.D., Vallone P.M. (2007), STRs s. SNPs: hough s on he
u u e o o ensic DNA es ing. Fo ensic Sci Med Pa hol. 3:200–205 201

INTRODUCTION
79
[25]Gill, P., D.J. We e , B. Budowle, and R. Gue ie i (2004),An assessmen o
whe he SNPs will eplace STRs in na ional DNA da abase: join conside a ions o he
DNA wo king g oup o he Eu opean Ne wo k o Fo ensic Science Ins i u es (ENFSI)
and he Scien i ic Wo king G oup on DNA Analysis Me hods (SWGDAM), Sci.
Jus ice 44:51-53.
[26]Amigo J, Phillips C, La eu M, Ca acedo A.(2008),The SNP o ID b owse : an
online ool o que y and display o equency da a om he SNP o ID p ojec . In J
Legal Med 2008, 122(5):435-440
[27]Budowle B, an Daal A.(2008),Fo ensically ele an SNP classes, BioTechniques
44:603-610,2008 pp. 603–610
[28]Sanchez, J.J., Phillips C., Bø s ing C., Balogh K., Bogus M., Fonde ila M.,
Ha ison C.D, Musg a e-B own E., Salas A., Synde combe-Cou D., Schneide P.,
Ca acedo A., Mo ling N. (2006), A mul iplex assay wi h 52 singlenucleo ide
polymo phisms o human iden i ica ion, Elec opho esis 27:1713-1724.
[29]Kidd, K.K., A.J. Paks is, W.C. Speed, E.L. G igo enko, S.L. Kajuna, N.J. Ka oma,
S.Kungulilo, J.J. Kim, e al. (2006), De eloping a SNP panel o o ensic iden i ica ion
o indi iduals, Fo ensic Sci. In . 164:20-32.
[30]J.J. Sanchez,C. Bø s ing,K. Balogh,B. Be ge ,M. Bogus,J.M. Bu le ,A.Ca acedo
D. Synde combe-Cou L.A. Dixon, B. Filipo i , M. Fonde ila, P. Gill, C.D. Ha ison,
C. Hoho , R. Huell, B. Ludes, W. Pa son, T.J. Pa sons,E. Pe ko ski,C. Phillips,
H. Schmi e , P.M. Schneide , P.M. Vallone, N. Mo ling (2008),Fo ensic yping o
au osomal SNPs wi h a 29 SNP-mul iplex-Resul s o a collabo a i e EDNAP exe cise,
Fo .Sci.In . Gene . 2:176-183
[31]Cos a G.,Da io P., Lucas I. Ribei o T., Espinhei a R., Geada H.(2008),Au osomal
SNPs in pa e ni y in es iga ion. Fo .Sci.In . Gene . Suppl. Se ies 1 :507–509
INTRODUCTION
80
[32]Coble, M.D., R.S. Jus , J.E. O’Callaghan, I.H. Le manyi, C.T. Pe e son, J.A.
I win, and T.J. Pa sons (2004),Single nucleo ide polymo phisms o e he en i e
m DNA genome ha inc ease he powe o o ensic es ing in Caucasians,In . J. Legal
Med.118:137-146.
[33] Allan F. McRae, Enda M. By ne, Zhen Zhen Zhao, G an W. Mon gome y, and
Pe e M. Vissche (2008),Powe and SNP agging in whole mi ochond ial genome
associa ion s udies,Genome Res. 18(6): 911–917.
[34]F udakis, T., K. Venka eswa lu, M.J. Thomas, Z.Gaskin, S. Ginjupalli, S. Gun u i,
V. Ponnuswamy, S. Na a ajan, and P.K. Nachimu hu. (2003),A classi ie o he SNP-
based in e ence o ances y,J. Fo ensic Sci. 48:771-782.
[35]Phillips C, Salas A, Sánchez JJ, Fonde ila M, Gómez-Ta o A, Al a ez-Dios J,
Calaza M, de Cal MC, Balla d D, La eu MV, Ca acedo A , SNP o ID Conso ium.
(2007),In e ing ances al o igin using a single mul iplex assay o ances y in o ma i e
ma ke SNPs. Fo ensic Sci In Gene .1(3-4):273-80.
[36]F udakis, T. N.(2007),Molecula Pho o i ing: P edic ing Ances y and Pheno ype
om DNA,Academic P ess Publishe s (Else ie ), Ams e dam, Ne he lands. Edi ion -
2007-09-21
[37]G imes, E.A., P.J. Noake, L. Dixon, and A. U quha (2001), Sequence
polymo phism in he human melanoco in 1 ecep o gene as an indica o o he ed
hai pheno ype,Fo ensic Sci. In . 122:124-129.
[38]Sulem, P., D.F. Gudbja sson, S.N. S acey, A. Helgason, T. Ra na , K.P.
Magnusson, A. Manolescu, A. Ka ason, e al. (2007),Gene ic de e minan s o hai , eye
and skin pigmen a ion,Na . Gene . 39:1443-1452.
INTRODUCTION
81
[39]Sang Hong Lee, Julius H. J. an de We , Ben J. Hayes,Michael E. Godda d, and
Pe e M. Vissche (2008,,P edic ing Unobse ed Pheno ypes o Complex T ai s om
Whole-Genome SNP, Da a PLoS Gene . 4(10).
[40]F udakis, T., M. Thomas, Z. Gaskin, K. Venka eswa lu, K.S. Chand a, S.
Ginjupalli, S. Gun u i, S. Na ajan, e al. (2003). Sequences associa ed wi h human i is
pigmen a ion,Gene ics 165:2071-2083.
INTRODUCTION
82
Chap e IV
DNA PROCEDURE STANDARDIZATION
1. In oduc ion
Al hough DNA analysis in mos cou s is gene ally admissible in p inciple, he
analysis o he e idence p esen ed by o ensics labs is he a ea ha is b ough unde
ca e ul inspec ion. In many cases, judges ha e uled ha DNA e idence was no
admissible because he analysis did no ollow gene ally accep ed p inciples o
o ensic analysis. As a new echnology, DNA inge p in ing had o be ound in each o
he cou s o sa is y well-es ablished s anda ds o he admissibili y o no el scien i ic
e idence. Also, in dozens o cases p osecu o s ha e chosen o wi hd aw DNA
e idence when de ence a o neys ha e hi ed hei own o ensic expe s who aised
ques ions abou he alidi y o he e idence.
As example he DNA esul s can be uled inadmissible by he judge and
he e o e we e ne e p esen ed o he ju y. This was no because o a p oblem wi h he
scien i ic alidi y o he es , bu he s a is ics o he esul we e complica ed o
example when no sample a e a ailable om he e e ence pe son.
The eliabili y o he esul s is main ained by s ingen quali y managemen p og am,
which includes p o iciency es ing, alida ion s udies and quali y con ol p ocedu es.
Any scien i ic es which esul s in in o ma ion ha may lead o he loss o libe y o
an indi idual accused o a c ime needs o be pe o med wi h he mos ca e. DNA
yping is no excep ion. I ’s a mul i s ep echnical p ocess ha needs o be pe o med by
quali ied and e ec i ely ained pe sonnel o ensu e ha accu a e esul s a e ob ained
and in e p e ed co ec ly.
In his pe spec i e labo a o y pe sonnel mus ha e he educa ion, aining and
expe ience commensu a e wi h he examina ion and es imony p o ided.
The echnical manage o leade and examine o analys (s) mus s ay ab eas o
de elopmen s wi hin he ield o DNA yping and also o ha e a minimum o h ee
yea s o o ensic DNA labo a o y expe ience.
INTRODUCTION
89
eagen blanks, and e iden ia y samples wi h low le els o DNA. Consumables may be
con amina ed du ing he manu ac u ing and/o packaging p ocess. Con amina ion
e en s ha e shown ha hese s e ilized p oduc s can ca y DNA om indi iduals
wo king in he manu ac u ing and/o packaging p ocess.
The Fo ensic Science Se ice (FSS) has epo ed inciden s o casewo k- ela ed
STR con amina ion om s a o plas ic wa e manu ac u e s. In es iga ions ca ied ou
by he FSS p omp ed he no el es ablishmen o a endo da abase consis ing o DNA
p o iles om indi iduals employed by a ious endo s o consumable p oduc s. The
da abase has subsequen ly sou ced unknown p o iles de eloped in he labo a o y o he
manu ac u ing p ocess.
The i s inciden in he Uni ed S a es was epo ed a e DNA p o iles we e
uploaded in o he Combined DNA Index Sys em (CODIS) and subsequen ly linked
mul iple c imes ac oss mul iple s a es. A e i was de e mined ha he FSS had also
obse ed his same p o ile on mo e han one occasion, i was unde s ood ha he
p o ile mus ha e o igina ed om a consumable used in he analysis p ocess.
3) One isk o ba ch analysis is he inad e en c oss con amina ion o DNA om one
sample o ano he sample ha was p ocessed concu en ly. Gene ally con amina ion
will be om samples wi h highe concen a ions o DNA o hose wi h lowe
concen a ion.
The e a e nume ous p ocesses ha labo a o ies can es ablish o minimize he isk o
con amina ion. I is impo an o each labo a o y o assess hei speci ic needs bo h
echnically and adminis a i ely p io o es ablishing a p ocess.
Labo a o ies mus demons a e ha hey ha e a acili y ha is designed o minimize
con amina ion. This mainly includes es ic ing he mo emen o s a , equipmen , and
consumables be ween p e- and pos -ampli ica ion a eas and also:
• S a aining
• Quali y con ol es ing o eagen s and consumables
• S o age and ea men o consumables
• Implemen a ion o clean echniques

INTRODUCTION
90
Labo a o y manage s should ensu e ha all labo a o y pe sonnel a e
app op ia ely ained in he handling and p ocessing o e idence and o ende samples.
The mos e ec i e way o p o ec ing e idence om con amina ion om in es iga o s
and labo a o y s a is o use pe sonal p o ec i e equipmen (PPE), such as glo es,
gowns, and masks. In gene al, uni e sal p ecau ion me hods no only p o ec he
in es iga o and analys bu also ensu e ha he e idence is p o ec ed om
con amina ion by handle s. Nega i e con ols and eagen blanks a e c i ical quali y
con ol s eps o de ec con amina ion om eagen s. Labo a o ies should un quali y
con ol checks on eagen s p io o use in casewo k. These checks assis in de e mining
i a eagen is ee o con amina ion a ha ime. Nega i e con ols can hen be
assessed on an ongoing basis o demons a e ha hey emain con aminan ee.
Because many con amina ion e en s a e spo adic, nega i e esul s in hese con ols do
no necessa ily mean ha samples om he same ba ch a e con aminan ee.
Addi ionally, he de ec ion o con amina ion in hese con ols does no mean ha all
ba ch samples ha e been a ec ed.
Some consumables can be ea ed wi h ul a iole (UV) ligh and/o au ocla ed.
These p e en i e measu es may be use ul in limi ing con amina ion e en s e en i
some imes may no be en i ely e ec i e since hey may no pene a e all su aces o
he consumable. Some labo a o ies ha e es ablished p ocedu es whe eby a pe cen age
o consumables om each lo numbe is e alua ed p io o use in casewo k. This may
be especially use ul o labo a o ies ha ha e obse ed con amina ion suspec ed o be
om consumable p oduc s. While his app oach will no p e en con amina ion, i can
p o ide da a om any p o ile(s) de eloped du ing hese checks, which i is
ecommended ha labo a o ies s o e hei consumables in such a way as o limi
exposu e o he en i onmen and conside e ec i e p e ea men .
One p oblem wi h con amina ion is ha an indi idual may be alsely linked o
a c ime. Re e ence samples a e gene ally good quali y DNA samples and esul in
high quan i ies o ex ac ed DNA. Many labo a o ies p ocess samples in a way ha
isola es e iden ia y samples om e e ence samples du ing he sc eening, ex ac ion,
and PCR s ages. The e o e, he possibili y o con amina ing an e iden ia y sample
INTRODUCTION
91
wi h e e ence DNA is a oided. Mos con amina ion e en s in ol e small quan i ies o
DNA and he e o e will be de ec ed a lowe h eshold alues.
Labo a o ies es ablish epo ing h esholds based on hei alida ion s udies.
Because mos con amina ion is below ha h eshold, i will no be epo ed; analys s
should assess any allelic ac i i y unde he epo ing h eshold o de e mine i i could
be om con amina ion.
As s a ed abo e, nega i e con ols and eagen blanks can g ea ly assis in he
de ec ion o con amina ion. Posi i e con ols and samples om known sou ces may
also aid in he de ec ion o con amina ion. This because hey a e single-sou ce
samples o a known ype so he de ec ion o addi ional alleles may indica e
con amina ion.
I ’s known he mos likely cause o con amina ion o e idence is om he s a
in ol ed in handling o samples. So i is highly desi able ha he labo a o y main ains
a s a DNA da abase including e e yone in ol ed om collec ion o comple ion o
analysis.
And shall also be expanded o he ollowing:
• DNA p o iles om con ac o s who wo k in he labo a o y a ea
• DNA p o iles om isi o s o he labo a o y
• DNA p o iles om employees o subcon ac endo labo a o ies
The compa ison wi h his da abase can ensu e ha no con amina ion om a s a
membe is mis akenly epo ed.
I is impo an o compa e he con aminan p o iles o:
• O he samples om he same ba ch
• Samples om o he ba ches p ocessed in he same ime ame
• S a p o iles
• P e iously de ec ed con aminan p o iles
• O he pe sons in ol ed in he collec ion and handling o he e idence
INTRODUCTION
92
I he p o ile con ains oo ew alleles o e ec i ely sc een agains he abo e,
conside a ion can be gi en o boos ing he signal s eng h by using one o mo e o he
ollowing:
• Ampli ying addi ional ex ac
• Ex ending he injec ion ime
• Concen a ing he ex ac o amplicon
• Inc easing he numbe o PCR cycles
The poin a which he con amina ion has occu ed may be de e mined by
ewo king he samples in e e se in a s ep-by-s ep manne .
Al hough alleles unde he h eshold a e no epo ed in casewo k, hese should be
conside ed when pe o ming in es iga ions/co ec i e ac ions o assis in he
de e mina ion o he sou ce.
In conclusion he e a e ou s eps o aking co ec i e ac ions:
• Iden i y he p oblem
• De e mine he oo cause
• Implemen p e en i e measu es
• Documen he e en
Each e en should be documen ed and included in he lab documen a ion:
• Desc ip ion o de iciency
• Desc ip ion o oo cause o de iciency
• Desc ip ion o he impac o de iciency on pas wo k and emedial ac ion aken
• Desc ip ion o esolu ion/comple ion
INTRODUCTION
93
3. REFERENCES
[1]Balazic, J. and I. Zupanic (1999),Quali y con ol and quali y assu ance in DNA
labo a o ies: Legal, ci il and e hical aspec s, Fo ensic Sci In Suppl. no.103:S1–5.
[2]DNA Ad iso y Boa d (1998)Quali y assu ance s anda ds o o ensic DNA es ing
labo a o ies, Fo ensic Science Communica ions 2 (3).
[3]DNA Ad iso y Boa d (1999),Quali y assu ance s anda ds o con ic ed o ende
DNA da abasing labo a o ies,Fo ensic Science Communica ions 2 (3).
[4]TWGDAM (1989),Guidelines o a quali y assu ance p og am o DNA es ic ion
agmen leng h polymo phism analysis,C ime Lab Dig 16: 40-59.
[5]TWGDAM (1991),Guidelines o a quali y assu ance p og am o DNA analysis,
C ime Lab Dig 18: 44-75.
[6]TWGDAM (1993),A guide o conduc ing a DNA quali y assu ance audi ,C ime
Lab Dig 20: 8-18.
[7]TWGDAM (1994a),No es om he Technical Wo king G oup on DNA Analysis
Me hods,C ime Lab Dig 21: 9-13.
[8]TWGDAM (1994b),No es om he Technical Wo king G oup on DNA Analysis
Me hods,C ime Lab Dig 21: 69-74.
[9]TWGDAM (1995),Guidelines o a quali y assu ance p og am o DNA analysis,
C ime Lab Dig 22: 21-50.
