239
Eu oscap o da wini sp. no ., a new species o mole (Mammalia,
Eulipo yphla, Talpidae) om he no h-cen al moun ains in Vie nam
Son T uong Nguyen1,2* , Hai Tuan Bui3, Vinh Quang Dau4, Phuong Dinh Le5, Yen Huong Vu1,3*
1 Ins i u e o Biology, Vie nam Academy o Science and Technology (VAST), 18 Hoang Quoc Vie Road, Hanoi, Vie nam
2 G adua e Uni e si y o Science and Technology, Vie nam Academy o Science and Technology (VAST), 18 Hoang Quoc Vie Road, Hanoi, Vie nam
3 Facul y o Biology, Hanoi Uni e si y o Science, Vie nam Na ional Uni e si y (VNU), 334 Nguyen T ai Road, Hanoi, Vie nam
4 Hong Duc Uni e si y, 565 Quang T ung Road, Thanh Hoa, Vie nam
5 Pu Luong Na u e Rese e, Thanh Hoa, Vie nam
Co esponding au ho s: Yen Huong Vu ([email p o ec ed]); Son T uong Nguyen ([email p o ec ed])
Copy igh : © Son T uong Nguyen e al.
This is an open access a icle dis ibu ed unde
e ms o he C ea i e Commons A ibu ion
License (A ibu ion 4.0 In e na ional – CC BY 4.0).
Resea ch A icle
Abs ac
A new species o osso ial mole (Eulipo yphla, Talpidae, Eu oscap o ) is desc ibed om
Pu Luong Na u e Rese e, no h-cen al Vie nam, based on dis inc gene ic and mo -
phological cha ac e is ics. The species inhabi s a geog aphically small and isola ed up-
land pa ch (900–1100 m a.s.l.), sha ply bounded by a nea ly e ical esca pmen . The
new axon is diagnosed by an ex emely educed ail bo h ex e nally and os eologically,
comp ising only six o se en caudal e eb ae, he lowes numbe documen ed in he
genus o da e. The species di e s u he om known congene s in Sou heas Asia by
i s slende c anium, na ow os um, elonga ed inne zygoma ic a ches, and signi ican ly
smalle an e io den i ion. Phylogene ic analyses o he mi ochond ial Cy b gene indi-
ca e gene ic dis ances o 5.41–6.35% om i s closes ela i e, E. subanu a, and cla i y
he e olu iona y placemen o he species wi hin he genus. Mul i a ia e analyses o 36
c anioden al measu emen s iden i ied key a iables con ibu ing o in e speci ic di e -
en ia ion among Vie namese moles, including b ead h be ween in ao bi al o amina,
leng h o zygoma ic a ch, uppe inciso –canine leng h, p emola s leng h, and lowe inci-
so –canine leng h. Specimens om he ype locali y show ha emales a e la ge han
males. The disco e y o his new Eu oscap o species cu en ly aises he o al numbe
o ecognized species in he genus o ele en wo ldwide and b ings he numbe o os-
so ial mole species eco ded in Vie nam o six. I highligh s bo h he unde es ima ed
mammalian di e si y o Vie nam and he impo ance o con inued in eg a i e su eys
in mon ane landscapes, whe e mic o-endemic and e olu iona ily dis inc axa emain
insu icien ly documen ed and ulne able o en i onmen al change.
Key wo ds: Annami e Range, Da win, mi ochond ial gene, PCA, small mammal, axonomy
In oduc ion
Vie nam, si ua ed on he eas e n bounda y o he Indochinese peninsula and
o ming pa o he Indo–Bu ma biodi e si y ho spo , is ecognized as one
o he mos biodi e se coun ies in Sou heas Asia. This biodi e si y is p in-
cipally a ibu ed o he coun y’s highly a ied opog aphy, complex clima ic
Academic edi o : Alessio Iannucci
Recei ed:
14 June 2025
Accep ed:
25 Augus 2025
Published:
10 Oc obe 2025
ZooBank: h ps://zoobank.
o g/3C3E0CF2-85BF-4F5C-B4D3-
9140F0BE2BC9
Ci a ion: Nguyen ST, Bui HT, Dau VQ,
Le PD, Vu YH (2025) Eu oscap o
da wini sp. no ., a new species o
mole (Mammalia, Eulipo yphla,
Talpidae) om he no h-cen al
moun ains in Vie nam. ZooKeys 1255:
239–274. h ps://doi.o g/10.3897/
zookeys.1255.161942
ZooKeys 1255: 239–274 (2025)
DOI: 10.3897/zookeys.1255.161942
* These au ho s con ibu ed equally and sha e i s and co esponding au ho ship.
240
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
egimes, and biogeog aphic posi ion wi hin he ansi ional zone be ween he
sub opics and opics (S e ling and Hu ley 2005; S e ling e al. 2006; Dang
e al. 2008; To do e al. 2012). S e ching mo e han 1650 km om no h o
sou h in a cha ac e is ic “S-shaped” con igu a ion, Vie nam encompasses a
mosaic o ecological egions, including i e del as, ka s limes one o ma-
ions, opical lowland o es s, and isola ed high-ele a ion moun ain anges,
each ha bo ing dis inc aunal assemblage (Bain and Hu ley 2011). This hab-
i a complexi y, oge he wi h his o ical geological ac i i y and limi ed aunal
dispe sal ac oss ugged e ain, has led o signi ican biogeog aphic agmen-
a ion and ele a ed le els o endemism e es ial e eb a es (S e ling and
Hu ley 2005; Badgley e al. 2017).
Among small insec i o ous mammals, osso ial mole species a e espe-
cially sensi i e o geog aphical ba ie s due o hei highly specialized sub-
e anean li es yle and low dispe sal capaci y (Ne o 1985, 1999). These
cha ac e is ics p omo e popula ion isola ion and localized di e gence, mak-
ing hese insec i o es an excellen model sys em o s udying he e ec s
o geog aphic isola ion in d i ing gene ic, mo phological di e en ia ion and
specia ion (Huxley 1938; Ko le 1978; Ba ow and MacLeod 2008; Pé ez e
al. 2017). In Vie nam, he ole o ecological g adien s, especially al i udinal
zona ion, has been p oposed as a majo d i e o bo h in aspeci ic and in-
e speci ic di e si ica ion in mammals (Mo okawa and Lin 2002; Asaha a e
al. 2012; Bui e al. 2020a). The eas e n moun ain sys ems o Vie nam, pa -
icula ly he Hoang Lien Son Range and Annami e Range, ep esen ancien
mon ane landscapes ha no only p o ide clima ic and ele a ional e ugia
bu also unc ion as long-s anding biogeog aphical ba ie s. These a eas a e
highly conduci e o allopa ic specia ion in limi ed dispe sing axa. In pa -
icula , mon ane habi a s abo e 1000 me e s ha e consis en ly yielded ge-
ne ically and mo phologically dis inc popula ions, many o which ha e been
o e looked in adi ional aunal su eys due o hei c yp ic beha io s (Zem-
leme o a e al. 2016; Bui e al. 2020a).
The genus Eu oscap o Mille , 1940 (Talpini, Talpidae) is a axonomically
complex lineage o osso ial mammals, cha ac e ized by c yp ic species and
a b oad dis ibu ion ac oss Eas and Sou heas Asia (Hu e e 2005; He e al.
2014; K yš u ek and Mo okawa 2018; Bu gin e al. 2020). Membe s o his ge-
nus a e highly adap ed o a sub e anean li es yle and ypically inhabi o es ed
moun ain en i onmen s and mois mon ane habi a s, ac oss a wide ele a ional
ange. Despi e hei b oad dis ibu ion, Eu oscap o species emain among he
leas known small mammals in Asia, ha ing been his o ically unde -sampled
due o hei elusi e beha io s, c yp ic habi s, limi ed su ace ac i i y and mo -
phologically conse a i e adap a ions o unde g ound niches.
Eu oscap o was o iginally es ablished o accommoda e a g oup o Asian
moles exhibi ing p imi i e den al cha ac e s and specialized osso ial mo -
phologies (Kawada 2016). A p esen , i is ecognized as he second la ges
genus o he amily Talpidae (K yš u ek and Mo okawa 2018; Bu gin e al.
2020), comp ising en ex an species, including: E. mic u a (Hodgson, 1841),
E. longi os is (Milne-Edwa ds, 1870), E. klossi (Thomas, 1929), E. g andis
Mille , 1940, E. pa idens Mille , 1940, E. malayana (Chasen, 1940) (see
Kawada e al. 2008), E. subanu a Kawada e al., 2012, E. kuzne so i Zemle-
me o a e al., 2016, E. o lo i Zemleme o a e al., 2016, and E. ngoclinhensis
241
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Zemleme o a e al., 2016 (see Bui e al. 2020a). Based on c anial mo pholo-
gy and den al cha ac e s, Eu oscap o species ha e been classi ied in o wo
majo clades: a wes e n g oup and an eas e n g oup (Kawada e al. 2009,
2012). The wes e n g oup comp ises E. mic u a, E. klossi, and E. malayana,
while he eas e n g oup includes no he n Vie namese popula ions p e ious-
ly assigned o E. longi os is, which ha e now been eclassi ied in o wo sep-
a a e species: E. kuzne so i and E. o lo i (Zemleme o a e al. 2016), along
wi h E. pa idens, E. ngoclinhensis, and E. subanu a. Vie nam ep esen s he
highes di e si y o he genus, cu en ly ha bo ing i e ecognized Eu oscap-
o species: E. kuzne so i, E. o lo i, E. pa idens, E. ngoclinhensis, and E. sub-
anu a. Fou o hese species: E. pa idens, E. ngoclinhensis, E. kuzne so i
and E. subanu a, a e only es ic ed o Vie nam.
