Progress in Forensic Genetics: New Markers Validation Studies and Population Data

Progress in Forensic Genetics: New Markers Validation Studies and Population Data Anna Barbaro PhD Academic Thesis 2012 Progress in Forensic Genetics: New Markers Validation Studies and Population Data Dedicated to My beloved Aysha Anna Barbaro Academic thesis submitted for the “Programa de Doutoramento in Ciencias Forenses e Patoloxía” Academic Year 2011-2012 UNIVERSIDADE DE SANTIAGO DE COMPOSTELA FACULTADE DE MEDICINA DEPARTAMENTO DE ANATOMÍA PATOLÓXICA La Doctora María Victoria Lareu Huidobro y el Doctor Ángel Carracedo Álvarez, Catedráticos de Medicina Legal de la Universidad de Santiago de Compostela CERTIFICAN Que la presente memoria que lleva por título Progress in Forensic Genetics: New Markers Validation Studies and Population Data realizada pro la licenciada Anna Barbaro, ha sido realziada bajo nuestra dirección, considerándola en condiciones para optar al Grado de Doctor y autorizándola para su presentación y defensa ante el Tribunal correspondiente. Y para que así conste firmamos la presente certificación en Santiago de Compostela a 20 de julio de 2012 Fdo. Dra.María Victoria Lareu Huidobro Fdo. Dr. Ángel Carracedo Álvarez Fdo. Dª Anna Barbaro INDEX Aims and outline of the thesis.........................................................................................1 Justificación y objetivos de la tesis.................................................................................4 Chapter I :General Introduction about Forensic DNA Typing 1. A brief History............................................................................................................7 2. RFLPs (Restriction Fragments Polymorphisms)analysis...........................................8 2.1 Polymerase Chain Reaction (PCR)...................................................................10 2.2 Applications of DNA typing…..………..………..………...............................12 3. How DNA typing works:statistical evaluations.…..……………….…...…...……..13 3.1 Criminal caseworks...........................................................................................13 3.2 Paternity Test....................................................................................................16 4. DNA databases..........................................................................................................18 5. References.................................................................................................................25 Chapter II : DNA Markers:Short Tandem Repeats Loci(STRs) 1. Autosomal STRs Markers.........................................................................................27 1.1 Introduction....................................................................................................27 1.2 A brief History...............................................................................................29 2. Alternative STRs Markers:Y-STRs..........................................................................31 2.1 Introduction....................................................................................................32 2.2 Y-STRs applications......................................................................................32 2.3 Population Study............................................................................................36 3. Alternative STRs Markers:X STRs...........................................................................38 3.1 Introduction....................................................................................................38 3.2 X-STRs applications......................................................................................39 3.3 Population Study............................................................................................41 4. Alternative STRs Markers:Mini STRs......................................................................44 4.1 Introduction....................................................................................................44 4.2 Mini-STRs applications.................................................................................46 5. References.................................................................................................................49 Chapter III: DNA Markers:Single Nucleotide Polymorphisms (SNPS) 1. Introduction...............................................................................................................54 2. SNPs Research Project..............................................................................................58 3. Relevant SNPs Classes..............................................................................................60 3.1 Autosomal SNPs..............................................................................................60 3.2 SNPs on Chromosome Y.................................................................................61 3.3 SNPs on Chromosome X.................................................................................63 3.4 Mitochondrial SNPs.........................................................................................65 4.Forensic Applications.................................................................................................66 5.References..................................................................................................................76 Chapter IV : DNA Procedure Standardization 1. Introduction...............................................................................................................82 1.1 Quality Assurance............................................................................................84 1.2 Laboratory Accreditation.................................................................................87 2. Troubleshooting:DNA Contamination......................................................................88 3. References.................................................................................................................93 Chapter V : Results.....................................................................................................95 a) Validation of New STRs Multiplex.......................................................................95 1.C.Phillips,A.Barbaro,L.Fernandez-Formoso, Á.Carracedo, M.V.Lareu,Development and validation of a next generation-STR pentaplex, Forensic Sci. Int. Genet. Suppl. 2 (2009) 25-26 …………………………………………………….………………….96 2. A.Barbaro, L.Fernandez-Formoso, C.Phillips, Á. Carracedo, M.V. Lareu, Casework application of a standalone pentaplex assay of extended-ESS STRs, Legal Medicine, in process. ……….…………………………………………………..…….98  3. A Barbaro, P.Cormaci, S.Votano, G.Falcone, Validation Study of AmpFlSTR NGM SElect™ PCR Amplification Kit, Journal of Forensic and Legal Medicine, in process…………………………………...…………………………………………..108 b) Population Study for forensic statistical evaluations………………...………..120 1. S.Presciuttini, N, Cerri, S Turrina, B Pennato, M Alù, A Asmundo, A Barbaro, I Boschi, L. Buscemi, L. Caenazzo, E.Carnevali, D. De Leo, C. Di Nunno, R. Domenici, M.Maniscalco, G. Peloso, S. Pelotti, A. Piccinini, D. Podini, U.Ricci, C.Robino, L Saravo, A.Verzeletti, M.Venturi, A.Tagliabracci, Validation of a large Italian Database of 15 STR loci, Forensic Sci Int.156 (2006):266-268................................121 2. L. Fernandez-Formoso, C.Phillips, A.Rodriguez, R. Calvo, A. Barbaro, M.V. Lareu, Á.Carracedo, Allele frequencies of 20 STRs from Northwest Spain (Galicia), Forensic Sci. Int. Genet. 6 (2012) 149–150…………………………….……………124 3. A.Barbaro C.Phillips,L.Fernandez-Formoso, M.V. Lareu Á.Carracedo, Distribution of allele frequencies of 20 STRs loci in a population sample from Calabria, Southern Italy, Forensic Sci. Int. Genet. 6 (2012) 137–138………………………..126 4.A.Barbaro, M.Cassar, P.Cormaci, J.C.Grech,Variability of SE33 Locus in 2 Mediterranean Populations, Journal of Forensic and Legal Medicine (2012), in process……………………………………………………………………………….128 5. A Barbaro, P.Cormaci, G.Falcone, S.Votano, A La Marca, Distribution of 8 X chromosomal STR loci in an Italian population sample (Calabria) Forensic Sci. Int.Genet.(2012),doi:10.1016/j.fsigen.2012.05.011....................................................133 6. V. Rodríguez, C.Tomàs, J.J Sánchez, J.A.Castro, M.M. Ramon, A Barbaro, N Morling, A Picornell, Genetic sub-structure in western Mediterranean populations revealed by 12 Y-chromosome STR loci, Int J Legal Med.123 (2009)13741.................................................................................................................................135 7. S. Pelotti, C. Bini, A. Barbaro, L. Caenazzo, E. Carnevali, N. Cerri, R. Domenici, G. Ferri, M. Maniscalco, V. Onofri, A. Piccinini, C. Previdere`, U. Ricci, C. Robino, F. Scarnicci, F. Torricelli, M. Venturi, S. Presciuttini Microgeographic variation of Ychromosome haplotypes in Italy,Forensic Sci. Int. Genet. Suppl. Series 1(2008) 239– 241.................................................................................................................................140  8. A. Barbaro C. Phillips, M.Fondevila, M.V. Lareu, Á.Carracedo, Study about the genetic variability of the SNPforID 52-plex panel in Italian population samples Forensic Sci.Int.Genet.(2012),DOI:10.1016/j.fsigen.2012.07.002...............................143 Chapter VI : General Discussion 1. Introduction ………………………………………………………………………145 1.1 Validation of New STRs Multiplex…………………………………………146 1.2 Population Study for forensic statistical evaluations ……………..…….…...155 Chapter VII Conclusions..................................................................................................................166 1. Validation of New STRs Multiplex.........................................................................166 2. Population Study for forensic statistical evaluations................................................166 Conclusiones................................................................................................................169 1. Validación de nuevos multiplex de STRs.................................................................169 2. Estudio Demográfico para evaluaciones forenses estadísticas.................................169 Chapter VIII:Future Perspective.............................................................................172 Acknowledgements....................................................................................................177 AIMS 1 Aims and outline of the thesis More than 20 years passed from the first application of DNA fingerprints in forensics and DNA analysis has played a crucial role in the investigation and resolution of thousands of violent crimes. In the last years DNA analysis is rapidly developed in particular after the introduction of forensic DNA databases useful in the fight against crime. DNA has become a powerful forensic tool for solving cases such as linking a suspect to a crime scene, resolving biological relationship issues and identifying disaster victims. Three different types of DNA marker, Short Tandem Repeats (STRs), Single Nucleotide Polymorphisms (SNPs) and DNA sequence data, represent the absolute majority of polymorphisms used in forensic genetic applications. They all have characteristics, making them especially useful for solving criminal cases and for relationship testing. Short tandem repeats (STRs) are the most widely used markers for forensic DNA testing, because of their high differentiating power, good resolution of alleles and the ability to process samples rapidly using multiplexed polymerase chain reaction (PCR). 13 STRs have been chosen as the core loci upon which the FBI’s Combined DNA Index System (CODIS) database has been built. But other genetic polymorphisms, such as those found in the mitochondrial DNA (mtDNA) genome and the X or Y chromosome, have been shown to provide effective results that can improve traditional STR data. The demand for tools and technologies in forensic DNA testing, is continuous: common problems in forensics are concerning the genetic identification of degraded biological samples such as the ones collected from crime scenes or mass disaster that may have been exposed to harsh environmental conditions (sunlight, humidity, etc.) that damage DNA structure, or the presence of inhibitors interfering with the ability to obtain a full DNA profile from a biological evidence. AIMS 2 To overcome these problems, new markers has been selected in the last years, in order to recover as more information as possible from smaller regions of DNA, which are more likely to be intact following DNA damage. These include mini-STRs and single nucleotide polymorphisms (SNPs). In this perspective, not only the range of genetic markers used is widely increased but also new sophisticated analytical methods (automation, miniaturization, highthroughput performance) have been adopted in order to give to investigators as more informations as possible about a perpetrator solely on the biological evidence left at the crime scene. Moreover, more recently, the analysis of genes useful for physical characteristics determination (such as hair, eye or skin colour) have been introduced and this application may have in the near future a fundamental role in forensics. The ability to perform genetic typing of biological traces collected at the crime scene, in order to obtain information about a donor’s physical characteristics, is a very attractive prospect for forensic analysis and it could potentially offer a powerful new tool for crime scene investigations. Obviously before the introduction in routine casework analysis, it’s relevant for the forensic community to establish which markers may be useful for catching up the procedure to a level acceptable for forensic application and than to validate protocols with sufficient analysis repeat rates. Moreover in order to calculate the correct representative weight of DNA evidence, prior knowledge about the DNA markers for a relevant population sample is required. Important properties such as how frequently certain DNA-variants (i.e. alleles) occur in the population, the differences in such frequencies between populations and the forensic efficiency of the DNA markers in casework should be studied to determine the probability that a particular genotype might occur at random in a population. The aims of this thesis are: - to validate a next generation pentaplex, previously we developed, including the new five loci recommended by the European Union Council for the expansion of the INTRODUCTION 9 DNA fragments obtained by restriction enzymes were separated in size by electropho resis in agar gel and than transferred to a filter membrane for subsequent detection by radioactively labelled probes using a procedure called Southern blotting. [4] Jeffreys proved that, even if VNTRs loci are very similar between closely related humans, however the small cut fragments of DNA molecules were so variable that unrelated individuals are extremely unlikely to have the same VNTRs, so they were virtually unique to individuals. With appropriate dramatic flair, he called the process he invented "DNA fingerprinting," a term most forensic scientists dislike because it is confusing and can be misleading. With his co-workers, he also demonstrated that forensic samples, dried stains several years old, contained sufficient DNA to yield conclusive results. Like the fingerprints that came into use by detectives and police labs during the 1930s, each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue and organs of a person and it cannot be altered by any known treatment. Consequently, DNA fingerprinting rapidly became the primary method for identifying and distinguishing among individual human beings. DNA fingerprinting was first used as a police forensic test to identify the rapist and killer of two teenagers, Lynda Mann and Dawn Ashworth, who were both murdered in Narborough Leicestershire, in 1983 and 1986 respectively. A young man Colin Pitchfork, was identified and convicted of murder after samples taken from him matched semen samples taken from the two dead girls. [5] This turned out to be a specifically important identification for without it, British Authorities believe that Richard Buckland, the main suspect, would have inevitably been convicted. Therefore, not only did Jeffrey's work in this case prove who the real killer was, but exonerate someone who likely would have spent his life in prison otherwise. This procedure was also used to help in some English immigration cases.[6] Unfortunately this method, while powerful in its ability to differentiate individuals, was limited by the quantity and quality of DNA required for an unambiguous result because it required a large amounts of un-degraded sample DNA and in addition it was laborious for the amount of time it took to obtain a result. INTRODUCTION 10 In summary RFLP analysis of VNTRs has several drawbacks, including:  The process is extremely laborious and time-consuming  Radioactive probes pose health and disposal risks (although chemiluminescent technology eliminated this risk)  A relatively large amount of sample is required to perform the tests  The method requires high molecular weight, un-degraded DNA  The use of yield gels is an essential, but time consuming, step in the analysis not only to estimate the amount of DNA recovered but also to determine the suitability of the sample for analysis 1.2 Polymerase Chain Reaction (PCR) The field of molecular biology was revolutionized by the invention of the polymerase chain reaction (PCR), technology that is ideally suited for the analysis of forensic DNA samples because it’s sensitive and rapid and not has limited by the quality/quantity of DNA as the RFLPs method. This revolutionary method was developed in April 1983 by Kary Mullis and some members of the Human Genetics group at the Cetus Corporation (now Roche Molecular Systems) Mullis received in 1993 the Nobel prize for it. [7] The method relies on thermal cycling consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA. Primers containing sequences complementary to the target region along with a DNA polymerase are key components to enable selective and repeated amplification. As PCR progresses, the DNA generated is itself used as a template for replication, setting in motion a chain reaction in which the DNA template is exponentially amplified. Each cycle has three steps: - The two DNA strands are denatured by heat. - The sample is then cooled to allow the primers to anneal to the DNA segments. - The temperature is raised to allow the DNA polymerase to add nucleotides to extend the primers to produce a copy of each DNA template strand INTRODUCTION 11 Fig.2 Polymerase Chain Reaction steps The PCR product is sometimes referred to as an amplicon. Each cycle results in the doubling of amplicons. The result is an exponential accumulation of the specific target fragment, approximately 2n, where “n” is the number of cycles of amplification performed. However, the process loses efficiency at higher cycle numbers. After 30 cycles, approximately a billion copies of the target DNA template are generated. Polymerase chain reaction (PCR) is used to make millions of exact copies of DNA from a biological sample. DNA amplification with PCR allows DNA analysis on biological samples as small as a few skin cells. The ability of PCR to amplify such tiny quantities of DNA enables even highly degraded samples to be analyzed. Great care, however, must be taken to prevent contamination with other biological materials during the identifying, collecting, and preserving of a sample. The PCR process was originally performed manually. The thermolabile Klenow DNA polymerase was used and had to be replenished at the beginning of each cycle. INTRODUCTION 12 The subsequent introduction of Thermus aquaticus (Taq) polymerase, a thermostable DNA polymerase, represented a considerable advance. Taq DNA polymerase is the most widely used polymerase in forensic DNA analysis and is available from multiple vendors activity. Ampli Taq Gold® DNA Polymerase (supplied by Applied Biosystems) is a chemically modified form of Taq DNA Polymerase, which is delivered in an inactive state and requires a pre-PCR heating step to be activated. [8,9] PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. More than one region can be copied simultaneously by adding more than one primer set to the reaction this is known as multiplexing. Primer design and the optimization of thermal cycling parameters are more complex with multiplex reactions than for a single-locus reaction. With the introduction of PCR it became possible to analyze another type of markers called Short Tandem Repeat (STRs).[10] 1.3 Applications of DNA typing Since 1987, FBI and police labs around the U.S. have begun to use DNA fingerprints to link suspects to biological evidence - blood or semen stains, hair, or items of clothing - found at the scene of a crime, so since that time, human identity testing using DNA typing methods has been widespread. The past 15 years have seen tremendous growth in the use of DNA evidence in crime scene investigations as well as paternity testing. DNA typing has become the most important tool for the identification. Today public forensic laboratories and private paternity testing laboratories conduct hundreds of thousands of DNA test annually and a lot of cases have been decided with the assistance of DNA fingerprint evidence. DNA typing has greatly expanded the sources of evidence that can be tested, while simultaneously reducing the amount of evidence necessary to perform a conclusive test. DNA profiles can be obtained from any source of biological material, provided, it contains nucleated cells. Furthermore, DNA is resistant to many conditions that would destroy other compounds of forensic interest such as polymorphic proteins and blood group substances.[11,12] INTRODUCTION 13 Practical applications of forensic DNA typing include : a) Criminal Identification and Forensics DNA isolated from blood, hair, skin cells, or other genetic evidence left at the scene of a crime can be compared, with the DNA of a criminal suspect to determine guilt or innocence. DNA profiles are also useful in establishing the identity of a homicide victim, either from DNA found as evidence or from the body itself. b) Personal Identification Like the fingerprints that came into use by detectives and police labs during the 1930s, each person has a unique DNA profile. Unlike a conventional fingerprint can be altered by surgery, a DNA fingerprint is the same for every cell, tissue, and organ of a person. It cannot be altered by any known treatment. Consequently, DNA fingerprinting is rapidly became the primary method for identifying and distinguishing among individual human beings in particular in Disaster Victim Identification cases. c) Paternity and Maternity Because a person inherits his/her DNA from parents, STRs patterns are so specific and can be used to establish paternity and maternity as well as more complicated cases of confirming legal nationality and, in instances of adoption, biological parenthood. 