[10]Guidelines o a P o iciency Tes ing P og am o DNA Res ic ion F agmen
Leng h Polymo phism Analysis, C ime Labo a o y Diges , 1990 Vol. 17: 59-64
INTRODUCTION
94
[11]Scien i ic Wo king G oup on DNA Analysis Me hods (SWGDAM)(2001),
T aining guidelines, Fo ensic Science Communica ions 3 (4).
[12]Unde s anding DNA E idence: A Guide o Vic im Se ice P o ide s, May 2001,
B ochu e, Na ional Ins i u e o Jus ice and O ice o Vic ims o C ime
[13] DNA-Da abase Managemen Re iew And Recommenda ion ENFSI DNA
Wo king G oup - Ap il 2010
[14]Na ional Resea ch Council,The E alua ion o Fo ensic DNA E idence,
Washing on, DC: The Na ional Academies P ess, 1996

RESULTS
95
Chap e V : RESULTS
In o de o ea adequa ely he aims o he hesis, esul s o he in es iga ion wo k ha e
been di ided in 2 di e en g oups, each including published (o in p ocess) pape s.
a) Valida ion o New STRs Mul iplex
In es iga ion was pe o med in o de o alida e a p e iously de eloped nex gene a ion
pen aplex, including he new i e ESS loci, e alua ing he STR da a in o ma i eness and
success a e on a wide ange o o ensic samples and o compa e i s pe o mance wi h he
one o o he comme cially a ailable ki s .
1.De elopmen and alida ion o a nex gene a ion-STR pen aplex, Fo ensic Sci. In .
Gene . Suppl. 2 (2009) 25-26
2.Casewo k applica ion o a s andalone pen aplex assay o ex ended-ESS STRs,
Legal Medicine (2012), in p ocess.
3. Valida ion S udy o AmpFlSTR NGM SElec ™ PCR Ampli ica ion Ki , Jou nal o
Fo ensic and Legal Medicine (2012), inp ocess
Resea ch a icle
De elopmen and alida ion o a nex gene a ion STR ESS-pen aplex
Ch is ophe Phillips
a,
*, Anna Ba ba o
b
, Luı
´s Fe nandez Fo moso
a
, Da id Balla d
c
,
Denise Synde combe Cou
c
,A
´ngel Ca acedo
a
, Ma iky La eu
a
a
Fo ensic Gene ics Uni , Ins i u e o Legal Medicine, Uni e si y o San iago de Compos ela, San iago de Compos ela, Spain
b
Depa men o Fo ensic Gene ics, SIMEF, Reggio Calab ia, I aly
c
Haema ology, ICMS, Ba s and The London, UK
1. In oduc ion
Two p oblems egula ly con on o ensic DNA analyses wi h
he ou ine use o s anda d STRs: insu ficien disc imina ion powe
and p esence o highly deg aded DNA whe e locus and allele d op-
ou can lead o complex in e p e a i e p oblems. Success wi h
highly deg aded DNA is imp o ed using sho amplicon mini-STRs.
We decided o de elop a bol -on STR pen aplex o fi e new loci,
ecommended as nex gene a ion ma ke s o he Eu opean
S anda d Se (ESS) in o de o gene a e allele equency da a
ahead o he elease o ESS ki s. The ESS-pen aplex comp ises wo
ied and es ed STRs: D12S391 and D1S1656, ha a e highly
in o ma i e bu wi h con en ional amplicon leng hs, plus h ee
mini-STRs: D2S441, D10S1248 and D22S1045 yped wi h ampli-
con size anges 74–135 bp. Space exis s in his mul iplex amongs
he agmen sizes and g een/yellow dye labels o allow addi ional
STRs o be included in u u e. As pa o he alida ion o he ESS-
pen aplex we assessed i s abili y o ampli y DNA om a ange o
deg aded casewo k samples including hai s, bones, nails and
washed bloods ains. In ou ine o ensic use he ESS-pen aplex
p o ided a aluable addi ional app oach o he analysis o
challenging DNA, e en when some s anda d STRs in comme cial
ki s ailed o we e oo weak.
2. Ma e ials and me hods
As comme cial p ime designs o he fi e new ESS STRs a e no
published we used ou o iginal p ime s o D1 and D12 [1,2]
oge he wi h hose de ailed in STRbase om he o iginal
de elope s o D2, D10 and D22 [3]. Amplicon sizes, p ime
sequences and dye labels a e ou lined in Table 1. These show ha
su ficien space exis s o inclusion o addi ional in o ma i e STRs
such as SE33 o D9S1120 [4] labeled wi h NED o VIC. Fo each STR
e e ence ladde s we e cons uc ed om sequenced alleles using
s anda d p ocedu es as p e iously desc ibed [4].
The quali y o esul s ob ained om challenging o ensic
ma e ial was e alua ed by assessing he ela i e pe o mance
and locus d op-ou o STRs in pa ial p ofiles measu ed as
pe cen age geno yping success. De ec able peaks below a p e-
sc ibed minimum signal o 100 RFU we e also eco ded.
3. Resul s and discussion
The pe cen age geno yping success a es obse ed in 49
challenging casewo k samples o Iden ifile , MiniFile and he
ESS-pen aplex a e summa ized in Fig. 1. Al hough his s udy
examined a wide ange o deg aded o ensic ma e ial, he h ee
mul iplexes showed a consis en pa e n o ela i e success. The
ESS-pen aplex showed an a e age 97.6% success (94.7% when
peaks below 100 RFU we e excluded); MiniFile an a e age 89.8%
(88.0%) and; Iden ifile 81.5% (80.8%). Clea ly calcula ing success
o he small-scale pen aplex is no comple ely compa able o
la ge mul iplexes, bu he limi ed numbe o PCR componen s
Fo ensic Science In e na ional: Gene ics Supplemen Se ies 2 (2009) 25–26
ARTICLE INFO
A icle his o y:
Recei ed 26 Augus 2009
Accep ed 27 Augus 2009
Keywo ds:
Sho andem epea
STR
Human iden ifica ion
Mul iplex PCR
Deg aded DNA
ABSTRACT
We cons uc ed a simple STR pen aplex o new loci ecommended as nex gene a ion ma ke s o he
Eu opean S anda d Se (ESS) comp ising no mal-amplicon STRs: D12S391 and D1S1656, plus mini-
amplicon STRs: D2S441, D10S1248 and D22S1045. Valida ion o he pen aplex included e alua ion o i s
abili y o ampli y DNA om a a ie y o deg aded o ensic casewo k samples. Al hough he ESS-
pen aplex was designed in he fi s ins ance o gene a e allele equency da a o supplemen exis ing
da abases o es ablished STRs, he mul iplex p o ed o be a aluable ool o he analysis o challenging
DNA when ce ain ma ke s o Iden ifile o MiniFile occasionally ailed.
ß2009 Else ie I eland L d. All igh s ese ed.
* Co esponding au ho . Tel.: +34 981 582 327; ax: +34 981 580 336.
E-mail add ess: [email p o ec ed] (C. Phillips).
Con en s lis s a ailable a ScienceDi ec
Fo ensic Science In e na ional: Gene ics Supplemen Se ies
jou nal homepage: www.else ie .com/loca e/FSIGSS
1875-1768/$ – see on ma e ß2009 Else ie I eland L d. All igh s ese ed.
doi:10.1016/j. sigss.2009.08.190
96
benefi s pe o mance and he pen aplex is an in o ma i e
supplemen o ei he Iden ifile o MiniFile wi h be e o e all
chance o success. I is in e es ing o no e ha he only ESS-
pen aplex STR showing locus d op-ou (8%) was D10S1248, while
bo h no mal-amplicon STRs wo ked almos as well as he o he
wo mini-STRs ha showed comple e success wi h all ma e ial
geno yped.
4. Conflic o in e es s a emen
None.
Re e ences
[1] M.V. La eu, C. Pes oni, M. Schu
¨ enkamp, S. Rand, B. B inkmann, A
´.Ca acedo,
A highly a iable STR a he D12S391 locus, In . J. Legal Med. 109 (1996) 134–
138.
[2] M.V. La eu, S. Ba al, A. Salas, C. Pes oni, A
´. Ca acedo, Sequence a ia ion o a
hype a iable sho andem epea a he D1S1656 locus, In . J. Legal Med. 111
(1998) 244–247.
[3] J.M. Bu le , Y. Shen, B.R. McCo d, The de elopmen o educed size STR amplicons as
ools o analysis o deg aded DNA, J. Fo ensic Sci. 48 (2003) 1054–1064.
[4] C. Phillips, A. Rod iguez, A. Mosque a-Miguel, M. Fonde ila, L. Po as-Hu ado, F.
Rondon, A. Salas, A
´. Ca acedo, M.V. La eu, D9S1120, a simple STR wi h a common
Na i e Ame ican-specific allele: o ensic op imiza ion, locus cha ac e iza ion and
allele equency s udies, Fo ensic Sci. In . Gene . 3 (2008) 7–13.
Table 1
PCR p ime designs, dye labels and amplicon sizes o he pen aplex STRs. Obse ed (obs.) allele sizes ob ained om an AB 3730xl and POP7.
STR Dye PCR p ime sequence Obs. epea numbe s Obs. sizes Ac ual sizes
D10S1248 F 6-FAM TTAATGAATTGAACAAATGAGTGAG 8 79 82
R gCAACTCTGGTTGTATTGTCTTCAT 19 123 126
D1S1656 F GTGTTGCTCAAGGGTCAACT 8 131 135
R 6-FAM c c c c c c c cc GAGAAATAGAATCACTAGGGA 19.3 181 182
D12S391 F AACAGGATCAATGGATGCAT 12 194 197
R 6-FAM TGGCTTTTAGACCTGGACTG 27.2 261 259
D2S441 F VIC CTGTGGCTCATCTATGAAAACTT 8 74 77
R gAAGTGGCTGTGGTGTTATGAT 17 112 113
D22S1045 F NED ATTTTCCCCGATGATAGTAGTCT 9 105 106
R CGGCACAGTGTGAGTGATCAC 19 135 136
Fig. 1. Pe cen geno yping success o h ee o ensic mul iplexes (Iden ifile , 15 STRs; MiniFile , 8; ESS-pen aplex, 5) in 49 challenging casewo k samples. Mul iple o e laying
poin s shown as g ey (black i 0%). Poin s wi h da k ou lines show success when excluding geno ype peaks below a p esc ibed minimum 100 RFU.
C. Phillips e al. / Fo ensic Science In e na ional: Gene ics Supplemen Se ies 2 (2009) 25–26
26
97
Else ie Edi o ial Sys em( m) o Legal Medicine
Manusc ip D a
Manusc ip Numbe :
Ti le: Casewo k applica ion o a s and-alone pen aplex assay o ex ended-ESS STRs
A icle Type: B ie Communica ion
Keywo ds: Ex ended ESS-STRs; challenging DNA; mini-STRs; D12S391; D1S1656; D2S441, D10S1248;
D22S1045
Co esponding Au ho : M . Ch is ophe Phillips,
Co esponding Au ho 's Ins i u ion: Uni e si y o San iago de Compos ela
Fi s Au ho : Anna Ba ba o
O de o Au ho s: Anna Ba ba o; Luis Fe nandez-Fo moso; Ch is ophe Phillips; Ángel Ca acedo;
Ma ia V La eu
Abs ac : Using a s and-alone pen aplex comp ising wo s anda d-leng h sho andem epea s (STRs):
D12S391 and D1S1656 plus h ee mini-STRs: D2S441, D10S1248 and D22S1045, all ecen ly adop ed
o ex end he Eu opean S anda d Se (ESS) STRs, we ha e examined he geno yping pe o mance o he
new ma ke s in 111 challenging casewo k samples. Al hough comme cial ki s now combine he i e
new STRs wi h exis ing co e loci, we ound he ESS-pen aplex we de eloped in-house pe o med be e
han bo h MiniFile (comp ising eigh minia u ised STRs) and he NGM ki ha includes he new STRs
in a 15-ma ke mul iplex . Ou indings sugges a leas pa o he imp o ed sensi i i y o ecen ly
a ailable ESS STRs can be a ibu ed o he loci hemsel es as well as applying long-s anding, obus
p ime designs ha we e i s designed o he ex ended ESS ma ke s by he labo a o ies ha
o iginally de eloped hem. The e o e he ESS-pen aplex p o ides an ideal adjunc o Iden i ile o
MiniFile o allow labo a o ies o assess he new STRs alongside exis ing s anda d loci, measu e
pe o mance wi h challenging ma e ial and gene a e popula ion equency da a ahead o a inal
decision on which addi ional STRs will ex end he econ igu ed CODIS co e se .
98
Table 1. P ime and epea numbe de ails o he i e ex ended ESS STRs yped in he ESS-pen aplex.
STR
Dye
Geno yping P ime s
Ra io in
PCR p ime
mix
Obse ed
epea s
Amplicon size ange
(including ails)
Sequencing p ime s
D10S1248
6-FAM
TTAATGAATTGAACAAATGAGTGAG
0.75 μl
7
78 (79)
CTCTGTATCCCACCCCTG
gCAACTCTGGTTGTATTGTCTTCAT
19
126 (127)
AAAGCAAACCTGAGCATTAGCC
D1S1656
6-FAM
GTGTTGCTCAAGGGTCAACT
0.75 μl
8
117 (135)
CCATATAAGTTCAAGCCTGTGTT
c c c c c c c cc GAGAAATAGAATCACTAGGGA
19.3
164 (182)
GAGAAATAGAATCACTAGGGA
D12S391
6-FAM
AACAGGATCAATGGATGCAT
0.75 μl
12
197
AGAGACTGTATTAGTAAGGCTTC
TGGCTTTTAGACCTGGACTG
27.2
259
TGGCTTTTAGACCTGGACTG
D2S441
VIC
CTGTGGCTCATCTATGAAAACTT
0.72 μl
8
76 (77)
CTGAGCCCTAATGCACCCA
gAAGTGGCTGTGGTGTTATGAT
17
112 (113)
gAAGTGGCTGTGGTGTTATGAT
D22S1045
NED
ATTTTCCCCGATGATAGTAGTCT
0.72 μl
9
104
AGCTGCTATGGGGGCTAGATT
CGGCACAGTGTGAGTGATCAC
19
134
CGGCACAGTGTGAGTGATCAC
Table 2A. Geno yping success o challenging casewo k samples analyzed wi h ESS-pen aplex (5-plex), MiniFile and Iden i ile .
The case a e age p o ile comple eness alues a e lis ed a he base o he able and mul iplex a e ages ( o all p o iles and o
hose wi h pa ial da a in a leas one mul iplex).
Table 2B. Geno yping success o a di e en se o challenging casewo k samples ( wo pa ial p o ile se s o esul s in common wi h
2A) analyzed wi h ESS-pen aplex, NGM and Iden i ile . This da a unde lies he hea maps o Fig. 1A and 1C espec i ely.
Table(s) 1 and 2
105

2A
Full p o iles
Bloods ains on wood 2
Too h - p e-mola
Nail
Bloods ains on co on 1
Sali a on adesi e ape
Bone - ecen ly deceased emu
Bone 5 yea s in e nmen 1
Ca bonized issue - 2
Hai oo - anagenic 2
Disposable azo 1
Too h wi h ca ies
Deg aded bone 1
Finge p in s 1
Swea s ains 1
Ciga e e bu 2
Finge p in s wi h DFO 1
Bone 10 yea s in e nmen 2
Deg aded bone 2
Too h
Decomposed issue
Deg aded bone 2
Finge p in s 2
Finge p in s wi h Cyano 1
Pa a in embedded issue 2
Bloods ains on co on 2
Finge p in s wi h Ninhyd in 1
Too hpick 2
Hai oo - elogenic 2
Hai oo - elogenic 1
Bone - humid en i onmen
Bone wi h pu i ied issue
Deg aded bone 1
Finge p in s wi h DFO 2
Finge p in s wi h Ninhyd in 2
Hai sha
A e age success ac oss all p o iles
A e age success when pa ial p o iles obse ed
No. o ull p o iles
1-
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
5-plex
10
0
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
80
80
80
100
100
100
100
100
80
40
0
0
80
80
80
93.
3
88.
6
50
MiniFile
10
0
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
87.5
100
100
100
75
75
75
75
50
62.5
100
100
100
0
0
0
91.
7
85.
7
50
Iden i ile
10
0
93.
3
93.
3
86.
7
86.
7
86.
7
80
80
80
80
80
80
73.
3
73.
3
73.
3
66.
7
66.
7
60
20
0
73.3
100
100
80
86.