Phylogene ically, Eu oscap o o ms a dis inc clade wi hin Talpinae, sepa-
a e om o he alpine gene a such as Moge a, Pa ascap o , and Talpa (Zemle-
me o a e al. 2013, 2016; Banniko a e al. 2015a). Recen ad ances in molec-
ula sys ema ics ha e e ealed ha Eu oscap o encompasses conside able
c yp ic di e si y (He e al. 2014). Mul ilocus phylogenies based on mi ochond i-
al genes (Cy b, 12S RNA) and nuclea loci (BRCA1, RAG1, ApoB) ha e e ealed
he se e al mo phologically simila bu gene ically dis inc lineages exis in his
genus. These lineages o en co espond o disc e e geog aphic egions o ele-
a ional zones, sugges ing allopa ic specia ion d i en by moun ainous opog-
aphy and ecological ba ie s (Banniko a e al. 2015a, 2015b; Shinoha a e al.
2015; Zemleme o a e al. 2016).
Mo phologically, Eu oscap o species a e cha ac e ized by ex e nal ea u es
associa ed wi h hei unde g ound-li ing li es yle: a cylind ical body, obus
o elimbs o digging, sho el-like claws, g ea ly educed o absen ex e nal
pinnae, minu e and concealed eyes. Thei os um is ypically elonga ed and
na ow, o en wi h p ominen senso y ib issae (Kawada e al. 2012; Bui e al.
2020a). While ex e nal mo phological cha ac e s a e o en conse a i e and
o e lapping among species, c anioden al ai s ha e p o en o be mo e in o -
ma i e o species delimi a ion, when analyzed in combina ion wi h cy ogene -
ic and molecula da a (Kawada e al. 2012; Shinoha a e al. 2015; Bui e al.
2020a). The skulls o Eu oscap o spp. a e ypically la and elonga ed, wi h
slende os a, na ow in e o bi al wid hs, and highly a iable pala al and b ain-
case b ead hs. The genus e ains a p imi i e den al o mula: I3/3, C1/1, P4/4,
M3/3 = 44 (Kawada e al. 2012). In e speci ic dis inc ions o en ely on sub le
diagnos ic ea u es, such as he shape and alignmen o mola cusps, he de-
g ee o iangula iza ion o he uppe mola s, he p esence o absence o he
hypoconulid on lowe mola s, and he con igu a ion o he zygoma ic a ches.
In he p esen s udy, we ound i e new specimens o Eu oscap o om mon-
ane o es s abo e 1000 m in Pu Luong NR, no h-cen al Vie nam. The new
axon is de ined by a ema kably sho ail, which is he mos educed among
known congene s bo h in absolu e leng h and in e eb al segmen a ion. Phylo-
gene ic analyses based on Cy b and 12S RNA genes con i med i s dis inc lin-
eage, wi h gene ic di e gences alling wi hin he expec ed ange o in e speci ic
di e ences in Talpidae. Mul i a ia e analyses and mo phome ic compa isons
o Vie namese Eu oscap o popula ions we e also conduc ed o assess mo -
phological a ia ion and u he co obo a e hei axonomic iden i y. He ein, we
desc ibe his newly disco e ed popula ion as a new Eu oscap o species.
242
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Ma e ials and me hods
S udy locali y and sampling me hods
Pu Luong Na u e Rese e (Pu Luong NR), si ua ed in he no hwes e n egion
o Thanh Hoa P o ince, no h-cen al Vie nam (20°21'–20°34'N, 105°02'–
105°20'E) (see Fig. 1) (Le e al. 2015), is ecognized as one o he key p o-
ec ed a eas wi hin he Indo–Bu ma Biodi e si y Ho spo (Bi dLi e In e na-
ional Vie nam P og amme and FIPI 2001; To do e al. 2004). The ese e
is cha ac e ized by a dis inc i e landscape o med by wo pa allel moun ain
idges unning no hwes o sou heas , sepa a ed by a cen al lowland al-
ley, which is excluded om he co e p o ec ed zone. The no heas e n idge
consis s p ima ily o highly dissec ed limes one ka s o ma ions, o ming a
geologic con inuum wi h he ka s sys em o Cuc Phuong NP and ex ending
u he no hwes wa d o Son La P o ince, whe eas he sou hwes e n idge
is cha ac e ized p edominan ly by ypical non-ka s ic (soil-based) moun ain
e ain. Ele a ions wi hin Pu Luong ange om ca 60 m o mo e han 1700
m a.s.l., ha bo ing di e se mic ohabi a s om lowland opical b oadlea
o es s o mon ane e e g een ecosys ems (Cen e o Na u e Conse a ion
and De elopmen 2005).
Ou ield su eys a ge ing small mammals, pa icula ly osso ial moles,
we e conduc ed along he ail o he summi o Pu Luong Moun ain, wi h he
assis ance o a local guide ac oss wo pe iods: he i s om 5–12 No embe
2024, and he second om 4–10 Ap il 2025. Sampling was concen a ed along
he sou hwes e n idge o Pu Luong Moun ain, wi h su ey e o di ec ed o-
wa d o es habi a s be ween 900 m and 1100 m a.s.l., du ing he d y season.
Sampling was conduc ed using specialized unnel aps, a s anda d me hod
Figu e 1. a. Map o Vie nam showing he loca ion o Pu Luong NR in Thanh Hoa P o ince (highligh ed in ed); b. Black do
enclosed wi hin eal iangle ma ks he ype locali y, dis ibu ed along al i udinal ansec s (600–1100 m a.s.l.). The map
was gene a ed using QGIS 3.38.3 (h ps://www.qgis.o g) and edi ed in Adobe Pho oshop 2023.
243
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
o cap u ing osso ial mammals (Sikes e al. 2011; Kawada e al. 2012).
Each unnel ap consis ed o a cylind ical plas ic ube (~4.5 cm in diame e
and ~8.5 cm in leng h), wi h a cen al chambe i ed wi h a sp ing-loaded
mechanism. T aps we e checked daily ea ly mo ning o ensu e p ope unc ion-
ing and o p omp ly e ie e cap u ed specimens.
Du ing each su ey, ele en unnel aps we e deployed a six apping s a ions
along o es ails and a eas wi h esh molehills, a ge ing loca ions wi h so ,
mois soils indica i e o ecen mole ac i i y. The s a ions we e es ablished a
~950 m a.s.l. in a ela i ely la a ea beyond an almos e ical slope (Figs 1,
2a), which co esponding o he si e whe e he i s unknown mole specimen,
an adul male, was disco e ed in No embe 2024 (Fig. 1). Du ing he ollow-up
ield su ey in Ap il 2025, he esea ch eam collec ed wo addi ional indi iduals
om he same locali y whe e he i s male had been ob ained, and wo o he s
om he ele a ion o ca1000 m a.s.l. (Fig. 2b–d). All specimens we e cap u ed
using unnel aps placed along al i udinal ange (950–1100 m) ac oss a ious
habi a ypes. Geog aphic coo dina es and ele a ions we e eco ded using he
Gaia GPS mobile applica ion (WGS84 da um) (Fig. 2e).
Following p ocessing, cap u ed indi iduals we e e ained as ouche speci-
mens o axonomic iden i ica ion and u he examina ion. All ouche spec-
imens we e ini ially ixed in 95% e hanol o he i s 30 days, and hen ans-
e ed o 70% e hanol o long- e m s o age. The skull, pel ic bone, and caudal
e eb ae we e ex ac ed om he specimen and ho oughly cleaned. Li e
issue samples we e sepa a ely p ese ed in absolu e e hanol o subsequen
gene ic analysis. Vouche specimens and associa ed issue samples o new
axon a e cu en ly deposi ed in he collec ions o he Depa men o Zoology,
Ins i u e o Biology (IB), VAST, Hanoi.