2. How DNA typing works : statistical evaluations 2.1 Criminal Caseworks DNA forensic scientists are presented with the situation were they are given two samples related to a crime scene, about which they know nothing in advance, and are asked whether or not they are identical. Only one-tenth of a single percent of DNA (about 3 million bases) differs from one person to the next. These variable regions are used to generate a DNA profile of an individual, using samples from blood, bone, hair, and other body tissues and products. In criminal cases,this generally involves obtaining INTRODUCTION 14 samples from crime-scene evidence and a suspect, extracting the DNA, and analyzing it for the presence of a set of specific DNA regions (markers). [13,14] DNA profiles are compared to determine whether the suspect's sample matches the evidence sample found at crime scene. A marker by itself usually is not unique to an individual; if, however, two DNA samples are alike at some regions, odds are great that the samples are from the same person. If the sample profiles don't match, the person did not contribute the DNA at the crime scene. If the patterns match, the suspect may have contributed the evidence sample. The possibility of a close relative (typically a brother) of the accused being in the pool of potential contributors of crime scene evidence should be considered in case-specific context. It is not appropriate to proffer that a close relative is a potential contributor of the evidence when there are no facts in evidence to suggest this instance is relevant. However, if a relative had access to a crime scene and there is reason to believe he/she could have been a contributor of the evidence, then the best action to take is to obtain a reference sample from the relative. After all, this scenario should be sufficient probable cause for obtaining a reference sample. Typing with the same battery of short tandem repeat (STR) loci will resolve the question of whether or not the relative carries the same DNA profile as the accused. A typical DNA case involves the comparison of two samples – an unknown or evidence sample and a known or reference sample, such as a blood/saliva sample from a suspect. If DNA profiles obtained from the two samples are indistinguishable (they "match"), that of course is evidence for the court that the samples have a common source. • If the DNA profile obtained from the two samples are distinguishable (they “ NOT match"), that of course is evidence for the court that the samples have a different source • If the DNA profile obtained from the two samples are indistinguishable (they "match"), that of course is evidence for the court that the samples have a common source INTRODUCTION 15 Once an individual's STR profile is identified, it is statistically improbable that anyone else in the world will have the same profile, unless that person has an identical twin. Identical twins (twins derived from a single fertilized egg) have identical STR DNA profiles. For evidence yielding full single source DNA profiles, it’s possible to calculate the random match probabilities and likelihood ratio. a) Random match probability It’s the chance of a random DNA profile match within a given population and is the reciprocal of the DNA profile frequency. PI = the probability that a match would occur by chance. A DNA profile frequency is estimated by determining the genotype frequency for each locus and then multiplying the frequency across all loci. Rare genotypes provide stronger evidence, and population databases sorted by race will yield somewhat different results, but it is important to understand that this is a representation of how rare a DNA profile is in a representative population. Population data with allele frequencies for used markers are collected for different populations and contain only DNA profiles from anonymous donors of specific populations tested. b) Likelihood Ratio A likelihood ratio (LR) is a ratio of two probabilities of the same evidence under two mutually exclusive hypotheses, specifically the position of the prosecution and the position of the defence. It conveys the relative support for the weight of DNA evidence under the hypothesis that the defendant is the source of the DNA profile, versus an unrelated individual from the population at large. While interpretation of the strength of the statistical value can be variable, and should ultimately be considered in context with all case circumstances INTRODUCTION 16 c) Combined Probability of Exclusion The combined probability of exclusion can be used to conservatively interpret complex DNA mixtures. This calculation provides an estimate of the portion of the population that has a genotype of at least one allele not observed in the DNA mixture. This is a conservative approach since all other alleles not observed are considered and an individual can be excluded if he has any allele at any locus that is not detected in the mixture. 2.2 Paternity Test In paternity tests to determine if the alleged father is the true biological father, the DNA profiles of the child, mother, and alleged father are compared. A child inherits two different alleles at each genetic locus—one from the mother and one from the father. If a child has an allele that the mother does not have, this obligate allele has to come from the biological father. If the tested man (alleged father) does not have the genetic characteristics necessary to be the biological father of the child, the result is an exclusion (the alleged father is not the biological father). If the tested man's DNA has the same allele as the obligate allele does, the result is an inclusion. In this last case the alleged father has the same allele as the obligate allele and a Paternity Index (PI) can be calculated. This is the relative probability that the alleged father and not an unrelated, randomly selected male of the same ethnic background transmitted the obligate allele to the child. This is a likelihood ratio and is presented in the formula X/Y, where X is the chance that the alleged father could transmit the obligate allele and Y is the chance that an unrelated man of the same race could have the allele. X is assigned the value of 1 if the alleged father is homozygous for the allele of interest and 0.5 if the alleged father is heterozygous. The probability of an unrelated, randomly selected man possessing the obligate allele is determined by using a database that lists the frequency distribution of individual alleles. If there is more than one obligate allele, the individual paternity INTRODUCTION 17 indexes can be multiplied and the total across all loci is called the Combined Paternity Index (CPI). This is a measure of the strength of the genetic evidence and is an odds ratio, not a probability. CPI can range from 0 to infinity, an interpretation of the CPI is as follows: - If CPI is between 0-1, the genetic evidence is more consistent with non-paternity than paternity. - If CPI>1, the genetic evidence is more consistent with paternity than non-paternity It is normal practice to establish a threshold value for CPI, above which it is accepted that the tested man is the true biological father. This threshold is 1000 in Europe, but can be as low as 100 in the USA. Sometimes a likelihood ratio is converted into a probability. This probability is known as the probability of paternity. This formula tests the hypothesis that the alleged father is indeed the biological father of the child. For example, a value of 99% reflects a 99% probability that the hypothesis is correct and a 1% probability that it is not. PI sometimes is called L and the probability of paternity is W (from the German word Wahrscheinlichkeit, "probability"). W and L are related as : W = L / (1+L), or L = W / (1-W). Probability of paternity is not widely used in the United States. A more common approach, similar to the probability of exclusion, is the Random Man Not Excluded (RMNE) statistic. This is the proportion of the population that could contribute all of the obligate alleles and therefore could not be excluded, or would be falsely included. A single locus RMNE is calculated by 1-(1-p)2. Combining the RMNE statistics over all loci gives the combined RMNE (CRMNE) which is equivalent to the CPI. The value of the CRMNE is typically small (less than one), and is analogous to 1CRMNE or exclusionary power (PE). PE represents the probability of excluding a falsely accused man. INTRODUCTION 18 3. DNA databases DNA analysis is a powerful crime-fighting tool for prosecuting criminals and exonerating the innocent. A national DNA database is a government database of DNA profiles which can be used by law enforcement agencies to identify suspects of crimes. The first government database was set up by the United Kingdom in April 1995, The second one in New Zealand, and than in France in 1998. [15,16] The growing public approval of DNA databases has seen the creation and expansion of many states' own DNA databases. California currently maintains the third largest DNA database in the world. The size of DNA database, and its rate of growth, is giving concern to civil liberties and political groups in the UK, where police have wide-ranging powers to take samples and retain them even in the event of acquittal. Originally intended for sex offenders, they have since been extended to include almost any criminal offender.DNA databases are effective because a majority of crimes are committed by repeat offenders. In fact has been evaluated that sixty percent of those individuals released from prison for violent offenses and subsequently released were re-arrested for a similar offense in less than 3 years. The value of the DNA database is in its ability to apprehend criminals that are not direct suspects in a case and to prevent further victims from crimes committed by those individuals. In particular : • Link an unknown sample to a convicted offender. This gives the investigator the name of a previously unidentified suspect. • Link an unknown sample to a solved case. This would also identify a suspect for the investigator. • Link two or more unsolved cases. Linking unsolved cases can help an investigator look for similarities in the crimes, define geographical areas, compare victim INTRODUCTION 25 4. References [1]Watson J.D. and Crick F.H.C. (1953),A Structure for Deoxyribose Nucleic Acid, Nature 171: 737-738 [2]Jeffreys A.J., Wilson V., Thein S.W.(1984), Hypervariable 'minisatellite' regions in human DNA, Nature 314: 67–73. [3]Jeffreys AJ, Wilson V, Thein SL.(1985), Individual-specific 'fingerprints' of human DNA, Nature, 316: 76 [4]Southern E.M.(1975),Detection of specific sequences among DNA fragments separated by gel electrophoresis, J Mol Biol., 98:503-517. [5]Sanders J.(2000),Forensic Casebook of Crime, London: True Crime Library, Forum Press. pp. 229. [6]Jeffreys A.J., Brookfield J.F., Semeonoff R., (1985) Positive identification of an immigration test-case using human DNA fingerprints, Nature 6: 317 [7]Mullis K. (1990), The unusual origin of the polymerase chain reaction, Scientific American 262 (4): 56–61, 64–5. [8]Sambrook J. and Russel D.W. (2001), Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, N.Y.: chapter 8: In vitro Amplification of DNA by the Polymerase Chain Reaction [9]Saiki, RK; Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA (1988), Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase,Science 239: 487–91. INTRODUCTION 26 [10]Butler J, (2005),Forensic DNA Typing – Biology, Technology, and Genetics of STR Markers, Academic Press, ISBN 0-12-147952-8 [11]Houck M.M., Siegel J.A.(2006),Fundamentals of forensic science. Burlington, MA : Elsevier Academic Press, 2 - Chapter 1 [12]Kiely T.F., (2006),Forensic evidence: science and the criminal law, CRC Press, Taylor & Francis. [13]Evett IW, Weir BS (1998),Interpreting DNA Evidence, Sinauer Associates. ISBN 0-87983-155-4 [14]Buckleton J, Triggs CM, Walsh SJ (2005),Forensic DNA Evidence Interpretation CRC Press, 534 [15] Schneider PM, Martin PD (2001),Criminal DNA database: the Europe situation, in Forensic Sci Int.119(2):232-8. [16]Linacre A.,(2003),The UK national DNA database, The Lancet, 361:1842 [17]DNA-Database Management Review and Recommendation ENFSI DNA Working Group - April 2010 INTRODUCTION 27 Chapter II DNA MARKERS : SHORT TANDEM REPEATS LOCI (STRs) 1. AUTOSOMAL STRs MARKERS 1.1 Introduction The human genome is full of repeated DNA sequences that are widespread throughout almost every chromosome in the genome. surrounding the chromosomal centromere. These repeated sequences come in various sizes and are classified according to the length of the core repeat units, the number of contiguous repeat units, and/or the overall length of the repeat region.Minisatellites (variable number of tandem repeats, VNTRs) have core repeats with 9-80 bp, while microsatellites (short tandem repeats, STRs) contain 2-5 bp repeats and are typically in the non-coding intron region. An individual inherits one copy of an STR from each parent, which may or may not have similar repeat sizes. The number of repeats in STR markers can be highly variable among individuals, the variety of alleles (generally more than 10 alleles for the commonly used STRs) present in a population is such that a high degree of discrimination among individuals in the population may be obtained when multiple STR loci are examined. That means a multi locus STR DNA profile is unique. Fig.1: example of STRs structure INTRODUCTION 28 There are hundreds of STR systems which have been mapped throughout the human genome. Several dozen have been investigated for application to human identity testing. This make these STRs have become important in several fields including genetic mapping, linkage analysis, and human identity testing. It is often challenging to obtain PCR amplification products from forensic samples because either the DNA in those samples is degraded, or mixed, such as in a sexual assault case. STRs have become popular DNA markers for the forensic community because they are easily amplified by polymerase chain reaction (PCR) and show several benefits that make them especially suitable for human identification, such as:  high heterozygosity  regular repeat unit  distinguishable alleles  robust amplification  low mutation rate The smaller size of STR alleles make STR markers better candidates for use in forensic applications, in which degraded DNA is common. PCR amplification of degraded DNA samples can be better accomplished with smaller target product sizes. Moreover because of their smaller size, STR alleles can also be separated from other chromosomal locations more easily to ensure closely linked loci are not chosen. Closely linked loci do not follow the predictable pattern of random distribution in the population, making statistical analysis difficult. [1] Because of these characteristics, STRs with higher power of discrimination are chosen for human identification in forensic cases on a regular basis. It is used to identify victim, perpetrator, missing persons, and others. It makes them effective for human identification application since for this purpose, it is important to have DNA markers that exhibit the highest possible variation in order to discriminate between samples. In October 1993, the DNA Commission of the International Society of Forensic Genetics (ISFG) recommended the nomenclature for STR systems which is commonly used today. Alleles are generally named by the number of repeats which they contain. INTRODUCTION 29 When an allele does not conform to the standard repeat motif of the system in question, it should be designated by the number of complete repeat units and the number of base pairs of the partial repeat. [2-4] 1.2 A brief History Beginning in 1996, the FBI Laboratory launched a nationwide forensic science effort to establish core STR loci for inclusion within the national database known as CODIS (Combined DNA Index System). The 13 CODIS loci are CSF1PO, FGA, TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11. These loci are nationally and internationally recognized as the standard for human identification. In 1999 the DNA working group of the European Network of Forensic Science Institutes (ENFSI) decided on a European Standard Set (ESS), which includes seven loci: TH01, vWA, FGA, D21S11, D3S1358, D8S1179 and D18S51. These loci have been confirmed by a resolution of the European Council in 2001 and now form the core of all national DNA databases in Europe. Due to the overwhelming success of DNA databases, a political process was initiated by a number of European countries to establish a legal basis for exchanging DNA database profiles between countries in criminal investigations. This led to the Treaty of Prüm, which was signed in 2005 with the purpose of stepping up crossborder cooperation, particularly in combatting terrorism, cross-border crime and illegal migration. Subsequently, the ENFSI DNA working group has established recom mendations for DNA database management, including criteria for including and deleting DNA profiles, matching rules, and handling of partial profiles. Furthermore, the occurrence of adventitious matches between DNA profiles that have no caserelated connection has been addressed in detail. When massive exchanges of DNA profiles are undertaken following the implementation of the Treaty of Prüm, the seven ESS loci will not be sufficient because the chance of adventitious matches will no longer be negligible. In addition, each DNA database contains a significant portion of partial profiles with an even higher probability to match randomly. INTRODUCTION 30 The ENFSI and EDNAP groups met in Glasgow in 2005 and discussed extension of the ESS and recommendations for additional European STR systems. Since the ESS loci are typically part of larger multiplexes with 10–15 loci, which are already used in forensic laboratories throughout Europe, it would have been straightforward to choose among these loci. However, at the same meeting, the results of a collaborative exercise carried out by the EDNAP group to examine typing of heavily degraded DNA samples were presented This exercise addresses the fact that many casework samples include only minimal amounts of DNA or DNA that is degraded due to environmental A decision was adopted by the ENFSI and EDNAP groups to increase the number of ESS loci and a recommendation was published to include more robust loci with short amplicons, rather than already established STRs which frequently fail to give results, and/or have a poor power of discrimination. In particular Europe adopted 5 new loci D2S441 D10S1248, D22S1045, D1S1656, and D12S391.[5] Short tandem repeats (STRs) located on autosomes are the genetic markers of choice in paternity investigation and they are also the most widely used in other cases of kinship analysis. Nevertheless, in some complex cases, independent of the number of polymorphisms being typed, autosomal markers convey very little information. Depending on the parentage constellation available for the analysis, as well as the gender of the subjects, this problem can sometimes be solved by using markers with different modes of transmission. Therefore, most forensic laboratories are nowadays prepared to analyze lineage markers (Y-chromosome and mitochondrial DNA) and many have recently introduced the analysis of X-STR markers in their routine. INTRODUCTION 31 2. ALTERNATIVE STRS MARKERS : YSTRs 2.1 Introduction Y-STRs are Short Tandem Repeats found on the male-specific Y Chromosome. The human Y-chromosome has often been considered an evolutionary relic of the X chromosome. The Y-chromosome has retained the ability to dictate gender but has little other functional significance. Recent studies have demonstrated that it possesses numerous functional genes, including some that appear to be critical for normal male development. Approximately 300 million years ago, the X and Y-chromosomes were true homologues, comparable in size and genetic content. Through the passage of time, the Y-chromosome underwent a series of deletion mutations reducing it to its present size of approximately 50 megabases (Mg). This notwithstanding, significant X chromosome sequence homology still persists. The chromatin of the Y-chromosome exists in at least three functionally different forms including: • Pseudoautosomal regions (PARs) • Euchromatin • Heterochromatin The PARs, located in the telomeric regions of the chromosome, pair and recombine with the X-chromosome during male meiosis. The euchromatin (containing the functional genes) and the transcriptionally inert heterochromatin form the nonrecombining region (NRY) of the Y-chromosome. Sequencing of the euchromatic region has revealed a patchwork of three distinct sequence classes. The coding genes, mostly found on the short arm of the Y Chromosome, are vital to male sex determination, spermatogenesis and other male related functions. The NRY region of the Y-chromosome is inherited in a patrilineal manner in which a haplotype of physically linked genetic markers is transmitted unchanged, barring the occasional rare mutation, from father to son. Reduced genetic variability results from: INTRODUCTION 32 • Non-independent segregation of genetic markers on the Y-chromosome • Enhanced genetic drift potential (due to the smaller effective population size of the Y-chromosome – one-fourth that of autosomes) Thus, significantly more Y-chromosome markers would be required to provide the same ability to discriminate individuals (the discriminating power) as that obtained by autosomal STR markers The Y-STRs are polymorphic among unrelated males and are inherited through the paternal line and remains virtually unchanged through many generations. By examining specific locations on the Y chromosome, we can generate a Y-STR profile for each male tested. Males who are related through their fathers will tend to have the same or similar Y-STR profiles, and males who are not related will likely have different Y-STR profiles. In humans, the Y chromosome spans about 58 million base pairs and represents approximately 2% of the total DNA in a male cells. The human Y chromosome contains 86 genes, which code for only 23 distinct proteins. Traits that are inherited via the Y chromosome are called holandric traits. The human Y chromosome is unable to recombine with the X chromosome, except for small pieces of pseudoautosomal regions at the telomeres (which comprise about 5% of the chromosome's length). These regions are relics of ancient homology between the X and Y chromosomes. The bulk of the Y chromosome which does not recombine is called the "NRY" or non-recombining region of the Y chromosome [6]. 2.2Y-STRs applications The analysis of Y-chromosome short tandem repeats (YSTRs) has become a very useful tool, both in evolutionary studies and forensic casework. [7-9] Although more than three hundred STR loci have been described on the Ychromosome a much more limited number have been appropriately evaluated for forensic casework use and some of these have presented a particular challenge for assay design. The Y-STR loci comprise di-, tri-, tetra-, and penta-nucleotide repeats INTRODUCTION 33 with the di-nucleotides exhibiting the most polymorphism but an excessively high level of stutter artifacts. The ability to identify male-specific DNA renders polymorphic Y-chromoso mal sequences an invaluable addition to the standard panel of autosomal loci used in forensic genetics. Y-STR haplotyping is particularly important for sensitive typing of male DNA in mixed stains as well as for rapid assortment of biological crime scene evidence. Males commit the majority of violent crimes. For example, the U.S. Bureau of Justice Statistics reports that males commit about 80% of all violent crimes and 95% of sexual offenses in the United States. Many times autosomal STR (Short Tandem Repeats) markers are able to fully discriminate between unrelated individuals, but there are several circumstances in which Y-chromosome polymorphisms are useful in forensic analysis. In a sexual assault case, evidence, such as vaginal swabs, contain both female and male DNA. Differential extraction is often used to separate the male component from the female component, but sometimes, the two components cannot be separated completely. As a result, the female component could exist prominently even in the male component after separation. When the sample undergoes the PCR amplification process, the female DNA component is amplified as well, sometimes masking the male DNA, which makes analysis difficult. This masking effect obviously does not occur when Y-STRs are examined. Since there is no Y-STR in the female evidence, the only contribution of Y-STR can only come from the assailant(s) in a sexual assault case. So the male component is easily detected, since only this part of DNA will be amplified. Thus the ability to specifically detect a male profile could obviate the need for the time-consuming and frequently inefficient differential extraction procedure for the separation of sperm and non-sperm fractions The Y-STRs analysis is especially helpful when there are more than one assailant since the mixed pattern in the evidence can help to identify them. Y chromosome specific systems may prove invaluable for the identification of the genetic profile of the male component in mixed male/female specimens from nonsexual assault cases, in which the female portion is present in overwhelming INTRODUCTION 34 quantities, (not balanced mixture) where there’s a masking effect due to very small quantity of male DNA in the sample. Performing Y-STR testing can help to identify all males who have contributed to the evidence. Male specific systems may also aid in the investigation of cases involving mixtures or degraded DNA specimens (displaying partial autosomal STR profiles) by providing additional statistical discriminating power, but in some circumstances, YSTR data might be the only data that can be obtained. It is important to note that a YSTR haplotype is shared by males from the same paternal lineage. This fact must be taken into account when drawing conclusions. In fact two individuals that share the same Y-STR haplotype are very likely related through the same paternal line. STRs loci are located on the non-recombining part of the Y-chromosome and, therefore, should be considered linked as a single locus because they are inherited as a block of linked haplotypes, so estimates of the multi-locus frequency cannot proceed by the product rule.