7
73.
3
66.
7
66.
7
46.
6
40
100
73.
3
66.
7
0
0
0
80.
6
66.
7
28
a e age success o ESS/MiniFile
10
0
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
93.7
5
90
90
90
90
87.
5
87.
5
87.
5
87.
5
71.2
5
70
50
50
40
40
40
2B
Full p o iles
Epi helial cells on lea he bel
Ca bonized issue 3
Sali a s ain
Mola 5 yea s in e nmen
Bone 5 yea s in e nmen 2
Washed bloods ain on blue denim 1
Bloods ains wi h luminol
Nasal mucus
Handp in on a gun
Skull 5 yea s in e nmen
Disposable azo 2
Nail
Cla icle 5 yea s in e nmen
Ve eb a 5 yea s in e nmen
Jaw 5 yea s in e nmen
Finge p in s wi h Cyano 3
Bloods ain on blue denim
Hai oo anagenic 3
Swea h on a balacla a
Finge p in s wi h Cyano 4
Finge p in on a bulle
Hai s om cada e
Washed bloods ains (+luminol)
Hai oo - elogenic 3
Too hpick 3
Bloods ain on black denim
Medulla 5 yea s
Finge p in on pape
Decomposed issue
Blood on lea he shoes
Washed bloods ains (+luminol)
Finge p in s wi h Ninhyd in 3
Hai oo - elogenic 1
Too h 20 yea s in e nmen
Finge p in s wi h DFO 3
Washed bloods ains on blue denim 2
A e age success ac oss all p o iles
A e age success when pa ial p o iles obse ed
No. o ull p o iles
61-
77
78
79
80
81
82
83
84
85
86
87
88
28
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
54
109
110
111
5plex
10
0
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
93.
3
100
100
100
100
93.
3
100
90
80
83.
3
80
100
90
80
80
60
97.
3
95.
3
52
NGM
10
0
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
93.
3
93.
3
100
93.
3
100
87.
5
95
93.
3
93.
3
87
87.
5
86.
7
86.
7
86.7
80
100
80
65
73.
3
80
45
95.
3
91.
9
44
Iden i ile
10
0
95
95
93.
3
93.
3
93.
3
93.
3
93.
3
93.
3
93.
3
90
87.
5
86.
7
86.
7
86.
7
86.
7
93.
3
93.
3
80
86.
7
75
90
75
75
73.
3
73
75
66.
7
73.
3
73.3
75
50
30
53.
3
45
30
20
86.
7
77.
0
26
a e age success o 5-
plex/ESS/MiniFile
10
0
98.
3
98.
3
97.
8
97.
8
97.
8
97.
8
97.
8
97.
8
97.
8
96.
7
95.
8
95.
6
95.
6
95.
6
95.
6
95.
5
95.
6
93.
3
93.
3
91.7
90.
3
90.
0
89.
4
88.
9
86.
6
85.
3
84.
4
83.
3
80.0
79.
4
76.
7
70.
0
69.
4
66.
1
63.
3
41.
7
106
Figu e 1
Click he e o download high esolu ion image
107
108
Valida ion S udy o AmpFlSTR NGM SElec ™ PCR Ampli ica ion Ki
Anna Ba ba oa*,
Pa izia Co macia ,
S e ano Vo anoa,
Giacomo Falconea
aDep . Fo ensic Gene ics
S udio Indagini Mediche E Fo ensi (SIMEF)- Reggio Calab ia - I aly
*Co esponding Au ho
Email add ess: [email p o ec ed] (Anna Ba ba o)
Tel. +39 0965891184 - Fax +39 0965891125
*Ti le Page (WITH Au ho De ails)
109
Valida ion S udy o AmpFlSTR NGM SElec ™ PCR Ampli ica ion Ki
1.In oduc ion
The AmpFLSTR NGM SElec ™ is a nex gene a ion ki de eloped by Applied Biosys ems ha con ains he
5 new loci speci ied in he ecen ly expanded Eu opean S anda d Se o Loci(ESS) oge he wi h he
emaining ma ke s om he SGM Plus® ki , plus he highly disc imina ing SE33. This pe mi s exchange o
da a wi h se e al cen al Eu opean coun ies using SE33 ou inely. [1-9] Re o mula ed eac ion eagen s and
a g ea e numbe o loci concen a ed in he low molecula weigh egion deli e g ea e sensi i i y.
We pe o med an in e nal alida ion s udy o he NGM SElec ™ Ki in o de o e alua e some c i ical
pa ame e s as species speci ici y, sensi i i y, deg ada ion/inhibi ion s udy, mix u e sample analysis,
pe o mance on a wide a ie y o o ensic samples, acco ding o SWGDAM eccomanda ions [10-12]
2. Ma e ials and Me hods
DNA samples we e ex ac ed by P ep ile /BTA™ sys em and quan i ied using he Quan i ile ® Human
DNA Quan i ica ion ki . PCR ampli ica ion was pe o med in he GeneAmp® PCR Sys ems 2720 (Applied
Biosys ems) acco ding NGM SElec ™ PCR Ampli ica ion ki p o ocol.
PCR p oduc s we e sepa a ed and de ec ed on he AB 3130 Gene ic Analyze using ecommended condi ions
and da a analysis pe o med by GeneMappe ® IDX 1.0 so wa e (Applied Biosys ems).
2.1 Sensi i i y S udy
DNA quan i y a ec s yping esul s: oo much DNA can esul in o scale da a and incomple e A nucleo ide
addi ion while ex emely low quan i y can p oduce unbalanced ampli ica ion .
Se ial wo- old dilu ions o 007 human con ol DNA we e made o gi e inal concen a ions om 0.5 ng o
0.01 ng pe eac ion. DNA dilu ions we e es ed in eplica es and assessed o he numbe o alleles de ec ed,
in a-colou balance and he e ozygo e balance. Full p o iles we e ob ained ep oducibly wi h 0.016 ng o
inpu DNA.
2.2 Inhibi ion S udy
Inhibi o s a e o en co-ex ac ed and co-pu i ied wi h he DNA and subsequen ly in e e es wi h PCR by
inhibi ing polyme ase ac i i y.
Two se ies o es samples we e o mula ed, con aining 1ng o 007 DNA Con ol oge he wi h inc easing
concen a ions o haema in as PCR inhibi o (10,50,100,150,200,250 uM).
Resul s we e eliable and ull p o iles we e ob ained ill o he highes concen a ions o inhibi o es ed.
Fig.1 Resul s om Sensi i i y S udy
Fig.2 Resul s om Inhibi ion S udy
2.3 Deg ada ion S udy
As he a e age size o deg aded DNA app oaches he size o he a ge sequence, he amoun o PCR p oduc
gene a ed is educed because o he educed numbe o in ac empla es in he size ange necessa y o
ampli ica ion
*Blinded Manusc ip (WITHOUT Au ho De ails)
110

Con ol DNA 007 was ea ed wi h inc easing concen a ion o DNase I (2,4,6,8U) o simula e DNA
deg ada ion. The longe loci g adually disappea as he amoun o DNase I inc eases bu he 3 new miniSTR
(D10S1248, D22S1045 and D2S441) ampli y success ully e en a 6U DNase.
Fig.3 Resul s om Deg ada ion S udy
2.4 Species Speci ici y S udy
Nonhuman DNA may be p esen in o ensic casewo k samples. 27 species (Go illa, Chimpanzee, Amad iade,
Macaque,Fox, Gazelle, Puma, Ox, Sheep, Ho se, Goa , Ho se, Rabbi , Jagua , Tu key, Dog, Raccoon,
Chicken, Ca , Pig, Rape, Fish, Ram, Ha e, Hippo, Pan he , Snake) we e es ed. Chimpanzee and Go illa
DNA samples p oduced pa ial p o iles, while Macaque DNA p oduced a s ong Amelogenin-X peak and
wo small ou -o -ma ke - ange peaks in PET. Among non-p ima es, only Ho se DNA p oduced a 96-bp
agmen nea he Amelogenin locus in he VIC® dye. The o he animals did no yield de ec able p oduc s.
Resul s a e ou lined in Table 1.
Table 1 Resul s om Species Speci ici y S udy
2.5 Mix u e s udies
Fo ensic casewo k samples may con ain DNA om mo e han one indi idual. The e o e, i is essen ial o
ensu e ha he DNA yping sys em is able o de ec DNA mix u es.
Mix u es o wo known DNA samples ( om sali a) we e examined a a ious a ios (1:1, 1:3, 1:7, 1:10
1:15). The o al amoun o genomic inpu DNA mixed a each a io was 1 ng.
De ec ion o ull p o iles o he mino con ibu o was possible ill o a io 1:10 , while 1:15 a ios esul ed
in pa ial p o iles o he mino componen .
Fig4 Resul s om Mix u e s udies
2.6 Casewo k samples S udy
The abili y o ob ain esul s om DNA eco e ed om biological samples deposi ed on a ious subs a es
and subjec ed o a ious en i onmen al and chemical insul s has been documen ed analyzing a wide a ie y
o casewo k samples (blood, sali a spe m s ains, washed bloods ains, cada e ic issues, bones, ee h, p in s,
swea ). DNA was han ampli ied in duplica e using AmpFlSTR Iden i ile ™ (28cycles) and NGM Selec ™
(29cycles). The quali y o STRs p o iles ob ained has been e alua ed conside ing peaks balance, p e e en ial
ampli ica ion, allelic d op-ou ,e c Geno yping pe o mance o NGM Selec ™ and Iden i ile ™ has been
compa ed in 20 casewo k challenging samples and esul s a e summa ized in a hea map.(Fig.4).
NGM SElec geno yping on challenging samples was mo e sensi i e han Iden i ile wi h 7 mo e comple e
p o iles ( 81,76 % success s. 42,5%)
Samples wi h low DNA (<100pg) p oduced no p o iles o e y li le geno yping in o ma ion wi h
Iden i ile ™ ki , while hey ga e success ul ampli ica ion o some loci by NGM™ . The e o e, e en his
pa ial NGM™ ki p o ile we e in o ma i e because include he 5 ESS new loci.
Di e en kind o samples a almos he same DNA concen a ion showed di e en yping success.
This means he na u e o he e idence and i s s o ing condi ion (i.e. en i onmen al ac o s) ha e a big impac
on inal esul s.
Fig.5 Hea map showing p o ile comple eness o de ed, le o igh , bes o wo s
111
The indi idual pe o mance o each STR in bo h ki s a e examined and he a e age a e o success o each
locus is epo ed in Fig.6: CSF1PO, acco ding o i s size, showed he lowes success (20%), while he 2 mini
D22S1045 and D2s441 we e he mos success ul loci (97,5%).
Fig.6 A e age a e o success o each locus
3.Conclusions
Resul s o ou alida ion s udy demons a e ha NGM SElec ™ ki is a eliable mul iplex well sui ed o
yping a wide a ie y o o ensic samples. I shows imp o ed pe o mances, especially in ega ds o i s
sensi i i y and g ea e ole ance o high le els o PCR inhibi o s, allowing maximum eco e y o in o ma ion
om di icul samples,p oducing use ul da a e en when wo king wi h e y ew DNA.
STRs p o iles by NGM™ we e gene ally be e balanced han Iden i ile ™ one showing clea baseline, less
noise and PCR a e ac s. This con i ms NGM™ mul iplex shows a obus PCR chemis y an he imp o ed
pe o mance eques ed by he o ensic communi y o challenging casewo k samples as well as pa e ni y
es ing . [13]
4. E hical s anda ds
The s udy desc ibed in he p esen pape ha e been ca ied ou using samples aken om people whe e
in o med consen had been p e iously ob ained o esea ch s udies in acco dance wi h I alian Law D.Lgs.
196/2003 and o app o ed SIMEF UNI EN ISO 17025 p ocedu e.
5. Con lic o in e es
None
6. Re e ences
[1] La eu M.V., Pes oni C, Schü enkamp M., Rand S., B inkmann B., Ca acedo A., A highly a iable STR
a he D12S391 locus, In J Legal Med. 109(3) (1996) 134-138.
[2] La eu M.V., Ba al S.,. Salas A, Pes oni C., Ca acedo A., Sequence a ia ion o a hype a iable sho
andem epea a he D1S1656 locus. In J Legal Med. 111(5) (1998) 244-247.
[3] Wenda S., Daube E. M.,. Schwa z M, Jungbaue C.,. Wei ich V, Wegene R. and. May W. R, ACTBP2
(alias ACTBP8) is localized on ch omosome 6 (band 6q14), Fo ensic Sci. In . Volume 148, Issues 2-3, 10
Ma ch 2005, Pages 207-209
[4] Coble M.D., Bu le J.M., Cha ac e iza ion o new miniSTR loci o aid analysis o deg aded DNA, J.
Fo ensic Sci. 50 (2005) 43–53.
[5] Olaisen B., Bä W., B inkmann B., Budowle B.,. Ca acedo A, Gill P, Lincoln P., May WR, DNA
ecommenda ions 1997 o he In e na ional Socie y o Fo ensic Gene ics.Vox Sang. 1998;74(1):61-3.
[6] Gill P., Fe eday L., Mo ling N., Schneide P.M., The e olu ion o DNA da abases ecommenda ions o
new Eu opean STR loci, Fo ensic Sci. In . 156 (2006) 242–244.
[7] Gill P., Fe eday L., Mo ling N., Schneide P.M, New mul iplexes o Eu ope. Amendmen s and
cla i ica ion o s a egic de elopmen , Fo ensic Sci. In . 163 (2006) 155–157.
[8] Bu le J. M., Coble M.D.,Rega ding nomencla u e o new miniSTR locus D10S1248, J. Fo ensic Sci. 52
(2007) 494.
112
[9] Bu le J.M and Coble M.D, Au ho s' Response o Le e o Edi o ega ding nomencla u e o new
miniSTR locus D10S1248]. J. Fo ensic Sci. 52 (2007) 494
[10]Scien i ic Wo king G oup on DNA Analysis Me hods (SWGDAM),Re ised Valida ion Guidelines,
Fo ensic Sci. Communica ions (2004) 6(3);
[11] Spa kes R., Kimp on C.,. Wa son S, Old oyd N., Clay on T., Ba ne L. ,A nold J., Thompson C., Hale
R., Chapman J., U quha A. and Gill P., The alida ion o a 7-locus mul iplex STR es o use in o ensic
casewo k. (I). Mix u es, ageing, deg ada ion and species s udies. In . J. Legal Med.109 (1996) 186–194.
[12]Spa kes R., Kimp on C., Gilba d S., Ca ne P., Ande sen J., Old oyd N., Thomas D.,U quha A., and
Gill P., The alida ion o a 7-locus mul iplex STR es o use in o ensic casewo k. (II), A i ac s, casewo k
s udies and success a es. In . J. Legal Med.109 (1996)195–204
[13] Sp eche C.J, McLa en R.S., Rabbach D., K enke B., Ensenbe ge M.G., Fulme P.M. , Downey L.,
McCombs E., S o s D.G., Powe Plex1 ESX and ESI Sys ems: A sui e o new STR sys ems designed o mee
he changing needs o he DNA- yping communi y, Fo ensic Sci. In . Gene . Supplemen Se 2 (2009) 2–4
113
Table 1: Resul s om Species Speci ici y S udy
Animal DNATes ed
PCR p oduc s: size e e ed o he close peak in he
human ange
Amad iade
178 bp (Fam)= allele 17 locus WA
246 bp (Fam) = allele 19 locus D16
101 bp (Joe) = allele X locus Amelogenin
219 bp (Joe)= allele 32.2 locus D21
Go illa,
chimpanzee
165 bp (Fam) = allele 15 locus WA
101 bp (Fam) = allele 14 locus D10
156 bp (Pe ) = allele 17 locus D3
101 bp (Joe) = allele X locus Amelogenin
149 bp (Joe) = allele 14 locus D8
204 bp (Ned) = allele 9.3 locus TH01
Macaque
97 bp (Fam) = ou ange locus D10
101 bp (Joe) = allele X locus Amelogenin
170 bp (Joe) = ou ange locus D3
Ho se
96 bp (Joe) = ou ange locus Amelogenin
Fox, Gazelle, Puma, Ox, Sheep, Ho se,
Goa , Rabbi , Jagua , Tu key, Dog,
Raccoon, Chicken, Ca , Pig, Rape, Fish,
Ram, Ha e. Hippo, Pan he , Snake.
no PCR p oduc s
Table1
114
RESULTS
120
b) Popula ion S udy o o ensic s a is ical e alua ions
We s udied he a iabili y in Medi e anean A ea in o de o c ea e a use ul popula ion
da abase, including he well es ablished 15 au osomal STRs oge he wi h he 5 new ESS,
he SE33 and some sex linked STRs ou inely used in o ensics. In addi ion i has been
e alua ed he a iabili y o he 52 SNPplex ecen ly in oduced o o ensic applica ions.