Molecula da a and phylogene ic analyses
DNA was isola ed om li e issue samples p ese ed in 99% e hanol us-
ing he DNeasy® Blood and Tissue Ki (Qiagen, Hilden, Ge many), ollowing
he manu ac u e ’s s anda d p o ocol. The mi ochond ial Cy b gene was
selec ed due o i s demons a ed e ec i eness in esol ing species-le -
el iden i ica ion. Ampli ica ion o he Cy b agmen was pe o med us-
ing he p ime pai So iF (5′–CCATCTCTGGTTTACAAGAC–3′) and So iR
(5′ TGACATGAAAAATCATCGTTG–3′) (Bui e al. 2020b). In addi ion, he pa -
ial mi ochond ial 12S ibosomal RNA (12S RNA) gene was included in he
analysis o p o ide complemen a y phylogene ic esolu ion. This agmen
was ampli ied using he p ime pai L–613 (5′–ACACAAAGCATGGCACT-
GAA–3′; Mindell e al. 1991) and H–1478 (5′–TGACTGCAGAGGGTGACGGG-
CGGTGTGT–3′; Koche e al. 1989). PCR eac ions we e conduc ed using he
PCR Mas e Mix (Phusa Genomics, Can Tho, Vie nam) unde he ollowing
he mal cycling condi ions: an ini ial dena u a ion a 95 °C o 5 min; ol-
lowed by 35 cycles o 95 °C o 30 s, annealing a 56 °C o 50 s, and ex en-
sion a 72 °C o 2 min; wi h a inal ex ension a 72 °C o 10 min. Ampli ied
p oduc s we e hen pu i ied and sequenced by 1s BASE (Selango , Malaysia)
using Sange sequencing p o ocols.
Fo wa d and e e se ch oma og ams o bo h Cy b and 12S RNA sequenc-
es we e manually edi ed and assembled in o consensus sequences using
244
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Ch omas P o (Technelysium P y L d., Aus alia), MEGA 11 (Tamu a e al. 2021)
and BioEdi (Hall 1999), wi h manual e i ica ion o base-calling accu acy and
alignmen consis ency. Mul iple sequence alignmen was pe o med using he
MUSCLE algo i hm (Edga 2004) implemen ed in MEGA 11. The inal alignmen
leng hs we e 1140 base pai s o Cy b and 846 base pai s o 12S RNA. No in-
se ions o dele ions (indels) we e de ec ed ac oss any o he ing oup sequenc-
es. The conca ena ed alignmen o Cy b and 12S RNA gene agmen s was
cons uc ed using SequenceMa ix . 1.8 (Vaidya e al. 2011), based on aligned
sequences wi h ma ching axon labels. In aspeci ic and in e speci ic pai wise
unco ec ed di e gences (p–dis ances) o Cy b sequences we e compu ed in
MEGA 11, applying pai wise dele ion o gaps/missing si es and a iance es i-
ma es ia boo s ap wi h 10000 eplica es.
Figu e 2. Habi a cha ac e is ics and sampling locali ies in Pu Luong NR. a. T opical e e g een o es a ~935 m a.s.l.,
ep esen ing he ype locali y o he holo ype; b–d. Typical mic ohabi a s whe e pa a ypes we e cap u ed. Sampling
poin s ( ed ma ke s) co espond o apping s a ions along he al i udinal ansec ; e. Topog aphic ail map and ele a-
ional p o ile (581–995 m a.s.l.) o he sampling ou e, gene a ed using he Gaia GPS mobile applica ion.
245
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Phylogene ic econs uc ion was in e ed using bo h Maximum Likelihood
(ML) and Bayesian In e ence (BI) me hods. The ML analysis was conduc ed
using IQ–TREE . 1.6.12 (Nguyen e al. 2015), wi h he op imal subs i u ion
model o each da ase de e mined by he Bayesian In o ma ion C i e ion
(BIC) ia ModelFinde (Kalyaanamoo hy e al. 2017), as implemen ed in IQ–
TREE. Model selec ion iden i ied HKY+I as he bes - i model o he Cy b,
GTR+G+I o he 12S RNA, and TN93+G o he conca ena ed alignmen .
ML ees we e gene a ed wi h 10000 ul a as boo s ap eplica es (UFBoo ,
Hoang e al. 2018) o e alua e b anch suppo . Bayesian phylogene ic in-
e ence was pe o med using M Bayes . 3.2.7 (Ronquis e al. 2012). Sub-
s i u ion models o each pa i ion we e selec ed using Kakusan4 (Tanabe
2011) unde Akaike In o ma ion C i e ion (AIC). Each analysis consis ed o
wo independen uns o ou Ma ko Chain Mon e Ca lo (MCMC) chains
each (one cold and h ee hea ed) o 10 million gene a ions, sampling e -
e y 1000 gene a ions. A 50% majo i y- ule consensus ee was cons uc ed
a e disca ding he i s 25% o ees as bu n-in, and Bayesian pos e io
p obabili ies (PP) we e calcula ed o all nodes. The esul ing phylogene -
ic ees we e isualized using FigT ee . 1.4.4 and ep esen ed g aphically
in Adobe Illus a o 2023.
Mo phological examina ion
All i e cap u ed indi iduals we e pho og aphed a e cap u e using a Canon
EOS Kiss X7 digi al came a equipped wi h a Canon EF-S 18–55 mm /3.5–5.6
ki lens. S anda d mo phome ic measu emen s we e eco ded, ollowed p o-
cedu es in Kawada e al. (2012). The ollowing measu emen s we e ob ained:
body leng h (HB), ail leng h (T), hind oo leng h wi h claws (HF), o e oo
wid h (FFW), and o e oo leng h wi hou claws (FFL), along wi h da a on sex,
and ep oduc i e s a us.
C anioden al measu emen s we e aken unde a s e eoscopic mic oscope
(SMZ 745, Nikon, Japan) using an elec onic digi al calipe (NTD12–15PMX,
Mi u oyo, Japan) wi h a p ecision o 0.01 mm. A o al o 36 c anioden al mea-
su emen s we e aken o each specimen, including 15 me ics ollowing he
me hod o Kawada e al. (2007), and an addi ional 21 measu emen s eco ded
in his s udy (Fig. 3). De ailed desc ip ions o each measu emen a e p o id-
ed in Suppl. ma e ial 1. The da ase comp ised measu emen s om 65 adul
skulls, including i e skulls o new Eu oscap o and 60 compa a i e skulls om
o he Eu oscap o species ecognized in Vie nam (Suppl. ma e ial 2). All he
measu emen s a e in millime e s.
S a is ical analyses
Minimum, maximum, mean alues, and s anda d de ia ions o measu e-
men s we e calcula ed using Mic oso ® Excel e sion O ice 2021 (Mic o-
so , Redmond, WA, USA). Mul i a ia e analyses o c anioden al mo phology
among Vie namese osso ial moles we e conduc ed o e alua e in e speci -
ic mo phome ic a ia ions, including P incipal Componen Analysis (PCA)
and Mul i a ia e Analysis o Va iance (MANOVA) based on log- ans o med
measu emen s. Di e ences in he mean alues be ween g oups we e
246
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Figu e 3. Do sal (a), en al (b), and la e al (c) iews o he c anium; d. La e al iew o he mandible showing c anioden al
measu emen s. Diag am cons uc ed based on he c anioden al mo phology o he new male specimen by VHY.
247
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
examined using - es s, p eceded by F- es s o assess homogenei y o a i-
ances (P < 0.05). Analysis o a iance (One-way ANOVA) ollowed by Tukey’s
hones ly signi ican di e ence (HSD) (signi ican a P < 0.05) was used o
pai wise compa isons wi hin axa. All hese analyses we e pe o med using
he PAST so wa e . 4.13 (Hamme e al. 2001).
Resul s
Phylogene ic analyses
The conca ena ed phylogene ic ee econs uc ed using bo h ML and BI me h-
ods gene a ed cong uen opologies wi h s ong s a is ical suppo ac oss all
majo nodes. ML ee is p esen ed in Fig. 4a, wi h suppo alues indica ed
as ML boo s ap (MLBS) and Bayesian pos e io p obabili ies (PP). The genus
Eu oscap o was eco e ed as a well-suppo ed monophyle ic g oup, clea ly
dis inguished om he ou g oup Moge a la ouchei in Vie nam. All ecognized
species-le el clades exhibi high suppo alues (MLBS ≥ 90%).
The newly collec ed specimens om Pu Luong NR ep esen a gene ical-
ly dis inc and maximally suppo ed monophyle ic lineage (MLBS = 100%,
PP = 1.0). This clade is posi ioned as he sis e g oup o he E. subanu-
a, om which i is sepa a ed by s ong b anch suppo and conside able
Figu e 4. Maximum likelihood (ML) phylogene ic ee cons uc ed based on a. The conca ena ed mi ochond ial Cy b and
12S RNA gene sequences (1,986 bp); b. Cy b sequences (1,140 bp) o he Eu oscap o spp. Nodal suppo alues a e
indica ed as Maximum Likelihood Boo s ap Suppo /Bayesian Pos e io P obabili y (MLBS/BPP). Rep esen a i es o
he genus Moge a we e included as he ou g oup. Each e minal axon is labelled wi h i s co esponding ouche numbe ,
sampling locali y, and GenBank Accession Numbe o bo h Cy b and 12S gene lis ed in Suppl. ma e ial 5.