[10,11] Although more than three hundred STR loci have been described on the Y-chromosome a much more limited number have been appropriately evaluated for forensic casework use and some of these have presented a particular challenge for assay design. The Y-STR loci comprise di-, tri-, tetra-, and pentanucleotide repeats with the di-nucleotides exhibiting the most polymorphism but an excessively high level of stutter artifacts. Fig.2 : example of Y-STRs markers INTRODUCTION 41 Consider, for example, a case where two sisters are tested to establish whether or not they have the same father, and where DNA profiles are only available for the sisters. In such instances, autosomal DNA markers cannot exclude paternity, since two sisters can inherit different alleles despite being full siblings. The use of X-chromosome markers can, however, exclude paternity, since two sisters would share the same paternal allele if they have the same father. DNA markers on the X-chromosome have been shown to be powerful tools for assigning pedigree members over long distances with respect to X-chromosomal tracks. However, they fail if X-chromosomal lines are interrupted by a father–son relationship. If female individuals have the same father, they always share the same paternal ChrX. An investigation of ChrX markers of two sisters or stepsisters can thus exclude paternity, even if DNA of the parents is not available. So typing of ChrX STR clusters provides a powerful tool. In paternity cases involving close blood-relatives as putative fathers, the exclusion power of STRs is considerably reduced and ChrX STRs may be superior to AS markers. For example, if two alleged fathers are father and son, they would not share any X-chromosomal alleles identical by descent , and hence ChrX markers would be more efficient than AS markers. Brothers, in contrast, share a given maternal ChrX allele with a probability of 0.5, which corresponds to the probability of exactly one allele shared ibd at an AS locus. A specific request for kinship tests in which only remote relatives are available for testing can be expected to arise, particularly from the need to rejoin families in the context of the identification of wars and mass disasters victims or also of world-wide migration. 3.3 Population Study The X-chromosome has features that make it a good source of information for population genetic studies. The X-chromosome is present in a single copy in males, which makes it possible to determine the X-chromosome haplotypes in men. Compared with autosomes, the X-chromosome has lower recombination rate, lower INTRODUCTION 42 mutation rate and smaller effective population size resulting in a faster genetic drift. In consequence, both linkage disequilibrium (LD) and population structure in the X chromosome are expected to be stronger than those in autosomes. Two thirds of the Xchromosome history has been spent in females. Thus, X chromosome polymorphisms mainly reflect the history of females. Due to recombination, X chromosome markers in females provide a multilocus system, while the mtDNA and Y-chromosome are linked haplotypes. Thus, X-chromosome markers are valuable for population genetic studies.[23-26] Furthermore, if other scientific disciplines such as evolutionary anthropology will focus their attention also at ChrX markers, they would need reliable data for ChrX markers found in different ethnics all over the world. Due to the quite different inheritance mode, the ChrX typing can never achieve the same significance in this field as ChrY marker research has obtained. In males, the ChrX marker appears in hemizygous state. Hence, ChrX typing of marker clusters automatically provides haplotypes. Since very closely linked markers regularly exhibit a linkage disequilibrium, hence, frequencies of haplotypes cannot be calculated by multiplicating the frequencies single alleles of the haplotypes involved but they must be estimated by the analysis of population samples. If two or more STR loci are used, the count of haplotypes may extend several hundreds or even more than thousand haplotypes. Thus a X-STR database must consist of haplotype frequencies rather than only allele frequencies. A website (http://www.chrx-str.org/) accessible for the forensic community was established in order to provide a reference database for ChrX STRs and ChrX STR haplotypes comprising published population data for populations from several countries. . INTRODUCTION 43 Fig.4 : Xchromosome ideogram INTRODUCTION 44 4. ALTERNATIVE STRS MARKERS : MINI STRs 4.1 Introduction Degraded DNA samples are commonly observed in forensic investigations involving biological evidence: forensic DNA laboratory often has to deal with DNA samples that are less than ideal. The biological material serving as evidence of a crime may been left exposed to a harsh environment for days, months or even years such as in the case of the investigations of missing person. The victims of homicides are typically taken to out of the way places where they remain until their bodies are discovered. Instead of being preserved in a freezer away from caustic chemicals that can break it down, the DNA molecule may have been left in direct sunlight or in damp woods. Regardless of the situation, the DNA molecules from a crime scene come from a less than pristine environment that is normally found in molecular biology laboratories. Just as important is the fact that the retrieved biological sample may be limited in quantity. Thus accurate sample analysis is critical since a forensic scientist may only obtain enough evidence for one attempt at analysis. [27] The versatility and the unequalled sensitivity of the DNA test has established its use in many forensic case scenario’s. The implementation of the DNA technology has a great impact on how a scene or a victim of crime must be investigated. Investigators have to look for biological traces so tiny that they cannot be detected. In cases where DNA evidence is limited, either in quantity or quality, such as highly degraded samples that are exposed to environmental insults or inhibitors, standard STR testing is often inadequate. Analysis of these compromised DNA samples often result in dropout of the larger STR loci from the sample, and only a partial DNA profile can be obtained.. The problem is further exacerbated when large multiplex PCR reactions are used due to the wide size range of PCR products generated. Partial DNA profiles generally do not provide the power of discrimination to include or exclude a potential contributor to the sample. Recovery of information from these degraded samples is often enhanced by analyzing smaller PCR products called Mini-STRs. This innovative approach exploits the ability of specially designed INTRODUCTION 45 primers that preferentially target the larger STR loci. Reduced-size STR amplicons can be created by moving the forward and reverse PCR primers in close to the STR repeat region. In fact while standard STR primers target longer sequences that include the STR loci, mini-STR primers “zoom in” on the STR locus so that the resulting DNA product is smaller, thereby increasing the chances of successful amplification of the larger loci. This technology dramatically increases the sensitivity of DNA detection and optimizes the opportunity to obtain a DNA profile from compromised samples helping to recover information from degraded DNA samples that typically produce partial profiles and a total loss of information from larger STR amplicons. Fig.5 : Mini Strs primers Because of the ability to type very degraded samples, mini-STR technology provides a useful tool for obtaining data from samples with extremely low DNA quality and INTRODUCTION 46 quantity, that typically produce partial profiles and a total loss of information from larger STR amplicons.[28-30] Thus, many previously unsolvable human identity cases may be resolved with miniSTR technology. MiniSTRs had a fairly macabre introduction into the world of forensics, as they were first used extensively in a forensic lab to help identify the victims of the World Trade Center disaster. They were needed because many of the remains collected from the debris left where the Twin Towers once stood were horribly degraded from fire, heat, and sometimes bacterial degradation. The majority of the bone samples were able to be analyzed and typed via conventional STR analysis. But there was a portion of the samples that were in such poor condition that little to no DNA results could be obtained. Miniaturized STRs primers were at that time in developing by John Butler and Bruce McCord of the National Institute of Science and Technology (NIST). These "MiniSTRs", as they came to be known, were shown to be very successful at amplifying DNA from highly degraded samples—and became really helpful with the most degraded remains from the WTC site in late 2002. [31] 4.2 Mini-STRs applications DNA fragments created through Mini STRs amplification are much smaller than traditional STR analysis, the types of samples that can benefit from this technology are those that are degraded or inhibited. Degraded samples typically can include bones, teeth, burnt items, items exposed to heat and humidity, etc and consist of DNA that is highly fragmented or broken down. Traditional STR typing can work with slightly degraded samples, but as the fragmentation increases even traditional STR markers (large amplicons) may yield a negative result. In addition, forensic samples often contain some substance that slows or inactivates the PCR reaction (inhibitors). Many inhibitors are known to forensic scientists. These include: certain dyes (such as the indigo dye in denim fabrics), humic acid present in some soils, heme from blood samples, melanin from skin and hair samples, and tannins from leather. While traditional STR testing works best with about INTRODUCTION 47 1-2 nanograms of DNA, Mini-STRs are more sensitive.(for example Minifiler kit works between 0.25-0.5 nanograms of DNA and has been shown to yield usable results with even less than this amount of DNA). This sensitivity allows analysts to obtain results from samples with very little DNA quantity. Trace biological evidence arising from casual handling of objects (‘touch DNA’) is increasingly being recovered from crime scenes. Many of these ‘touch DNA’ samples contain low amount of DNA. Recovery of genetic profiles from LCN samples is difficult using standard STR methods and such attempts often result in total failure or recovery of partial profiles. The technology of Mini-STRs, using reduced-size STR amplicons, can help to recover information from these samples, increasing the success rate in difficult sample typing. One prime area for MiniSTR testing is unidentified remains in missing persons cases (DVI). Bones that have been located in sub-optimal conditions, such as buried, underwater, or in locations with high heat and humidity are perfect for MiniSTR analysis. Typically these samples would be analyzed in combination with the traditional STR testing. Traditional testing could allow the analyst to obtain results from the majority of the loci tested, and MiniSTR typing could provide many of the loci that may be missing from the traditional results. Cold cases can also benefit from MiniSTR testing. Samples that even a year or two ago would not be considered good candidates for DNA testing may now yield results with this extremely sensitive systems. However, one must take into account the condition and handling of the sample prior to its arrival in the lab. MiniSTR typing is so sensitive it is possible to pick up DNA from officers or others who may have handled the item years ago. MiniSTR typing opens the doors for a whole new genre of samples in the forensic DNA laboratory. In fact a collaborative study with the European DNA Profiling Group evaluated several methods of analysis to assess how effective each was for genotyping degraded DNA. STR systems (miniSTR assays and standard STR kits) and single nucleotide polymorphisms were compared and in general, miniSTR systems were observed to be the most effective in the analysis of degraded. One major advantage of these smaller STRs, or “miniSTRs,” is that database compatibility can be maintained with convicted offender samples processed using commercial STR multiplexes. In fact 3 new miniSTR loci (D10S1248, D2S441, and INTRODUCTION 48 D22S1045) have been recommended for adoption by the European DNA community as new core loci The addition of new loci into the ESS decreases the chance of obtaining false positive matches with cross-border DNA data exchanges – especially when there are partial (incomplete) profiles, whilst the small amplicon sizes of the new loci increases the chance of amplification in degraded sample, where DNA may be fragmented and/or in low quantity. In addition, these miniSTR markers have the potential to provide additional discrimination in complex paternity cases or missing persons cases. [32,33] INTRODUCTION 49 5. References [1]John M. Butler, Advanced Topics in Forensic DNA Typing Methodology (2011) CRC Accademic Press. [2]Bär W., Brinkmann B., Lincoln P., Mayr W., Rossi U., Budowle B., Eisenberg A., Fourney R., Gill P., Rand S. (1992), Editorial: Recommendations of the DNA Commission of the International Society for Forensic Haemogenetics relating to the use of PCR-based polymorphisms, Forensic Sci. Int. 55, 1-3 [3]Bär W., Brinkmann B., Budowle B., Carracedo A., Gill P., Lincoln P., Mayr W., Olaisen B. (1997), DNA recommendations. Further report of the DNA Commission of the ISFG regarding the use of short tandem repeat systems, Forensic Sci Int. 87(3), 179-4 [4]Bär W., Brinkmann B., Lincoln P., Mayr W., Rossi U., Budowle B., Fourney R., Gill P., Rand S. (1993), Editorial: Statement by DNA Commission of the International Society for Forensic Haemogenetics concerning the National Academy of Sciences report on DNA Technology in Forensic Science in the USA, Forensic Sci.Int.59(1),1-2 [5]Graves, J.A.M. (2006),Sex chromosome specialization and degeneration in mammals, Cell 124 (5): 901–914. [6]de Knijff P., Kayser M., Caglia A., Corach D., Fretwell N., Gehrig C., Graziosi G., Heidorn F., Herrmann S., Herzog B., Hidding M., Honda K., Jobling M., Krawczak, M., Leim K., Meuser S., Meyer E., Oesterreich W., Pandya A., Parson W., Penacino, G., Perez-Lezaun, A., Piccinini, A., Prinz M., Schmitt, C., Schneider,P.M., Szibor R., Teifel-Greding J., Weichhold G. M., and Roewer, L. (1997) Chromosome Y microsatellites: population genetic and evolutionary aspects, Int.J.Legal Med. 110(3): 134-140 INTRODUCTION 50 [7]Kayser M., de Knijff P., Dieltjes P., Krawczak M., Nagy M., Zerjal T., Pandya A., Tyler-SmithC.,and Roewer,L.(1997),Applications of microsatellite-based Y chromosome haplotyping, Electrophoresis. 18: 1602-1607. [8]Butler,J.M.,Kline,M.C.,Decker,A.E.(2008),AddressingY-chromosome short tandem repeat (Y-STR) allele nomenclature.Journal of Genetic Genealogy 4(2):125-148 [9]Gill P., Brenner C., Brinkmann B., Budowle B., Carracedo A., Jobling MA., De Knijff P., Kayser M., Krawczak M., Mayr WR., Morling N., Olaisen B., Pascali V., Prinz M., Roewer L., Schneider PM., Sajantila A., Tyler Smith C. (2001),DNA Commission of the International Society of Forensic Genetics: recommendations on forensic analysis using Y-chromosome STRs., Forensic Sci Int 124(1), 5-10 [10]Gusmao L., Butler JM., Carracedo A., Gill P., Kayser M., Mayr WR., Morling N., Prinz M., Roewer L., Tyler Smith C., Schneider PM. (2006), DNA Commission of the International Society of Forensic Genetics (ISFG): an update of the recommendations on the use of Y-STRs in forensic analysis, Forensic Sci Int 157: 187-97 [11]Kayser, M., Kruger, C., Nagy, M., Geserick, G., de Knijff, P., and Roewer, L. (1998),Y-chromosomal DNA-analysis in paternity testing: experiences and recommendations, Advances in Forensic Genetics 7: 494-496. [12]Roewer L., Krawczak M., Willuweit S.,Nagy M., Alves C., Amorim A., Anslinger K., Augustin C., Betz A., Bosch E., Caglia A., Carracedo Kayser M. et al. (2001), Online reference database of European Y-chromosomal short tandem repeat (STR) haplotypes, Forensic Sci Int 118: 106-13 [13]Willuweit S., Roewer L.(2007), Y chromosome haplotype reference database (YHRD): Update, Forensic Science International: Genetics 1(2), 83-7 INTRODUCTION 57 Single nucleotide polymorphisms within a gene region have often been studied to evaluate their effect on phenotype. Although a single base pair change can produce a phenotypic change, however a phenotype is often influenced by the presence of multiple polymorphisms and their relative positions within a given region. This means that it is essential to study the haplotype, or the combination of multiple SNPs alleles on each chromosome in order to associate genomic changes with a particular phenotype. SNP markers are preferred over microsatellite markers for association studies because of their abundance along the human genome (SNPs with minor allele frequency > 10% occur in 1 of every 600 bp), the low mutation rate and the potential to high-throughput genotyping. Different genotyping applications require screening of different numbers of SNPs. The determination of a single SNP can be sufficient to screen for the presence of a Mendelian disease even if to accurately evaluate whether mutations within a class of genes contribute to a disease, hundreds to thousands of SNPs must be studied in association studies. In fact the number of SNPs required for genomewide association studies depends on the LD pattern. Recent studies have shown that the human genome can be partitioned into discrete blocks of high LD and relatively limited haplotype diversity, separated by shorter regions of low LD. One of the practical implications of this observation is that only a small fraction of all the single-nucleotide polymorphisms (SNPs) (referred as “tag SNPs”) is sufficient to capture most of haplotype structure of the human genome in each block. So it can be extremely useful for association studies in which it is not necessary to genotype all SNPs since it permits significantly to reduce genotyping effort. [4-6] Many efforts in both the public (Human Genome Project) as well as the private (The SNP Consortium) sectors have been made underway to generate high-density SNPs maps that could provide the framework for research studies designed to identify genes involved in the physiology of multigenic diseases, as well as diagnostic markers or responsible of different individual response to drug or pharmaceuticals. INTRODUCTION 58 2. SNPs RESEARCH PROJECT In the past years, several research groups worked to create SNP maps of the human genome. Among these were the U.S. Human Genome Project (HGP) and a group of companies called the SNP Consortium. The U.S. Human Genome Project was a 13-year effort coordinated by the U.S. Department of Energy (DOE) and the National Institutes of Health (NIH) with the aim to discover all the estimated 20,000-25,000 human genes and make them accessible for further biological study. [7] The project begun in October 1990 and originally was planned to last 15 years, but rapid technological advances accelerated the completion date to 2003. In 1998, as a part of the last five years research plans, the DOE and NIH established the following goals about Human Genome Sequence Variation: • Develop technologies for rapid, large-scale identification and/or scoring of single nucleotide polymorphisms and other DNA sequence variants. • Identify common variants in the coding regions of the majority of identified genes during this five-year period. • Create a SNP map of at least 100,000 markers. • Develop the intellectual foundations for studies of sequence variation. • Create public resources of DNA samples and cell lines. The initial aim was briefly reached and widely exceeded since in February 2003 were mapped 3.7 million human SNPs. All data informations are stored in a public database accessible as a common resource for scientits. The SNP Consortium (TSC) was established in april 1999 under the leading of Arthur L. Holden as a collaboration of ten large pharmaceutical companies and the U.K. Wellcome Trust philanthropy.The goal was to discover in two years 300,000 SNPs and to produce a public widely accepted, high-quality SNPs map resource. [8] The international member companies APBiotech, AstraZeneca Group PLC, Aventis, Bayer Group AG, Bristol-Myers Squibb Co., F. Hoffmann-La Roche, Glaxo Wellcome PLC, IBM, Motorola, Novartis AG, Pfizer Inc., Searle, and SmithKline Beecham PLC INTRODUCTION 59 contribuited at least $30 million to the consortium while the Wellcome Trust gave around $14 million. Laboratories funded by these companies to identify SNPs are located at the Whitehead Institute, Sanger Centre, Washington University (St. Louis), and Stanford University. Data management and analysis take place at Cold Spring Harbor Laboratory. The final results largely exceeded the initial purpose and a high-density map with 1.8 million SNPs was created. Now that the first phase of the TSC project is essentially complete, the current goal is to determine the of the allele frequency/genotype frequency of certain SNPs in the major world populations. A public website (http://snp.cshl.org), maintained at Cold Spring Harbor Laboratory, was established to make all TSC project data available to the research community, to provide information about the project itself and also to improve existing data browsing and searching facilities. The mapping of the human genome has made possible to develop a haplotype map in order to better define human SNP variability. The haplotypes map or ‘‘HapMap’’ (www. hapmap.org) is a powerful tool that allow researchers to find genes and genetic variations that affect health and disease. The International HapMap Project is a multi-country effort started on October 2002 as a collaboration among scientists from public and private organizations in six countries (Canada, China, Japan, Nigeria, United States, United Kingdom). The goal of the project is to compare the genetic sequences of different individuals to identify the common patterns of genetic variation in humans. This includes the chromosome regions with sets of strongly associated SNPs, the haplotypes in those regions, the SNPs that tag them, the identification of regions where associations among SNPs are weak. All of the information generated by the Project are released into the public domain, in order to help researchers in finding genes that affect health, disease, and individual responses to therapeutic drugs and environmental factors. By October 2007 more than 3 millions SNPs were found and discovery still continues. [9,10] Genotyping quality was assessed by using duplicate samples, since all centers genotyped a standard set of SNPs and checked some of the genotypes produced by other centers. INTRODUCTION 60 3. RELEVANT SNPs CLASSES 2.1 Autosomal SNPs Highly degraded DNA presents a major challenge to the standard identification markers available for forensic analyses; though shortening the amplified fragments generated in PCR markedly improves genotyping success. The rate of DNA degradation is accelerated by the effect of environmental factors including temperature, humidity, ultraviolet radiation, pH, presence of microorganisms and the localized geochemical properties of the soil. All these factors have a greater bearing on the condition of DNA than the time since deposition or death. Chemical reactions affecting DNA stability and consequently PCR efficiency, can be categorized into three groups: hydrolysis leading to base loss, oxidation leading to base modification and single/ double strand breakage. Post mortem, a corpse is subject to the action of a range of bacterial enzymes originating from the gastro-intestinal tract and from the immediate environment. The principal catalytic activity of bacterial enzymes is to cleave DNA to generate a pool of small oligonucleotides where average fragment sizes and their range of 80–200 base pairs (bp) fall within most forensic markers’ interprimer lengths and therefore compromise PCR amplification efficiency. Short Tandem Repeats (STRs) represent the first-choice markers for forensic identification due in large part to their high discrimination power. However STR analysis of highly degraded samples is often inadequate in terms of profile completeness and this compromises the discrimination power that can be expected from genotyping of these markers alone. The need to decrease amplicon sizes to the smallest possible amplifiable fragments has led to the development of several alternative marker sets specifically aimed at analyzing highly degraded DNA. These include: mini-STRs, and single nucleotide polymorphism (SNPs) [11]. SNPs offer ideal candidate loci for typing degraded DNA due to their simplified binary polymorphisms that allow large-scale multiplexing as well as their obvious potential for designing PCR amplicon sizes in a feasible range of 50–120 bp. INTRODUCTION 61 Unfortunately in the case of identification,the disadvantage, however, is that since the number of alleles per locus is limited, the information content is low. The amount of information from one STR marker is the same as from approximately four SNPs (Sobrino et al., 2005). A SNP with high heterozygosity and essentially identical allele frequencies in all populations would be ideal because the match probability would be nearly constant irrespective of population. High heterozygosity maximizes the information at each SNP and low Fst minimizes the chance effects between populations. Thus, it should be possible to select SNPs that are useful for human identification purposes in the majority of populations, and to supplement these with SNPs showing highly contrasting allele frequency distributions in particular populations. These latter SNPs can provide valuable information for population admixture detection, in addition to the estimation of biogeographical ancestry. In addition autosomal single nucleotide polymorphisms (SNPs) are widely investigated as markers of biogeographical ancestry due to their low mutation rate, high abundance in the genome and wide range of allele frequencies amongst populations. The development of autosomal SNP-based forensic assays which can infer ancestral origin from biological evidence samples has considerable potential in forensic intelligence but is relatively limited, particularly with respect to populations studied. Inferences of ancestry could be utilized to narrow, or create, a pool of suspects particularly when STR profiling has been unsuccessful and when eyewitnesses are unavailable. Such techniques could also assist in the identification of victims in mass disasters and enable more efficient use of police and forensic resources in the early stages of an investigation. 