1. Valida ion o a la ge I alian Da abase o 15 STR loci, Fo ensic Sci In . 156
(2006):266-268.
2. Allele equencies o 20 STRs om No hwes Spain (Galicia), Fo ensic Sci. In .
Gene . 6 (2012) 149–150.
3. Dis ibu ion o allele equencies o 20 STRs loci in a popula ion sample om
Calab ia, Sou he n I aly, Fo ensic Sci. In . Gene . 6 (2012) 137–138.
4.,Va iabili y o SE33 Locus in 2 Medi e anean Popula ions, Jou nal o Fo ensic and
Legal Medicine, (2012) inp ocess
5. Dis ibu ion o 8 X ch omosomal STR loci in an I alian popula ion sample
(Calab ia) Fo ensic Sci. In . Gene . (2012), doi:10.1016/j. sigen.2012.05.011
6. Gene ic sub-s uc u e in wes e n Medi e anean popula ions e ealed by 12 Y-
ch omosome STR loci. In J Legal Med. 123 (2009) 137-41.
7. Mic ogeog aphic a ia ion o Y-ch omosome haplo ypes in I aly, Fo ensic Sci. In .
Gene . Suppl. Se ies 1(2008)239–241

8. S udy abou he gene ic a iabili y o he SNP o ID 52-plex panel in I alian
popula ion samples, Fo ensic Sci. In . Gene . (2012),DOI: 10.1016/j. sigen.2012.07.002

Announcemen o popula ion da a
Valida ion o a la ge I alian Da abase o 15 STR loci
Sil ano P esciu ini
a,1,
*, Nicole a Ce i
b,2
, S e ania Tu ina
c,2
, Benede o Penna o
a
,
Milena Alu
`
d
, Alessio Asmundo
e
, Anna Ba ba o
, Ila ia Boschi
g
, Lo edana Buscemi
h
,
Luciana Caenazzo
i
, Eugenia Ca ne ali
j
, Domenico De Leo
c
, Cosimo Di Nunno
l
,
Ranie i Domenici
m
, Michela Maniscalco
n
, Gab iella Peloso
o
, Susi Pelo i
p
,
And ea Piccinini
q
, Daniele Podini
, Ugo Ricci
s
, Ca lo Robino
, Luigi Sa a o
u
,
And ea Ve zele i
b
, Ma ina Ven u i
, Ad iano Tagliab acci
h,3
a
Cen e o S a is ical Gene ics, SS Abe one e B enne o 2, 56127 Pisa, I aly
b
Depa men o Su ge y, Radiology and Fo ensic Medicine, Uni e si y o B escia, I aly
c
Depa men o Medicine and Public Heal h, Uni e si y o Ve ona, I aly
d
Depa men o Mo phological and Fo ensic Sciences, Uni e si y o Modena, I aly
e
Ins i u e o Legal Medicine, Uni e si y o Messina, I aly
Depa men o Fo ensic Gene ics SIMEF, Reggio Calab ia, I aly
g
Ins i u e o Legal Medicine, Ca holic Uni e si y, Rome, I aly
h
Chai o Legal Medicine, Uni e si y o Ancona, I aly
i
Depa men o En i onmen al Medicine and Public Heal h, Uni e si y o Pado a, I aly
j
Depa men o Su ge y and Fo ensic Sciences, Uni e si y o Pe ugia and Sec ion o Legal Medicine, Hospi al o Te ni, I aly
l
Depa men o In e nal Medicine, Uni e si y o Ba i, I aly
m
Depa men o Neu osciences, Uni e si y o Pisa, I aly
n
And os Cen e s l, Pale mo, I aly
o
Depa men o En i omen al Medicine and Public Heal h., Uni e si y o Pa ia, I aly
p
Depa men o Medicine and Public Heal h, Sec ion o Legal Medicine, Uni e si y o Bologna, I aly
q
Ins i u e o Legal Medicine, Uni e si y o Milan, I aly
Genoma s l, Roma, I aly
s
Cen e o Medical and Molecula Gene ics, Hospi al ‘‘A. Meye ’’, Flo ence, I aly
Depa men o Ana omy, Pha macology and Legal Medicine, Uni e si y o Tu in, I aly
u
Ra.C.I.S., Sec ion o Biology, Messina, I aly
Depa men o Biomedical Sciences, Sec ion o Legal Medicine, Uni e si y o Fe a a, I aly
Recei ed 14 Decembe 2004; ecei ed in e ised o m 2 Ma ch 2005; accep ed 2 Ma ch 2005
A ailable online 22 Ap il 2005
Abs ac
Resul s om a collabo a i e exe cise wi h p o iciency es ing conduc ed by 20 I alian labo a o ies on he 15 loci included in
he Iden i ile
1
ki we e analyzed by allele sha ing me hods and by s anda d popula ion gene ics es s. The alida ed da abase,
www.else ie .com/loca e/ o sciin
Fo ensic Science In e na ional 156 (2006) 266–268
* Co esponding au ho . Tel.: +39 050 2213797; ax: +39 050 2213524.
E-mail add ess: [email p o ec ed] (S. P esciu ini).
1
Responsible o da a analysis.
2
Exe cise coo dina o .
3
P esiden o he GeFI.
0379-0738/$ – see on ma e #2005 Else ie I eland L d. All igh s ese ed.
doi:10.1016/j. o sciin .2005.03.001
121
including abou 1500 subjec s, was me ged wi h ha o a p e ious exe cise conduc ed on nine loci, and he esul ing allele
equencies, subdi ided by I alian egion, we e published on-line.
#2005 Else ie I eland L d. All igh s ese ed.
Keywo ds: Iden i ile STR; Da abase alida ion; Popula ion da a
Popula ion: Twen y labo a o ies sca e ed a ound I aly
(16 om hospi als/uni e si ies, h ee om p i a e compa-
nies, one om a na ional c iminal jus ice se ice) yped 41–
197 un ela ed subjec s o bo h sexes bo n in hei egion,
o aling 1541 indi iduals.
Ex ac ion: All labs bu one ex ac ed a leas pa o
DNA samples om blood; sali a was also used as a sou ce
by 11 labs and h ee labs indica ed o he addi ional sou ces.
Ex ac ion me hods a ied by labo a o y; mos labs used
Chelex-100, o he s indica ed Qiagen, and h ee used phenol–
chlo o o m; o he comme cial ki s we e also indica ed
(Ame sham, P omega, Epicen e, Mac/Nag).
PCR: The Iden i ile
1
ki (Applied Biosys ems) was
used by 12 labs; he combina ion o P o ile Plus
1
+ SGM
Plus
1
+ G een
TM
I (Applied Biosys ems) was used by wo
labs, and one lab used a cus om mul iplex combina ion; ou
labs used he combina ion P o ile Plus
1
+ Co ile
1
(Applied Biosys ems, 13 loci).
Typing: Elec opho esis was ca ied ou using i e-colo
capilla y sepa a ion by 12 labs, whe eas six used a ou -colo
sepa a ion appa a us. Two labs used e ical gels. Allele call
was ca ied ou by he Geno ype
1
so wa e (Applied
Biosys em) by 16 labs, whe eas ou used isual compa ison
wi h ladde .
Analysis o da a: Allele sha ing be ween pai s o indi-
iduals wi hin local da ase s was analyzed wi h he Excel
wo kbook AlleleSha ingShee .xls, and allele sha ing among
he en i e da abase wi h he p og am AlleleSha ingMa-
c o.xls (bo h a e a ailable a h p://s a gen.dps.unipi.i /
downloads/). Exac es s o Ha dy–Weibe g (HW) equili-
b ium, F
ST
analysis and es s o popula ion di e en ia ion
we e pe o med by A lequin 2000 [3]. Homozygosi y es
was pe o med by Chi-squa e.
Resul s: Da a o labo a o ies om he same egion we e
me ged. Allele equencies we e a ailable o 12 (ou o 20)
I alian egions om no h, cen e and sou h, oge he ep e-
sen ing 77% o he en i e I alian popula ion (2001 census
[1],Fig. 1). Da a om a p e ious GeFI collabo a i e exe cise
[2], which included nine o he 15 loci examined he e, we e
c osschecked agains he new da abase; he epea ed samples
we e disca ded, and he wo da abases we e me ged. Thus,
he inal published ables (h p://www.ge i- o ensicdna.i )
include nine loci yped in abou 2800 indi iduals and six
loci yped in mo e han 1500 indi iduals.
Quali y con ol: Blind yping o wo s ains p o ided by
he o ganizing commi ee.
O he ema ks: Allele sha ing analysis allowed co ec -
ing local da abases o duplica e eco ds and p esence o
possibly ela ed indi iduals; global allele sha ing analysis
highligh ed wo pai s o indi iduals yped independen ly by
di e en labo a o ies. Analysis o ou lie geno ypes ( hose
wi h e y low HW o con ingency- able expec a ions)
allowed co ec ing o ypos. One lab sample ha emained
ou o HW equilib ium o a locus e en a e applying he
Bon e oni co ec ion was disca ded. Allele equency dis-
ibu ions o 9 o he 15 loci ha e al eady been compa ed
ac oss di e en I alian s udies [2]. The o he six loci showed
equencies consis en wi h hose published in he ollowing
epo s ( om g oups no pa icipa ing in he p esen exe -
cise): D2S1338 [4], D16S539 [5], D19S43 [6], CFS1PO–
TH01–TPOX [7]. The le el o gene ic di e en ia ion among
egions was low a all loci, so ha he o e all allele e-
quencies can be used in gene al o ensic analyses in I aly.
This pape ollows he guidelines o publica ion o
popula ion da a eques ed by he jou nal [8].
Re e ences
[1] ISTAT - 148censimen o gene ale della popolazione e delle
abi azioni 2001. Popolazione legale (ISBN: 88-458-1069-0)
Roma, 2003.
S. P esciu ini e al. / Fo ensic Science In e na ional 156 (2006) 266–268 267
Fig. 1. Map o I aly showing egional bounda ies. Numbe s a e
sample sizes o he published da abase.
122
[2] S. P esciu ini, F. Ciampini, M. Alu
`, N. Ce i, M. Dobosz, R.
Domenici, G. Peloso, S. Pelo i, A. Piccinini, E. Ponzano, U.
Ricci, Ad iano Tagliab acci, J.E. Baley-Wilson, F ancesco
De S e ano and Vincenzo Pascali. Allele sha ing in i s -deg ee
and un ela ed pai s o indi iduals in he GeFI AmpFlSTR
1
P o ile Plus
TM
da abase, Fo ensic Sci. In . 131 (2003) 85–
89.
[3] S. Schneide , D. Roessli, L. Exco ie , A lequin (Ve sion 2000):
A So wa e o Popula ion Gene ics Da a Analysis, Gene ics
and Biome y Labo a o y, Uni e si y o Gene a, Swi ze land,
2000.
[4] L. Ga o ano, M. Pizzamiglio, F. Dona o, F. Biondi, M. Rosse i,
B. Budowle, I alian popula ion da a on wo new sho andem
epea loci: D2S1338 and Pen a E, Fo ensic Sci. In . 105 (1999)
131–136.
[5] L. Ga o ano, M. Pizzamiglio, C. Vecchio, G. Lago, T. Flo is, G.
D’E ico, G. B embilla, A. Romano, B. Budowle, I alian popu-
la ion da a on hi een sho andem epea loci: HUMTH01,
D21S11, D18S51, HUMVWFA31, HUMFIBRA, D8S1179,
HUMTPOX, HUMCSF1PO, D16S539, D7S820, D13S317,
D5S818, D3S1358, Fo ensic Sci. In . 97 (1998) 53–60.
[6] L. Ga o ano, M. Pizzamiglio, G.P. Bizza o, F. Dona o, M.
Rosse i, B. Budowle, I alian popula ion da a on wo new sho
andem epea loci: D6S477 and D19S433, Fo ensic Sci. In .
101 (1999) 203–208.
[7] R. Biondo, A. Spinella, P. Mon agna, P.S. Walsh, C. Hol , B.
Budowle, Regional I alian Allele equencies a nine sho
andem epea loci, Fo ensic Sci. In . 115 (2001) 95–98.
[8] P. Lincoln, A. Ca acedo, Publica ion o popula ion da a o
human polymo phisms, Fo ensic Sci. In . 110 (2000) 3–5.
S. P esciu ini e al. / Fo ensic Science In e na ional 156 (2006) 266–268268
123
Fo ensic Popula ion Gene ics—Le e o he Edi o
Allele equencies o 20 STRs om No hwes Spain (Galicia)
Dea Si ,
Allele equencies and o ensic in o ma i eness pa ame e s o
15 es ablished au osomal STRs and 5 new ESS au osomal STRs
we e ob ained om 204 un ela ed indi iduals o No hwes Spain
(Galicia) wi h Iden ifile
1
Plus ki o Applied Biosys ems ( yping
D2S1338, D3S1358, D8S1179, D16S539, D18S51, D19S433,
D21S11, FGA, TH01, WA and Amelogenin) and an in-house
designed pen aplex yping he fi e STRs (D1S1656, D2S441,
D10S1248, D12S391 and D22S1045) adop ed o he Eu opean
S anda d Se (ESS) in 2009 [1–5]. This s udy ollowed he
guidelines o publica ion o o ensic popula ion da a [6] as well
as he ecommenda ions o he ISFG wi h pa icula e e ence o
he cha ac e iza ion o new o ensic STR ma ke s [7,8].
Samples we e aken om pa e ni y ios whe e in o med
consen had been p e iously ob ained o ex ended popula ion
s udies and his p ocedu e was app o ed by he e hics commi ee
o he Uni e si y o San iago de Compos ela. DNA was ex ac ed
using QIAamp
1
DNA Mic o ki and QIAamp
1
DNA Blood Mini ki
ollowing he manu ac u e ’s p o ocol. DNA quan ifica ion we e
Fo ensic Science In e na ional: Gene ics 6 (2012) e149–e150
[(Fig._1)TD$FIG]
Fig. 1. Allele equency dis ibu ions obse ed o 20 STRs in he s udy popula ion o Galicians om NW Spain (ligh g ey ba s) compa ed wi h a combined Eu opean
popula ion g oup om he HGDP-CEPH genome di e si y panel comp ising: F ench om F ance; F ench Basque; Adygei om Caucasus; Russian; O cadian om UK;
Sa dinian; Tuscan; and No h I alian popula ion samples.
Con en s lis s a ailable a SciVe se ScienceDi ec
Fo ensic Science In e na ional: Gene ics
jou nal homepage: www.else ie .com/loca e/ sig
1872-4973/$ – see on ma e ß2012 Else ie I eland L d. All igh s ese ed.
doi:10.1016/j. sigen.2012.02.009
124
made using Quan ifile
TM
Human DNA Quan ifica ion Ki (AB)
using a 7500 Real-Time PCR Sys em (AB).
Elec opho esis was pe o med using a 3130xl gene ic analyze
(AB) wi h 36 cm capilla y filled wi h POP-4TM Polyme (AB). Allele
designa ions we e made ollowing manu ac u e ’s p o ocol in he
15 es ablished STRs o Iden ifile
1
Plus ki excep using 10
m
l final
PCR olume and o he 5 new ESS as p e iously desc ibed by
Phillips e al. [1].
Allele equency da a and basic o ensic s a is ics we e ob ained
wi h P omega Powe s a s so wa e [9] o Galician popula ion da a
and a e ou lined in supplemen a y Table S1. Ha dy–Weinbe g
analysis was made using A lequin e . 3.5 [10] and is summa ized
in supplemen a y Table S2. No significan de ia ions om Ha dy–
Weinbe g equilib ium we e ound.