254
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
C anium mo phology. The c anium is diminu i e, ligh ly buil , and slende in
p o ile, wi h a g ea es leng h (GLS) o 30.51 mm alling wi hin he lowe size
ange documen ed o Eu oscap o species in Vie nam (Table 4). The os um is
p opo ionally sho and g adually ape ed an e io ly, o ming a iangula ou line
in do sal iew. In la e al aspec , he os al egion is s aigh and only sligh ly
a ched do sally. The b aincase is mode a ely in la ed wi h a smoo hly domed
do sal su ace. The in e o bi al egion is nea ly pa allel-sided, main aining con-
sis en heigh om he on als o he pa ie als. The sagi al c es is absen , and
he lambdoidal c es is low and ounded, con ibu ing o he smoo h con ou o
he pos e io c anial aul . The zygoma ic a ches a e poo ly de eloped, lacking
he hickened and la e ally expanded mo phology seen in la ge species (Fig. 5c).
The in ao bi al o amina a e small and posi ioned close o he an e io ma gin o
he maxillae. The audi o y bullae a e do so en ally la ened, no ex ending be-
yond he pos e io ma gin o he skull, and lacking any signi ican la e al in la ion.
The occipi al egion is gen ly ounded, wi h no p ominen idges o p ojec ions.
Figu e 9. Bi a ia e sca e plo s o he 1s , 2nd, and 3 d p incipal componen sco es de i ed om log- ans o med c anioden-
al measu emen s o Eu oscap o species in Vie nam. a. Sca e plo o PC1 s PC2 showing di e en ia ion among E. da -
wini ( ed squa es), E. subanu a (as e isks), E. kuzne so i ( iangles), E. o lo i (ci cles), E. ngoclinhensis (g ay squa es), and
E. pa idens (diamonds); b, c. Plo o PC1 s PC2 and PC2 s PC3 o E. da wini ( ed colo ) and E. subanu a ( eal colo );
d, e. Plo o PC1 s PC2 and PC2 s PC3 o E. da wini ( ed colo ) and six E. subanu a popula ions in Vie nam ( eal colo ).
255
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Mandible and den i ion. The mandible o holo ype is delica e and mode a ely
a ched, wi h a slende ascending amus and a weakly de eloped angula p o-
cess. The lowe bo de o he mandible is gen ly conca e; he co onoid p ocess
is na ow and sligh ly ecu ed. The mandibula condyle is small, and he man-
dibula symphysis is sho and igh ly used. The species e ains he p imi i e
osso ial mole den al o mula: I3/3, C1/1, P4/4, M3/3 = 44. The i s uppe in-
ciso (I1) sligh ly ecu ed pos e io ly and has a p ominen cu ing edge. I2 and
I3 a e sligh ly smalle han I1, closely aligned, and g adually ape in heigh and
olume. In he lowe jaw, he i s inciso (i1) is small and cu es sligh ly o wa d,
Table 3. Compa a i e s a is ics o ex e nal measu emen s (in millime e s) be ween E. da wini sp. no . and o he osso ial
mole species. (*) indica es sha ed measu emen s be ween E. pa idens and E. ngoclinhensis; (#) indica es sha ed mea-
su emen s be ween E. kuzne so i and E. o lo i.
Species Re e ence (n) HB T HF FFW FFL Tail a io = T/
HB (%)
E. da wini sp. no . This s udy (holo ype ♂) 115.71 2.11 14.51 13.88 13.29 1.82
This s udy (4 pa a ypes ♀) 122.21–127.93
125.52 ± 2.86
2.67–3.74
3.33 ± 0.47
14.86–15.38
15.03 ± 0.24
14.02–14.51
14.21 ± 0.22
13.64–14.11
13.86 ± 0.28
2.18–2.92
2.64 ± 0.32
This s udy (bo h sexes) 115.71–127.93
123.56 ± 5.04
2.11–3.74
3.08 ± 0.68
14.51–15.38
14.93 ± 0.31
13.88–14.51
14.14 ± 0.24
13.29–14.11
13.79 ± 0.41
1.82–2.92
2.48 ± 0.46
E. subanu a Kawada e al. (2012) (8) 113.0–130.0
122.88 ± 5.51
4.0–5.0
4.38 ± 0.44
13.5–15.5
14 ± 0.38
15.0–16.5
14.38 ± 0.38
14.0–15.5
14.75 ± 0.46
3.6
Kawada (2016) (28) 113.0–131.5
125.48 ± 3.95
2.5–5.0
3.80 ± 0.79
13.0–14.5
13.70 ± 0.49
13.0–15.5
14.21 ± 0.55
13.0–15.5
14.27 ± 0.62
1.96–4.24
3.04 ± 0.65
Bui (2022) (42) 107.0–130.5
121.89 ± 5.61
2.50–5.00
3.76 ± 0.73
12.0–16.5
14.02 ± 0.87
13.0–15.5
14.29 ± 0.55
13.80–18.00
14.80 ± 0.84
2.33–3.85
3.08 ± 0.56
E. pa idens Kawada e al. (2012) (10) * 135.0–148.5
143.75 ± 3.75
5.5–9.0
6.95 ± 1.09
13.5–15.5
14.6 ± 0.66
15.0–16.5
15.4 ± 0.61
14.5–16.5
15.3 ± 0.63
4.8
Kawada (2016) (18) * 135.0–150.0
144.89 ± 3.77
5.5–10.5
7.42 ± 1.30
13.5–16.0
14.92 ± 0.69
14.0–17.5
15.47 ± 0.88
14.5–18.0
15.75 ± 0.93
4.07–7.07
5.11 ± 0.83
Bui (2022) (42) 130–165.5
150.9 ± 10.71
5.5–10.0
7.9 ± 1.48
12.0–17.74
16.01 ± 1.18
14.15–16.96
15.65 ± 0.54
14.7–17.6
16.03 ± 0.80
4.23–6.06
5.23 ± 0.0.75
E. ngoclinhensis Bui (2022) (30) 120.0–150.0
137.87 ± 9.01
5.50–10.0
7.50 ± 1.18
12.0–16.0
14.15 ± 0.93
12.27–17.0
14.66 ± 1.34
13.20–18.00
15.02 ± 1.09
4.58–6.67
5.44 ± 0.86
E. kuzne so i Kawada e al. (2012) (19) # 133.0–144.0
138.45 ± 3.39
14.0–17.0
15.37 ± 1.01
14.5–16.5
15.55 ± 0.50
14.5–17.0
15.95 ± 0.71
15.0–17.5
16.26 ± 0.77
11.1
Kawada (2016) (27) # 122.0–144.0
136.85 ± 4.97
10.0–17.0
14.69 ± 2.00
14.5–16.5
15.46 ± 0.46
14.5–17.0
15.91 ± 0.72
15.0–17.5
16.24 ± 0.74
8.19–11.81
10.73 ± 0.93
Zemleme o a e al. (2016) 132–136 11.4–12.5
K yš u ek and Mo okawa
(2018)
117–136 14–17 14.5–16.5 11.6–14.5
Bui (2022) (24) 115.4–144
137.37 ± 5.74
14–17.5
15.65 ± 1.09
14.5–18.4
15.73 ± 0.77
14.5–17
15.82 ± 0.69
15–17.9
16.36 ± 0.80
11.33–12.57
12.05 ± 0.4
E. o lo i Zemleme o a e al. (2016) 115–129 12.6–13.7
K yš u ek and Mo okawa
(2018)
106–129 15–17.5 15.5 12.5–15.1
Bui (2022) (6) 115–137.62
127 ± 7.40
11.76–19.28
16 ± 2.29
13.43–15.5
14.87 ± 0.92
14–16.5
15.15 ± 0.73
15–16.5
15.83 ± 0.76
10.63–13.57
12.45 ± 0.67
E. longi os is Smi h and Xie (2008) 90–145 11.0–25 14–23
E. klossi Kawada e al. (2012) (2) 130.0–135.5 9.5–10.5 15 16 16.0–16.5 7.5
Kawada (2016) (4) 115.0–135.5
127.63 ± 8.81
9.5–13
11.25 ± 1.55
15.0–16.0
15.38 ± 0.48
16.0–17.0
16.38 ± 0.48
15.5–16.5
16.13 ± 0.48
7.01–11.30
8.91 ± 1.84
Smi h and Xie (2008) 115–135.5 9.5–13 15–16 7–11.3
E. malayana Kawada e al. (2008) 124–134.5 4.5–8.5 14–16.5 15–17 15–19 3.35–6.59
Kawada (2016) (10) 128.5–134.5
131.15 ± 1.94
4.5–8.5
5.70 ± 1.09
14.5–16.5
15.50 ± 0.62
15.5–17.0
16.40 ± 0.57
15.0–16.5
15.80 ± 0.42
3.34–6.58
4.35 ± 0.86
Smi h and Xie (2008) 128.5–134.5 4.5–8.5 14.5–16.5 3.3–6.6
E. g andis Mille (1940) 150 9.6 18 15
E. mic u us Smi h and Xie (2008) 128–135 5–9 15–16
256
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Table 4. C anioden al measu emen s o he Eu oscap o species in Vie nam. Fo measu emen s abb e ia ions, see Ma e ials
and me hods sec ion. The comple e lis o specimens included in he c anioden al analysis is p o ided in Suppl. ma e ial 2.