2.2 SNPs on Chromosome Y Males have one X chromosome and one Y chromosome, that contains a gene which triggers the embryonic development as a male. Since some years, Y chromosome analysis has became a common method for tracing human evolution through male lineages as well as application to male identification in INTRODUCTION 62 forensic situations. In fact the ability to separate and identify the male component from evidences containing mixtures of male and female DNA is strongly useful in many forensic situations. In fact, for example in case of sexual assault, the use of Y chromosome specific primers can improve the chances of detecting low levels of the perpretator’s DNA in a high background of the female victim’s DNA without any procedure for differential DNA extraction between male and female cells. Y chromosome analysis can also benefit paternity testing when a male offspring is in question: in fact since fathers pass their Y chromosome onto their sons unchanged (except for an occasional mutation), all males in a paternal lineage will possess a common Y chromosome haplotype. The lack of recombination along most of the Y-chromosome makes it a useful tool in difficult paternity analysis for reconstruction of male linage or application in kinship analysis, in human evolutionary studies and for assessing male migration patterns . To assess the reliability of a database as representation of actual population haplotype frequencies, however the extent of structure among populations also needs to be considered in particular because Y chromosome haploid and paternal mode of inheritance makes it more sensitive to genetic drift than the autosomes. Extensive studies are still performed to identify numerous single nucleotide polymorphisms (SNPs) on the Y chromosome. A variety of polymorphic genetic markers have been identified in the euchromatin portion of the Y-chromosome, including a number of STR and SNPs loci. These SNPs are single base changes or insertion/deletions, which are slowly evolving in comparison with the short tandem repeat markers, which evolve more rapidly. The analysis of single nucleotide polymorphisms located within the malespecific region of the Y-chromosome (MSY) is widely used as a powerful tool for evolutionary studies and for measuring the variability between populations. Every man can trace his Ychromosome back to an ancestor who lived in East Africa around 140.000 years ago. DNA has changed slightly during years: if one brother had a SNP mutation, and another didn't, the brothers go separate ways. Because each of their respective sons had these different mutations and all of their descendants, at the end two large branches of the Y-chromosome tree were created. INTRODUCTION 63 Roughly 80 thousand years ago men decided to move, first just within Africa, but then to every part of the globe and they took this Y-chromosome mutation, (and thus the identifying branch) with them. When men adapted to new surroundings many new mutations in the DNA strand have occurred. Series of mutations form molecular lineages and each SNP mutation may define a set of specific Y chromosomes called haplogroups. Because of the special feature of Y-DNA (no recombination) mutations remain fixed in place on both types of DNA and the historical sequence of these mutations can be inferred. In fact due to the specific distribution of Y-haplogroups among populations, Y-SNP permit to infer the origin, evolution, and history of humans by tracing back male initiated patterns of migration from modern human populations. The non-random distribution of the Y chromosome lineages worldwide permits an accurate characterisation of haplogroups associated with specific geographic areas. [12,13]. At the present day, there are many of these large branches 'haplogroups' (called A trough to R) in different regions around the globe. Even if the validation of the Y chromosome SNPs multiplexes described for forensic application is still in progress, however SNP typing could in a near future significantly contribute to forensic investigation by providing information on the ethnic origin of a male DNA sample and combined with STR markers, could be a powerful tool for mass disasters or terrorist attacks being able to identify people from various geographical areas involved. [14,15] 2.3 SNPs on Chromosome X The X-chromosome is present in a single copy in males, who inherit their one X-Chr from their mother, while female individuals receive one X from the mother and the other one from the father. So, female individuals fathered by the same man share their paternal Chromosome X. Female individuals fathered by the same man share their paternal Chromosome X. INTRODUCTION 64 X chromosome analysis have been proven to be useful in case of deficiency paternity testing and in effective mother-son kinship and father-daughter testing. Hence in case of deficiency paternity in which the mother is available for typing, the possible X alleles of the putative father can be determined and the paternal profile can be reconstructed. [16] The X-chromosome has features that make it a good source of information for population genetic studies. It has a lower recombination and mutation rate than autosomes and also a small population size that results in a faster genetic drift. As consequence the linkage disequilibrium (LD) and population structure in the X chromosome are stronger than in autosomes. X chromosome polymorphisms reflect the history of females: following to recombination, X-chromosome markers in females provide a multilocus system, while the mtDNA and Y-chromosome are linked haplotypes. The transmission pattern of the human X chromosome reduces its population size relative to the autosomes, subjects it to disproportionate influence by female demography, and leaves X-linked mutations exposed to selection in males. As a result, the analysis of X-linked genomic variation can provide insights into the influence of demography and selection on the human genome. X chromosomes tend to be more differentiated between human populations than autosomes with several notable exceptions. Comparisons between genetically distant populations also showed an excess of X-linked SNPs with large allele frequency differences. The relationship between male and female demographic histories is likely to be complex as evidence supporting different conclusions can be found in the same dataset. Although demography may have contributed to the excess of SNPs with large allele frequency differences observed on the X chromosome, however the selection is at least partially responsible. X-chromosome SNPs markers can be used to complement the results obtained from STR markers since they show some advantages compared to STRs such as the low mutation rate, the high number in the human genome and the ability to be typed also in partly degraded samples: all features that makes them particularly useful in forensic caseworks, complex kinship analysis or immigration case. [17,18]. INTRODUCTION 65 2.4 Mitochondrial SNPs Mitochondrial genome is highly polymorphic, making it useful for human identification. The vast majority of the human genome is located within the nucleus of each cell, however also mitochondria which are placed in the cytoplasm, contain a small circular genome. Human mt-DNA was first sequenced in 1981 in the laboratory of Frederick Sanger in Cambridge, England. The original sequence is the reference sequence to which new sequences are compared and is commonly known as the Anderson sequence or the Cambridge reference sequence. Mt-DNA is useul to the forensic DNA community because it can be efficiently amplified from limited or severaly degraded biological material. The likelihood of recovering mtDNA in small or degraded biological samples is greater than for nuclear DNA because mtDNA molecules are present in high copy number (hundreds to thousands) in each cell compared to the nuclear complement of two copies per cell. Therefore samples that lack sufficient nuclear DNA as shed hairs, old bones and in general scarce human remains, even if degraded by environmental insult or time, may provide enough material for typing the mtDNA locus. Unlike nuclear DNA, which is passed from both mother and father to the offspring, mtDNA is only maternally inherited so that in situations where an individual is not available for a direct comparison with a biological sample, any maternally related individual may provide a reference sample. Moreover it has a relatively infrequent mutation rate and it remains the same through many generations. Thus, mt-DNA analysis will not differentiate women that are in the same maternal lineage or children with the same mother.[19,20] Since considerable effort and expense are required to obtain a full HVI (positions 16024–16365 ) and HVII (positions 73–340) mtDNA sequence so several mtDNA screening methods have been developed that permit rapid resolution of nonmatching samples.Moreover the discrimination power of an mtDNA analysis is limited because common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. INTRODUCTION 66 In all this cases it can be useful the analysis of some coding region variations in addition to the non-coding polimorphysms. The sequence analysis of the coding region require more material than the one generally present in forensic samples and for that an alternative SNP analysis approach is possible in order to analyze SNPs polymorphisms within the hypervariable region as well as in the coding region. Even though the number of markers in the current system is limited, it can easily be extended to yield a greater power of discrimination. When fully developed, microarray analysis provides a promising system for efficient sensitive SNP analysis of forensic samples in the future. The typing of mithocondrial SNPs allows the differentiation between individuals possessing an identical HV1/HV2 sequence.[21] Multiplex SNPs panels are in development to resolve mitotypes in some populations such as Caucasian, Hispanic, and African American. For example a set of 11 SNPs has been selected by NIST reserachers for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype. Resolution and detection of products were achieved by electrophoresis on a capillary sequencer The development of the mtSNP 11-plex assay is ian accurate method for typing sequence variant mtSNPs on a platform common to almost all forensic laboratories. Currently are in developing additional multiplex SNP panels to resolve other common mitotypes such as Caucasian, Hispanic, and African American. [22,23]. Therefore, the forensic genetics fields have been increasingly interested in studying these polymorphisms, assembling information on genetic variation of human populations and their history and also using SNPs for individual identification purposes. Coding region SNPs can fulfil a useful role for separating common HV1/HV2 mitochondrial DNA types and assays have been developed to reliably examine mtDNA coding region SNP variation 3. Forensic Applications Since many years forensic laboratories commonly use short tandem repeats (STRs) as the standard DNA identification method, because they have been widely INTRODUCTION 73 SBE, capillary electrophoresis and multicolor detection methods can be applied to forensic caseworks. [29-31]. b) Lineage Informative SNPs Lineage SNPs are placed on the Y chromosome or in mitochondrial DNA genome. They show a lack of recombination and a low mutation rate, so they are informative for evolutionary studies and kinship analyses, in particular in complex cases when the evidence and the reference sample are separated by several generations. In fact the most useful forensic application of lineage SNPs is for missing person or mass disaster identifications, even if the success of analysis in kinship test is limited by the amount of DNA in samples, the number of family members available for comparison, and the characteristics of the used genetic markers. In fact the lineage markers, currently available have a limited power of discrimination. Coble et al. selected for lineage forensic applications 59 SNPs that have been subdivided into 8 different multiplex panels targeting 18 specific common Caucasian HVI/HVII types. [32,33] However other studies are in progress to select more SNPs either on Y chromosome and mt-DNA than on the autosomes that all together may serve as lineage-based markers. [34,35] c) Ancestry Informative SNPs In all cases where no suspects are available for a comparison with an evidentiary sample or not match is found against a DNA database , it may be useful, for investigative purpose, to define the genetic bio geographical ancestry of a perpetrator. Forensic STR loci are powerful identity markers, but they are poor informative as ancestry markers because of the high degree of allele-sharing among different populations. Y chromosome and mt-DNA markers used for evolutionary purposes may give some informations also about the genetic ancestry even they're not good candidates for ancestry studies because of their uniparental inheritance (haplotypes) and limited representation of the human genome. INTRODUCTION 74 Ancestry informative markers (AIMs) are SNPs that reveal ancestral origin of a sample donor but not identify directly physical characteristics. They are distributed throughout all the human genome and show different frequencies in different populations . Tests that infer the ancestral origin of a DNA sample may have a considerable potential in the development of forensic tools that can assist crime investigation. Since this method is based on the correlation of phenotypic expression with certain elements of population ancestry structure, thus it strongly requires the assessment of the genetic variation that correlates with specific populations and the development of specific databases to quantify AIMs. Moreover a complex statistical classification algorithm based on maximum likelihood, is required to predict ancestral origin from the profiles obtained. A reliable forensic test for assigning the most likely ancestry can be achieved from multiplexed assays by choosing SNPs that exhibit significative allele frequency differences between population so to characterize sequences of DNA that are more prevalent in people from one continent than another. The investigation of a series of five unsolved serial murders in southern Louisiana between September 2001 and March 2003 was aided by the use of AIMSNPs. Prior to their use, psychological profiling had indicated the likelihood that a Caucasian male was the culprit. However, AIM-SNP analysis revealed that the killer was likely to be of African-American ancestry. Acting upon this lead, investigators eventually arrested an African-American suspect, Derek Todd Lee and tried him for the murder of Charlotte Murray Pace. Lee was subsequently linked by DNA evidence to seven other homicides from 1998 to 2003. d) Phenotype Informative SNPs The association between genetic variation and phenotypic features has been explored in several studies. The ability to perform genetic typing of biological traces collected at the crime scene, in order to obtain information about a donor’s physical characteristics, is a very attractive prospect for forensic analysis and it could potentially offer a powerful new tool for crime scene investigations. INTRODUCTION 75 SNPs can be taken into consideration as DNA markers for phenotypic traits (eye colour, hair, skin, etc) that enable a genetic prediction of appearance for investigative purpose to identify the perpetrator of a crime. They also may have value in anthropology studies for the reconstruction of unknown human remains. AIMs provide useful information regarding the likely appearance of a suspect connected only with biogeographic ancestry, so they can be indirect measures of the phenotype of an individual. [36] Studies are performed to determine the genetic polymorphisms, simple and complex, responsible for these different phenotypic traits, SNPs in a number of pigmentation genes have been associated with various human hair, skin, and eye colour phenotypes.This requires an assessment of a set of SNPs that strongly affects a specific phenotype as well as development of databases to relate these variants to the specific traits. To date most work on phenotype SNPs has concentrated on pigmentation, since the genetic basis of hair, skin and eye colour is well understood from animal model studies.[37,38] Thus, they have very limited value for describing the physical appearance of an individual and the informative value must be taken into consideration on a case-by case basis. DNA markers that describe phenotypic traits would enable a more precise genetic prediction of appearance for investigative leads to identify the perpetrator of a crime. They also may be of value in anthropology studies for the facial reconstruction of unknown human remains (i.e., the skull). DNA evidence left by a perpretor at a crime scene or on a victim’s body can be analyzed to obtain physical informations about the donor in order to construct a physical portrait of the person , giving an high improvement to the investigation. The most obvious descriptors of an individual’s appearance are colouring, height, and facial features, which are all highly heritable It should therefore be possible to determine responsible for different phenotypic traits variation. [39,40] INTRODUCTION 76 5. REFERENCES [1]Miller, R.D., P. Taillon-Miller, and P.Y. Kwok. (2001), Regions of Low SingleNucleotide Polymorphism Incidence in Human and Orangutan Xq: Deserts and Recent Coalescences,Genomics 71: 78-88. [2]Third International Meeting on Single Nucleotide Polymorphism and Complex Genome Analysis (2000) Eur. J. Hum. Genet. 9, 316-18. [3]Weiner MP, Hudson TJ (2002),Introduction to SNPs: Discovery of Markers for Disease. BioTechniques Suppl:4-7, 12-3 [4]Wang N, Akey JM, Zhang K, Chakraborty R, Jin L(2002), Distribution of recombination crossovers and the origin of haplotype blocks: the interplay of population history, recombination and mutation,Am J Hum Genet 71:1227–1234 [5]Daly MJ, Rioux JD, Schaffner SF, Hudson TJ, Lander ES (2001),High-resolution haplotype structure in the human genome,Nat Genet 29:229–232 [6]Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, De Felice M, Lochner A, Faggart M, Liu-Cordero SN, Rotimi C, Adeyemo A, Cooper R, Ward R, Lander ES, Daly MJ, Altshuler D (2002), The structure of haplotype blocks in the human genome,Science 296:2225–2229 [7]International_Human_Genome_Sequencing_Consortium (2001), Initial sequencing and analysis of the human genome. Nature 409: 860-921. [8]The SNP Consortium Website: Past, Present, and Future (2003),Nucleic Acids Research 31(1), 124-27. INTRODUCTION 77 [9]TheInternational HapMap Consortium (2007), A second generation human haplotype - map of over 3.1 million SNPs ,Nature 449: 851-861 [10]The_International_SNP_Map_Working_Group.(2001),A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms,Nature 409: 928-933. [11]Gill P.(2001),An assessment of the utility of single nucleotide polymorphisms (SNPs) for forensic purposes. Int J Legal Med 114(4–5):204–10. [12]Sobrino B. and Carracedo A. (2005), SNP Typing in Forensic Genetics, Forensic DNA Typing Protocols, 297: 1064-3745 [13]Blanco-Verea A, Brion, M.. Ramos-Luis E,. Lareu, M.V Carracedo A. (2008), Forensic validation and implementation of Y-chromosome SNP multiplexes, For.Sci. Int. Genetics Suppl. Series 1 181–183 [14]Brion M., Sanchez J.J.,. Balogh K, Thacker C., Blanco-Verea A., Børsting C.,. Stradmann-Bellinghausen B,. Bogus M, Syndercombe-Court D., Schneider P.M., A. Carracedo, N. Morling (2006), Analysis of 29 Y-chromosome SNPs in a single multiplex useful to predict the geographic origin of male lineages. ICS 1288, 13– 15 [15]Bouakaze C., Keyser C., Amory S., Crubézy E. and Ludes B.(2007), First successful assay of Y-SNP typing by SNaPshot minisequencing on ancient DNA Int J Legal Med, 121 (6):493-9 [16]Tomas C.,Sanchez J.J.,Castro J.A., Børsting C.,Morling N.,Utility of X-chromoso me SNPs in relationship testing, (2008) For. Sci. Int. Genetics Supplement Series 1: 528–530 INTRODUCTION 78 [17] M.T. Zarrabeitia, V.Mijares and J.A.Riancho (2007),Forensic efficiency of microsatellites and single nucleotide polymorphisms on the X chromosome, Int J Legal Med, 121 (6), 433-437 [18]Tomas C.,Sanchez J.J.,Castro J.A.,Børsting C.,Morling N.(2010), Forensic usefulness of a 25 X-chromosome single-nucleotide polymorphism marker set, Transfusion 50: 2258–2265 [19]Kimberly A. S., Coble M. D., Barritt. S. M., Parsons T. J., Just R. S. (2008),The application of mtDNA SNPs to a forensic case, For. Sci. Int. Genetics Supplement Series 1 :295–297 [20]Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004), Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149 [21]Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005),Mitochondrial DNA typing screens with control region and coding region SNPs, J. Forensic Sci. 50(2): 377-385 [22]Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004), A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome, Int. J. Legal Med. 118: 147-157 [23]Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004),Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians,Int. J. Legal Med. 118: 137-146. [24]Butler J.M., Coble M.D., Vallone P.M. (2007), STRs vs. SNPs: thoughts on the future of forensic DNA testing. Forensic Sci Med Pathol. 3:200–205 201 INTRODUCTION 79 [25]Gill, P., D.J. Werrett, B. Budowle, and R. Guerrieri (2004),An assessment of whether SNPs will replace STRs in national DNA database: joint considerations of the DNA working group of the European Network of Forensic Science Institutes (ENFSI) and the Scientific Working Group on DNA Analysis Methods (SWGDAM), Sci. Justice 44:51-53. [26]Amigo J, Phillips C, Lareu M, Carracedo A.(2008),The SNPforID browser: an online tool for query and display of frequency data from the SNPforID project. Int J Legal Med 2008, 122(5):435-440 [27]Budowle B, van Daal A.(2008),Forensically relevant SNP classes, BioTechniques 44:603-610,2008 pp. 603–610 [28]Sanchez, J.J., Phillips C., Børsting C., Balogh K., Bogus M., Fondevila M., Harrison C.D, Musgrave-Brown E., Salas A., Syndercombe-Court D., Schneider P., Carracedo A., Morling N. (2006), A multiplex assay with 52 singlenucleotide polymorphisms for human identification, Electrophoresis 27:1713-1724. [29]Kidd, K.K., A.J. Pakstis, W.C. Speed, E.L. Grigorenko, S.L. Kajuna, N.J. Karoma, S.Kungulilo, J.J. Kim, et al. (2006), Developing a SNP panel for forensic identification of individuals, Forensic Sci. Int. 164:20-32. [30]J.J. Sanchez,C. Børsting,K. Balogh,B. Berger,M. Bogus,J.M. Butler,A.Carracedo D. Syndercombe-Court L.A. Dixon, B. Filipovi , M. Fondevila, P. Gill, C.D. Harrison, C. Hohoff, R. Huell, B. Ludes, W. Parson, T.J. Parsons,E. Petkovski,C. Phillips, H. Schmitter, P.M. Schneider, P.M. Vallone, N. Morling (2008),Forensic typing of autosomal SNPs with a 29 SNP-multiplex-Results of a collaborative EDNAP exercise, For.Sci.Int. Genet. 2:176-183 [31]Costa G.,Dario P., Lucas I. Ribeiro T., Espinheira R., Geada H.