As a poin o e e ence, allele equency da a o combined
Eu opean popula ions om he HGDP-CEPH human di e si y panel
we e ob ained using he pop.STR da abase [11] comp ising: F ench
om F ance; F ench Basque; Adygei om Caucasus; Russian;
O cadian om UK; Sa dinian; Tuscan; and No h I alian popula ion
samples. Summa y allele equencies o his popula ion g ouping
a e shown in supplemen a y Table S3. A g aphic compa ison o
allele equency dis ibu ions be ween CEPH Eu opeans and
Galicians o 20 STRs is shown in Fig. 1, indica ing e y simila
equencies in bo h popula ions. We obse ed ha ce ain alleles
a e p esen a low equency in CEPH Eu opean popula ions bu no
ound in he Galician popula ion s udied, hese a e: CSF1PO Allele:
15; D10S1248 18; D16S539 15; D19S433 13.2; D21S11 35.2;
D22S1045 9; D2S1338 11; D2S441 8, 9 and 13.3; FGA 16, 20.2 and
23.2; TH01 11, and; WA 13. In con as , h ee alleles we e
obse ed uniquely in he Galician popula ion in STR D19S433:
epea s 13.2, 20 and 23.
Obse ed he e ozygosi y is abo e 0.650 in all STRs in bo h he
Eu opean g oup and he Galician s udy popula ion excep o TPOX
ha has a alue o 0.647 in he Eu ope popula ion g oup. The mos
in o ma i e STR in he Galician popula ion is D12S391 wi h a
disc imina ion index o 0.900, nea iden ical o he mos
in o ma i e STR in he Eu opean popula ion g oup: D1S1656 ha
gi es a disc imina ion index o 0.898.
Appendix A. Supplemen a y da a
Supplemen a y da a associa ed wi h his a icle can be ound, in
he online e sion, a doi:10.1016/j. sigen.2012.02.009.
Re e ences
[1] C. Phillips, L. Fe nandez-Fo moso, M. Ga cia-Maga in
˜os, L. Po as, T. T edeb ink, J.
Amigo, M. Fonde ila, A. Gomez-Ta o, J. Al a ez-Dios, A. F ei e-A ada, A. Gomez-
Ca balla, A. Mosque a-Miguel, A
´. Ca acedo, M.V. La eu, Analysis o global a i-
abili y in 15 es ablished and 5 new Eu opean S anda d Se (ESS) STRs using he
CEPH human genome di e si y panel, Fo ensic Sci. In . Gene . 5 (2011) 155–169.
[2] M.V. La eu, C. Pes oni, M. Schu enkamp, S. Rand, B. B inkmann, A
´.Ca acedo,
A highly a iable STR a he D12S391 locus, In . J. Legal Med. 109 (1996)
134–138.
[3] M.V. La eu, S. Ba al, A. Salas, C. Pes oni, A
´. Ca acedo, Sequence a ia ion o a
hype a iable sho andem epea a he D1S1656 locus, In . J. Legal Med. 111
(1998) 244–247.
[4] M.D. Coble, J.M. Bu le , Cha ac e iza ion o new miniSTR loci o aid analysis o
deg aded DNA, J. Fo ensic Sci. 50 (2005) 43–53.
[5] T. Lede e , G. B aunschweige , Commen a y on: Coble MD, Bu le JM. Cha ac e i-
za ion o new miniSTR loci o aid analysis o deg aded DNA, J. Fo ensic Sci. 50
(2005) 43–53, J. Fo ensic Sci. 52 (2007) 493 and 494.
[6] P. Lincoln, A
´. Ca acedo, Publica ion o popula ion da a o human polymo phisms,
Fo ensic Sci. In . 110 (2000) 3–5.
[7] W. Ba
¨ , B. B inkmann, B. Budowle, A
´. Ca acedo, P. Gill, P. Lincoln, W.R. May , B.
Olaisen, Fu he epo o he DNA Commission o he ISFH ega ding he use o
sho andem epea sys ems. In e na ional Socie y o Fo ensic Haemogene ics,
In . J. Legal Med. 110 (1997) 175–176.
[8] B. Olaisen, W. Ba
¨ , B. B inkmann, B. Budowle, A
´. Ca acedo, P. Gill, P. Lincoln, W.R.
May , S. Rand, DNA ecommenda ions 1997 o he In e na ional Socie y o
Fo ensic Gene ics, Vox Sang. 74 (1998) 61–63.
[9] P omega Powe s a s Download Page: h p://www.p omega.com/gene icid ools/
powe s a s/.
[10] L. Exco fie , H.E. Lische , A lequin sui e e 3.5: a new se ies o p og ams o
pe o m popula ion gene ics analyses unde Linux and Windows, Mol. Ecol.
Resou . 10 (2010) 564–567.
[11] J. Amigo, C. Phillips, A. Salas, L. Fe nandez-Fo moso, A
´. Ca acedo, M.V. La eu,
pop.STR—an online popula ion equency b owse o es ablished and new o-
ensic STRs, Fo ensic Sci. In . Gene . Suppl. Se ies 2 (2009) 361–362.
L. Fe nandez-Fo moso
C. Phillips
*
A. Rod iguez
R. Cal o
Fo ensic Gene ics Uni , Ins i u e o Legal Medicine, Uni e si y o
San iago de Compos ela, San iago de Compos ela, Galicia, Spain
A. Ba ba o
a,b
a
Fo ensic Gene ics Uni , Ins i u e o Legal Medicine, Uni e si y o
San iago de Compos ela, San iago de Compos ela, Galicia, Spain
b
S udio Indagini Mediche E Fo ensi (SIMEF), Reggio Calab ia, I aly
M.V. La eu
Fo ensic Gene ics Uni , Ins i u e o Legal Medicine, Uni e si y o
San iago de Compos ela, San iago de Compos ela, Galicia, Spain
A
´. Ca acedo
a,b
a
Fo ensic Gene ics Uni , Ins i u e o Legal Medicine, Uni e si y o
San iago de Compos ela, San iago de Compos ela, Galicia, Spain
b
Genomics Medicine G oup, CIBERER, Uni e si y o San iago de
Compos ela, Galicia, Spain
*
Co esponding au ho . Tel.: +34 981 582 327;
ax: +34 981 580 336
E-mail add ess: [email p o ec ed] (C. Phillips)
8 No embe 2011
Fo ensic Popula ion Gene ics—Le e o he Edi o / Fo ensic Science In e na ional: Gene ics 6 (2012) e149–e150
e150
125

Le e o he Edi o
Dis ibu ion o allele equencies o 20 STRs loci in a popula ion
sample om Calab ia, Sou he n I aly
Dea Edi o ,
Allele equencies o 20 STRs including he 5 new loci
(D10S1248, D2S441, D1S1656, D12S391, D22S1045) app o ed
by he Eu opean Union Council o he expansion o he Eu opean
S anda d Se (ESS) we e calcula ed om a popula ion sample om
Calab ia in sou he n I aly using he Applied Biosys ems (AB)
AmpflSTR Iden ifile
TM
ki plus a nex -gene a ion 5-plex we
p e iously de eloped as a supplemen a y assay o Iden ifile
TM
[1–6].
Blood o sali a samples we e collec ed om un ela ed heal hy
dono s belonging o he Calab ian popula ion o a leas 3
gene a ions. Samples we e aken om dono s wi h p e iously
ob ained in o med consen o popula ion s udies in acco dance
wi h I alian Law D.Lgs. 196/2003 and app o ed by SIMEF ISO-
17025 p ocedu es.
DNA was ex ac ed by apid esin (Is aGene Ma ix Sys em-
Bio ad) and hen quan ified wi h he Quan ifile
TM
Human DNA
Quan ifica ion Ki using a 7300 Real Time Sys em ki [7]. PCR
amplifica ion was pe o med using he AmpFlSTR Iden ifile
TM
ki
ha amplifies he well-es ablished loci: D2S1338, D3S1358,
D8S1179, D16S539, D18S51, D19S433, D21S11, FGA, TH01,
WA, and amelogenin. We supplemen ed his analysis wi h a
pen aplex we designed o he amplifica ion o he fi e new ESS
loci: D10S1248, D22S1045, D2S441, D1S1656 & D12S391, as
p e iously desc ibed [8,3]. Posi i e and nega i e con ols we e
used du ing all amplifica ion s eps.
PCR p oduc s we e analyzed by capilla y elec opho esis wi h
an AB 3130 gene ic analyze and allele assignmen s made by
compa ison wi h Iden ifile
TM
ladde o in he case o he pen aplex
yping wi h e e ence o sequenced allelic ladde s assembled in-
house. Fo he fi e new STRs allele designa ions we e de e mined
ollowing he epea s uc u e changes no ed by Coble and Bu le
[9,10].
S a is ical pa ame e s o o ensic in e es (Dp: powe o
disc imina ion, PE: powe o exclusion, RMP: andom ma ching
p obabili y, e c.) we e calcula ed using Powe S a s .1.2 so wa e
[11]. Ha dy–Weinbe g equilib ium and o he popula ion pa am-
e e s we e calcula ed using A lequin so wa e .3.1. [12].
Allelic equencies o all wen y STRs we e compa ed o
p e iously published popula ion da a. No significan di e ences
we e ound in compa ison wi h o he Eu opean popula ion da a
[13–18]. No significan de ia ions om Ha dy–Weinbe g expec-
a ions we e ound (p>0.05). In all STRs excep TPOX he obse ed
he e ozygosi y was g ea e han 0.7, wi h he highes alue in
D1S1656. Wi h he excep ion o D12S391 indi idual STRs showed
a low exclusion powe (PE) bu he combined PE eached
0.99999999. Combined RMP using 20 loci was calcula ed o be
4.47 10
24
, he e o e used oge he hese wen y loci can
dis inguish samples wi h a p obabili y o 99.99999%.
Allele equencies and he esul ing s a is ical pa ame e s a e
gi en in Tables 1–2 a ailable as e-componen s. A popula ion
compa ison was made be ween he I alian samples desc ibed he e
and p e iously a ailable da a o Galicia (NW Spain) and he
analysis is ou lined in Table 3. Allele equencies om hese wo
sou he n Eu opean popula ions we e e y simila o each o he
STRs s udied.
The s udy labo a o y has ISO17025 acc edi a ion and pa ici-
pa es in he quali y con ol/p oficiency es ing o he GEP-ISFG WG
(www.gep-is g.o g). This pape ollows he guidelines o publica-
ion o popula ion da a eques ed by he jou nal. [19].
Appendix A. Supplemen a y da a
Supplemen a y da a associa ed wi h his a icle can be ound, in
he online e sion, a doi:10.1016/j. sigen.2012.02.006.
Re e ences
[1] M.V. La eu, C. Pes oni, M. Schu
¨ enkamp, S. Rand, B. B inkmann, A. Ca acedo, A
highly a iable STR a he D12S391 locus, In . J. Legal Med. 109 (1996) 134–138.
[2] M.V. La eu, S. Ba al, A. Salas, C. Pes oni, A. Ca acedo, Sequence a ia ion o a
hype a iable sho andem epea a he D1S1656 locus, In . J. Legal Med. 111
(1998) 244–247.
[3] M.D. Coble, J.M. Bu le , Cha ac e iza ion o new miniSTR loci o aid analysis o
deg aded DNA, J. Fo ensic Sci. 50 (2005) 43–53.
[4] B. Olaisen, W. Ba
¨ , B. B inkmann, B. Budowle, A
´. Ca acedo, P. Gill, P. Lincoln, W.R.
May , S. Rand, Vox Sang. 74 (1998) 61–63.
[5] P. Gill, L. Fe eday, N. Mo ling, P.M. Schneide , The e olu ion o DNA da abases
ecommenda ions o new Eu opean STR loci, Fo ensic Sci. In . 156 (2006) 242–
244.
[6] P. Gill, L. Fe eday, N. Mo ling, P.M. Schneide , New mul iplexes o Eu ope.
Amendmen s and cla ifica ion o s a egic de elopmen , Fo ensic Sci. In . 163
(2006) 155–157.
[7] P.S. Walsh, D.A. Me zge , R. Higuchi, Chelex 100 as a medium o he simple
ex ac ion o DNA o PCR-based yping om o ensic ma e ials, Bio echniques 10
(1991) 506–513.
[8] C. Phillips, A. Ba ba o, L. Fe nandez-Fo moso, A. Ca acedo, M.V. La eu, De elop-
men and alida ion o a nex gene a ion-STR pen aplex, Fo ensic Sci. In . Gene .
(Suppl. 2) (2009) 25–26.
[9] J.M. Bu le , M.D. Coble, Rega ding nomencla u e o new miniSTR locus
D10S1248, J. Fo ensic Sci. 52 (2007) 494.
[10] J.M. Bu le , M.D. Coble, Au ho ’s esponse o le e o edi o ega ding nomencla-
u e o new miniSTR locus D10S1248, J. Fo ensic Sci. 52 (2007) 494.
[11] A. Te eba, Tools o analysis o popula ion s a is ics, P ofiles in DNA 9 (1999) 14–
16 ( ee so wa e dis ibu ed a h p://www.p omega.com/gene icid ools).
[12] L. Exco fie , G. La al, S. Schneide , A lequin e . 3.0: an in eg a ed so wa e
package o popula ion gene ics da a analysis, E ol. Bioin o m. (Online) 1
(2005) 47–50.
[13] P.Ha ze -G ubwiese ,B.Be ge ,D. Niede wiese ,M. S einlechne ,Allele equencies
and conco dance s udy o 16 STR loci—including he new Eu opean S anda d Se
(ESS)loci-in anAus ian popula ion sample, Fo ensic Sci. In . Gene . 6 (2012) 50–51.
[14] M. A lindo, T. Lagoa, V. Ma ins, L.M. Caine
´,M.Fa
´ ima Pinhei o, Allele equencies
o six miniSTR loci in he popula ion o No he n Po ugal, Fo ensic Sci. In . Gene .
2 (2008) 379–381.
Fo ensic Science In e na ional: Gene ics 6 (2012) e137–e138
Con en s lis s a ailable a SciVe se ScienceDi ec
Fo ensic Science In e na ional: Gene ics
jou nal homepage: www.else ie .com/loca e/ sig
1872-4973/$ – see on ma e ß2012 Else ie I eland L d. All igh s ese ed.
doi:10.1016/j. sigen.2012.02.006
126
[15] V. Lopes, A. Se a, J. Game o, L. Sampaio, F. Balsa, C. Oli ei a, L. Ba is a, F. Co e-
Real, D.N. Viei a, M.C. Vide, M.J. Anjos, M. Ca alho, Allelic equency dis ibu ion
o 17 STRs om Iden ifile and Powe Plex-16 in Cen al Po ugal a ea and he
Azo es a chipelago, Fo ensic Sci. In . Gene . 4 (2009) e1–e7.
[16] F. B isighelli, C. Capelli, I. Boschi, P. Ga agnani, M.V. La eu, V.L. Pascali, A.
Ca acedo, Allele equencies o fi een STRs in a ep esen a i e sample o he
I alian popula ion, Fo ensic Sci. In . Gene . 3 (2009) 29–30.
[17] A. Be i, F. B isighelli, A. Bose i, E. Pilli, C. T apani, V. Tullio, C. F anchi, G. Lago, C.
Capelli, Allele equencies o he new Eu opean S anda d Se (ESS) loci in he
I alian popula ion, Fo ensic Sci. In . Gene . 5 (2011) 548–549.
[18] L. Fe nandez-Fo moso, C. Phillips, A. Rod iguez, R. Cal o, A. Ba ba o, M.V. La eu, A.
Ca acedo, Allele equencies o 20 STRs om No hwes Spain (Galicia), Fo ensic
Sci. In . Gene . 6 (2012) e149–e150.
[19] A. Ca acedo, J.M. Bu le , L. Gusmao, W. Pa son, L. Roewe , P.M. Schneide ,
Publica ion o popula ion da a o o ensic pu poses, Fo ensic Sci. In . Gene . 4
(2010) 145–147.