Cha ac e
Species (n)
E. da wini sp. no .
(5) E. subanu a (21) E. ngoclinhensis (4) E. pa idens (13) E. kuzne so i (11) E. o lo i (3)
GLS 30.51–31.01
30.88 ± 0.21
29.49–31.69
30.71 ± 0.55
31.83–33.03
32.53 ± 0.54
33.53–34.76
34.07 ± 0.41
31.75–34.72
33.74 ± 0.73
32.87–33.91
33.50 ± 0.56
BB 13.77–14.26
14.02 ± 0.22
13.44–14.67
14.01 ± 0.29
14.37–14.76
14.59 ± 0.17
14.11–15.32
14.78 ± 0.33
14.71–15.67
15.22 ± 0.32
15.22–16.04
15.51 ± 0.46
IOB 6.72–6.87
6.82 ± 0.06
6.53–7.31
6.83 ± 0.2
6.72–7.21
6.98 ± 0.2
6.41–7.01
6.78 ± 0.16
6.67–7.58
7.04 ± 0.22
7.19–7.31
7.25 ± 0.06
BIOF 5.41–5.77
5.62 ± 0.14
6.07–6.46
6.25 ± 0.27
6.16–6.46
6.36 ± 0.14
6.53–6.76
6.64 ± 0.12
6.18–6.92
6.55 ± 0.21
6.26–6.37
6.32 ± 0.06
RB 4.12–4.27
4.19 ± 0.06
3.84–4.41
4.09 ± 0.14
4.06–4.34
4.20 ± 0.12
4.28–4.74
4.58 ± 0.13
4.13–4.47
4.33 ± 0.1
4.21–4.36
4.30 ± 0.08
LZA 7.88–8.22
8.01 ± 0.13
6.83–7.74
7.33 ± 0.26
8.11–8.72
8.31 ± 0.28
8.69–9.51
9.06 ± 0.27
8.38–9.08
8.62 ± 0.36
8.18–8.39
8.31 ± 0.11
PZRW 10.09–10.37
10.21 ± 0.11
9.19–10.18
9.87 ± 0.3
10.54–10.77
10.64 ± 0.1
10.02–11.15
10.57 ± 0.29
10.53–11.32
11.03 ± 0.27
10.44–10.79
10.64 ± 0.18
ACRB 6.93–7.19
7.06 ± 0.11
7.01–7.28
7.18 ± 0.07
6.66–6.74
6.70 ± 0.04
6.39–6.54
6.46 ± 0.05
7.25–7.45
7.32 ± 0.06
6.68–6.81
6.76 ± 0.07
FMW 3.35–3.54
3.43 ± 0.07
3.27–3.75
3.53 ± 0.16
3.81–4.02
3.89 ± 0.09
3.62–4.23
3.88 ± 0.18
3.55–4.09
3.76 ± 0.17
3.45–3.92
3.68 ± 0.24
CCoL 21.41–21.88
21.59 ± 0.17
20.75–22.43
21.62 ± 0.51
23.07–23.65
23.23 ± 0.28
23.21–24.86
24.1 ± 0.41
22.68–24.38
23.96 ± 0.48
23.55–24.02
23.85 ± 0.26
PL 11.61–12.16
11.92 ± 0.23
11.31–12.6
12.05 ± 0.37
12.58–12.97
12.75 ± 0.16
12.74–13.69
13.31 ± 0.3
12.92–14.18
13.64 ± 0.34
13.31–13.65
13.52 ± 0.19
I1–M311.51–12.02
11.75 ± 0.23
11.19–12.72
11.81 ± 0.41
12.17–12.44
12.30 ± 0.11
12.51–13.24
12.81 ± 0.21
12.55–13.61
13.19 ± 0.34
12.85–13.21
13.03 ± 0.18
I1–P47.15–7.53
7.35 ± 0.16
6.73–7.79
7.28 ± 0.3
7.29–7.72
7.45 ± 0.19
7.67–8.37
7.95 ± 0.2
7.75–8.37
8.04 ± 0.21
8.05–8.19
8.12 ± 0.07
I1–P35.72–6.07
5.92 ± 0.14
5.16–6.06
5.7 ± 0.28
5.47–5.88
5.75 ± 0.19
5.84–6.45
6.15 ± 0.15
5.95–6.65
6.31 ± 0.21
6.27–6.54
6.40 ± 0.14
I1–C 2.94–3.17
3.03 ± 0.11
2.62–3.09
2.90 ± 0.15
3.02–3.21
3.11 ± 0.08
3.22–3.76
3.46 ± 0.17
3.01–3.39
3.22 ± 0.13
3.29–3.46
3.35 ± 0.09
C–M310.13–10.44
10.25 ± 0.14
9.76–11.21
10.34 ± 0.41
10.69–10.99
10.79 ± 0.14
10.63–11.58
11.07 ± 0.27
11.04–11.83
11.49 ± 0.24
11.21–11.43
11.30 ± 0.11
C–P45.51–5.93
5.69 ± 0.2
5.27–6.27
5.71 ± 0.31
5.59–5.97
5.74 ± 0.17
5.72–6.61
6.09 ± 0.25
5.89–6.45
6.18 ± 0.17
6.13–6.25
6.17 ± 0.07
P4–M35.91–6.18
6.10 ± 0.11
5.71–6.58
6.14 ± 0.24
6.34–6.78
6.63 ± 0.2
6.39–6.87
6.67 ± 0.12
6.61–7.21
6.93 ± 0.2
6.62–6.77
6.68 ± 0.08
P1–P43.99–4.11
4.06 ± 0.05
4.13–4.29
4.21 ± 0.07
4.01–4.14
4.08 ± 0.06
3.83–4.57
4.35 ± 0.21
4.44–4.87
4.58 ± 0.11
4.36–4.59
4.48 ± 0.12
M1–M34.54–5.03
4.75 ± 0.19
4.34–5.21
4.73 ± 0.25
4.94–5.28
5.12 ± 0.14
4.86–5.23
5.06 ± 0.1
4.79–5.62
5.24 ± 0.23
5.09–5.34
5.19 ± 0.13
M2–M2W6.71–7.17
6.96 ± 0.22
6.65–7.81
7.06 ± 0.27
7.41–7.68
7.57 ± 0.12
7.01–7.82
7.35 ± 0.2
7.14–7.71
7.44 ± 0.19
7.27–7.59
7.44 ± 0.16
CCW 3.64–3.85
3.74 ± 0.09
3.41–3.79
3.59 ± 0.11
3.57–3.79
3.65 ± 0.1
3.79–4.41
4.03 ± 0.18
3.69–4.04
3.88 ± 0.12
3.77–3.98
3.88 ± 0.11
PWCC 2.27–2.42
2.36 ± 0.06
2.16–2.54
2.32 ± 0.1
2.31–2.49
2.40 ± 0.1
2.32–2.69
2.52 ± 0.1
2.25–2.62
2.43 ± 0.12
2.36–2.73
2.50 ± 0.2
PWM2M23.81–3.93
3.90 ± 0.05
3.48–4.18
3.84 ± 0.18
3.91–4.06
4.00 ± 0.07
3.67–4.21
3.93 ± 0.15
3.64–4.07
3.86 ± 0.14
3.88–3.95
3.91 ± 0.04
PWM3M33.91–4.06
3.98 ± 0.06
3.67–4.35
4.06 ± 0.17
4.12–4.45
4.28 ± 0.17
3.94–4.46
4.21 ± 0.15
3.79–4.43
4.21 ± 0.21
4.26–4.31
4.28 ± 0.03
ML 18.93–19.37
19.19 ± 0.16
18.33–20.28
19.24 ± 0.53
19.91–21.01
20.38 ± 0.48
20.61–22.02
21.42 ± 0.39
20.31–22.03
21.44 ± 0.44
21.04–21.46
21.21 ± 0.22
CAL 8.09–8.24
8.15 ± 0.06
7.69–8.49
8.15 ± 0.21
8.47–9.27
9.05 ± 0.38
8.61–9.53
9.24 ± 0.29
8.69–9.65
9.31 ± 0.26
9.05–9.17
9.09 ± 0.07
MH 5.73–5.84
5.78 ± 0.05
5.31–6.31
5.80 ± 0.26
6.01–6.21
6.14 ± 0.09
6.17–6.81
6.39 ± 0.19
6.03–6.81
6.49 ± 0.23
6.25–6.67
6.43 ± 0.22
i1–m310.88–11.45
11.16 ± 0.23
10.47–11.87
11.14 ± 0.45
11.43–11.74
11.57 ± 0.13
11.77–12.36
12.04 ± 0.18
11.86–12.94
12.5 ± 0.33
11.96–12.36
12.22 ± 0.23
257
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
while i2 and i3 a e smalle and aligned along he la e al mandibula oo h ow. The
uppe canines (C1) a e mode a e in size, conical, and do no p o ude s ongly
beyond he adjacen ee h, while he lowe canines (c1) a e simila in shape o
he h ee lowe inciso s. The p emola s (P1–P4 / p1–p4) a e asymme ical in size.