(2008),Autosomal SNPs in paternity investigation. For.Sci.Int. Genet. Suppl. Series 1 :507–509 INTRODUCTION 80 [32]Coble, M.D., R.S. Just, J.E. O’Callaghan, I.H. Letmanyi, C.T. Peterson, J.A. Irwin, and T.J. Parsons (2004),Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians,Int. J. Legal Med.118:137-146. [33] Allan F. McRae, Enda M. Byrne, Zhen Zhen Zhao, Grant W. Montgomery, and Peter M. Visscher (2008),Power and SNP tagging in whole mitochondrial genome association studies,Genome Res. 18(6): 911–917. [34]Frudakis, T., K. Venkateswarlu, M.J. Thomas, Z.Gaskin, S. Ginjupalli, S. Gunturi, V. Ponnuswamy, S. Natarajan, and P.K. Nachimuthu. (2003),A classifier for the SNPbased inference of ancestry,J. Forensic Sci. 48:771-782. [35]Phillips C, Salas A, Sánchez JJ, Fondevila M, Gómez-Tato A, Alvarez-Dios J, Calaza M, de Cal MC, Ballard D, Lareu MV, Carracedo A , SNPforID Consortium. (2007),Inferring ancestral origin using a single multiplex assay of ancestry informative marker SNPs. Forensic Sci Int Genet.1(3-4):273-80. [36]Frudakis, T. N.(2007),Molecular Photofitting: Predicting Ancestry and Phenotype from DNA,Academic Press Publishers (Elsevier), Amsterdam, Netherlands. Edition - 2007-09-21 [37]Grimes, E.A., P.J. Noake, L. Dixon, and A. Urquhart (2001), Sequence polymorphism in the human melanocortin 1 receptor gene as an indicator of the red hair phenotype,Forensic Sci. Int. 122:124-129. [38]Sulem, P., D.F. Gudbjartsson, S.N. Stacey, A. Helgason, T. Rafnar, K.P. Magnusson, A. Manolescu, A. Karason, et al. (2007),Genetic determinants of hair, eye and skin pigmentation,Nat. Genet. 39:1443-1452. INTRODUCTION 81 [39]Sang Hong Lee, Julius H. J. van der Werf, Ben J. Hayes,Michael E. Goddard, and Peter M. Visscher (2008,,Predicting Unobserved Phenotypes for Complex Traits from Whole-Genome SNP, Data PLoS Genet. 4(10). [40]Frudakis, T., M. Thomas, Z. Gaskin, K. Venkateswarlu, K.S. Chandra, S. Ginjupalli, S. Gunturi, S. Natrajan, et al. (2003). Sequences associated with human iris pigmentation,Genetics 165:2071-2083. INTRODUCTION 82 Chapter IV DNA PROCEDURE STANDARDIZATION 1. Introduction Although DNA analysis in most courts is generally admissible in principle, the analysis of the evidence presented by forensics labs is the area that is brought under careful inspection. In many cases, judges have ruled that DNA evidence was not admissible because the analysis did not follow generally accepted principles of forensic analysis. As a new technology, DNA fingerprinting had to be found in each of the courts to satisfy well-established standards for the admissibility of novel scientific evidence. Also, in dozens of cases prosecutors have chosen to withdraw DNA evidence when defence attorneys have hired their own forensic experts who raised questions about the validity of the evidence. As example the DNA results can be ruled inadmissible by the judge and therefore were never presented to the jury. This was not because of a problem with the scientific validity of the test, but the statistics of the result were complicated for example when no sample are available from the reference person. The reliability of the results is maintained by stringent quality management program, which includes proficiency testing, validation studies and quality control procedures. Any scientific test which results in information that may lead to the loss of liberty for an individual accused of a crime needs to be performed with the most care. DNA typing is no exception. It’s a multi step technical process that needs to be performed by qualified and effectively trained personnel to ensure that accurate results are obtained and interpreted correctly. In this perspective laboratory personnel must have the education, training and experience commensurate with the examination and testimony provided. The technical manager or leader and examiner or analyst(s) must stay abreast of developments within the field of DNA typing and also to have a minimum of three years of forensic DNA laboratory experience. INTRODUCTION 89 reagent blanks, and evidentiary samples with low levels of DNA. Consumables may be contaminated during the manufacturing and/or packaging process. Contamination events have shown that these sterilized products can carry DNA from individuals working in the manufacturing and/or packaging process. The Forensic Science Service (FSS) has reported incidents of casework-related STR contamination from staff of plastic ware manufacturers. Investigations carried out by the FSS prompted the novel establishment of a vendor database consisting of DNA profiles from individuals employed by various vendors of consumable products. The database has subsequently sourced unknown profiles developed in the laboratory to the manufacturing process. The first incident in the United States was reported after DNA profiles were uploaded into the Combined DNA Index System (CODIS) and subsequently linked multiple crimes across multiple states. After it was determined that the FSS had also observed this same profile on more than one occasion, it was understood that the profile must have originated from a consumable used in the analysis process. 3) One risk of batch analysis is the inadvertent cross contamination of DNA from one sample to another sample that was processed concurrently. Generally contamination will be from samples with higher concentrations of DNA to those with lower concentration. There are numerous processes that laboratories can establish to minimize the risk of contamination. It is important for each laboratory to assess their specific needs both technically and administratively prior to establishing a process. Laboratories must demonstrate that they have a facility that is designed to minimize contamination. This mainly includes restricting the movement of staff, equipment, and consumables between preand post-amplification areas and also: • Staff training • Quality control testing of reagents and consumables • Storage and treatment of consumables • Implementation of clean techniques INTRODUCTION 90 Laboratory managers should ensure that all laboratory personnel are appropriately trained in the handling and processing of evidence and offender samples. The most effective way of protecting evidence from contamination from investigators and laboratory staff is to use personal protective equipment (PPE), such as gloves, gowns, and masks. In general, universal precaution methods not only protect the investigator and analyst but also ensure that the evidence is protected from contamination by handlers. Negative controls and reagent blanks are critical quality control steps to detect contamination from reagents. Laboratories should run quality control checks on reagents prior to use in casework. These checks assist in determining if a reagent is free of contamination at that time. Negative controls can then be assessed on an ongoing basis to demonstrate that they remain contaminant free. Because many contamination events are sporadic, negative results in these controls do not necessarily mean that samples from the same batch are contaminant free. Additionally, the detection of contamination in these controls does not mean that all batch samples have been affected. Some consumables can be treated with ultraviolet (UV) light and/or autoclaved. These preventive measures may be useful in limiting contamination events even if sometimes may not be entirely effective since they may not penetrate all surfaces of the consumable. Some laboratories have established procedures whereby a percentage of consumables from each lot number is evaluated prior to use in casework. This may be especially useful for laboratories that have observed contamination suspected to be from consumable products. While this approach will not prevent contamination, it can provide data from any profile(s) developed during these checks, which it is recommended that laboratories store their consumables in such a way as to limit exposure to the environment and consider effective pretreatment. One problem with contamination is that an individual may be falsely linked to a crime. Reference samples are generally good quality DNA samples and result in high quantities of extracted DNA. Many laboratories process samples in a way that isolates evidentiary samples from reference samples during the screening, extraction, and PCR stages. Therefore, the possibility of contaminating an evidentiary sample INTRODUCTION 91 with reference DNA is avoided. Most contamination events involve small quantities of DNA and therefore will be detected at lower threshold values. Laboratories establish reporting thresholds based on their validation studies. Because most contamination is below that threshold, it will not be reported; analysts should assess any allelic activity under the reporting threshold to determine if it could be from contamination. As stated above, negative controls and reagent blanks can greatly assist in the detection of contamination. Positive controls and samples from known sources may also aid in the detection of contamination. This because they are single-source samples of a known type so the detection of additional alleles may indicate contamination. It’s known the most likely cause of contamination of evidence is from the staff involved in handling of samples. So it is highly desirable that the laboratory maintains a staff DNA database including everyone involved from collection to completion of analysis. And shall also be expanded to the following: • DNA profiles from contractors who work in the laboratory area • DNA profiles from visitors to the laboratory • DNA profiles from employees of subcontract vendor laboratories The comparison with this database can ensure that no contamination from a staff member is mistakenly reported. It is important to compare the contaminant profiles to: • Other samples from the same batch • Samples from other batches processed in the same time frame • Staff profiles • Previously detected contaminant profiles • Other persons involved in the collection and handling of the evidence INTRODUCTION 92 If the profile contains too few alleles to effectively screen against the above, consideration can be given to boosting the signal strength by using one or more of the following: • Amplifying additional extract • Extending the injection time • Concentrating the extract or amplicon • Increasing the number of PCR cycles The point at which the contamination has occurred may be determined by reworking the samples in reverse in a step-by-step manner . Although alleles under the threshold are not reported in casework, these should be considered when performing investigations/corrective actions to assist in the determination of the source. In conclusion there are four steps to taking corrective actions: • Identify the problem • Determine the root cause • Implement preventive measures • Document the event Each event should be documented and included in the lab documentation: • Description of deficiency • Description of root cause of deficiency • Description of the impact of deficiency on past work and remedial action taken • Description of resolution/completion INTRODUCTION 93 3. REFERENCES [1]Balazic, J. and I. Zupanic (1999),Quality control and quality assurance in DNA laboratories: Legal, civil and ethical aspects, Forensic Sci Int Suppl. no.103:S1–5. [2]DNA Advisory Board (1998)Quality assurance standards for forensic DNA testing laboratories, Forensic Science Communications 2 (3). [3]DNA Advisory Board (1999),Quality assurance standards for convicted offender DNA databasing laboratories,Forensic Science Communications 2 (3). [4]TWGDAM (1989),Guidelines for a quality assurance program for DNA restriction fragment length polymorphism analysis,Crime Lab Dig 16: 40-59. [5]TWGDAM (1991),Guidelines for a quality assurance program for DNA analysis, Crime Lab Dig 18: 44-75. [6]TWGDAM (1993),A guide for conducting a DNA quality assurance audit,Crime Lab Dig 20: 8-18. [7]TWGDAM (1994a),Notes from the Technical Working Group on DNA Analysis Methods,Crime Lab Dig 21: 9-13. [8]TWGDAM (1994b),Notes from the Technical Working Group on DNA Analysis Methods,Crime Lab Dig 21: 69-74. [9]TWGDAM (1995),Guidelines for a quality assurance program for DNA analysis, Crime Lab Dig 22: 21-50. [10]Guidelines for a Proficiency Testing Program for DNA Restriction Fragment Length Polymorphism Analysis, Crime Laboratory Digest, 1990 Vol. 17: 59-64 INTRODUCTION 94 [11]Scientific Working Group on DNA Analysis Methods (SWGDAM)(2001), Training guidelines, Forensic Science Communications 3 (4). [12]Understanding DNA Evidence: A Guide for Victim Serice Providers, May 2001, Brochure, National Institute of Justice and Office for Victims of Crime [13] DNA-Database Management Review And Recommendation ENFSI DNA Working Group - April 2010 [14]National Research Council,The Evaluation of Forensic DNA Evidence, Washington, DC: The National Academies Press, 1996 RESULTS 95 Chapter V : RESULTS In order to treat adequately the aims of the thesis, results of the investigation work have been divided in 2 different groups, each including published (or in process) papers. a) Validation of New STRs Multiplex Investigation was performed in order to validate a previously developed next generation pentaplex, including the new five ESS loci, evaluating the STR data informativeness and success rate on a wide range of forensic samples and to compare its performance with the one of other commercially available kits . 1.Development and validation of a next generation-STR pentaplex, Forensic Sci. Int. Genet. Suppl. 2 (2009) 25-26 2.Casework application of a standalone pentaplex assay of extended-ESS STRs, Legal Medicine (2012), in process. 3. Validation Study of AmpFlSTR NGM SElect™ PCR Amplification Kit, Journal of Forensic and Legal Medicine (2012), inprocess Research article Development and validation of a next generation STR ESS-pentaplex Christopher Phillips a, *, Anna Barbaro b , Luı ´s Fernandez Formoso a , David Ballard c , Denise Syndercombe Court c ,A ´ngel Carracedo a , Maviky Lareu a a Forensic Genetics Unit, Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Spain b Department of Forensic Genetics, SIMEF, Reggio Calabria, Italy c Haematology, ICMS, Barts and The London, UK 1. Introduction Two problems regularly confront forensic DNA analyses with the routine use of standard STRs: insufficient discrimination power and presence of highly degraded DNA where locus and allele dropout can lead to complex interpretative problems. Success with highly degraded DNA is improved using short amplicon mini-STRs. We decided to develop a bolt-on STR pentaplex of five new loci, recommended as next generation markers for the European Standard Set (ESS) in order to generate allele frequency data ahead of the release of ESS kits. The ESS-pentaplex comprises two tried and tested STRs: D12S391 and D1S1656, that are highly informative but with conventional amplicon lengths, plus three mini-STRs: D2S441, D10S1248 and D22S1045 typed with amplicon size ranges 74–135 bp. Space exists in this multiplex amongst the fragment sizes and green/yellow dye labels to allow additional STRs to be included in future. As part of the validation of the ESSpentaplex we assessed its ability to amplify DNA from a range of degraded casework samples including hairs, bones, nails and washed bloodstains. In routine forensic use the ESS-pentaplex provided a valuable additional approach for the analysis of challenging DNA, even when some standard STRs in commercial kits failed or were too weak. 2. Materials and methods As commercial primer designs for the five new ESS STRs are not published we used our original primers for D1 and D12 [1,2] together with those detailed in STRbase from the original developers for D2, D10 and D22 [3]. Amplicon sizes, primer sequences and dye labels are outlined in Table 1. These show that sufficient space exists for inclusion of additional informative STRs such as SE33 or D9S1120 [4] labeled with NED or VIC. For each STR reference ladders were constructed from sequenced alleles using standard procedures as previously described [4]. The quality of results obtained from challenging forensic material was evaluated by assessing the relative performance and locus drop-out of STRs in partial profiles measured as percentage genotyping success. Detectable peaks below a prescribed minimum signal of 100 RFU were also recorded. 3. Results and discussion The percentage genotyping success rates observed in 49 challenging casework samples for Identifiler, MiniFiler and the ESS-pentaplex are summarized in Fig. 1. Although this study examined a wide range of degraded forensic material, the three multiplexes showed a consistent pattern of relative success. The ESS-pentaplex showed an average 97.6% success (94.7% when peaks below 100 RFU were excluded); MiniFiler an average 89.8% (88.0%) and; Identifiler 81.5% (80.8%). Clearly calculating success for the small-scale pentaplex is not completely comparable to larger multiplexes, but the limited number of PCR components Forensic Science International: Genetics Supplement Series 2 (2009) 25–26 ARTICLE INFO Article history: Received 26 August 2009 Accepted 27 August 2009 Keywords: Short tandem repeat STR Human identification Multiplex PCR Degraded DNA ABSTRACT We constructed a simple STR pentaplex of new loci recommended as next generation markers for the European Standard Set (ESS) comprising normal-amplicon STRs: D12S391 and D1S1656, plus miniamplicon STRs: D2S441, D10S1248 and D22S1045. Validation of the pentaplex included evaluation of its ability to amplify DNA from a variety of degraded forensic casework samples. Although the ESSpentaplex was designed in the first instance to generate allele frequency data to supplement existing databases of established STRs, the multiplex proved to be a valuable tool for the analysis of challenging DNA when certain markers of Identifiler or MiniFiler occasionally failed. ß2009 Elsevier Ireland Ltd. All rights reserved. * Corresponding author. Tel.: +34 981 582 327; fax: +34 981 580 336. E-mail address: [email protected] (C. Phillips). Contents lists available at ScienceDirect Forensic Science International: Genetics Supplement Series journal homepage: www.elsevier.com/locate/FSIGSS 1875-1768/$ – see front matter ß2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.fsigss.2009.08.190 96 benefits performance and the pentaplex is an informative supplement to either Identifiler or MiniFiler with better overall chance of success. It is interesting to note that the only ESSpentaplex STR showing locus drop-out (8%) was D10S1248, while both normal-amplicon STRs worked almost as well as the other two mini-STRs that showed complete success with all material genotyped. 4. Conflict of interest statement None. References [1] M.V. Lareu, C. Pestoni, M. Schu ¨renkamp, S. Rand, B. Brinkmann, A ´.Carracedo, A highly variable STR at the D12S391 locus, Int. J. Legal Med. 109 (1996) 134– 138. [2] M.V. Lareu, S. Barral, A. Salas, C. Pestoni, A ´. Carracedo, Sequence variation of a hypervariable short tandem repeat at the D1S1656 locus, Int. J. Legal Med. 111 (1998) 244–247. [3] J.M. Butler, Y. Shen, B.R. McCord, The development of reduced size STR amplicons as tools for analysis of degraded DNA, J. Forensic Sci. 48 (2003) 1054–1064. [4] C. Phillips, A. Rodriguez, A. Mosquera-Miguel, M. Fondevila, L. Porras-Hurtado, F. Rondon, A. Salas, A ´. Carracedo, M.V. Lareu, D9S1120, a simple STR with a common Native American-specific allele: forensic optimization, locus characterization and allele frequency studies, Forensic Sci. Int. Genet. 3 (2008) 7–13. Table 1 PCR primer designs, dye labels and amplicon sizes of the pentaplex STRs. Observed (obs.) allele sizes obtained from an AB 3730xl and POP7. STR Dye PCR primer sequence Obs. repeat numbers Obs. sizes Actual sizes D10S1248 F 6-FAM TTAATGAATTGAACAAATGAGTGAG 8 79 82 R gCAACTCTGGTTGTATTGTCTTCAT 19 123 126 D1S1656 F GTGTTGCTCAAGGGTCAACT 8 131 135 R 6-FAM ctctctctctctctccttGAGAAATAGAATCACTAGGGA 19.3 181 182 D12S391 F AACAGGATCAATGGATGCAT 12 194 197 R 6-FAM TGGCTTTTAGACCTGGACTG 27.2 261 259 D2S441 F VIC CTGTGGCTCATCTATGAAAACTT 8 74 77 R gAAGTGGCTGTGGTGTTATGAT 17 112 113 D22S1045 F NED ATTTTCCCCGATGATAGTAGTCT 9 105 106 R CGGCACAGTGTGAGTGATCAC 19 135 136 Fig. 1. Percent genotyping success for three forensic multiplexes (Identifiler, 15 STRs; MiniFiler, 8; ESS-pentaplex, 5) in 49 challenging casework samples. Multiple overlaying points shown as grey (black if 0%). Points with dark outlines show success when excluding genotype peaks below a prescribed minimum 100 RFU. C. Phillips et al. / Forensic Science International: Genetics Supplement Series 2 (2009) 25–26 26 97 Elsevier Editorial System(tm) for Legal Medicine Manuscript Draft Manuscript Number: Title: Casework application of a stand-alone pentaplex assay of extended-ESS STRs Article Type: Brief Communication Keywords: Extended ESS-STRs; challenging DNA; mini-STRs; D12S391; D1S1656; D2S441, D10S1248; D22S1045 Corresponding Author: Mr. Christopher Phillips, Corresponding Author's Institution: University of Santiago de Compostela First Author: Anna Barbaro Order of Authors: Anna Barbaro; Luis Fernandez-Formoso; Christopher Phillips; Ángel Carracedo; Maria V Lareu Abstract: Using a stand-alone pentaplex comprising two standard-length short tandem repeats (STRs): D12S391 and D1S1656 plus three mini-STRs: D2S441, D10S1248 and D22S1045, all recently adopted to extend the European Standard Set (ESS) STRs, we have examined the genotyping performance of the new markers in 111 challenging casework samples. Although commercial kits now combine the five new STRs with existing core loci, we found the ESS-pentaplex we developed in-house performed better than both MiniFiler (comprising eight miniaturised STRs) and the NGM kit that includes the new STRs in a 15-marker multiplext. Our findings suggest at least part of the improved sensitivity of recently available ESS STRs can be attributed to the loci themselves as well as applying long-standing, robust primer designs that were first designed for the extended ESS markers by the laboratories that originally developed them. Therefore the ESS-pentaplex provides an ideal adjunct to Identifiler or MiniFiler to allow laboratories to assess the new STRs alongside existing standard loci, measure performance with challenging material and generate population frequency data ahead of a final decision on which additional STRs will extend the reconfigured CODIS core set. 98 Table 1. Primer and repeat number details for the five extended ESS STRs typed in the ESS-pentaplex. STR Dye Genotyping Primers Ratio in PCR primer mix Observed repeats Amplicon size range (including tails) Sequencing primers D10S1248 6-FAM TTAATGAATTGAACAAATGAGTGAG 0.75 μl 7 78 (79) CTCTGTATCCCACCCCTG gCAACTCTGGTTGTATTGTCTTCAT 19 126 (127) AAAGCAAACCTGAGCATTAGCC D1S1656 6-FAM GTGTTGCTCAAGGGTCAACT 0.75 μl 8 117 (135) CCATATAAGTTCAAGCCTGTGTT ctctctctctctctccttGAGAAATAGAATCACTAGGGA 19.3 164 (182) GAGAAATAGAATCACTAGGGA D12S391 6-FAM AACAGGATCAATGGATGCAT 0.75 μl 12 197 AGAGACTGTATTAGTAAGGCTTC TGGCTTTTAGACCTGGACTG 27.2 259 TGGCTTTTAGACCTGGACTG D2S441 VIC CTGTGGCTCATCTATGAAAACTT 0.72 μl 8 76 (77) CTGAGCCCTAATGCACCCA gAAGTGGCTGTGGTGTTATGAT 17 112 (113) gAAGTGGCTGTGGTGTTATGAT D22S1045 NED ATTTTCCCCGATGATAGTAGTCT 0.72 μl 9 104 AGCTGCTATGGGGGCTAGATT CGGCACAGTGTGAGTGATCAC 19 134 CGGCACAGTGTGAGTGATCAC Table 2A. Genotyping success of challenging casework samples analyzed with ESS-pentaplex (5-plex), MiniFiler and Identifiler. The case average profile completeness values are listed at the base of the table and multiplex averages (for all profiles and for those with partial data in at least one multiplex). Table 2B. Genotyping success for a different set of challenging casework samples (two partial profile sets of results in common with 2A) analyzed with ESS-pentaplex, NGM and Identifiler. This data underlies the heatmaps of Fig. 1A and 1C respectively. Table(s) 1 and 2 105 2A Full profiles Bloodstains on wood 2 Tooth - pre-molar Nail Bloodstains on cotton 1 Saliva on adesive tape Bone - recently deceased femur Bone 5 years internment 1 Carbonized tissue - 2 Hair root - anagenic 2 Disposable razor 1 Tooth with caries Degraded bone 1 Fingerprints 1 Sweat stains 1 Cigarette butt 2 Fingerprints with DFO 1 Bone 10 years internment 2 Degraded bone 2 Tooth Decomposed tissue Degraded bone 2 Fingerprints 2 Fingerprints with Cyano 1 Paraffin embedded tissue 2 Bloodstains on cotton 2 Fingerprints with Ninhydrin 1 Toothpick 2 Hair root - telogenic 2 Hair root - telogenic 1 Bone - humid environment Bone with putrified tissue Degraded bone 1 Fingerprints with DFO 2 Fingerprints with Ninhydrin 2 Hair shaft Average success across all profiles Average success when partial profiles observed No. of full profiles 125 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 5-plex 10 0 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 80 80 80 100 100 100 100 100 80 40 0 0 80 80 80 93. 3 88. 6 50 MiniFiler 10 0 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 87.5 100 100 100 75 75 75 75 50 62.5 100 100 100 0 0 0 91. 7 85. 7 50 Identifiler 10 0 93. 3 93. 3 86. 7 86. 7 86. 7 80 80 80 80 80 80 73. 3 73. 3 73. 3 66. 7 66. 7 60 20 0 73.3 100 100 80 86. 7 73. 3 66. 7 66. 7 46. 6 40 100 73. 3 66. 7 0 0 0 80. 6 66. 