Anna Ba ba o
a,b,
*
a
S udio Indagini Mediche E Fo ensi (SIMEF), Reggio Calab ia, I aly
b
Ins i u e o Legal Medicine, Uni e si y o San iago de Compos ela,
San iago de Compos ela, Spain
Ch is Phillips
Luis Fe nandez Fo moso
Ma ia Vic o ia La eu
A
´ngel Ca acedo
Ins i u e o Legal Medicine, Uni e si y o San iago de Compos ela,
San iago de Compos ela, Spain
*Co esponding au ho a : S udio Indagini Mediche E Fo ensi
(SIMEF), Reggio Calab ia, I aly
E-mail add ess: [email p o ec ed] (A. Ba ba o)
7 Decembe 2011
Le e o he Edi o / Fo ensic Science In e na ional: Gene ics 6 (2012) e137–e138
e138
127
128
VARIABILITY OF SE33 LOCUS IN 2 MEDITERRANEAN POPULATIONS
A.Ba ba oa *
M. Cassa b
P.Co macia
J. C. G ech b
aS udio Indagini Mediche E Fo ensi (SIMEF), Reggio Calab ia , I aly
b MLS BioDNA , Paola, Mal a.
*Co esponding Au ho
S udio Indagini Mediche E Fo ensi (SIMEF)
Via Nicolò da Reggio 4, Reggio Calab ia , I aly
Fax +390965891125
Email add ess: [email p o ec ed]
*Ti le Page (WITH Au ho De ails)
129
haplo ype egional da abase and o e alua e sub-s uc u ing
o geog aphical sub-se s in his Medi e anean egion.
Ma e ials and me hods
Popula ion samples
Blood samples we e ob ained om 554 un ela ed males
belonging o se en popula ions in he wes e n Medi e a-
nean a ea (Figu e shown in ESM 1)— h ee Spanish
popula ions: Valencia (eas e n coas o he Ibe ian Penin-
sula; n=59), Majo ca (n=91) and Ibiza (n=96) (Balea ic
Islands) and ou I alian popula ions: Sicily (n=115) and
h ee popula ions om he egion o Calab ia (sou he n
I aly), Reggio Calab ia (n=97), Cosenza (n=37) and
Ca anza o (n=59). P o ocols we e app o ed by he Danish
local e hical commi ee (KF-01-037/03). DNA was
ex ac ed by using QIAamp spin columns (Qiagen, Hilden,
Ge many) ollowing he manu ac u e ’s ecommenda ions.
Y-STR yping
Ampli ica ion o he 12 Y-ch omosome STRs loci DYS19,
DYS389 I/II, DYS390, DYS391, DYS392, DYS393,
DYS385 a/b, DYS437, DYS438 and DYS439 was ca ied
ou acco ding o he ki Powe plex® Y Sys em p o ocol,
om 2 ng DNA empla e in a 10-μl inal eac ion olume,
using a GeneAmp PCR sys em 2400 The mal Cycle
(Pe kin-Elme , Wal ham, MA, USA).
Fo gene ic yping, an ABI PRISM® 3100 Gene ic
Analyse along wi h GeneScan® 3.7 and Geno ype ® . 3.7
so wa e (Applied Biosys ems, Fos e Ci y, CA, USA) we e
used. All samples we e es ed wice. Allelic designa ion was
based on compa ison o he Powe plex® Y Sys em allelic
ladde . Allele nomencla u e was acco ding o he ISFG
guidelines [16].
Sequence analysis
A new a ian allele was sequenced on bo h s ands. B ie ly,
he samples we e ampli ied using unlabelled p ime s [3],
amplicons we e pu i ied wi h a QIAquick PCR pu i ica ion
ki (Qiagen) and he sequence was de e mined using he Big
Dye® Te mina o Cycle Sequencing ki . 3.1 (Applied
Biosys ems) and an ABI PRISM® 3130 Gene ic Analyse
(Applied Biosys ems). Sequences we e aligned using he
Bioedi p og am . 7.0.5.3 [17].
Quali y con ol
P o iciency es ing o he Spanish and Po uguese Wo king
G oup o he In e na ional Socie y o Fo ensic Gene ics
(GEP-ISFG, h p://www.gep-is g.o g/) was ca ied ou as
quali y con ol.
S a is ical analysis
Allele and haplo ype equencies we e es ima ed by gene
coun ing. Haplo ype and gene di e si ies, popula ion
di e en ia ion pa ame e s (F
ST
and R
ST
) and analysis o
molecula a iance (AMOVA) we e calcula ed using
ARLEQUIN . 3.01 [11]. Disc imina ion capaci y was
calcula ed as he pe cen age o di e en haplo ypes and
haplo ype ma ch p obabili y as 1-haplo ype di e si y. All
s a is ical pa ame e s we e calcula ed o bo h minimal and
ex ended haplo ypes.
In o de o examine he ela ionship o he popula ions
s udied wi h o he neighbou ing popula ions, Reynolds’
gene ic dis ances [30], calcula ed using PHYLIP . 3.67
[12], we e used o gene a e he mul i-dimensional scaling
(MDS) plo pe o med using he SPSS . 15.0 (SPSS, Inc.,
Chicago, IL, USA).
Resul s and discussion
Allele equencies and gene di e si ies o each Y-STR o he
popula ions unde s udy a e shown in he able in ESM 2.
DYS392 and DYS438 showed bimodal dis ibu ion o allele
equencies. In DYS392, modali y was sha ed by DYS392-
11 and DYS392-13 alleles, wi h DYS392-13 he mos
common allele amongs he Spanish popula ions and
DYS392-11 he mos equen in sou he n I aly. These
esul s a e consis en wi h p e ious s udies showing a
longi udinal dec ease o equencies om he wes o he
eas o he Eu opean landscape o DYS392-13 and,
con e sely, a dec ease in he opposi e di ec ion o
DYS392-11. The Neoli hic demic di usion could explain
hese wo opposi e pa e ns, wi h he DYS392-13 allele
p esen in he p o o-Eu opean gene pool [27,28]. The clinal
equency pa e n obse ed in he DYS438 sys em, wi h
DYS438-12 as he mos equen in he Spanish and Sicilian
popula ions and DYS438-10 he mos equen in Calab ia,
could also be due o he same Neoli hic e ec .
Gene di e si ies anged om a ound 0.85 (in DYS385)
o app oxima ely 0.50 (in DYS392). Gene ally, I alian
popula ions had highe gene di e si ies han he Spanish
popula ions, ollowing he same pa e n ound in bi-allelic
Y-ch omosome ma ke s, wi h an inc easing di e si y end
om Spain o G eece, maybe due o he impac o he
a i al o haplo ypes in Eu ope om he Middle Eas [13].
Ibiza showed especially low gene di e si ies o DYS389II,
DYS390, DYS391, DYS385, DYS438 and DYS439 loci.
Ex a peaks we e ep oducibly ob ained a DYS19 and
DYS385, ep esen ing he p esence o duplica ed egions in
138 In J Legal Med (2009) 123:137–141
136

he Y-ch omosome (e.g. [2,6,19,20,32]). Duplica ions
we e obse ed in six indi iduals: a locus DYS19, alleles
13 and 14 (once) and a loci DYS385, alleles 13–14–15
(once), 13–17–18 ( wice) and 13–18–19 ( wice).
Th ee alleles no included in he Powe plex® Y allelic
ladde we e obse ed. DYS438-7 and DYS438-13 alleles
ha e been epo ed in o he popula ions (e.g. [8,23]), bu o
ou knowledge, DYS19-9 has no been epo ed be o e.
Sequence analysis (GenBank: FJ196286) con i med he
numbe o epea s a ibu ed: (TAGA)
3
agg(TAGA)
6
.
Amongs he 554 wes e n Medi e anean males analysed,
443 di e en haplo ypes we e obse ed (Table in ESM 3), o
which 372 we e only obse ed once. The o he haplo ypes
we e sha ed by wo o se en men. The mos equen
haplo ypes we e h314 (15–12–29–22–10–11–14–14,14–16–
10–12) and h356 (15–13–29–24–11–13–13–11,14–14–12–
13), bo h ound in se en men om he Ibiza popula ion bu
absen om he o he s udied popula ions.
The haplo ypes (wi hou locus DYS437, no included in he
YHR da abase) we e sea ched agains he haplo ypes in he
YHRD ( elease 18), and 149 haplo ypes we e ma ched o a
leas one YHRD sample. The mos equen haplo ypes h314
and h356 ma ched wi h h ee and six samples o Eu opean
o igin, espec i ely, in a wo ldwide da abase o 38,761
haplo ypes. I is no ewo hy ha 46 o he o he haplo ypes
(almos all om Valencia, he Balea ic Islands and Sicily)
ma ched wi h no h A ican o A ican samples. This esul is
conco dan wi h o he s udies showing A ican in luences in
hese Medi e anean popula ions (e.g. [14,15,24,35]).
Table 1shows he o ensic pa ame e s o he 12-loci
Powe plex® Y Sys em haplo ypes compa ed wi h he
di e si y alues o haplo ypes based on he nine-loci minimal
haplo ype. The o e all haplo ype di e si y only inc eased by
0.20% ( anging om 0% o Cosenza o 1.15% o Ibiza) by
using he 12-loci Powe plex® Y Sys em ins ead o he
minimal haplo ype.
The disc imina ion capaci y anged om 87.63% (Reggio
Calab ia) o 94.92% (Valencia) excep in he Ibizan
popula ion (56.25%). Ibiza also showed a educed gene ic
di e si y in p e ious gene ic s udies [24,25,37]. These
esul s a e in acco dance wi h he his o ical and demog aphic
da a o he island popula ion (an isola ed, consanguineous
popula ion wi h a educed e ec i e popula ion size) [1,22].
The e o e, he high haplo ype ma ch p obabili y in Ibiza
(1.93%) mus be aken in o accoun in o ensic p ac ice.
AMOVA analysis o he se en Medi e anean popula-
ions showed a signi ican alue (F
ST
=0.0499, P<0.0001).
Pai wise analyses (Table in ESM 4) e idenced wo
Table 1 Fo ensic pa ame e s o he se en wes e n Medi e anean popula ions s udied using he minimal and he Powe plex® Y haplo ypes
Ibiza
(n=96)
Majo ca
(n=91)
Valencia
(n=59)
Sicily
(n=115)
Ca anza o
(n=59)
Cosenza
(n=37)
R. Calab ia
(n=97)
To al
(n=554)
Minimal 9 Y-STR haplo ype
Numbe o haplo ypes 43 74 49 98 52 33 83 379
Unique haplo ypes 19 53 37 72 37 23 58 299
Haplo ype di e si y ± SD 0.9695±
0.0061
0.9927±
0.0035
0.9930±
0.0047
0.9968±
0.0018
0.9959±
0.0039
0.9925±
0.0088
0.9968±
0.0020
0.9968±
0.0006
Disc imina ion capaci y (%) 44.79 81.32 83.05 85.22 88.14 89.19 85.57 68.41
Ma ch p obabili y (%) 3.05 0.73 0.70 0.32 0.41 0.75 0.32 0.32
Powe plex 12 Y-STR haplo ype
Numbe o haplo ypes 54 82 56 103 54 33 85 443
Unique haplo ypes 30 70 49 86 43 26 68 372
Haplo ype di e si y ± SD 0.9807±
0.0050
0.9968±
0.0025
0.9982±
0.0035
0.9976±
0.0017
0.9971±
0.0037
0.9925±
0.0088
0.9972±
0.0020
0.9988±
0.0002
Disc imina ion capaci y (%) 56.25 90.11 94.92 89.57 91.53 89.19 87.63 79.96
Ma ch p obabili y (%) 1.93 0.32 0.18 0.24 0.29 0.75 0.28 0.12
-2.0
1.0
-4.0 3.0
I aly
Tunisia
Majo ca
Ibiza
Valencia
Py enees
Po ugal
Denma k
Sicily
Ca anza o
Cosenza
R.Calab ia
Balkans
Ba celona
Spain
Dimension 1
Dimension 2
Fig. 1 MDS plo based on Reynolds’dis ances (Spain [23], Py enees
[21], Ba celona [33], Po ugal [26], I aly [29], he Balkans [5], Tunisia
[9], Denma k [18], Majo ca, Valencia, Ibiza, Ca anza o, Cosenza,
Reggio Calab ia and Sicily ( his s udy))
In J Legal Med (2009) 123:137–141 139
137
signi ican ly di e en sub-se s: one wi h he Spanish
popula ions (Valencia, Ibiza and Majo ca) and ano he wi h
he Calab ian samples (Ca anza o, Cosenza and Reggio
Calab ia). Sicily was close o he I alian han o he
Spanish popula ions, al hough p esen ed signi ican di e -
ences wi h Reggio Calab ia (P<0.005). Signi ican di e -
ences be ween g oups (F
CT
=0.0603, P<0.0001) we e
ound wi h a h ee-hie a chical AMOVA pe o med g oup-
ing he popula ions acco ding o pai wise analysis esul s
(Spanish popula ions, Sicily and Calab ian popula ions).
Figu e 1shows a mul i-dimensional scaling plo whe e 15
popula ions ha e been included. The Tunisia popula ion
showed a displaced posi ion, in acco dance wi h o he s udies
ha ha e sugges ed ha he Medi e anean Sea may ha e
ac ed as a ela i e no h- o-sou h geog aphic ba ie o gene
low [4,10,28]. Wi h he excep ion o Sicily and Ibiza, he
Spanish and I alian popula ions unde s udy g ouped oge he
wi h o he Spanish and I alian samples, espec i ely. On he
one hand, Sicily p esen ed an in e media e posi ion be ween
I alian and Spanish popula ions. No consensus on he gene ic
landscape o he Sicilian popula ion has been es ablished o
da e. Whils some au ho s claim he di e en ia ion o he
Sicilian popula ion om I aly and om he wes e n Medi e -
anean basin [7,31], o he s udies indica e Sicily is closely
ela ed o o he I alian popula ions [13,15,34]. On he o he
hand, Ibiza showed a la ge dis ance om he Spanish g oup,
in acco dance wi h he ac ha Ibiza has impo an his o ical
and gene ic di e ences om o he insula and con inen al
popula ions in he wes e n Medi e anean a ea [24,25,37].
In conclusion, he esul s o he p esen s udy p o ide a
use ul Y-STR haplo ype da ase , o he wes e n Medi e -
anean egion, whe e some geog aphical and/o cul u al
isola es exis based on demog aphic, his o ical and gene ic
da a. A clea gene ic sub-s uc u e be ween popula ion
g oups (Spanish, Sicilian and Calab ian popula ions) was
obse ed. The e o e, local da abases mus be used in he
o ensic ield o co ec ly weigh he alue o he e idence
o a Y p o ile ma ch. Special ca e should be aken in male
iden i ica ion in he Ibizan popula ion, due o he e y low
disc imina ion capaci y ound o he 12 Y-STR loci
included in he Powe plex® Y Sys em.
Acknowledgemen s This wo k was pa ially suppo ed by g an s
PRDT-2003-12099 and PRDIB-2006-687872 om he Di ecció
Gene al de R+D+I (Comuni a Au ònoma de les Illes Balea s) and
by Ellen and Aage Ande sen’s Founda ion.
Re e ences
1. Ala co Von Pe all C (1981) Cul u a y pe sonalidad en Ibiza.
Edi o a Nacional, Mad id
2. Bala esque P, Pa kin EJ, Roewe L e al (2008) Genomic
complexi y o he Y-STR DYS19: in e sions, dele ions and
ounde lineages ca ying duplica ions. In J Legal Med (in p ess)
3. Beleza S, Al es C, González-Nei a A, La eu M, Amo im A,
Ca acedo A, Gusmão L (2003) Ex ending STR ma ke s in Y
ch omosome haplo ypes. In J Legal Med 117:27–33
4. Bosch E, Cala ell F, Comas D, Oe ne PJ, Unde hill PA,
Be anpe i J (2001) High- esolu ion analysis o human Y-
ch omosome a ia ion shows a sha p discon inui y and limi ed
gene low be ween no hwes e n A ica and he Ibe ian Peninsula.