In he uppe jaw, P2 is he smalles o he se ies, whe eas P4 is he la ges and
mo e obus in o e all dimensions—nea ly 2.5 imes he size o P2. P1 and P3 a e
almos equal in c own heigh . In he lowe jaw, he e is a clea size p og ession,
wi h p4 being he la ges . The p1 and p4 a e subequal, while p2 is sligh ly educed.
The uppe mola s (M1–M3) exhibi a na ow lingual ma gin, and ins ead o hy-
pocones, hey possess well-de eloped me aconules, especially on P2 and P1,
which a e clea ly isible om he lingual iew. M3 displays a iangula occlusal
ou line, wi h a p ominen igon and an an e io ly shi ed p o ocone. The lowe
mola s (m1–m3) lack hypoconulids, and cuspid sepa a ion is ela i ely weak.
Pel ic mo phology. The pel ic gi dle is slende and educed in o e all o-
bus ness. The ischia a e sho ened and hin, con ibu ing o a na ow pel ic
ou le (Fig. 5). The sac al e eb ae a icula e weakly wi h he ilia, and he pel is
shows no e idence o expanded muscle a achmen si es.
Female seconda y sexual cha ac e s. The adul emale pa a ype (NTS.2025.
PL.02) exhibi s clea ly iden i iable sexual cha ac e is ics indica i e o ep oduc-
i e ma u i y (Fig. 6). Ex e nal mo phological inspec ion e eals he p esence
o wo pai s o inguinal mammae, symme ically posi ioned along he lowe
abdomen. The nipples a e well-de eloped and sligh ly p o uding, wi h he
su ounding u sligh ly pa ed. The mos p ominen ex e nal ea u e is a con-
spicuous pale-yellow en al pa e n, ex ending longi udinally om he lowe
ho acic egion o he pel ic a ea. The s eak is localized along he midline,
o ming a con as wi h he da ke g ey–b own en al pelage, and is absen in
male and non-b eeding emale specimens examined in he se ies. This indi id-
ual was con i med o be g a id a he ime o cap u e, based on isible abdomi-
nal dis ension and he p esence o de eloping emb yos upon dissec ion.
Va ia ion. The holo ype displays a uni o mly da k g eyish–black do sum wi h
a ain sil e y sheen, while he en al su ace is only ma ginally ligh e , esul -
ing in a nea ly unicolo ed appea ance. In con as , emale pa a ypes show mo e
p onounced en al pallo , especially in he h oa and pel ic egions, some-
imes accompanied by a b ownish inge a ound he ches . The p egnan emale
(NTS.2025.PL.02) has a dis inc pale-yellow u a ea on he mid- en al su ace.
Cha ac e
Species (n)
E. da wini sp. no .
(5) E. subanu a (21) E. ngoclinhensis (4) E. pa idens (13) E. kuzne so i (11) E. o lo i (3)
p1–m38.99–9.43
9.21 ± 0.18
8.48–9.76
9.15 ± 0.37
9.29–9.57
9.44 ± 0.12
9.18–9.91
9.58 ± 0.18
9.74–10.55
10.23 ± 0.25
9.82–10.14
10.01 ± 0.17
p4–m36.07–6.47
6.28 ± 0.16
5.85–6.68
6.28 ± 0.28
6.51–6.89
6.70 ± 0.21
6.16–6.89
6.65 ± 0.2
6.72–7.47
7.14 ± 0.23
6.62–6.94
6.78 ± 0.16
i1–p46.11–6.27
6.21 ± 0.06
6.16–6.33
6.23 ± 0.06
6.25–6.31
6.27 ± 0.03
6.53–6.71
6.64 ± 0.06
6.78–7.06
6.93 ± 0.08
6.67–6.81
6.75 ± 0.07
m1–m34.89–5.29
5.05 ± 0.16
4.62–5.49
5.01 ± 0.27
4.98–5.42
5.27 ± 0.2
5.17–5.59
5.36 ± 0.1
5.27–6.18
5.68 ± 0.28
5.34–5.53
5.45 ± 0.1
i1–c 1.54–1.63
1.59 ± 0.04
1.65–1.88
1.76 ± 0.08
1.68–1.96
1.79 ± 0.13
1.93–2.27
2.11 ± 0.09
1.83–2.16
1.96 ± 0.11
1.74–1.81
1.77 ± 0.04
i1–p12.95–3.19
3.04 ± 0.09
2.77–3.34
3.09 ± 0.15
3.05–3.16
3.12 ± 0.05
3.52–3.88
3.68 ± 0.12
3.29–3.71
3.47 ± 0.14
3.37–3.54
3.48 ± 0.1
p1–p43.97–4.19
4.10 ± 0.09
3.63–4.39
4.00 ± 0.19
3.91–4.14
3.99 ± 0.1
3.94–4.41
4.18 ± 0.16
4.27–4.69
4.46 ± 0.13
4.41–4.58
4.49 ± 0.09
258
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Table 5. C anioden al measu emen s (in mm) o ype specimens o Eu oscap o da wini sp. no . (Vouche : 1♂ NTS.2024.
PL.01; 4♀♀ NTS.2025.PL.02–NTS.2025.PL.05) and E. subanu a (Vouche : 4♂♂ SIK0882, SIK0884, SIK0875, SIK0876;
1♀ SIK0883), as well as addi ional specimens ep esen ing h ee o he Vie namese popula ions o E. subanu a om Pu
Huong NR (Nghe An P o ince), Na Hang (Tuyen Quang P o ince), and Xuan Son NP (Phu Tho P o ince).
Cha ac e
E. da wini sp. no . E. subanu a E. subanu a E. subanu a E. subanu a
Pu Luong NR (Thanh Hoa) pop. Tam Dao (Tuyen Quang) pop. Pu Huong NR
(Nghe An) pop.
Na Hang
(Tuyen Quang) pop. Xuan Son NP (Phu Tho) pop.
Male (1) Female (4) Male (4) Female (1) Female (1) Male (2) Male (3) Female (6)
GLS 30.51 30.94–31.01
30.97 ± 0.03
30.44–30.96
30.66 ± 0.22
31.41 31.33 30.75–31.69
31.22 ± 0.66
30.49–30.98
30.78 ± 0.26
29.96–31.02
30.48 ± 0.57
BB 13.76 13.84–14.26
14.08 ± 0.21
13.44–14.23
13.75 ± 0.34
14.44 14.33 13.93–14.67
14.30 ± 0.52
13.91–14.47
14.15 ± 0.29
13.58–14.19
13.92 ± 0.23
IOB 6.72 6.83–6.87
6.85 ± 0.02
6.57–6.86
6.77 ± 0.14
6.97 6.74 7.13–7.14
7.14 ± 0.01
6.59–7.05
6.79 ± 0.24
6.53–7.13
6.82 ± 0.21
BIOF 5.41 5.59–5.77
5.68 ± 0.09
6.13–6.21
6.17 ± 0.04
6.21 6.27 6.27–6.35
6.31 ± 0.06
6.12–6.22
6.16 ± 0.05
6.16–6.38
6.29 ± 0.08
RB 4.12 4.17–4.27
4.21 ± 0.04
3.84–4.29
4.10 ± 0.19
4.21 4.26 3.99–4.41
4.20 ± 0.3
3.96–4.16
4.03 ± 0.11
4.04–4.28
4.13 ± 0.09
LZA 8.22 7.88–8.02
7.96 ± 0.06
7.24–7.61
7.43 ± 0.16
7.68 7.63 7.01–7.54
7.28 ± 0.37
7.15–7.51
7.28 ± 0.2
7.11–7.51
7.28 ± 0.17
PZRW 10.23 10.09–10.37
10.21 ± 0.13
10.01–10.17
10.09 ± 0.08
10.13 9.85 9.96–10.18
10.07 ± 0.16
9.19–9.64
9.44 ± 0.23
9.34–10.16
9.78 ± 0.36
ACRB 6.92 6.98–7.19
7.09 ± 0.11
7.12–7.26