7 28 average success of ESS/MiniFiler 10 0 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 93.7 5 90 90 90 90 87. 5 87. 5 87. 5 87. 5 71.2 5 70 50 50 40 40 40 2B Full profiles Epithelial cells on leather belt Carbonized tissue 3 Saliva stain Molar 5 years internment Bone 5 years internment 2 Washed bloodstain on blue denim 1 Bloodstains with luminol Nasal mucus Handprint on a gun Skull 5 years internment Disposable razor 2 Nail Clavicle 5 years internment Vertebra 5 years internment Jaw 5 years internment Fingerprints with Cyano 3 Bloodstain on blue denim Hair root anagenic 3 Sweath on a balaclava Fingerprints with Cyano 4 Fingerprint on a bullet Hairs from cadaver Washed bloodstains (+luminol) Hair root - telogenic 3 Toothpick 3 Bloodstain on black denim Medulla 5 years Fingerprint on paper Decomposed tissue Blood on leather shoes Washed bloodstains (+luminol) Fingerprints with Ninhydrin 3 Hair root - telogenic 1 Tooth 20 years internment Fingerprints with DFO 3 Washed bloodstains on blue denim 2 Average success across all profiles Average success when partial profiles observed No. of full profiles 6177 78 79 80 81 82 83 84 85 86 87 88 28 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 54 109 110 111 5plex 10 0 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 93. 3 100 100 100 100 93. 3 100 90 80 83. 3 80 100 90 80 80 60 97. 3 95. 3 52 NGM 10 0 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 93. 3 93. 3 100 93. 3 100 87. 5 95 93. 3 93. 3 87 87. 5 86. 7 86. 7 86.7 80 100 80 65 73. 3 80 45 95. 3 91. 9 44 Identifiler 10 0 95 95 93. 3 93. 3 93. 3 93. 3 93. 3 93. 3 93. 3 90 87. 5 86. 7 86. 7 86. 7 86. 7 93. 3 93. 3 80 86. 7 75 90 75 75 73. 3 73 75 66. 7 73. 3 73.3 75 50 30 53. 3 45 30 20 86. 7 77. 0 26 average success of 5plex/ESS/MiniFiler 10 0 98. 3 98. 3 97. 8 97. 8 97. 8 97. 8 97. 8 97. 8 97. 8 96. 7 95. 8 95. 6 95. 6 95. 6 95. 6 95. 5 95. 6 93. 3 93. 3 91.7 90. 3 90. 0 89. 4 88. 9 86. 6 85. 3 84. 4 83. 3 80.0 79. 4 76. 7 70. 0 69. 4 66. 1 63. 3 41. 7 106 Figure 1 Click here to download high resolution image 107 108 Validation Study of AmpFlSTR NGM SElect™ PCR Amplification Kit Anna Barbaroa*, Patrizia Cormacia , Stefano Votanoa, Giacomo Falconea aDept. Forensic Genetics Studio Indagini Mediche E Forensi (SIMEF)- Reggio Calabria - Italy *Corresponding Author Email address: [email protected] (Anna Barbaro) Tel. +39 0965891184 - Fax +39 0965891125 *Title Page (WITH Author Details) 109 Validation Study of AmpFlSTR NGM SElect™ PCR Amplification Kit 1.Introduction The AmpFLSTR NGM SElect™ is a next generation kit developed by Applied Biosystems that contains the 5 new loci specified in the recently expanded European Standard Set of Loci(ESS)together with the remaining markers from the SGM Plus® kit, plus the highly discriminating SE33. This permits exchange of data with several central European countries using SE33 routinely. [1-9] Reformulated reaction reagents and a greater number of loci concentrated in the low molecular weight region deliver greater sensitivity. We performed an internal validation study of the NGM SElect™ Kit in order to evaluate some critical parameters as species specificity, sensitivity, degradation/inhibition study, mixture sample analysis, performance on a wide variety of forensic samples, according to SWGDAM reccomandations [10-12] 2. Materials and Methods DNA samples were extracted by Prepfiler/BTA™ system and quantified using the Quantifiler® Human DNA Quantification kit. PCR amplification was performed in the GeneAmp® PCR Systems 2720 (Applied Biosystems) according NGM SElect™ PCR Amplification kit protocol. PCR products were separated and detected on the AB 3130 Genetic Analyzer using recommended conditions and data analysis performed by GeneMapper® IDX v1.0 software (Applied Biosystems). 2.1 Sensitivity Study DNA quantity affects typing results: too much DNA can result in off scale data and incomplete A nucleotide addition while extremely low quantity can produce unbalanced amplification . Serial two-fold dilutions of 007 human control DNA were made to give final concentrations from 0.5 ng to 0.01 ng per reaction. DNA dilutions were tested in replicates and assessed for the number of alleles detected, intra-colour balance and heterozygote balance. Full profiles were obtained reproducibly with 0.016 ng of input DNA. 2.2 Inhibition Study Inhibitors are often co-extracted and co-purified with the DNA and subsequently interferes with PCR by inhibiting polymerase activity. Two series of test samples were formulated, containing 1ng of 007 DNA Control together with increasing concentrations of haematin as PCR inhibitor (10,50,100,150,200,250 uM). Results were reliable and full profiles were obtained till to the highest concentrations of inhibitor tested. Fig.1 Results from Sensitivity Study Fig.2 Results from Inhibition Study 2.3 Degradation Study As the average size of degraded DNA approaches the size of the target sequence, the amount of PCR product generated is reduced because of the reduced number of intact templates in the size range necessary for amplification *Blinded Manuscript (WITHOUT Author Details) 110 Control DNA 007 was treated with increasing concentration of DNase I (2,4,6,8U) to simulate DNA degradation. The longer loci gradually disappear as the amount of DNase I increases but the 3 new miniSTR (D10S1248, D22S1045 and D2S441) amplify successfully even at 6U DNase. Fig.3 Results from Degradation Study 2.4 Species Specificity Study Nonhuman DNA may be present in forensic casework samples. 27 species (Gorilla, Chimpanzee, Amadriade, Macaque,Fox, Gazelle, Puma, Ox, Sheep, Horse, Goat, Horse, Rabbit, Jaguar, Turkey, Dog, Raccoon, Chicken, Cat, Pig, Rape, Fish, Ram, Hare, Hippo, Panther, Snake) were tested. Chimpanzee and Gorilla DNA samples produced partial profiles, while Macaque DNA produced a strong Amelogenin-X peak and two small out-of-marker-range peaks in PET. Among non-primates, only Horse DNA produced a 96-bp fragment near the Amelogenin locus in the VIC® dye. The other animals did not yield detectable products. Results are outlined in Table 1. Table 1 Results from Species Specificity Study 2.5 Mixture studies Forensic casework samples may contain DNA from more than one individual. Therefore, it is essential to ensure that the DNA typing system is able to detect DNA mixtures. Mixtures of two known DNA samples (from saliva) were examined at various ratios (1:1, 1:3, 1:7, 1:10 1:15). The total amount of genomic input DNA mixed at each ratio was 1 ng. Detection of full profiles for the minor contributor was possible till to ratio 1:10 , while 1:15 ratios resulted in partial profiles for the minor component. Fig4 Results from Mixture studies 2.6 Casework samples Study The ability to obtain results from DNA recovered from biological samples deposited on various substrates and subjected to various environmental and chemical insults has been documented analyzing a wide variety of casework samples (blood, saliva sperm stains, washed bloodstains, cadaveric tissues, bones, teeth, prints, sweat). DNA was than amplified in duplicate using AmpFlSTR Identifiler™ (28cycles) and NGM Select™ (29cycles). The quality of STRs profiles obtained has been evaluated considering peaks balance, preferential amplification, allelic drop-out,etc Genotyping performance of NGM Select™ and Identifiler™ has been compared in 20 casework challenging samples and results are summarized in a heatmap.(Fig.4). NGM SElect genotyping on challenging samples was more sensitive than Identifiler with 7 more complete profiles ( 81,76 % success vs. 42,5%) Samples with low DNA (<100pg) produced no profiles or very little genotyping information with Identifiler™ kit, while they gave successful amplification for some loci by NGM™ . Therefore, even this partial NGM™ kit profile were informative because include the 5 ESS new loci. Different kind of samples at almost the same DNA concentration showed different typing success. This means the nature of the evidence and its storing condition (i.e. environmental factors) have a big impact on final results. Fig.5 Heatmap showing profile completeness ordered, left to right, best to worst 111 The individual performance of each STR in both kits are examined and the average rate of success for each locus is reported in Fig.6: CSF1PO, according to its size, showed the lowest success (20%), while the 2 mini D22S1045 and D2s441 were the most successful loci (97,5%). Fig.6 Average rate of success for each locus 3.Conclusions Results of our validation study demonstrate that NGM SElect™ kit is a reliable multiplex well suited for typing a wide variety of forensic samples. It shows improved performances, especially in regards to its sensitivity and greater tolerance to high levels of PCR inhibitors, allowing maximum recovery of information from difficult samples,producing useful data even when working with very few DNA. STRs profiles by NGM™ were generally better balanced than Identifiler™ one showing clear baseline, less noise and PCR artefacts. This confirms NGM™ multiplex shows a robust PCR chemistry an the improved performance requested by the forensic community for challenging casework samples as well as paternity testing . [13] 4. Ethical standards The study described in the present paper have been carried out using samples taken from people where informed consent had been previously obtained for research studies in accordance with Italian Law D.Lgs. 196/2003 and to approved SIMEF UNI EN ISO 17025 procedure. 5. Conflict of interest None 6. References [1] Lareu M.V., Pestoni C, Schürenkamp M., Rand S., Brinkmann B., Carracedo A., A highly variable STR at the D12S391 locus, Int J Legal Med. 109(3) (1996) 134-138. [2] Lareu M.V., Barral S.,. Salas A, Pestoni C., Carracedo A., Sequence variation of a hypervariable short tandem repeat at the D1S1656 locus. Int J Legal Med. 111(5) (1998) 244-247. [3] Wenda S., Dauber E. M.,. Schwartz M, Jungbauer C.,. Weirich V, Wegener R. and. Mayr W. R, ACTBP2 (alias ACTBP8) is localized on chromosome 6 (band 6q14), Forensic Sci. Int. Volume 148, Issues 2-3, 10 March 2005, Pages 207-209 [4] Coble M.D., Butler J.M., Characterization of new miniSTR loci to aid analysis of degraded DNA, J. Forensic Sci. 50 (2005) 43–53. [5] Olaisen B., Bär W., Brinkmann B., Budowle B.,. Carracedo A, Gill P, Lincoln P., Mayr WR, DNA recommendations 1997 of the International Society for Forensic Genetics.Vox Sang. 1998;74(1):61-3. [6] Gill P., Fereday L., Morling N., Schneider P.M., The evolution of DNA databases recommendations for new European STR loci, Forensic Sci. Int. 156 (2006) 242–244. [7] Gill P., Fereday L., Morling N., Schneider P.M, New multiplexes for Europe. Amendments and clarification of strategic development, Forensic Sci. Int. 163 (2006) 155–157. [8] Butler J. M., Coble M.D.,Regarding nomenclature for new miniSTR locus D10S1248, J. Forensic Sci. 52 (2007) 494. 112 [9] Butler J.M and Coble M.D, Authors' Response to Letter to Editor regarding nomenclature for new miniSTR locus D10S1248]. J. Forensic Sci. 52 (2007) 494 [10]Scientific Working Group on DNA Analysis Methods (SWGDAM),Revised Validation Guidelines, Forensic Sci. Communications (2004) 6(3); [11] Sparkes R., Kimpton C.,. Watson S, Oldroyd N., Clayton T., Barnett L. ,Arnold J., Thompson C., Hale R., Chapman J., Urquhart A. and Gill P., The validation of a 7-locus multiplex STR test for use in forensic casework. (I). Mixtures, ageing, degradation and species studies. Int. J. Legal Med.109 (1996) 186–194. [12]Sparkes R., Kimpton C., Gilbard S., Carne P., Andersen J., Oldroyd N., Thomas D.,Urquhart A., and Gill P., The validation of a 7-locus multiplex STR test for use in forensic casework. (II), Artifacts, casework studies and success rates. Int. J. Legal Med.109 (1996)195–204 [13] Sprecher C.J, McLaren R.S., Rabbach D., Krenke B., Ensenberger M.G., Fulmer P.M. , Downey L., McCombs E., Storts D.G., PowerPlex1 ESX and ESI Systems: A suite of new STR systems designed to meet the changing needs of the DNA-typing community, Forensic Sci. Int. Genet. Supplement Ser 2 (2009) 2–4 113 Table 1: Results from Species Specificity Study Animal DNATested PCR products: size reffered to the closer peak in the human range Amadriade 178 bp (Fam)= allele 17 locus vWA 246 bp (Fam) = allele 19 locus D16 101 bp (Joe) = allele X locus Amelogenin 219 bp (Joe)= allele 32.2 locus D21 Gorilla, chimpanzee 165 bp (Fam) = allele 15 locus vWA 101 bp (Fam) = allele 14 locus D10 156 bp (Pet) = allele 17 locus D3 101 bp (Joe) = allele X locus Amelogenin 149 bp (Joe) = allele 14 locus D8 204 bp (Ned) = allele 9.3 locus TH01 Macaque 97 bp (Fam) = out range locus D10 101 bp (Joe) = allele X locus Amelogenin 170 bp (Joe) = out range locus D3 Horse 96 bp (Joe) = out range locus Amelogenin Fox, Gazelle, Puma, Ox, Sheep, Horse, Goat, Rabbit, Jaguar, Turkey, Dog, Raccoon, Chicken, Cat, Pig, Rape, Fish, Ram, Hare. Hippo, Panther, Snake. no PCR products Table1 114 RESULTS 120 b) Population Study for forensic statistical evaluations We studied the variability in Mediterranean Area in order to create a useful population database, including the well established 15 autosomal STRs together with the 5 new ESS, the SE33 and some sex linked STRs routinely used in forensics. In addition it has been evaluated the variability of the 52 SNPplex recently introduced for forensic applications. 1. Validation of a large Italian Database of 15 STR loci, Forensic Sci Int. 156 (2006):266-268. 2. Allele frequencies of 20 STRs from Northwest Spain (Galicia), Forensic Sci. Int. Genet. 6 (2012) 149–150. 3. Distribution of allele frequencies of 20 STRs loci in a population sample from Calabria, Southern Italy, Forensic Sci. Int. Genet. 6 (2012) 137–138. 4.,Variability of SE33 Locus in 2 Mediterranean Populations, Journal of Forensic and Legal Medicine, (2012) inprocess 5. Distribution of 8 X chromosomal STR loci in an Italian population sample (Calabria) Forensic Sci. Int. Genet. (2012), doi:10.1016/j.fsigen.2012.05.011 6. Genetic sub-structure in western Mediterranean populations revealed by 12 Ychromosome STR loci. Int J Legal Med. 123 (2009) 137-41. 7. Microgeographic variation of Y-chromosome haplotypes in Italy, Forensic Sci. Int. Genet. Suppl. Series 1(2008)239–241  8. Study about the genetic variability of the SNPforID 52-plex panel in Italian population samples, Forensic Sci. Int. Genet. (2012),DOI: 10.1016/j.fsigen.2012.07.002 Announcement of population data Validation of a large Italian Database of 15 STR loci Silvano Presciuttini a,1, *, Nicoletta Cerri b,2 , Stefania Turrina c,2 , Benedetto Pennato a , Milena Alu ` d , Alessio Asmundo e , Anna Barbaro f , Ilaria Boschi g , Loredana Buscemi h , Luciana Caenazzo i , Eugenia Carnevali j , Domenico De Leo c , Cosimo Di Nunno l , Ranieri Domenici m , Michela Maniscalco n , Gabriella Peloso o , Susi Pelotti p , Andrea Piccinini q , Daniele Podini r , Ugo Ricci s , Carlo Robino t , Luigi Saravo u , Andrea Verzeletti b , Marina Venturi v , Adriano Tagliabracci h,3 a Center of Statistical Genetics, SS Abetone e Brennero 2, 56127 Pisa, Italy b Department of Surgery, Radiology and Forensic Medicine, University of Brescia, Italy c Department of Medicine and Public Health, University of Verona, Italy d Department of Morphological and Forensic Sciences, University of Modena, Italy e Institute of Legal Medicine, University of Messina, Italy f Department of Forensic Genetics SIMEF, Reggio Calabria, Italy g Institute of Legal Medicine, Catholic University, Rome, Italy h Chair of Legal Medicine, University of Ancona, Italy i Department of Environmental Medicine and Public Health, University of Padova, Italy j Department of Surgery and Forensic Sciences, University of Perugia and Section of Legal Medicine, Hospital of Terni, Italy l Department of Internal Medicine, University of Bari, Italy m Department of Neurosciences, University of Pisa, Italy n Andros Center srl, Palermo, Italy o Department of Enviromental Medicine and Public Health., University of Pavia, Italy p Department of Medicine and Public Health, Section of Legal Medicine, University of Bologna, Italy q Institute of Legal Medicine, University of Milan, Italy r Genoma srl, Roma, Italy s Center of Medical and Molecular Genetics, Hospital ‘‘A. Meyer’’, Florence, Italy t Department of Anatomy, Pharmacology and Legal Medicine, University of Turin, Italy u Ra.C.I.S., Section of Biology, Messina, Italy v Department of Biomedical Sciences, Section of Legal Medicine, University of Ferrara, Italy Received 14 December 2004; received in revised form 2 March 2005; accepted 2 March 2005 Available online 22 April 2005 Abstract Results from a collaborative exercise with proficiency testing conducted by 20 Italian laboratories on the 15 loci included in the Identifiler 1 kit were analyzed by allele sharing methods and by standard population genetics tests. The validated database, www.elsevier.com/locate/forsciint Forensic Science International 156 (2006) 266–268 * Corresponding author. Tel.: +39 050 2213797; fax: +39 050 2213524. E-mail address: [email protected] (S. Presciuttini). 1 Responsible for data analysis. 2 Exercise coordinator. 3 President of the GeFI. 0379-0738/$ – see front matter #2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.forsciint.2005.03.001 121 including about 1500 subjects, was merged with that of a previous exercise conducted on nine loci, and the resulting allele frequencies, subdivided by Italian region, were published on-line. #2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Identifiler STR; Database validation; Population data Population: Twenty laboratories scattered around Italy (16 from hospitals/universities, three from private companies, one from a national criminal justice service) typed 41– 197 unrelated subjects of both sexes born in their region, totaling 1541 individuals. Extraction: All labs but one extracted at least part of DNA samples from blood; saliva was also used as a source by 11 labs and three labs indicated other additional sources. Extraction methods varied by laboratory; most labs used Chelex-100, others indicated Qiagen, and three used phenol– chloroform; other commercial kits were also indicated (Amersham, Promega, Epicentre, Mac/Nag). PCR: The Identifiler 1 kit (Applied Biosystems) was used by 12 labs; the combination of ProfilerPlus 1 + SGM Plus 1 + Green TM I (Applied Biosystems) was used by two labs, and one lab used a custom multiplex combination; four labs used the combination ProfilerPlus 1 + Cofiler 1 (Applied Biosystems, 13 loci). Typing: Electrophoresis was carried out using five-color capillary separation by 12 labs, whereas six used a four-color separation apparatus. Two labs used vertical gels. Allele call was carried out by the Genotyper 1 software (Applied Biosystem) by 16 labs, whereas four used visual comparison with ladder. Analysis of data: Allele sharing between pairs of individuals within local datasets was analyzed with the Excel workbook AlleleSharingSheet.xls, and allele sharing among the entire database with the program AlleleSharingMacro.xls (both are available at http://statgen.dps.unipi.it/ downloads/). Exact tests for Hardy–Weiberg (HW) equilibrium, F ST analysis and tests of population differentiation were performed by Arlequin 2000 [3]. Homozygosity test was performed by Chi-square. Results: Data of laboratories from the same region were merged. Allele frequencies were available for 12 (out of 20) Italian regions from north, center and south, together representing 77% of the entire Italian population (2001 census [1],Fig. 1). Data from a previous GeFI collaborative exercise [2], which included nine of the 15 loci examined here, were crosschecked against the new database; the repeated samples were discarded, and the two databases were merged. Thus, the final published tables (http://www.gefi-forensicdna.it) include nine loci typed in about 2800 individuals and six loci typed in more than 1500 individuals. Quality control: Blind typing of two stains provided by the organizing committee. Other remarks: Allele sharing analysis allowed correcting local databases for duplicate records and presence of possibly related individuals; global allele sharing analysis highlighted two pairs of individuals typed independently by different laboratories. Analysis of outlier genotypes (those with very low HW or contingency-table expectations) allowed correcting for typos. One lab sample that remained out of HW equilibrium for a locus even after applying the Bonferroni correction was discarded. Allele frequency distributions of 9 of the 15 loci have already been compared across different Italian studies [2]. The other six loci showed frequencies consistent with those published in the following reports (from groups not participating in the present exercise): D2S1338 [4], D16S539 [5], D19S43 [6], CFS1PO– TH01–TPOX [7]. The level of genetic differentiation among regions was low at all loci, so that the overall allele frequencies can be used in general forensic analyses in Italy. This paper follows the guidelines for publication of population data requested by the journal [8]. References [1] ISTAT - 148censimento generale della popolazione e delle abitazioni 2001. Popolazione legale (ISBN: 88-458-1069-0) Roma, 2003. S. Presciuttini et al. / Forensic Science International 156 (2006) 266–268 267 Fig. 1. Map of Italy showing regional boundaries. Numbers are sample sizes of the published database. 122 [2] S. Presciuttini, F. Ciampini, M. Alu `, N. Cerri, M. Dobosz, R. Domenici, G. Peloso, S. Pelotti, A. Piccinini, E. Ponzano, U. Ricci, Adriano Tagliabracci, J.E. Baley-Wilson, Francesco De Stefano and Vincenzo Pascali. Allele sharing in first-degree and unrelated pairs of individuals in the GeFI AmpFlSTR 1 Profiler Plus TM database, Forensic Sci. Int. 131 (2003) 85– 89. [3] S. Schneider, D. Roessli, L. Excoffier, Arlequin (Version 2000): A Software for Population Genetics Data Analysis, Genetics and Biometry Laboratory, University of Geneva, Switzerland, 2000. [4] L. Garofano, M. Pizzamiglio, F. Donato, F. Biondi, M. Rossetti, B. Budowle, Italian population data on two new short tandem repeat loci: D2S1338 and Penta E, Forensic Sci. Int. 105 (1999) 131–136. [5] L. Garofano, M. Pizzamiglio, C. Vecchio, G. Lago, T. Floris, G. D’Errico, G. Brembilla, A. Romano, B. Budowle, Italian population data on thirteen short tandem repeat loci: HUMTH01, D21S11, D18S51, HUMVWFA31, HUMFIBRA, D8S1179, HUMTPOX, HUMCSF1PO, D16S539, D7S820, D13S317, D5S818, D3S1358, Forensic Sci. Int. 97 (1998) 53–60. [6] L. Garofano, M. Pizzamiglio, G.P. Bizzaro, F. Donato, M. Rossetti, B. Budowle, Italian population data on two new short tandem repeat loci: D6S477 and D19S433, Forensic Sci. Int. 101 (1999) 203–208. [7] R. Biondo, A. Spinella, P. Montagna, P.S. Walsh, C. Holt, B. Budowle, Regional Italian Allele frequencies at nine short tandem repeat loci, Forensic Sci. Int. 115 (2001) 95–98. [8] P. Lincoln, A. Carracedo, Publication of population data of human polymorphisms, Forensic Sci. Int. 110 (2000) 3–5. S. Presciuttini et al. / Forensic Science International 156 (2006) 266–268268 123 Forensic Population Genetics—Letter to the Editor Allele frequencies of 20 STRs from Northwest Spain (Galicia) Dear Sir, Allele frequencies and forensic informativeness parameters for 15 established autosomal STRs and 5 new ESS autosomal STRs were obtained from 204 unrelated individuals of Northwest Spain (Galicia) with Identifiler 1 Plus kit of Applied Biosystems (typing D2S1338, D3S1358, D8S1179, D16S539, D18S51, D19S433, D21S11, FGA, TH01, vWA and Amelogenin) and an in-house designed pentaplex typing the five STRs (D1S1656, D2S441, D10S1248, D12S391 and D22S1045) adopted for the European Standard Set (ESS) in 2009 [1–5]. This study followed the guidelines for publication of forensic population data [6] as well as the recommendations of the ISFG with particular reference to the characterization of new forensic STR markers [7,8]. Samples were taken from paternity trios where informed consent had been previously obtained for extended population studies and this procedure was approved by the ethics committee of the University of Santiago de Compostela. DNA was extracted using QIAamp 1 DNA Micro kit and QIAamp 1 DNA Blood Mini kit following the manufacturer’s protocol. DNA quantification were Forensic Science International: Genetics 6 (2012) e149–e150 [(Fig._1)TD$FIG] Fig. 1. Allele frequency distributions observed for 20 STRs in the study population of Galicians from NW Spain (light grey bars) compared with a combined European population group from the HGDP-CEPH genome diversity panel comprising: French from France; French Basque; Adygei from Caucasus; Russian; Orcadian from UK; Sardinian; Tuscan; and North Italian population samples. Contents lists available at SciVerse ScienceDirect Forensic Science International: Genetics journal homepage: www.elsevier.com/locate/fsig 1872-4973/$ – see front matter ß2012 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.fsigen.2012.02.009 124 made using Quantifiler TM Human DNA Quantification Kit (AB) using a 7500 Real-Time PCR System (AB). Electrophoresis was performed using a 3130xl genetic analyzer (AB) with 36 cm capillary filled with POP-4TM Polymer (AB). Allele designations were made following manufacturer’s protocol in the 15 established STRs of Identifiler 1 Plus kit except using 10 m l final PCR volume and for the 5 new ESS as previously described by Phillips et al. [1]. Allele frequency data and basic forensic statistics were obtained with Promega Powerstats software [9] for Galician population data and are outlined in supplementary Table S1. Hardy–Weinberg analysis was made using Arlequin ver. 3.5 [10] and is summarized in supplementary Table S2. No significant deviations from Hardy– Weinberg equilibrium were found. As a point of reference, allele frequency data for combined European populations from the HGDP-CEPH human diversity panel were obtained using the pop.STR database [11] comprising: French from France; French Basque; Adygei from Caucasus; Russian; Orcadian from UK; Sardinian; Tuscan; and North Italian population samples. Summary allele frequencies for this population grouping are shown in supplementary Table S3. A graphic comparison of allele frequency distributions between CEPH Europeans and Galicians for 20 STRs is shown in Fig. 1, indicating very similar frequencies in both populations. We observed that certain alleles are present at low frequency in CEPH European populations but not found in the Galician population studied, these are: CSF1PO Allele: 15; D10S1248 18; D16S539 15; D19S433 13.2; D21S11 35.2; D22S1045 9; D2S1338 11; D2S441 8, 9 and 13.3; FGA 16, 20.2 and 23.2; TH01 11, and; vWA 13. In contrast, three alleles were observed uniquely in the Galician population in STR D19S433: repeats 13.2, 20 and 23. Observed heterozygosity is above 0.650 in all STRs in both the European group and the Galician study population except for TPOX that has a value of 0.647 in the Europe population group. The most informative STR in the Galician population is D12S391 with a discrimination index of 0.900, near identical to the most informative STR in the European population group: D1S1656 that gives a discrimination index of 0.898. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.fsigen.2012.02.009. References [1] C. Phillips, L. Fernandez-Formoso, M. Garcia-Magarin ˜os, L. Porras, T. Tvedebrink, J. Amigo, M. Fondevila, A. Gomez-Tato, J. Alvarez-Dios, A. Freire-Arada, A. GomezCarballa, A. Mosquera-Miguel, A ´. Carracedo, M.V. Lareu, Analysis of global variability in 15 established and 5 new European Standard Set (ESS) STRs using the CEPH human genome diversity panel, Forensic Sci. Int. Genet. 5 (2011) 155–169. [2] M.V. Lareu, C. Pestoni, M. Schurenkamp, S. Rand, B. Brinkmann, A ´.Carracedo, A highly variable STR at the D12S391 locus, Int. J. Legal Med. 109 (1996) 134–138. [3] M.V. Lareu, S. Barral, A. Salas, C. Pestoni, A ´. Carracedo, Sequence variation of a hypervariable short tandem repeat at the D1S1656 locus, Int. J. Legal Med. 111 (1998) 244–247. [4] M.D. Coble, J.M. Butler, Characterization of new miniSTR loci to aid analysis of degraded DNA, J. Forensic Sci. 50 (2005) 43–53. [5] T. Lederer, G. Braunschweiger, Commentary on: Coble MD, Butler JM. Characterization of new miniSTR loci to aid analysis of degraded DNA, J. Forensic Sci. 50 (2005) 43–53, J. Forensic Sci. 52 (2007) 493 and 494. [6] P. Lincoln, A ´. Carracedo, Publication of population data of human polymorphisms, Forensic Sci. Int. 110 (2000) 3–5. [7] W. Ba ¨r, B. Brinkmann, B. Budowle, A ´. Carracedo, P. Gill, P. Lincoln, W.R. Mayr, B. Olaisen, Further report of the DNA Commission of the ISFH regarding the use of short tandem repeat systems. International Society for Forensic Haemogenetics, Int. J. Legal Med. 110 (1997) 175–176. [8] B. Olaisen, W. Ba ¨r, B. Brinkmann, B. Budowle, A ´. Carracedo, P. Gill, P. Lincoln, W.R. Mayr, S. Rand, DNA recommendations 1997 of the International Society for Forensic Genetics, Vox Sang. 74 (1998) 61–63. [9] Promega Powerstats Download Page: http://www.promega.com/geneticidtools/ powerstats/. [10] L. Excoffier, H.E. Lischer, Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows, Mol. Ecol. Resour. 10 (2010) 564–567. [11] J. Amigo, C. Phillips, A. Salas, L. Fernandez-Formoso, A ´. Carracedo, M.V. Lareu, pop.STR—an online population frequency browser for established and new forensic STRs, Forensic Sci. Int. Genet. Suppl. Series 2 (2009) 361–362. L. Fernandez-Formoso C. Phillips * A. Rodriguez R. Calvo Forensic Genetics Unit, Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Galicia, Spain A. Barbaro a,b a Forensic Genetics Unit, Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Galicia, Spain b Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria, Italy M.V. Lareu Forensic Genetics Unit, Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Galicia, Spain A ´. Carracedo a,b a Forensic Genetics Unit, Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Galicia, Spain b Genomics Medicine Group, CIBERER, University of Santiago de Compostela, Galicia, Spain * Corresponding author. Tel.: +34 981 582 327; fax: +34 981 580 336 E-mail address: [email protected] (C. Phillips) 8 November 2011 Forensic Population Genetics—Letter to the Editor / Forensic Science International: Genetics 6 (2012) e149–e150 e150 125 Letter to the Editor Distribution of allele frequencies of 20 STRs loci in a population sample from Calabria, Southern Italy Dear Editor, Allele frequencies of 20 STRs including the 5 new loci (D10S1248, D2S441, D1S1656, D12S391, D22S1045) approved by the European Union Council for the expansion of the European Standard Set (ESS) were calculated from a population sample from Calabria in southern Italy using the Applied Biosystems (AB) AmpflSTR Identifiler TM kit plus a next-generation 5-plex we previously developed as a supplementary assay to Identifiler TM [1–6]. Blood or saliva samples were collected from unrelated healthy donors belonging to the Calabrian population for at least 3 generations. Samples were taken from donors with previously obtained informed consent for population studies in accordance with Italian Law D.Lgs. 196/2003 and approved by SIMEF ISO17025 procedures. DNA was extracted by rapid resin (IstaGene Matrix SystemBiorad) and then quantified with the Quantifiler TM Human DNA Quantification Kit using a 7300 Real Time System kit [7]. PCR amplification was performed using the AmpFlSTR Identifiler TM kit that amplifies the well-established loci: D2S1338, D3S1358, D8S1179, D16S539, D18S51, D19S433, D21S11, FGA, TH01, vWA, and amelogenin. We supplemented this analysis with a pentaplex we designed for the amplification of the five new ESS loci: D10S1248, D22S1045, D2S441, D1S1656 & D12S391, as previously described [8,3]. Positive and negative controls were used during all amplification steps. PCR products were analyzed by capillary electrophoresis with an AB 3130 genetic analyzer and allele assignments made by comparison with Identifiler TM ladder or in the case of the pentaplex typing with reference to sequenced allelic ladders assembled inhouse. For the five new STRs allele designations were determined following the repeat structure changes noted by Coble and Butler [9,10]. Statistical parameters of forensic interest (Dp: power of discrimination, PE: power of exclusion, RMP: random matching probability, etc.) were calculated using PowerStats v.1.2 software [11]. Hardy–Weinberg equilibrium and other population parameters were calculated using Arlequin software v.3.1. [12]. Allelic frequencies for all twenty STRs were compared to previously published population data. No significant differences were found in comparison with other European population data [13–18]. No significant deviations from Hardy–Weinberg expectations were found (p>0.05). In all STRs except TPOX the observed heterozygosity was greater than 0.7, with the highest value in D1S1656. With the exception of D12S391 individual STRs showed a low exclusion power (PE) but the combined PE reached 0.99999999. Combined RMP using 20 loci was calculated to be 4.47 10 24 , therefore used together these twenty loci can distinguish samples with a probability of 99.99999%. Allele frequencies and the resulting statistical parameters are given in Tables 1–2 available as e-components. A population comparison was made between the Italian samples described here and previously available data of Galicia (NW Spain) and the analysis is outlined in Table 3. Allele frequencies from these two southern European populations were very similar for each of the STRs studied. The study laboratory has ISO17025 accreditation and participates in the quality control/proficiency testing of the GEP-ISFG WG (www.gep-isfg.org). This paper follows the guidelines for publication of population data requested by the journal. [19]. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.fsigen.2012.02.006. References [1] M.V. Lareu, C. Pestoni, M. Schu ¨renkamp, S. Rand, B. Brinkmann, A. Carracedo, A highly variable STR at the D12S391 locus, Int. J. Legal Med. 109 (1996) 134–138. [2] M.V. Lareu, S. Barral, A. Salas, C. Pestoni, A. Carracedo, Sequence variation of a hypervariable short tandem repeat at the D1S1656 locus, Int. J. Legal Med. 111 (1998) 244–247. [3] M.D. Coble, J.M. Butler, Characterization of new miniSTR loci to aid analysis of degraded DNA, J. Forensic Sci. 50 (2005) 43–53. [4] B. Olaisen, W. Ba ¨r, B. Brinkmann, B. Budowle, A ´. Carracedo, P. Gill, P. Lincoln, W.R. Mayr, S. Rand, Vox Sang. 74 (1998) 61–63. [5] P. Gill, L. Fereday, N. Morling, P.M. Schneider, The evolution of DNA databases recommendations for new European STR loci, Forensic Sci. Int. 156 (2006) 242– 244. [6] P. Gill, L. Fereday, N. Morling, P.M. Schneider, New multiplexes for Europe. Amendments and clarification of strategic development, Forensic Sci. Int. 163 (2006) 155–157. [7] P.S. Walsh, D.A. Metzger, R. Higuchi, Chelex 100 as a medium for the simple extraction of DNA for PCR-based typing from forensic materials, Biotechniques 10 (1991) 506–513. [8] C. Phillips, A. Barbaro, L. Fernandez-Formoso, A. Carracedo, M.V. Lareu, Development and validation of a next generation-STR pentaplex, Forensic Sci. Int. Genet. (Suppl. 2) (2009) 25–26. [9] J.M. Butler, M.D. Coble, Regarding nomenclature for new miniSTR locus D10S1248, J. Forensic Sci. 52 (2007) 494. [10] J.M. Butler, M.D. Coble, Author’s response to letter to editor regarding nomenclature for new miniSTR locus D10S1248, J. Forensic Sci. 52 (2007) 494. [11] A. Tereba, Tools for analysis of population statistics, Profiles in DNA 9 (1999) 14– 16 (free software distributed at http://www.promega.com/geneticidtools). [12] L. Excoffier, G. Laval, S. Schneider, Arlequin ver. 3.0: an integrated software package for population genetics data analysis, Evol. Bioinform. (Online) 1 (2005) 47–50. [13] P.Hatzer-Grubwieser,B.Berger,D. Niederwieser,M. Steinlechner,Allelefrequencies and concordance study of 16 STR loci—including the new European Standard Set (ESS)loci-in anAustrian population sample, Forensic Sci. Int. Genet. 6 (2012) 50–51. [14] M. Arlindo, T. Lagoa, V. Martins, L.M. Caine ´,M.Fa ´tima Pinheiro, Allele frequencies of six miniSTR loci in the population of Northern Portugal, Forensic Sci. Int. Genet. 2 (2008) 379–381. Forensic Science International: Genetics 6 (2012) e137–e138 Contents lists available at SciVerse ScienceDirect Forensic Science International: Genetics journal homepage: www.elsevier.com/locate/fsig 1872-4973/$ – see front matter ß2012 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.fsigen.2012.02.006 126 [15] V. Lopes, A. Serra, J. Gamero, L. Sampaio, F. Balsa, C. Oliveira, L. Batista, F. CorteReal, D.N. Vieira, M.C. Vide, M.J. Anjos, M. Carvalho, Allelic frequency distribution of 17 STRs from Identifiler and PowerPlex-16 in Central Portugal area and the Azores archipelago, Forensic Sci. Int. Genet. 4 (2009) e1–e7. [16] F. Brisighelli, C. Capelli, I. Boschi, P. Garagnani, M.V. Lareu, V.L. Pascali, A. Carracedo, Allele frequencies of fifteen STRs in a representative sample of the Italian population, Forensic Sci. Int. Genet. 3 (2009) 29–30. [17] A. Berti, F. Brisighelli, A. Bosetti, E. Pilli, C. Trapani, V. Tullio, C. Franchi, G. Lago, C. Capelli, Allele frequencies of the new European Standard Set (ESS) loci in the Italian population, Forensic Sci. Int. Genet. 5 (2011) 548–549. [18] L. Fernandez-Formoso, C. Phillips, A. Rodriguez, R. Calvo, A. Barbaro, M.V. Lareu, A. Carracedo, Allele frequencies of 20 STRs from Northwest Spain (Galicia), Forensic Sci. Int. Genet. 6 (2012) e149–e150. [19] A. Carracedo, J.M. Butler, L. Gusmao, W. Parson, L. Roewer, P.M. Schneider, Publication of population data for forensic purposes, Forensic Sci. Int. Genet. 4 (2010) 145–147. Anna Barbaro a,b, * a Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria, Italy b Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Spain Chris Phillips Luis Fernandez Formoso Maria Victoria Lareu A ´ngel Carracedo Institute of Legal Medicine, University of Santiago de Compostela, Santiago de Compostela, Spain *Corresponding author at: Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria, Italy E-mail address: [email protected] (A. Barbaro) 7 December 2011 Letter to the Editor / Forensic Science International: Genetics 6 (2012) e137–e138 e138 127 128 VARIABILITY OF SE33 LOCUS IN 2 MEDITERRANEAN POPULATIONS A.Barbaroa * M. Cassar b P.Cormacia J. C. Grech b aStudio Indagini Mediche E Forensi (SIMEF), Reggio Calabria , Italy b MLS BioDNA , Paola, Malta. *Corresponding Author Studio Indagini Mediche E Forensi (SIMEF) Via Nicolò da Reggio 4, Reggio Calabria , Italy Fax +390965891125 Email address: [email protected] *Title Page (WITH Author Details) 129 haplotype regional database and to evaluate sub-structuring of geographical sub-sets in this Mediterranean region. Materials and methods Population samples Blood samples were obtained from 554 unrelated males belonging to seven populations in the western Mediterranean area (Figure shown in ESM 1)—three Spanish populations: Valencia (eastern coast of the Iberian Peninsula; n=59), Majorca (n=91) and Ibiza (n=96) (Balearic Islands) and four Italian populations: Sicily (n=115) and three populations from the region of Calabria (southern Italy), Reggio Calabria (n=97), Cosenza (n=37) and Catanzaro (n=59). Protocols were approved by the Danish local ethical committee (KF-01-037/03). DNA was extracted by using QIAamp spin columns (Qiagen, Hilden, Germany) following the manufacturer’s recommendations. Y-STR typing Amplification of the 12 Y-chromosome STRs loci DYS19, DYS389 I/II, DYS390, DYS391, DYS392, DYS393, DYS385 a/b, DYS437, DYS438 and DYS439 was carried out according to the kit Powerplex® Y System protocol, from 2 ng DNA template in a 10-μl final reaction volume, using a GeneAmp PCR system 2400 Thermal Cycler (Perkin-Elmer, Waltham, MA, USA). For genetic typing, an ABI PRISM® 3100 Genetic Analyser along with GeneScan® 3.7 and Genotyper® v. 3.7 software (Applied Biosystems, Foster City, CA, USA) were used. All samples were tested twice. Allelic designation was based on comparison to the Powerplex® Y System allelic ladder. Allele nomenclature was according to the ISFG guidelines [16]. Sequence analysis A new variant allele was sequenced on both strands. Briefly, the samples were amplified using unlabelled primers [3], amplicons were purified with a QIAquick PCR purification kit (Qiagen) and the sequence was determined using the Big Dye® Terminator Cycle Sequencing kit v. 3.1 (Applied Biosystems) and an ABI PRISM® 3130 Genetic Analyser (Applied Biosystems). Sequences were aligned using the Bioedit program v. 7.0.5.3 [17]. Quality control Proficiency testing of the Spanish and Portuguese Working Group of the International Society for Forensic Genetics (GEP-ISFG, http://www.gep-isfg.org/) was carried out as quality control. Statistical analysis Allele and haplotype frequencies were estimated by gene counting. Haplotype and gene diversities, population differentiation parameters (F ST and R ST ) and analysis of molecular variance (AMOVA) were calculated using ARLEQUIN v. 3.01 [11]. Discrimination capacity was calculated as the percentage of different haplotypes and haplotype match probability as 1-haplotype diversity. All statistical parameters were calculated for both minimal and extended haplotypes. In order to examine the relationship of the populations studied with other neighbouring populations, Reynolds’ genetic distances [30], calculated using PHYLIP v. 3.67 [12], were used to generate the multi-dimensional scaling (MDS) plot performed using the SPSS v. 15.0 (SPSS, Inc., Chicago, IL, USA). Results and discussion Allele frequencies and gene diversities of each Y-STR of the populations under study are shown in the table in ESM 2. DYS392 and DYS438 showed bimodal distribution of allele frequencies. In DYS392, modality was shared by DYS39211 and DYS392-13 alleles, with DYS392-13 the most common allele amongst the Spanish populations and DYS392-11 the most frequent in southern Italy. These results are consistent with previous studies showing a longitudinal decrease of frequencies from the west to the east of the European landscape for DYS392-13 and, conversely, a decrease in the opposite direction for DYS392-11. The Neolithic demic diffusion could explain these two opposite patterns, with the DYS392-13 allele present in the proto-European gene pool [27,28]. The clinal frequency pattern observed in the DYS438 system, with DYS438-12 as the most frequent in the Spanish and Sicilian populations and DYS438-10 the most frequent in Calabria, could also be due to the same Neolithic effect. Gene diversities ranged from around 0.85 (in DYS385) to approximately 0.50 (in DYS392). Generally, Italian populations had higher gene diversities than the Spanish populations, following the same pattern found in bi-allelic Y-chromosome markers, with an increasing diversity trend from Spain to Greece, maybe due to the impact of the arrival of haplotypes in Europe from the Middle East [13]. Ibiza showed especially low gene diversities for DYS389II, DYS390, DYS391, DYS385, DYS438 and DYS439 loci. Extra peaks were reproducibly obtained at DYS19 and DYS385, representing the presence of duplicated regions in 138 Int J Legal Med (2009) 123:137–141 136 the Y-chromosome (e.g. [2,6,19,20,32]). Duplications were observed in six individuals: at locus DYS19, alleles 13 and 14 (once) and at loci DYS385, alleles 13–14–15 (once), 13–17–18 (twice) and 13–18–19 (twice). Three alleles not included in the Powerplex® Y allelic ladder were observed. DYS438-7 and DYS438-13 alleles have been reported in other populations (e.g. [8,23]), but to our knowledge, DYS19-9 has not been reported before. Sequence analysis (GenBank: FJ196286) confirmed the number of repeats attributed: (TAGA) 3 tagg(TAGA) 6 . Amongst the 554 western Mediterranean males analysed, 443 different haplotypes were observed (Table in ESM 3), of which 372 were only observed once. The other haplotypes were shared by two to seven men. The most frequent haplotypes were h314 (15–12–29–22–10–11–14–14,14–16– 10–12) and h356 (15–13–29–24–11–13–13–11,14–14–12– 13), both found in seven men from the Ibiza population but absent from the other studied populations. The haplotypes (without locus DYS437, not included in the YHR database) were searched against the haplotypes in the YHRD (release 18), and 149 haplotypes were matched to at least one YHRD sample. The most frequent haplotypes h314 and h356 matched with three and six samples of European origin, respectively, in a worldwide database of 38,761 haplotypes. It is noteworthy that 46 of the other haplotypes (almost all from Valencia, the Balearic Islands and Sicily) matched with north African or African samples. This result is concordant with other studies showing African influences in these Mediterranean populations (e.g. [14,15,24,35]). Table 1shows the forensic parameters for the 12-loci Powerplex® Y System haplotypes compared with the diversity values of haplotypes based on the nine-loci minimal haplotype. The overall haplotype diversity only increased by 0.20% (ranging from 0% for Cosenza to 1.15% for Ibiza) by using the 12-loci Powerplex® Y System instead of the minimal haplotype. The discrimination capacity ranged from 87.63% (Reggio Calabria) to 94.92% (Valencia) except in the Ibizan population (56.25%). Ibiza also showed a reduced genetic diversity in previous genetic studies [24,25,37]. These results are in accordance with the historical and demographic data of the island population (an isolated, consanguineous population with a reduced effective population size) [1,22]. Therefore, the high haplotype match probability in Ibiza (1.93%) must be taken into account in forensic practice. AMOVA analysis of the seven Mediterranean populations showed a significant value (F ST =0.0499, P<0.0001). Pairwise analyses (Table in ESM 4) evidenced two Table 1 Forensic parameters for the seven western Mediterranean populations studied using the minimal and the Powerplex® Y haplotypes Ibiza (n=96) Majorca (n=91) Valencia (n=59) Sicily (n=115) Catanzaro (n=59) Cosenza (n=37) R. Calabria (n=97) Total (n=554) Minimal 9 Y-STR haplotype Number of haplotypes 43 74 49 98 52 33 83 379 Unique haplotypes 19 53 37 72 37 23 58 299 Haplotype diversity ± SD 0.9695± 0.0061 0.9927± 0.0035 0.9930± 0.0047 0.9968± 0.0018 0.9959± 0.0039 0.9925± 0.0088 0.9968± 0.0020 0.9968± 0.0006 Discrimination capacity (%) 44.79 81.32 83.05 85.22 88.14 89.19 85.57 68.41 Match probability (%) 3.05 0.73 0.70 0.32 0.41 0.75 0.32 0.32 Powerplex 12 Y-STR haplotype Number of haplotypes 54 82 56 103 54 33 85 443 Unique haplotypes 30 70 49 86 43 26 68 372 Haplotype diversity ± SD 0.9807± 0.0050 0.9968± 0.0025 0.9982± 0.0035 0.9976± 0.0017 0.9971± 0.0037 0.9925± 0.0088 0.9972± 0.0020 0.9988± 0.0002 Discrimination capacity (%) 56.25 90.11 94.92 89.57 91.53 89.19 87.63 79.96 Match probability (%) 1.93 0.32 0.18 0.24 0.29 0.75 0.28 0.12 -2.0 1.0 -4.0 3.0 Italy Tunisia Majorca Ibiza Valencia Pyrenees Portugal Denmark Sicily Catanzaro Cosenza R.Calabria Balkans Barcelona Spain Dimension 1 Dimension 2 Fig. 1 MDS plot based on Reynolds’distances (Spain [23], Pyrenees [21], Barcelona [33], Portugal [26], Italy [29], the Balkans [5], Tunisia [9], Denmark [18], Majorca, Valencia, Ibiza, Catanzaro, Cosenza, Reggio Calabria and Sicily (this study)) Int J Legal Med (2009) 123:137–141 139 137 significantly different sub-sets: one with the Spanish populations (Valencia, Ibiza and Majorca) and another with the Calabrian samples (Catanzaro, Cosenza and Reggio Calabria). Sicily was closer to the Italian than to the Spanish populations, although presented significant differences with Reggio Calabria (P<0.005). Significant differences between groups (F CT =0.0603, P<0.0001) were found with a three-hierarchical AMOVA performed grouping the populations according to pairwise analysis results (Spanish populations, Sicily and Calabrian populations). Figure 1shows a multi-dimensional scaling plot where 15 populations have been included. The Tunisia population showed a displaced position, in accordance with other studies that have suggested that the Mediterranean Sea may have acted as a relative north-to-south geographic barrier to gene flow [4,10,28]. With the exception of Sicily and Ibiza, the Spanish and Italian populations under study grouped together with other Spanish and Italian samples, respectively. On the one hand, Sicily presented an intermediate position between Italian and Spanish populations. No consensus on the genetic landscape of the Sicilian population has been established to date. Whilst some authors claim the differentiation of the Sicilian population from Italy and from the western Mediterranean basin [7,31], other studies indicate Sicily is closely related to other Italian populations [13,15,34]. On the other hand, Ibiza showed a large distance from the Spanish group, in accordance with the fact that Ibiza has important historical and genetic differences from other insular and continental populations in the western Mediterranean area [24,25,37]. In conclusion, the results of the present study provide a useful Y-STR haplotype dataset, for the western Mediterranean region, where some geographical and/or cultural isolates exist based on demographic, historical and genetic data. A clear genetic sub-structure between population groups (Spanish, Sicilian and Calabrian populations) was observed. Therefore, local databases must be used in the forensic field to correctly weigh the value of the evidence of a Y profile match. Special care should be taken in male identification in the Ibizan population, due to the very low discrimination capacity found for the 12 Y-STR loci included in the Powerplex® Y System. Acknowledgements This work was partially supported by grants PRDT-2003-12099 and PRDIB-2006-687872 from the Direcció General de R+D+I (Comunitat Autònoma de les Illes Balears) and by Ellen and Aage Andersen’s Foundation. References 1. Alarco Von Perfall C (1981) Cultura y personalidad en Ibiza. Editora Nacional, Madrid 2. Balaresque P, Parkin EJ, Roewer L et al (2008) Genomic complexity of the Y-STR DYS19: inversions, deletions and founder lineages carrying duplications. Int J Legal Med (in press) 3. Beleza S, Alves C, González-Neira A, Lareu M, Amorim A, Carracedo A, Gusmão L (2003) Extending STR markers in Y chromosome haplotypes. Int J Legal Med 117:27–33 4. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J (2001) High-resolution analysis of human Ychromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. Am J Hum Genet 68:1019–1029 5. Bosch E, Calafell F, González-Neira A et al (2006) Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns. Ann Hum Genet 70:459–487 6. Butler JM, Decker AE, Kline MC, Vallone PM (2005) Chromosomal duplications along the Y-chromosome and their potential impact on Y-STR interpretation. J Forensic Sci 50:853–859 7. Calò CM, Garofano L, Mameli A, Pizzamiglio M, Vona G (2003) Genetic analysis of a Sicilian population using 15 short tandem repeats. Hum Biol 75:163–178 8. Chang YM, Perumal R, Keat PY, Kuehn DL (2007) Haplotype diversity of 16 Y-chromosomal STRs in three main ethnic populations (Malays, Chinese and Indians) in Malaysia. Forensic Sci Int 167:70–76 9. Cherni L, Pereira L, Goios A et al (2005) Y-chromosomal STR haplotypes in three ethnic groups and one cosmopolitan population from Tunisia. Forensic Sci Int 152:95–99 10. Comas D, Calafell F, Benchemsi N, Helal A, Lefranc G, Stoneking M, Batzer MA, Bertranpetit J, Sajantilla A (2000) Alu insertion polymorphisms in NW Africa and the Iberian peninsula: evidence for a strong genetic boundary through the Gibraltar straits. Hum Genet 107:312–329 11. Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol Bioinf Online 1:47–50 12. Felsenstein J (2007) PHYLIP (Phylogeny Inference Package) version 3.67. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle 13. Francalacci P, Morelli L, Underhill PA et al (2003) Peopling of three Mediterranean islands (Corsica, Sardinia, and Sicily) inferred by Y-chromosome biallelic variability. Am J Phys Anthropol 121:270–279 14. Gérard N, Berriche S, Aouizerate A, Dieterlen F, Lucotte G (2006) North African Berber and Arab influences in the western Mediterranean revealed by Y-chromosome DNA haplotypes. Hum Biol 78:307–316 15. Ghiani ME, Piras IS, Mitchell RJ, Vona G (2004) Y-chromosome 10 locus short tandem repeat haplotypes in a population sample from Sicily Italy. Legal Med 6:89–96 16. Gusmão L, Butler JM, Carracedo A et al (2006) DNA Commission of the International Society of Forensic Genetics (ISFG): an update of the recommendation on the use of Y-STRs in forensic analysis. Int J Legal Med 120:191–200 17. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 18. Hallenberg C, Nielsen K, Simonsen B, Sánchez J, Morling N (2005) Y-chromosome STR haplotypes in Danes. Forensic Sci Int 155:205–210 19. Hohoff C, Dewa K, Sibbing U, Hoppe K, Forster P, Brinkmann B (2007) Y-chromosomal microsatellite mutation rates in a population sample from northwestern Germany. Int J Legal Med 121:359–363 140 Int J Legal Med (2009) 123:137–141 138 20. Lim SK, Xue Y, Parkin EJ, Tyler-Smith C (2007) Variation of 52 new Y-STR loci in the Y Chromosome Consortium worldwide panel of 76 diverse individuals. Int J Legal Med 121:124–127 21. López AM, Alvarez S, Gusmão L et al (2004) Population data for 16 Y-chromosome STRs in four populations from Pyrenees (Spain). Forensic Sci Int 140:125–129 22. Macabich I (1966) Historia de Ibiza. Volumen I. Daedalus, Palma de Mallorca 23. Martín P, García-Hirschfeld J, García O et al (2004) A Spanish population study of 17 Y-chromosome STR loci. Forensic Sci Int 139(1):231–235 24. Picornell A, Gómez-Barbeito L, Tomàs C, Castro JA, Ramon MM (2005) Mitochondrial DNA HVRI variation in Balearic populations. Am J Phys Anthropol 128:119–130 25. Picornell A, Miguel A, Castro JA, Ramon MM, Arya R, Crawford MH (1996) Genetic variation in the population of Ibiza (Spain): genetic structure, geography and language. Hum Biol 68:899–913 26. Pontes ML, Cainé L, Abrantes D, Lima G, Pinheiro MF (2007) Allele frequencies and population data for 17 Y-STR loci (AmpFlSTR Y-filer) in a northern Portuguese population sample. Forensic Sci Int 170:62–67 27. Quintana-Murci L, Semino O, Minch E, Passarino G, Brega A, Santachiara-Benerecetti AS (1999) Further characteristics of proto-European Y chromosomes. Eur J Hum Genet 7:603–608 28. Quintana-Murci L, Veitia R, Fellous M, Semino O, Poloni ES (2003) Genetic structure of Mediterranean populations revealed by Y-chromosome haplotype analysis. Am J Phys Anthropol 121:157–171 29. Rapone C, Geraci A, Capelli C et al (2007) Y chromosome haplotypes in central-south Italy: implication for reference database. Forensic Sci Int 172:67–71 30. Reynolds J, Weir BS, Cockerham CC (1983) Estimation of the coancestry coefficient: basis for a short-term genetic distance. Genetics 105:767–779 31. Robino C, Inturri S, Gino S et al (2006) Y-chromosomal STR haplotypes in Sicily. Forensic Sci Int 159:235–240 32. Roewer L, Willuweit S, Krüger C et al (2008) Analysis of Y chromosome STR haplotypes in the European part of Russia reveals high diversities but non-significant genetic distances between populations. Int J Legal Med 122:219–223 33. Sánchez C, Barrot C, Xifró A et al (2007) Haplotype frequencies of 16 Y-chromosome STR loci in the Barcelona metropolitan area population using Y-Filer™kit. Forensic Sci Int 172:211–217 34. Scozzari R, Cruciani F, Pangrazio A et al (2001) Human Ychromosome variation in the western Mediterranean area: implications for the peopling of the region. Hum Immunol 62:871–884 35. Semino O, Torroni A, Scozzari R, Brega A, De Benedictis G, Santachiara Benerecetti AS (1989) Mitochondrial DNA polymorphisms in Italy. III. Population data from Sicily: a possible quantitation of maternal African ancestry. Ann Hum Genet 53:193–202 36. Tagarelli A, Piro A, Tagarelli G, Zinno F (2000) Color-blindness in Calabria (southern Italy): a north–south decreasing trend. Am J Hum Biol 12:17–24 37. Tomàs C, Jiménez G, Picornell A, Castro JA, Ramon MM (2006) Differential maternal and paternal contributions to the genetic pool of Ibiza Island, Balearic Archipelago. Am J Phys Anthropol 129:268–278 38. Willuweit S, Roewer L, on behalf of the International Forensic Y Chromosome User Group (2007) Y chromosome haplotype reference database (YHRD): update. Forensic Sci Int: Genetics 1:83–87 Int J Legal Med (2009) 123:137–141 141 139 Research article Microgeographic variation of Y-chromosome haplotypes in Italy S. Pelotti a, *, C. Bini a , A. Barbaro b , L. Caenazzo c , E. Carnevali d , N. Cerri e , R. Domenici f , G. Ferri g , M. Maniscalco h , V. Onofri i , A. Piccinini j , C. Previdere ` k , U. Ricci l , C. Robino m , F. Scarnicci n , F. Torricelli o , M. Venturi p , S. Presciuttini q GeFI’s group of Y-chromosome characterization a Department of Medicine and Public Health, Section of Legal Medicine, University of Bologna, Italy b Department of Forensic Genetics, Studio Indagini Mediche e Forensi (SIMEF), Italy c Department of Environmental Medicine and Public Health, University of Padova, Italy d Department of Surgery and Forensic Sciences, University of Perugia and Section of Legal Medicine, Hospital of Terni, Italy e Department of Surgery, Radiology and Forensic Medicine, University of Brescia, Italy f University of Pisa, Italy g Department of Diagnostic and Laboratory Service and Legal Medicine, Section of Legal Medicine, University of Modena and Reggio Emilia, Italy h Andros Day Surgery, Reproduction Medicine Center, Palermo, Italy i Institute of Legal Medicine, University of Ancona, Italy j Institute of Legal Medicine, University of Milan, Italy k Department of Environmental Medicine and Public Health, University of Pavia, Italy l Medical Genetic Unit, Azienda Ospedaliero Universitaria ‘‘A. Meyer’’, Florence, Italy m Department of Anatomy, Pharmacology and Legal Medicine, University of Turin, Italy n Institute of Legal Medicine, Universita `Cattolica Sacro Cuore, Rome, Italy o Genetic Diagnostic Unit, Azienda Ospedaliero Universitaria Careggi, Florence, Italy p Department of Biomedical Sciences, Section of Legal Medicine, University of Ferrara, Italy q Center of Statistical Genetics, University of Pisa, Italy Received 17 August 2007; accepted 8 October 2007 Abstract Within an Italian collaborative exercise on the extended haplotype of the Y-chromosome, 1288 subjects were typed by the AmpFlSTR YFiler Amplification Kit (AB Applied Biosystems) and other 526 were typed by the PowerPlex Y 1 System (Promega). The sampling scheme included either a ‘‘regional’’ or a ‘‘local’’ recruitment, the first referring to individuals born in the region of the participating lab, the second referring to individuals coming from small villages. Total sample sizes were N= 954 and 860, respectively. A significant decrease of haplotype diversity was found in the local samples. The results may be of interest in forensic applications of the Y-chromosome. #2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Y-chromosome; Population data; Short tandem repeats; Haplotypes 1. Introduction Up to now the haplotype diversity using nine Y-STRs comprising the so-called minimal haplotype loci was studied among worldwide population samples showing that there are significant portions of haplotypes in several populations which cannot be resolved. Evaluation of haplotype discrimination capacity of 35 Y-STRs was recently evaluated and complete resolution of the pooled population was achieved by additional genotyping of further loci [1]. Y-STRs generating haplotypes were studied in 2001 by GeFI collaborative exercise on 1176 Italian individuals from different regions [2]. The typed loci were DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385 and a low degree of variations was shown among regions. In forensic genetics laboratories YSTRs multiplex kit, based on 17 markers validated for forensic applications, have become widely used in the last years for the high power of discrimination at minimal samples consumption. www.elsevier.com/locate/FSIGSS A vailable online at www.sciencedirect.com Forensic Science International: Genetics Supplement Series 1 (2008) 239–241 * Corresponding author. Tel.: +39 0512088343; fax: +39 0512088358. E-mail address: [email protected] (S. Pelotti). 1875-1768/$ – see front matter #2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.fsigss.2007.10.083 140 This further GEFI collaborative project was designed for studying the diversity of 17-locus Y-STR profiles, usually used in casework, on different Italian population groups, sampling by regional or local ways for a total of 1288 typed samples to determine individual loci gene diversity, multiplex discriminatory capacity and to increase data for reference database. In addition a total of 526 samples were typed for 12 loci by a few number of laboratories and the results were collected to increase the minimal haplotype Italian database. 2. Materials and methods Participating laboratories were asked to type at least 100 unrelated individuals born in their region for 17 loci by Y filer kit. Blind control samples were prepared for each laboratory. Laboratories were left free to use their preferred DNA extraction methods. PCR and analysis of amplified products were performed according to the manufacturer’s recommendations. In addition other 526 Italian samples were typed by the PowerPlex Y 1 System (Promega). 3. Results and discussion Within an Italian collaborative exercise on the extended haplotype of the Y-chromosome, 1288 subjects were typed by the AmpFlSTR YFiler Amplification Kit (AB Applied Biosystems) and other 526 were typed by the PowerPlex Y 1 System (Promega). Thesampling scheme included either a‘‘regional’’ or a ‘‘local’’ recruitment, the first referring to individuals born in the region of the participating lab, the second referring to individuals coming from small villages. In the second case, only nonisonymous subjects were sampled. Fig. 1 shows the 9-locus haplotype counts in 631 individuals from 14 local samples compared with the expected counts in a sample of the same size if it were randomly sampled from the general Italian population. The expected counts were obtained by numerical resampling of the Italian database. For example, the first two most frequent haplotypes among the local samples display the highest rank in Italy also; however, their relative frequency is higher in the local samples (observed counts 38 vs. expected counts 21.8). In general, the haplotype frequency distribution is biased in the local samples towards a lower number of haplotypes with higher frequency. Fig. 2 shows the non-unique 17-locus haplotype counts in 12 local samples (two local samples were not typed with the 17-locus kit). It is remarkable that all non-unique haplotypes but one are present in a single local sample. Conflict of interest None. Fig. 1. The most frequent ‘‘minimal haplotypes’’ in 14 local samples from central and northern Italy. #N/A: not present in the Italian database. Fig. 2. Non-unique 17-locus haplotypes in 12 local samples from northern and central Italy. S. Pelotti et al. / Forensic Science International: Genetics Supplement Series 1 (2008) 239–241240 141 References [1] H. Roding, L. Roewer, A. Gross, T. Richter, P. de Knijff, M. Kaiser, W. Brabetz, Evaluation of haplotype discrimination capacity of 35 Y-chromosomal short tandem repeat loci, Forensic Sci. Int. 174 (2008) 182–188. [2] S. Presciuttini, A. Caglia `, M. Alu `, A. Asmundo, L. Buscemi, L. Caenazzo, E. Carnevali, E. Carra, Z. De Battisti, F. De Stefano, R. Domenici, A. Piccinini, N. Resta, U. Ricci, V.L. Pascali, Y-chromosome haplotypes in Italy: the GEFI collaborative database, Forensic Sci. Int. 122 (2001) 184–188. S. Pelotti et al. / Forensic Science International: Genetics Supplement Series 1 (2008) 239–241 241 142 Letter to the Editor Genetic variability of the SNPforID 52-plex identification SNP panel in Italian population samples Dear Editor, The potential application of SNPs in place of supplementary STRs in paternity testing and forensic casework has been the subject of debate in recent years [1–4]. In fact SNPs show a range of characteristics that make them well suited to forensic analysis, such as low mutation rate, much reduced amplicons sizes and relatively simple multiplex assays [5–8]. Previously we characterized variation within Italy, studying two geographically separated populations from the north of Italy (Veneto) and the south (Calabria). In this study we update existing data analyzing more samples (200) from the same populations. DNA was extracted from blood samples of healthy, unrelated volunteers that gave informed consent for population studies in accordance with Italian Law D. Lgs. 196/2003 and approved by SIMEF ISO-17025 procedures. DNA extractions were made with the Promega Wizard 1 DNA purification kit and quantification with the Applied Biosystems (AB) Quantifiler Human DNA Quantification Kit using an AB 7300 real-time PCR system. The 52plex SNaPshot assay was applied, as previously described by Sanchez et al. validated for forensic applications [9]. Amplifications were made in a single PCR followed by two parallel 23and 29-plex single base extension reactions (SBEs) using primers and reaction conditions described by Sanchez et al. [9]. Detection of the SBE products was performed by capillary electrophoresis on an AB Prism 3130 using GeneScan LIZ 120 for internal calibration. Allele frequencies, forensic and statistical parameters are given in Supplementary Tables 1 and 2. No significant differences were found in comparison with our previous data already published in the SPSmart open-access online frequency browser (http://spsmart.- cesga.es/snpforid.php?dataSet=snpforid52). Moreover, when comparing our data to other European populations (specifically, Spanish, Portuguese and Danish data), no overall significant differences were found for the same markers [12]. Comparison analysis is outlined in Table 3. The main differences for allelic distributions were found with Denmark in rs1335873, rs2046361, with Portugal in rs1357617 and with both populations in rs826472. Statistical parameters of forensic interest were calculated, comprising: Dp: power of discrimination, PE: power of exclusion, RMP: random matching probability, using PowerStats v.1.2 software [10]. The SNPs showed low discrimination power (PD) and exclusion power (PE) when used individually, but in combination PD and PE were raised to 0.9999 in both populations, representing values comparable to those obtained analyzing a standard 15 STRs set. Hardy–Weinberg equilibrium and other population parameters were calculated using Arlequin software v.3.1 [11]. The highest average heterozygosity for both populations was found in rs2831700. No significant deviation from Hardy– Weinberg expectations was observed (P > 0.05). The typical paternity index that can be expected applying these SNPs was assessed by calculating the average PI values obtained from three trio cases and, separately, from three deficient family studies (lacking the mother in each case) and the genotypes obtained are listed in full in Supplementary Tables 4a and 4b. Individual paternity indices were calculated in the standard way and a combined paternity index (CPI) determined as the product of these individual values [13]. From three combined PIs the average trio PI was 7.23E+10 and the average deficient family PI was 1.22E+8. With both values in accordance with previously published data [6]. In conclusion, all 52 SNPs were informative in the population samples analysed, this means they can provide valuable information not only for population studies but also for forensic applications (e.g. identification cases with highly degraded samples) as well as the analysis of complex pedigrees (e.g. distant relationships or incomplete pedigrees) as a complement to standard STRs typing. The laboratory performing this study participates in the quality control/proficiency testing of the GEP-ISFG WG (www.gepisfg.org). This paper follows the guidelines for publication of population data requested by the journal [14]. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fsigen.2012.07.002. References [1] C. Phillips, M.V. Lareu, J. Sanchez, M. Brion, B. Sobrino, N. Morling, P. Schneider, D. Syndercombe Court, A ´. Carracedo, Selecting single nucleotide polymorphisms for forensic applications, Progress Forensic Genet. 10 (2004) 18–20. [2] J.M. Butler, M.D. Coble, P.M. Vallone, STRs vs. SNPs: thoughts on the future of forensic DNA testing, Forensic Sci. Med. Pathol. 3 (2007) 200–205. [3] B. Budowle B, A. van Daal, Forensically relevant SNP classes, BioTechniques 44 (2008) 603–610. [4] P. Gill, An assessment of the utility of single nucleotide polymorphisms (SNPs) for forensic purposes, Int. J. Legal Med. 114 (2001) 204–210. [5] C. Phillips, M. Fondevila, M. Garcı ´a-Magarin ˜os, A. Rodriguez, A. Salas, A ´. Carracedo, M.V. Lareu, Resolving relationship tests that show ambiguous STR results using autosomal SNPs as supplementary markers, Forensic Sci. Int. Genet. 2 (2008) 198–204. [6] C. Børsting, J.J. Sanchez, H.E. Hansen, A.J. Hansen, H.Q. Bruun, N. Morling, Performance of the SNPforID 52 SNP-plex assay in paternity testing, Forensic Sci. Int. Genet. 2 (2008) 292–300. [7] M. Fondevila, C. Phillips, N. Navera ´n, M. Cerezo, A. Rodrı ´guez, A. Salas, A ´. Carracedo, M.V. Lareu, Identification of skeletal remains using short-amplicon marker analysis of severely degraded DNA extracted from a decomposed and charred femur, Forensic Sci. Int. Genet. 2 (2008) 212–218. [8] L.A. Dixon, A.E. Dobbins, H.K. Pulker, J.M. Butler, P.M. Vallone, M.D. Coble, W. Parson, B. Berger, P. Grubwieser, H.S. Mogensen, N. Morling, K. Nielsen, J.J. Sanchez, E. Petkovski, A ´. Carracedo, P. Sanchez-Diz, E. Ramos-Luisf, M. Brion, Forensic Science International: Genetics xxx (2012) xxx–xxx G Model FSIGEN-890; No. of Pages 2 Please cite this article in press as: A. Barbaro, Genetic variability of the SNPforID 52-plex identification SNP panel in Italian population samples, Forensic Sci. Int. Genet. (2012), http://dx.doi.org/10.1016/j.fsigen.2012.07.002 Contents lists available at SciVerse ScienceDirect Forensic Science International: Genetics jou r nal h o mep ag e: w ww .elsevier .co m /loc ate/fs ig 1872-4973/$ – see front matter ß 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsigen.2012.07.002 143 J.A. Irwin, R.S. Just, O. Loreille, T.J. Parsons, D. Syndercombe Court, H. Schmitter, B. Stradmann-Bellinghausen, K. Bender, P. Gill, Analysis of artificially degraded DNA using STRs and SNPs – results of a collaborative European (EDNAP) exercise, Forensic Sci. Int. 164 (2006) 33–44. [9] J.J. Sanchez, C. Phillips, C. Borsting, K. Balogh, M. Bogus, M. Fondevila, C.D. Harrison, E. Musgrave-Brown, A. Salas, D. Syndercombe-Court, P.M. Schneider, A ´. Carracedo, N. Morling, A multiplex assay with 52 single nucleotide polymorphisms for human identification, Electrophoresis 27 (2006) 1713–1724. [10] A. Tereba, Tools for Analysis of Population Statistics Profiles in DNA, Promega Corp., 1999. [11] L. Excoffier, G. Laval, S. Schneider, Arlequin ver. 3.0: an integrated software package for population genetics data analysis, Evol. Bioinform. (2005) 47–50. [12] J. Amigo, C. Phillips, A. Salas, L. Fernandez Formoso, A ´. Carracedo, M.V. Lareu, pop.STR—an online population frequency browser for established and new forensic STRs, Forensic Sci. Int. Genet. Suppl. Series 2 (2009) 361–362. [13] D.W. Gjertson, C.H. Brenner, M.P. Baur, A ´. Carracedo, F. Guidet, J.A. Luque, R. Lessig, W.R. Mayr, V.L. Pascali, M. Prinz, P.M. Schneider, N. Morling, ISFG: recommendations on biostatistics in paternity testing, Forensic Sci. Int. Genet. 1 (2007) 223–231. [14] A ´. Carracedo, J.M. Butler, L. Gusmao, W. Parson, L. Roewer, P.M. Schneider, Publication of population data for forensic purposes, Forensic Sci. Int. Genet. 4 (2010) 145–147. Anna Barbaro a,b, * a Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria, Italy b Institute of Legal Medicine, University of Santiago de Compostela, Spain Chris Phillips Manuel Fondevila Maviky Lareu A ´ngel Carracedo Institute of Legal Medicine, University of Santiago de Compostela, Spain *Corresponding author at: Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria, Italy E-mail address: [email protected] (A. Barbaro) 8 March 2012 Letter to the Editor / Forensic Science International: Genetics xxx (2012) xxx–xxx e2 G Model FSIGEN-890; No. of Pages 2 Please cite this article in press as: A. Barbaro, Genetic variability of the SNPforID 52-plex identification SNP panel in Italian population samples, Forensic Sci. Int. Genet. (2012), http://dx.doi.org/10.1016/j.fsigen.2012.07.002 144 DISCUSSION 145 Chapter VI : GENERAL DISCUSSION 1. Introduction Forensic labs have often to deal with the analysis of highly degraded DNA samples that can result in locus or allele dropout leading to complex interpretative problems. In cases where DNA evidence is limited, either in quantity or quality, such as highly degraded samples that are exposed to environmental insults or inhibitors, standard STR testing is often inadequate. Analysis of these compromised DNA samples often result in dropout of the larger STR loci from the samples and only a partial DNA profile can be obtained. Partial DNA profiles generally do not provide the power of discrimination to include or exclude a potential contributor to the sample. Success with highly degraded DNA is improved using short amplicon mini-STRs. While standard STR primers target longer sequences that include the STR loci, miniSTR primers are redesigned so resulting DNA product is smaller, thereby increasing the chances of successful amplification of the larger loci. The use of more robust loci, rather than already established STRs which frequently fail to give results, and/or have a poor power of discrimination increases the sensitivity of DNA detection and optimizes the opportunity to obtain a DNA profile from compromised samples, providing forensic scientists with a tool that captures genetic data from DNA samples of marginal and extremely low quality and quantity. Thus, many previously unsolvable human identity cases may be resolved with miniSTR technology. Obviously before the introduction in routine casework analysis, it’s relevant for the forensic community to establish which markers may be useful for catching up the procedure to a level acceptable for forensic application and to validate protocols with sufficient analysis repeat rates. Moreover in order to calculate the correct representative weight of DNA evidence, prior knowledge about the DNA markers for a relevant population sample is required. Important properties such as how frequently certain DNA-variants (i.e. alleles) occur in the population, the differences in such frequencies between populations and the forensic efficiency of the DNA markers