Am J Hum Gene 68:1019–1029
5. Bosch E, Cala ell F, González-Nei a A e al (2006) Pa e nal and
ma e nal lineages in he Balkans show a homogeneous landscape
o e linguis ic ba ie s, excep o he isola ed A omuns. Ann
Hum Gene 70:459–487
6. Bu le JM, Decke AE, Kline MC, Vallone PM (2005) Ch omo-
somal duplica ions along he Y-ch omosome and hei po en ial
impac on Y-STR in e p e a ion. J Fo ensic Sci 50:853–859
7. Calò CM, Ga o ano L, Mameli A, Pizzamiglio M, Vona G (2003)
Gene ic analysis o a Sicilian popula ion using 15 sho andem
epea s. Hum Biol 75:163–178
8. Chang YM, Pe umal R, Kea PY, Kuehn DL (2007) Haplo ype
di e si y o 16 Y-ch omosomal STRs in h ee main e hnic
popula ions (Malays, Chinese and Indians) in Malaysia. Fo ensic
Sci In 167:70–76
9. Che ni L, Pe ei a L, Goios A e al (2005) Y-ch omosomal STR
haplo ypes in h ee e hnic g oups and one cosmopoli an popula-
ion om Tunisia. Fo ensic Sci In 152:95–99
10. Comas D, Cala ell F, Benchemsi N, Helal A, Le anc G,
S oneking M, Ba ze MA, Be anpe i J, Sajan illa A (2000)
Alu inse ion polymo phisms in NW A ica and he Ibe ian
peninsula: e idence o a s ong gene ic bounda y h ough he
Gib al a s ai s. Hum Gene 107:312–329
11. Exco ie L, La al G, Schneide S (2005) A lequin e . 3.0: an
in eg a ed so wa e package o popula ion gene ics da a analysis.
E ol Bioin Online 1:47–50
12. Felsens ein J (2007) PHYLIP (Phylogeny In e ence Package)
e sion 3.67. Dis ibu ed by he au ho . Depa men o Genome
Sciences, Uni e si y o Washing on, Sea le
13. F ancalacci P, Mo elli L, Unde hill PA e al (2003) Peopling o
h ee Medi e anean islands (Co sica, Sa dinia, and Sicily)
in e ed by Y-ch omosome biallelic a iabili y. Am J Phys
An h opol 121:270–279
14. Gé a d N, Be iche S, Aouize a e A, Die e len F, Luco e G
(2006) No h A ican Be be and A ab in luences in he wes e n
Medi e anean e ealed by Y-ch omosome DNA haplo ypes. Hum
Biol 78:307–316
15. Ghiani ME, Pi as IS, Mi chell RJ, Vona G (2004) Y-ch omosome
10 locus sho andem epea haplo ypes in a popula ion sample
om Sicily I aly. Legal Med 6:89–96
16. Gusmão L, Bu le JM, Ca acedo A e al (2006) DNA
Commission o he In e na ional Socie y o Fo ensic Gene ics
(ISFG): an upda e o he ecommenda ion on he use o Y-STRs in
o ensic analysis. In J Legal Med 120:191–200
17. Hall TA (1999) BioEdi : a use - iendly biological sequence
alignmen edi o and analysis p og am o Windows 95/98/NT.
Nucleic Acids Symp Se 41:95–98
18. Hallenbe g C, Nielsen K, Simonsen B, Sánchez J, Mo ling N
(2005) Y-ch omosome STR haplo ypes in Danes. Fo ensic Sci In
155:205–210
19. Hoho C, Dewa K, Sibbing U, Hoppe K, Fo s e P, B inkmann B
(2007) Y-ch omosomal mic osa elli e mu a ion a es in a popula-
ion sample om no hwes e n Ge many. In J Legal Med
121:359–363
140 In J Legal Med (2009) 123:137–141
138
20. Lim SK, Xue Y, Pa kin EJ, Tyle -Smi h C (2007) Va ia ion o 52
new Y-STR loci in he Y Ch omosome Conso ium wo ldwide
panel o 76 di e se indi iduals. In J Legal Med 121:124–127
21. López AM, Al a ez S, Gusmão L e al (2004) Popula ion da a o
16 Y-ch omosome STRs in ou popula ions om Py enees
(Spain). Fo ensic Sci In 140:125–129
22. Macabich I (1966) His o ia de Ibiza. Volumen I. Daedalus, Palma
de Mallo ca
23. Ma ín P, Ga cía-Hi sch eld J, Ga cía O e al (2004) A Spanish
popula ion s udy o 17 Y-ch omosome STR loci. Fo ensic Sci In
139(1):231–235
24. Pico nell A, Gómez-Ba bei o L, Tomàs C, Cas o JA, Ramon MM
(2005) Mi ochond ial DNA HVRI a ia ion in Balea ic popula-
ions. Am J Phys An h opol 128:119–130
25. Pico nell A, Miguel A, Cas o JA, Ramon MM, A ya R, C aw o d
MH (1996) Gene ic a ia ion in he popula ion o Ibiza (Spain):
gene ic s uc u e, geog aphy and language. Hum Biol 68:899–913
26. Pon es ML, Cainé L, Ab an es D, Lima G, Pinhei o MF (2007)
Allele equencies and popula ion da a o 17 Y-STR loci
(AmpFlSTR Y- ile ) in a no he n Po uguese popula ion sample.
Fo ensic Sci In 170:62–67
27. Quin ana-Mu ci L, Semino O, Minch E, Passa ino G, B ega A,
San achia a-Bene ece i AS (1999) Fu he cha ac e is ics o
p o o-Eu opean Y ch omosomes. Eu J Hum Gene 7:603–608
28. Quin ana-Mu ci L, Vei ia R, Fellous M, Semino O, Poloni ES
(2003) Gene ic s uc u e o Medi e anean popula ions e ealed
by Y-ch omosome haplo ype analysis. Am J Phys An h opol
121:157–171
29. Rapone C, Ge aci A, Capelli C e al (2007) Y ch omosome
haplo ypes in cen al-sou h I aly: implica ion o e e ence
da abase. Fo ensic Sci In 172:67–71
30. Reynolds J, Wei BS, Cocke ham CC (1983) Es ima ion o he
coances y coe icien : basis o a sho - e m gene ic dis ance.
Gene ics 105:767–779
31. Robino C, In u i S, Gino S e al (2006) Y-ch omosomal STR
haplo ypes in Sicily. Fo ensic Sci In 159:235–240
32. Roewe L, Willuwei S, K üge C e al (2008) Analysis o Y
ch omosome STR haplo ypes in he Eu opean pa o Russia
e eals high di e si ies bu non-signi ican gene ic dis ances
be ween popula ions. In J Legal Med 122:219–223
33. Sánchez C, Ba o C, Xi ó A e al (2007) Haplo ype equencies
o 16 Y-ch omosome STR loci in he Ba celona me opoli an a ea
popula ion using Y-File ™ki . Fo ensic Sci In 172:211–217
34. Scozza i R, C uciani F, Pang azio A e al (2001) Human Y-
ch omosome a ia ion in he wes e n Medi e anean a ea: impli-
ca ions o he peopling o he egion. Hum Immunol 62:871–884
35. Semino O, To oni A, Scozza i R, B ega A, De Benedic is G,
San achia a Bene ece i AS (1989) Mi ochond ial DNA poly-
mo phisms in I aly. III. Popula ion da a om Sicily: a possible
quan i a ion o ma e nal A ican ances y. Ann Hum Gene
53:193–202
36. Taga elli A, Pi o A, Taga elli G, Zinno F (2000) Colo -blindness
in Calab ia (sou he n I aly): a no h–sou h dec easing end. Am J
Hum Biol 12:17–24
37. Tomàs C, Jiménez G, Pico nell A, Cas o JA, Ramon MM (2006)
Di e en ial ma e nal and pa e nal con ibu ions o he gene ic pool
o Ibiza Island, Balea ic A chipelago. Am J Phys An h opol
129:268–278
38. Willuwei S, Roewe L, on behal o he In e na ional Fo ensic Y
Ch omosome Use G oup (2007) Y ch omosome haplo ype
e e ence da abase (YHRD): upda e. Fo ensic Sci In : Gene ics
1:83–87
In J Legal Med (2009) 123:137–141 141
139
Resea ch a icle
Mic ogeog aphic a ia ion o Y-ch omosome haplo ypes in I aly
S. Pelo i
a,
*, C. Bini
a
, A. Ba ba o
b
, L. Caenazzo
c
, E. Ca ne ali
d
, N. Ce i
e
, R. Domenici
,
G. Fe i
g
, M. Maniscalco
h
, V. Ono i
i
, A. Piccinini
j
, C. P e ide e
`
k
, U. Ricci
l
, C. Robino
m
,
F. Sca nicci
n
, F. To icelli
o
, M. Ven u i
p
, S. P esciu ini
q
GeFI’s g oup o Y-ch omosome cha ac e iza ion
a
Depa men o Medicine and Public Heal h, Sec ion o Legal Medicine, Uni e si y o Bologna, I aly
b
Depa men o Fo ensic Gene ics, S udio Indagini Mediche e Fo ensi (SIMEF), I aly
c
Depa men o En i onmen al Medicine and Public Heal h, Uni e si y o Pado a, I aly
d
Depa men o Su ge y and Fo ensic Sciences, Uni e si y o Pe ugia and Sec ion o Legal Medicine, Hospi al o Te ni, I aly
e
Depa men o Su ge y, Radiology and Fo ensic Medicine, Uni e si y o B escia, I aly
Uni e si y o Pisa, I aly
g
Depa men o Diagnos ic and Labo a o y Se ice and Legal Medicine, Sec ion o Legal Medicine, Uni e si y o Modena and Reggio Emilia, I aly
h
And os Day Su ge y, Rep oduc ion Medicine Cen e , Pale mo, I aly
i
Ins i u e o Legal Medicine, Uni e si y o Ancona, I aly
j
Ins i u e o Legal Medicine, Uni e si y o Milan, I aly
k
Depa men o En i onmen al Medicine and Public Heal h, Uni e si y o Pa ia, I aly
l
Medical Gene ic Uni , Azienda Ospedalie o Uni e si a ia ‘‘A. Meye ’’, Flo ence, I aly
m
Depa men o Ana omy, Pha macology and Legal Medicine, Uni e si y o Tu in, I aly
n
Ins i u e o Legal Medicine, Uni e si a
`Ca olica Sac o Cuo e, Rome, I aly
o
Gene ic Diagnos ic Uni , Azienda Ospedalie o Uni e si a ia Ca eggi, Flo ence, I aly
p
Depa men o Biomedical Sciences, Sec ion o Legal Medicine, Uni e si y o Fe a a, I aly
q
Cen e o S a is ical Gene ics, Uni e si y o Pisa, I aly
Recei ed 17 Augus 2007; accep ed 8 Oc obe 2007
Abs ac
Wi hin an I alian collabo a i e exe cise on he ex ended haplo ype o he Y-ch omosome, 1288 subjec s we e yped by he AmpFlSTR YFile
Ampli ica ion Ki (AB Applied Biosys ems) and o he 526 we e yped by he Powe Plex Y
1
Sys em (P omega). The sampling scheme included
ei he a ‘‘ egional’’ o a ‘‘local’’ ec ui men , he i s e e ing o indi iduals bo n in he egion o he pa icipa ing lab, he second e e ing o
indi iduals coming om small illages. To al sample sizes we e N= 954 and 860, espec i ely. A signi ican dec ease o haplo ype di e si y was
ound in he local samples. The esul s may be o in e es in o ensic applica ions o he Y-ch omosome.
#2008 Else ie I eland L d. All igh s ese ed.
Keywo ds: Y-ch omosome; Popula ion da a; Sho andem epea s; Haplo ypes
1. In oduc ion
Up o now he haplo ype di e si y using nine Y-STRs
comp ising he so-called minimal haplo ype loci was s udied
among wo ldwide popula ion samples showing ha he e a e
signi ican po ions o haplo ypes in se e al popula ions which
canno be esol ed. E alua ion o haplo ype disc imina ion
capaci y o 35 Y-STRs was ecen ly e alua ed and comple e
esolu ion o he pooled popula ion was achie ed by addi ional
geno yping o u he loci [1]. Y-STRs gene a ing haplo ypes
we e s udied in 2001 by GeFI collabo a i e exe cise on 1176
I alian indi iduals om di e en egions [2]. The yped loci
we e DYS19, DYS389I, DYS389II, DYS390, DYS391,
DYS392, DYS393, DYS385 and a low deg ee o a ia ions
was shown among egions. In o ensic gene ics labo a o ies Y-
STRs mul iplex ki , based on 17 ma ke s alida ed o o ensic
applica ions, ha e become widely used in he las yea s o he
high powe o disc imina ion a minimal samples consump ion.
www.else ie .com/loca e/FSIGSS
A
ailable online a www.sciencedi ec .com
Fo ensic Science In e na ional: Gene ics Supplemen Se ies 1 (2008) 239–241
* Co esponding au ho . Tel.: +39 0512088343; ax: +39 0512088358.
E-mail add ess: [email p o ec ed] (S. Pelo i).
1875-1768/$ – see on ma e #2008 Else ie I eland L d. All igh s ese ed.
doi:10.1016/j. sigss.2007.10.083
140
This u he GEFI collabo a i e p ojec was designed o
s udying he di e si y o 17-locus Y-STR p o iles, usually used
in casewo k, on di e en I alian popula ion g oups, sampling
by egional o local ways o a o al o 1288 yped samples o
de e mine indi idual loci gene di e si y, mul iplex disc imi-
na o y capaci y and o inc ease da a o e e ence da abase. In
addi ion a o al o 526 samples we e yped o 12 loci by a ew
numbe o labo a o ies and he esul s we e collec ed o
inc ease he minimal haplo ype I alian da abase.
2. Ma e ials and me hods
Pa icipa ing labo a o ies we e asked o ype a leas 100
un ela ed indi iduals bo n in hei egion o 17 loci by Y ile
ki . Blind con ol samples we e p epa ed o each labo a o y.
Labo a o ies we e le ee o use hei p e e ed DNA
ex ac ion me hods. PCR and analysis o ampli ied p oduc s
we e pe o med acco ding o he manu ac u e ’s ecommenda-
ions. In addi ion o he 526 I alian samples we e yped by he
Powe Plex Y
1
Sys em (P omega).
3. Resul s and discussion
Wi hin an I alian collabo a i e exe cise on he ex ended
haplo ype o he Y-ch omosome, 1288 subjec s we e yped by he
AmpFlSTR YFile Ampli ica ion Ki (AB Applied Biosys ems)
and o he 526 we e yped by he Powe Plex Y
1
Sys em
(P omega). Thesampling scheme included ei he a‘‘ egional’’ o
a ‘‘local’’ ec ui men , he i s e e ing o indi iduals bo n in he
egion o he pa icipa ing lab, he second e e ing o indi iduals
coming om small illages. In he second case, only non-
isonymous subjec s we e sampled. Fig. 1 shows he 9-locus
haplo ype coun s in 631 indi iduals om 14 local samples
compa ed wi h he expec ed coun s in a sample o he same size i
i we e andomly sampled om he gene al I alian popula ion.
The expec ed coun s we e ob ained by nume ical esampling o
he I alian da abase. Fo example, he i s wo mos equen
haplo ypes among he local samples display he highes ank in
I aly also; howe e , hei ela i e equency is highe in he local
samples (obse ed coun s 38 s. expec ed coun s 21.8). In
gene al, he haplo ype equency dis ibu ion is biased in he
local samples owa ds a lowe numbe o haplo ypes wi h highe
equency. Fig. 2 shows he non-unique 17-locus haplo ype
coun s in 12 local samples ( wo local samples we e no yped
wi h he 17-locus ki ). I is ema kable ha all non-unique
haplo ypes bu one a e p esen in a single local sample.
Con lic o in e es
None.
Fig. 1. The mos equen ‘‘minimal haplo ypes’’ in 14 local samples om cen al and no he n I aly. #N/A: no p esen in he I alian da abase.
Fig. 2. Non-unique 17-locus haplo ypes in 12 local samples om no he n and
cen al I aly.
S. Pelo i e al. / Fo ensic Science In e na ional: Gene ics Supplemen Se ies 1 (2008) 239–241240
141

Re e ences
[1] H. Roding, L. Roewe , A. G oss, T. Rich e , P. de Knij , M. Kaise , W.
B abe z, E alua ion o haplo ype disc imina ion capaci y o 35 Y-ch omo-
somal sho andem epea loci, Fo ensic Sci. In . 174 (2008) 182–188.
[2] S. P esciu ini, A. Caglia
`, M. Alu
`, A. Asmundo, L. Buscemi, L. Caenazzo,
E. Ca ne ali, E. Ca a, Z. De Ba is i, F. De S e ano, R. Domenici, A.
Piccinini, N. Res a, U. Ricci, V.L. Pascali, Y-ch omosome haplo ypes
in I aly: he GEFI collabo a i e da abase, Fo ensic Sci. In . 122 (2001)
184–188.