7.19 ± 0.07
7.29 7.18 7.27–7.35
7.31 ± 0.06
7.01–7.16
7.11 ± 0.08
7.11–7.28
7.21 ± 0.07
FMW 3.35 3.38–3.54
3.45 ± 0.07
3.27–3.71
3.46 ± 0.19
3.27 3.67 3.35–3.58
3.47 ± 0.16
3.51–3.67
3.57 ± 0.09
3.45–3.75
3.63 ± 0.13
CCoL 21.41 21.54–21.88
21.64 ± 0.16
21.42–21.83
21.68 ± 0.2
22.31 22.26 21.49–22.13
21.81 ± 0.45
20.92–21.48
21.05 ± 0.45
21.15–21.91
21.52 ± 0.42
PL 11.61 11.81–12.16
12 ± 0.17
11.55–12.53
12.03 ± 0.4
12.6 12.32 11.72–12.51
12.12 ± 0.56
11.98–12.38
12.12 ± 0.22
12.11–12.69
12.38 ± 0.31
I1–M311.51 11.59–12.02
11.81 ± 0.22
11.86–12.14
11.98 ± 0.12
12.72 12.16 11.89–12.33
12.11 ± 0.31
11.43–12.02
11.67 ± 0.31
11.58–12.21
11.84 ± 0.35
I1–P47.15 7.23–7.53
7.38 ± 0.17
7.17–7.36
7.25 ± 0.08
7.79 7.27 7.53–7.58
7.56 ± 0.04
6.73–7.68
7.21 ± 0.39
7.23–7.44
7.33 ± 0.11
I1–P35.92 5.72–6.07
5.92 ± 0.16
5.56–5.88
5.69 ± 0.16
6.03 5.78 5.95–6.06
6.01 ± 0.08
5.16–5.97
5.61 ± 0.35
5.68–5.95
5.85 ± 0.15
I1–C 3.12 2.94–3.17
3.01 ± 0.11
2.62–3.04
2.84 ± 0.17
2.92 2.99 2.97–3.09
3.03 ± 0.08
2.76–3.09
2.96 ± 0.17
2.68–3.09
2.88 ± 0.17
C–M310.13 10.14–10.44
10.28 ± 0.15
10.47–10.76
10.58 ± 0.13
11.21 10.55 10.24–10.69
10.47 ± 0.32
10.03–10.55
10.24 ± 0.28
9.76–10.76
10.17 ± 0.44
C–P45.51 5.56–5.93
5.72 ± 0.21
5.56–5.71
5.65 ± 0.07
6.27 5.49 5.63–5.79
5.71 ± 0.11
5.81–6.08
5.95 ± 0.14
5.31–6.05
5.70 ± 0.37
P4–M35.91 6.12–6.18
6.15 ± 0.03
6.27–6.41
6.32 ± 0.06
6.58 6.39 6.28–6.45
6.37 ± 0.12
5.81–6.11
5.92 ± 0.17
5.71–6.26
5.99 ± 0.2
P1–P43.99 4.02–4.11
4.07 ± 0.05
4.19–4.23
4.21 ± 0.02
4.27 4.25 4.16–4.25
4.21 ± 0.06
4.18–4.29
4.23 ± 0.06
4.13–4.29
4.21 ± 0.07
M1–M34.54 4.65–5.03
4.80 ± 0.17
4.81–4.98
4.92 ± 0.08
5.21 4.91 4.75–5.01
4.88 ± 0.18
4.43–4.71
4.54 ± 0.15
4.34–4.87
4.55 ± 0.23
M2–M2W6.69 6.72–7.17
7.02 ± 0.2
7.01–7.33
7.12 ± 0.14
7.81 7.14 7.02–7.26
7.14 ± 0.17
6.71–7.06
6.86 ± 0.18
6.65–7.29
6.96 ± 0.22
CCW 3.71 3.64–3.85
3.75 ± 0.1
3.57–3.71
3.64 ± 0.07
3.73 3.74 3.71–3.76
3.74 ± 0.04
3.49–3.61
3.55 ± 0.06
3.41–3.79
3.56 ± 0.13
PWCC 2.41 2.27–2.42
2.35 ± 0.06
2.17–2.37
2.31 ± 0.09
2.41 2.54 2.31–2.36
2.34 ± 0.04
2.29–2.33
2.31 ± 0.02
2.16–2.47
2.29 ± 0.13
PWM2M23.91 3.81–3.93
3.90 ± 0.06
3.57–3.96
3.80 ± 0.16
4.15 3.95 3.95–3.99
3.97 ± 0.03
3.69–3.89
3.80 ± 0.1
3.56–3.94
3.83 ± 0.14
PWM3M33.91 3.92–4.06
3.99 ± 0.06
3.92–4.09
4.03 ± 0.07
4.35 4.11 4.07–4.21
4.14 ± 0.1
3.67–4.19
3.98 ± 0.27
3.91–4.17
4.07 ± 0.12
ML 18.93 19.21–19.37
19.26 ± 0.07
19.1–19.47
19.32 ± 0.17
20.28 19.77 19.07–20.18
19.63 ± 0.78
18.33–19.86
18.89 ± 0.55
18.91–19.69
19.35 ± 0.4
CAL 8.14 8.09–8.24
8.15 ± 0.07
8.05–8.33
8.15 ± 0.12
8.33 8.29 7.81–8.29
8.05 ± 0.34
7.69–8.36
8.05 ± 0.27
8.16–8.41
8.31 ± 0.13
259
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Pa icula ly, emale pa a ypes (n = 4) exhibi signi ican ly la ge c anioden al
dimensions han he male holo ype (Fig. 5, Table 4). Female specimens show
g ea e GLS (≤31.01 mm), maxilla y oo h ow leng h, and mandibula leng h in
size. Howe e , he o e all den al mo phology emains conse ed ac oss sexes.
Va ia ion is also appa en in ail e eb ae coun s. The holo ype male possess-
es only six caudal e eb ae, which co esponds o i s ex e nally es igial ail. In
he ou emale pa a ypes, h ee indi iduals (NTS.2025.PL.03, NTS.2025.PL.04,
NTS.2025.PL.05) also exhibi six caudal e eb ae, bu he p egnan emale
(NTS.2025.PL.02) di e s in ha ing se en (Fig. 5g).
E ymology. The speci ic epi he da wini hono s he eminen na u alis Cha les
Da win, whose ounda ional con ibu ions o e olu iona y biology ha e p o-
oundly in luenced mode n sys ema ics and he unde s anding o specia ion.
Da win’s insigh s ha e had a pa icula ly s ong impac on he au ho s o his
s udy. We p opose “Da win’s mole” as he English common name, and “Chuộ
chũi Da win” as he Vie namese common name, e lec ing he mos p ominen
mo phological ai and hono ing he indi idual commemo a ed.
Dis ibu ion. Eu oscap o da wini sp. no . is cu en ly known only om i s ype
locali y wi hin Pu Luong NR, Thanh Hoa P o ince, no h-cen al Vie nam. All known
specimens we e collec ed along a o es ed ele a ional ansec on he sou hwes -
e n idge o Pu Luong Moun ain, a al i udes anging om 900 o 1100 me e s a.s.l.
Ecological habi a no es. Eu oscap o da wini sp. no . was encoun e ed in
closed-canopy p ima y e e g een o es a he Pu Luong NR. The o es a he
collec ion si es exhibi s a dense, s a i ied s uc u e wi h an uppe canopy dom-
ina ed by la ge dip e oca p and Fagaceae ees, an unde s o y laye o palms,
sh ubs, and saplings, and a g ound laye co e ed in deep lea li e , decompos-
ing o ganic ma e ial, and ine oo ne wo ks. The soil is da k b own o eddish,
loamy o clay-loam in ex u e, mois bu well-d ained, and ee o su ace ocks
o exposed limes one. Specimens we e collec ed along na ow animal pa hs,
unde hick ege a ion, and beside moss-co e ed ee bases, whe e soil is pa -
icula ly so and cool. All apping si es we e loca ed in non-ka s a eas wi h
iable, humus- ich o es soils, and deep, o ganic subs a es.
Cha ac e
E. da wini sp. no . E. subanu a E. subanu a E. subanu a E. subanu a
Pu Luong NR (Thanh Hoa) pop. Tam Dao (Tuyen Quang) pop. Pu Huong NR
(Nghe An) pop.
Na Hang
(Tuyen Quang) pop. Xuan Son NP (Phu Tho) pop.