S. Pelo i e al. / Fo ensic Science In e na ional: Gene ics Supplemen Se ies 1 (2008) 239–241 241
142
Le e
o
he
Edi o
Gene ic
a iabili y
o
he
SNP o ID
52-plex
iden ifica ion
SNP
panel
in
I alian
popula ion
samples
Dea
Edi o ,
The
po en ial
applica ion
o
SNPs
in
place
o
supplemen a y
STRs
in
pa e ni y
es ing
and
o ensic
casewo k
has
been
he
subjec
o
deba e
in
ecen
yea s
[1–4].
In
ac
SNPs
show
a
ange
o
cha ac e is ics
ha
make
hem
well
sui ed
o
o ensic
analysis,
such
as
low
mu a ion
a e,
much
educed
amplicons
sizes
and
ela i ely
simple
mul iplex
assays
[5–8].
P e iously
we
cha ac e ized
a ia ion
wi hin
I aly,
s udying
wo
geog aphically
sepa a ed
popula ions
om
he
no h
o
I aly
(Vene o)
and
he
sou h
(Calab ia).
In
his
s udy
we
upda e
exis ing
da a
analyzing
mo e
samples
(200)
om
he
same
popula ions.
DNA
was
ex ac ed
om
blood
samples
o
heal hy,
un ela ed
olun ee s
ha
ga e
in o med
consen
o
popula ion
s udies
in
acco dance
wi h
I alian
Law
D.
Lgs.
196/2003
and
app o ed
by
SIMEF
ISO-17025
p ocedu es.
DNA
ex ac ions
we e
made
wi h
he
P omega
Wiza d
1
DNA
pu ifica ion
ki
and
quan ifica ion
wi h
he
Applied
Biosys ems
(AB)
Quan ifile
Human
DNA
Quan ifica ion
Ki
using
an
AB
7300
eal- ime
PCR
sys em.
The
52plex
SNaPsho
assay
was
applied,
as
p e iously
desc ibed
by
Sanchez
e
al.
alida ed
o
o ensic
applica ions
[9].
Amplifica-
ions
we e
made
in
a
single
PCR
ollowed
by
wo
pa allel
23-
and
29-plex
single
base
ex ension
eac ions
(SBEs)
using
p ime s
and
eac ion
condi ions
desc ibed
by
Sanchez
e
al.
[9].
De ec ion
o
he
SBE
p oduc s
was
pe o med
by
capilla y
elec opho esis
on
an
AB
P ism
3130
using
GeneScan
LIZ
120
o
in e nal
calib a ion.
Allele
equencies,
o ensic
and
s a is ical
pa ame e s
a e
gi en
in
Supplemen a y
Tables
1
and
2.
No
significan
di e ences
we e
ound
in
compa ison
wi h
ou
p e ious
da a
al eady
published
in
he
SPSma
open-access
online
equency
b owse
(h p://spsma .-
cesga.es/snp o id.php?da aSe =snp o id52).
Mo eo e ,
when
com-
pa ing
ou
da a
o
o he
Eu opean
popula ions
(specifically,
Spanish,
Po uguese
and
Danish
da a),
no
o e all
significan
di e ences
we e
ound
o
he
same
ma ke s
[12].
Compa ison
analysis
is
ou lined
in
Table
3.
The
main
di e ences
o
allelic
dis ibu ions
we e
ound
wi h
Denma k
in
s1335873,
s2046361,
wi h
Po ugal
in
s1357617
and
wi h
bo h
popula ions
in
s826472.
S a is ical
pa ame e s
o
o ensic
in e es
we e
calcula ed,
comp ising:
Dp:
powe
o
disc imina ion,
PE:
powe
o
exclusion,
RMP:
andom
ma ching
p obabili y,
using
Powe S a s
.1.2
so wa e
[10].
The
SNPs
showed
low
disc imina ion
powe
(PD)
and
exclusion
powe
(PE)
when
used
indi idually,
bu
in
combina ion
PD
and
PE
we e
aised
o
0.9999
in
bo h
popula ions,
ep esen ing
alues
compa able
o
hose
ob ained
analyzing
a
s anda d
15
STRs
se .
Ha dy–Weinbe g
equilib ium
and
o he
popula ion
pa ame e s
we e
calcula ed
using
A lequin
so wa e
.3.1
[11].
The
highes
a e age
he e ozygosi y
o
bo h
popula ions
was
ound
in
s2831700.
No
significan
de ia ion
om
Ha dy–
Weinbe g
expec a ions
was
obse ed
(P
>
0.05).
The
ypical
pa e ni y
index
ha
can
be
expec ed
applying
hese
SNPs
was
assessed
by
calcula ing
he
a e age
PI
alues
ob ained
om
h ee
io
cases
and,
sepa a ely,
om
h ee
deficien
amily
s udies
(lacking
he
mo he
in
each
case)
and
he
geno ypes
ob ained
a e
lis ed
in
ull
in
Supplemen a y
Tables
4a
and
4b.
Indi idual
pa e ni y
indices
we e
calcula ed
in
he
s anda d
way
and
a
combined
pa e ni y
index
(CPI)
de e mined
as
he
p oduc
o
hese
indi idual
alues
[13].
F om
h ee
combined
PIs
he
a e age
io
PI
was
7.23E+10
and
he
a e age
deficien
amily
PI
was
1.22E+8.
Wi h
bo h
alues
in
acco dance
wi h
p e iously
published
da a
[6].
In
conclusion,
all
52
SNPs
we e
in o ma i e
in
he
popula ion
samples
analysed,
his
means
hey
can
p o ide
aluable
in o ma-
ion
no
only
o
popula ion
s udies
bu
also
o
o ensic
applica ions
(e.g.
iden ifica ion
cases
wi h
highly
deg aded
samples)
as
well
as
he
analysis
o
complex
pedig ees
(e.g.
dis an
ela ionships
o
incomple e
pedig ees)
as
a
complemen
o
s anda d
STRs
yping.
The
labo a o y
pe o ming
his
s udy
pa icipa es
in
he
quali y
con ol/p oficiency
es ing
o
he
GEP-ISFG
WG
(www.gep-
is g.o g).
This
pape
ollows
he
guidelines
o
publica ion
o
popula ion
da a
eques ed
by
he
jou nal
[14].
Appendix
A.
Supplemen a y
da a
Supplemen a y
da a
associa ed
wi h
his
a icle
can
be
ound,
in
he
online
e sion,
a
h p://dx.doi.o g/10.1016/j. sigen.2012.07.002.
Re e ences
[1]
C.
Phillips,
M.V.
La eu,
J.
Sanchez,
M.
B ion,
B.
Sob ino,
N.
Mo ling,
P.
Schneide ,
D.
Synde combe
Cou ,
A
´.
Ca acedo,
Selec ing
single
nucleo ide
polymo phisms
o
o ensic
applica ions,
P og ess
Fo ensic
Gene .
10
(2004)
18–20.
[2]
J.M.
Bu le ,
M.D.
Coble,
P.M.
Vallone,
STRs
s.
SNPs:
hough s
on
he
u u e
o
o ensic
DNA
es ing,
Fo ensic
Sci.
Med.
Pa hol.
3
(2007)
200–205.
[3]
B.
Budowle
B,
A.
an
Daal,
Fo ensically
ele an
SNP
classes,
BioTechniques
44
(2008)
603–610.
[4]
P.
Gill,
An
assessmen
o
he
u ili y
o
single
nucleo ide
polymo phisms
(SNPs)
o
o ensic
pu poses,
In .
J.
Legal
Med.
114
(2001)
204–210.
[5]
C.
Phillips,
M.
Fonde ila,
M.
Ga cı
´a-Maga in
˜os,
A.
Rod iguez,
A.
Salas,
A
´.
Ca acedo,
M.V.
La eu,
Resol ing
ela ionship
es s
ha
show
ambiguous
STR
esul s
using
au osomal
SNPs
as
supplemen a y
ma ke s,
Fo ensic
Sci.
In .
Gene .
2
(2008)
198–204.
[6]
C.
Bø s ing,
J.J.
Sanchez,
H.E.
Hansen,
A.J.
Hansen,
H.Q.
B uun,
N.
Mo ling,
Pe o -
mance
o
he
SNP o ID
52
SNP-plex
assay
in
pa e ni y
es ing,
Fo ensic
Sci.
In .
Gene .
2
(2008)
292–300.
[7]
M.
Fonde ila,
C.
Phillips,
N.
Na e a
´n,
M.
Ce ezo,
A.
Rod ı
´guez,
A.
Salas,
A
´.
Ca acedo,
M.V.
La eu,
Iden ifica ion
o
skele al
emains
using
sho -amplicon
ma ke
analysis
o
se e ely
deg aded
DNA
ex ac ed
om
a
decomposed
and
cha ed
emu ,
Fo ensic
Sci.
In .
Gene .
2
(2008)
212–218.
[8]
L.A.
Dixon,
A.E.
Dobbins,
H.K.
Pulke ,
J.M.
Bu le ,
P.M.
Vallone,
M.D.
Coble,
W.
Pa son,
B.
Be ge ,
P.
G ubwiese ,
H.S.
Mogensen,
N.
Mo ling,
K.
Nielsen,
J.J.
Sanchez,
E.
Pe ko ski,
A
´.
Ca acedo,
P.
Sanchez-Diz,
E.
Ramos-Luis ,
M.
B ion,
Fo ensic
Science
In e na ional:
Gene ics
xxx
(2012)
xxx–xxx
G
Model
FSIGEN-890;
No.
o
Pages
2
Please
ci e
his
a icle
in
p ess
as:
A.
Ba ba o,
Gene ic
a iabili y
o
he
SNP o ID
52-plex
iden ifica ion
SNP
panel
in
I alian
popula ion
samples,
Fo ensic
Sci.
In .
Gene .
(2012),
h p://dx.doi.o g/10.1016/j. sigen.2012.07.002
Con en s
lis s
a ailable
a
SciVe se
ScienceDi ec
Fo ensic
Science
In e na ional:
Gene ics
jou
nal
h
o
mep
ag
e:
w
ww
.else ie
.co
m
/loc
a e/ s
ig
1872-4973/$
–
see
on
ma e
ß
2012
Else ie
I eland
L d.
All
igh s
ese ed.
h p://dx.doi.o g/10.1016/j. sigen.2012.07.002
143
J.A.
I win,
R.S.
Jus ,
O.
Lo eille,
T.J.
Pa sons,
D.
Synde combe
Cou ,
H.
Schmi e ,
B.
S admann-Bellinghausen,
K.
Bende ,
P.
Gill,
Analysis
o
a ificially
deg aded
DNA
using
STRs
and
SNPs
–
esul s
o
a
collabo a i e
Eu opean
(EDNAP)
exe cise,
Fo ensic
Sci.
In .
164
(2006)
33–44.
[9]
J.J.
Sanchez,
C.
Phillips,
C.
Bo s ing,
K.
Balogh,
M.
Bogus,
M.
Fonde ila,
C.D.
Ha ison,
E.
Musg a e-B own,
A.
Salas,
D.
Synde combe-Cou ,
P.M.
Schneide ,
A
´.
Ca acedo,
N.
Mo ling,
A
mul iplex
assay
wi h
52
single
nucleo ide
polymo -
phisms
o
human
iden ifica ion,
Elec opho esis
27
(2006)
1713–1724.
[10]
A.
Te eba,
Tools
o
Analysis
o
Popula ion
S a is ics
P ofiles
in
DNA,
P omega
Co p.,
1999.
[11]
L.
Exco fie ,
G.
La al,
S.
Schneide ,
A lequin
e .
3.0:
an
in eg a ed
so wa e
package
o
popula ion
gene ics
da a
analysis,
E ol.
Bioin o m.
(2005)
47–50.
[12]
J.
Amigo,
C.
Phillips,
A.
Salas,
L.
Fe nandez
Fo moso,
A
´.
Ca acedo,
M.V.
La eu,
pop.STR—an
online
popula ion
equency
b owse
o
es ablished
and
new
o en-
sic
STRs,
Fo ensic
Sci.
In .
Gene .
Suppl.
Se ies
2
(2009)
361–362.
[13]
D.W.
Gje son,
C.H.
B enne ,
M.P.
Bau ,
A
´.
Ca acedo,
F.
Guide ,
J.A.
Luque,
R.
Lessig,
W.R.
May ,
V.L.
Pascali,
M.
P inz,
P.M.
Schneide ,
N.
Mo ling,
ISFG:
ecommenda ions
on
bios a is ics
in
pa e ni y
es ing,
Fo ensic
Sci.
In .
Gene .
1
(2007)
223–231.
[14]
A
´.
Ca acedo,
J.M.
Bu le ,
L.
Gusmao,
W.
Pa son,
L.
Roewe ,
P.M.
Schneide ,
Publica ion
o
popula ion
da a
o
o ensic
pu poses,
Fo ensic
Sci.
In .
Gene .
4
(2010)
145–147.
Anna
Ba ba o
a,b,
*
a
S udio
Indagini
Mediche
E
Fo ensi
(SIMEF),
Reggio
Calab ia,
I aly
b
Ins i u e
o
Legal
Medicine,
Uni e si y
o
San iago
de
Compos ela,
Spain
Ch is
Phillips
Manuel
Fonde ila
Ma iky
La eu
A
´ngel
Ca acedo
Ins i u e
o
Legal
Medicine,
Uni e si y
o
San iago
de
Compos ela,
Spain
*Co esponding
au ho
a :
S udio
Indagini
Mediche
E
Fo ensi
(SIMEF),
Reggio
Calab ia,
I aly
E-mail
add ess:
[email p o ec ed]
(A.
Ba ba o)
8
Ma ch
2012
Le e
o
he
Edi o
/
Fo ensic
Science
In e na ional:
Gene ics
xxx
(2012)
xxx–xxx
e2
G
Model
FSIGEN-890;
No.
o
Pages
2
Please
ci e
his
a icle
in
p ess
as:
A.
Ba ba o,
Gene ic
a iabili y
o
he
SNP o ID
52-plex
iden ifica ion
SNP
panel
in
I alian
popula ion
samples,
Fo ensic
Sci.
In .
Gene .
(2012),
h p://dx.doi.o g/10.1016/j. sigen.2012.07.002
144
DISCUSSION
145
Chap e VI : GENERAL DISCUSSION
1. In oduc ion
Fo ensic labs ha e o en o deal wi h he analysis o highly deg aded DNA
samples ha can esul in locus o allele d opou leading o complex in e p e a i e
p oblems. In cases whe e DNA e idence is limi ed, ei he in quan i y o quali y, such
as highly deg aded samples ha a e exposed o en i onmen al insul s o inhibi o s,
s anda d STR es ing is o en inadequa e. Analysis o hese comp omised DNA
samples o en esul in d opou o he la ge STR loci om he samples and only a
pa ial DNA p o ile can be ob ained. Pa ial DNA p o iles gene ally do no p o ide he
powe o disc imina ion o include o exclude a po en ial con ibu o o he sample.
Success wi h highly deg aded DNA is imp o ed using sho amplicon mini-STRs.
While s anda d STR p ime s a ge longe sequences ha include he STR loci, mini-
STR p ime s a e edesigned so esul ing DNA p oduc is smalle , he eby inc easing
he chances o success ul ampli ica ion o he la ge loci.
The use o mo e obus loci, a he han al eady es ablished STRs which equen ly ail
o gi e esul s, and/o ha e a poo powe o disc imina ion inc eases he sensi i i y o
DNA de ec ion and op imizes he oppo uni y o ob ain a DNA p o ile om
comp omised samples, p o iding o ensic scien is s wi h a ool ha cap u es gene ic
da a om DNA samples o ma ginal and ex emely low quali y and quan i y.
Thus, many p e iously unsol able human iden i y cases may be esol ed wi h mini-
STR echnology. Ob iously be o e he in oduc ion in ou ine casewo k analysis, i ’s
ele an o he o ensic communi y o es ablish which ma ke s may be use ul o
ca ching up he p ocedu e o a le el accep able o o ensic applica ion and o alida e
p o ocols wi h su icien analysis epea a es. Mo eo e in o de o calcula e he
co ec ep esen a i e weigh o DNA e idence, p io knowledge abou he DNA
ma ke s o a ele an popula ion sample is equi ed. Impo an p ope ies such as how
equen ly ce ain DNA- a ian s (i.e. alleles) occu in he popula ion, he di e ences in
such equencies be ween popula ions and he o ensic e iciency o he DNA ma ke s