Male (1) Female (4) Male (4) Female (1) Female (1) Male (2) Male (3) Female (6)
MH 5.84 5.73–5.83
5.76 ± 0.05
5.72–6.01
5.81 ± 0.13
6.03 6.26 5.64–6.08
5.86 ± 0.31
5.53–6.07
5.76 ± 0.19
5.78–6.31
6.00 ± 0.28
i1–m310.88 11.01–11.45
11.23 ± 0.19
10.69–11.57
11.18 ± 0.37
11.87 11.67 11.38–11.59
11.49 ± 0.15
11.05–11.33
11.19 ± 0.14
10.51–11.65
10.95 ± 0.46
p1–m38.99 9.16–9.43
9.23 ± 0.21
9.24–9.39
9.32 ± 0.08
9.76 9.56 9.21–9.52
9.37 ± 0.22
8.63–9.54
8.99 ± 0.34
9.03–9.31
9.17 ± 0.14
p4–m36.07 6.22–6.47
6.33 ± 0.13
6.39–6.54
6.46 ± 0.07
6.67 6.68 6.26–6.48
6.37 ± 0.16
5.91–6.28
6.14 ± 0.2
5.85–6.49
6.13 ± 0.25
i1–p46.11 6.21–6.27
6.24 ± 0.03
6.22–6.29
6.25 ± 0.03
6.24 6.19 6.32–6.37
6.35 ± 0.04
6.16–6.24
6.21 ± 0.04
6.17–6.32
6.21 ± 0.06
m1–m34.89 4.97–5.29
5.09 ± 0.15
5.15–5.25
5.20 ± 0.04
5.34 5.49 5.09–5.29
5.19 ± 0.14
4.68–5.06
4.84 ± 0.2
4.62–5.28
4.84 ± 0.25
i1–c 1.54 1.56–1.63
1.60 ± 0.03
1.72–1.81
1.74 ± 0.09
1.86 1.88 1.77–1.79
1.78 ± 0.01
1.68–1.86
1.74 ± 0.1
1.69–1.88
1.77 ± 0.07
i1–p12.98 2.95–3.19
3.06 ± 0.1
3.05–3.17
3.10 ± 0.05
3.02 3.22 3.34–3.39
3.37 ± 0.04
2.77–3.22
3.05 ± 0.18
3.11–3.17
3.13 ± 0.03
p1–p43.97 4.07–4.19
4.10 ± 0.1
3.87–4.12
3.99 ± 0.11
4.15 3.94 4.08–4.12
4.10 ± 0.03
3.79–4.23
3.98 ± 0.16
3.93–4.25
4.1 ± 0.16
260
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Compa isons. The new species is dis inguished om i s close congene s by
i s unca ed ail, along wi h dis inc i e c anial mo phology, including a slende
zygoma ic a ch and a na ow pel ic s uc u e.
Eu oscap o da wini sp. no . is mos simila mo phologically o E. suban-
u a, wi h which i sha es a ma kedly educed ail leng h and compac body
p opo ions. Howe e , hey di e in bo h c anioden al mo phology and ex e -
nal cha ac e s. In e es ingly, despi e he signi ican ly na owe b ead h ac oss
he in e o bi al o amina (BIOF: 5.41–5.77 mm in E. da wini s 6.07–6.46 mm
in E. subanu a), he la e al zygoma ic a ch (LZA) in E. da wini is ema kably
elonga ed (7.88–8.22 mm), exceeding ha o E. subanu a (6.83–7.74). This
associa ed wi h di e ences in he shape o he zygoma ic a ch: in E. da wi-
ni, he a ch is slende and ape s pos e io ly owa d he pala ine, whe eas in
Table 6. Cha ac e ac o loadings o log- ans o med measu emen s (PCs 1, 2, 3)
among all axa and be ween E. da wini sp. no . and E. subanu a.
Cha ac e All axa E. da wini and E. subanu a
PC 1 PC 2 PC 3 PC 1 PC 2 PC 3
GLS 0.17 –0.05 –0.05 0.09 –0.03 0.01
BB 0.12 0.04 –0.06 0.06 0.00 0.06
IOB 0.04 0.13 0.01 0.08 0.05 0.01
BIOF 0.09 0.02 0.24 –0.01 0.44 0.17
RB 0.14 –0.17 –0.16 0.10 –0.17 0.19
LZA 0.27 –0.24 –0.35 0.05 –0.45 0.00
PZRW 0.14 0.06 –0.18 0.06 –0.18 0.17
ACRB –0.07 0.32 0.17 0.02 0.08 0.05
FMW 0.14 –0.19 0.00 –0.04 0.18 –0.07
CCoL 0.18 –0.02 –0.08 0.12 –0.01 0.02
PL 0.20 0.08 0.01 0.12 0.02 –0.05
I1–M30.18 0.12 0.02 0.21 0.03 0.07
I1–P40.17 0.08 0.10 0.22 0.03 –0.22
I1–P30.17 0.13 0.11 0.26 –0.08 –0.37
I1–C 0.23 –0.30 –0.12 0.10 –0.21 –0.07
C–M30.17 0.17 0.01 0.23 0.05 0.03
C–P40.15 0.13 0.15 0.24 0.11 –0.38
P4–M30.18 0.13 –0.09 0.19 0.00 0.31
P1–P40.11 0.12 0.25 0.02 0.15 –0.36
M1–M30.17 0.19 –0.14 0.29 –0.03 0.29
M2–M2W0.10 0.06 –0.11 0.18 0.06 0.14
CCW 0.16 –0.13 –0.14 0.11 –0.18 0.04
PWCC 0.12 –0.12 –0.16 0.06 –0.10 0.13
PWM2M20.04 0.00 –0.11 0.18 0.01 0.11
PWM3M30.09 –0.02 –0.04 0.13 0.15 0.21
ML 0.19 0.01 –0.06 0.15 –0.02 0.01
CAL 0.22 –0.04 –0.16 0.07 –0.04 0.05
MH 0.20 0.02 –0.06 0.19 0.00 –0.10
i1–m30.18 0.13 0.06 0.23 0.04 –0.06
p1–m30.15 0.24 0.01 0.24 0.01 –0.04
p4–m30.17 0.25 –0.08 0.25 –0.01 0.14
i1–p40.14 0.07 0.09 0.04 0.04 –0.01
m1–m30.18 0.22 –0.04 0.31 –0.04 0.20
i1–c 0.26 –0.39 0.59 0.02 0.55 0.08
i1–p10.27 –0.19 0.30 0.21 0.18 –0.25
p1–p40.15 0.27 0.10 0.24 0.02 –0.28
% a iance 67.70 9.37 4.12 42.37 16.10 8.74
261
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
E. subanu a, he an e io pa zygoma ic a ch is sligh ly expanded la e ally, e-
sul ing in a mo e pa allel con igu a ion be ween he le and igh a ches (Fig.
7). This zygoma ic di e ence is u he suppo ed by compa a i e measu e-
men s ac oss mul iple E. subanu a popula ions. All examined popula ions o
E. subanu a— om Tam Dao, Na Hang, Xuan Son, Ba Vi, and Pu Huong—exhibi
consis en ly sho e LZA alues (Fig. 8, Table 5).
The E. da wini displays sho e c own heigh s and weake cuspid de el-
opmen , pa icula ly on p4, m1, m2, m3. In do sal iew, he os al po ion o
E. da wini appea s na owe and mo e ape ed an e io ly, wi h he in e o bi al
egion sligh ly mo e cons ic ed. The snou b ead h and pala al leng h a e bo h
consis en ly na owe in E. da wini, showing a slende c anio acial p o ile (Figs
7, 8). This is suppo ed by he sho e maxilla y p emola leng h (P1–P4: 3.99–
4.11 mm in E. da wini s 4.13–4.29 mm in E. subanu a) and he compac man-
dibula inciso ow leng h (i1–c: 1.54–1.63 mm in E. da wini s 1.65–1.88 mm in
E. subanu a) (Table 4). Fu he mo e, den al spacing and size di e en ia ion a e
p onounced: I1 in E. da wini is medium size and cu ed, bu smalle han ha o
E. subanu a, and he spacing be ween I2 and I3 is mo e comp essed. The lowe
inciso s and p emola s also ollow a p og essi e enla gemen pos e io ly, bu
a e o e all less massi e and e ically de eloped in E. da wini, con ibu ing o a
educed mas ica o y appa a us.
In e ms o ex e nal measu emen s, E. da wini displays a sho e ail han
E. subanu a, wi h ail leng hs anging om 2.11–3.74 mm compa ed o 2.5–
5.0 mm as epo ed by Kawada (2016) and Bui (2022). This di e ence occu s
despi e o e lapping head–body leng hs: 115.71–127.93 mm in E. da wini s
113.0–131.5 mm and 107.0–130.5 mm in E. subanu a (Kawada 2016, Bui
2022), esul ing in a lowe ail o body leng h a io (1.82–2.92%) compa ed o
E. subanu a (1.96–4.24% and 2.33–3.85%) (Table 3). This ex e nal unca ion
is suppo ed by os eological e idence: E. da wini possesses only six o se en
caudal e eb ae, whe eas E. subanu a e ains nine o en.
Eu oscap o da wini possesses an o e all smalle skull compa ed o E. ngo-
clinhensis, as e lec ed by sho e measu emen s in GLS (30.51–31.01 mm s
31.83–33.03 mm), LZA (7.88–8.22 mm s 8.11–8.72 mm), and mandibula
leng h (ML: 18.93–19.37 mm s 19.91–21.01 mm). I also has a na owe in-
e o bi al b ead h (BIOF: 5.41–5.77 mm s 6.16–6.46 mm) and a sho e lowe
pos hi d-p emola oo h ow (p4–m3: 6.07–6.47 mm s 6.51–6.89 mm). The
uppe oo h ow (I1–M3) is educed in leng h (11.51–12.02 mm in E. da wini s
12.17–12.44 mm in E. ngoclinhensis, and up o 13.0 mm in E. pa idens and
E. kuzne so i). The dis ance be ween lowe inciso -canine (i1–c) is also sho e
(1.54–1.63 mm), ep esen ing he smalles alue eco ded wi hin he genus.
Table 7. Measu emen a iables showing signi ican pai wise di e ences be ween Eu oscap o da wini and o he Eu os-
cap o species in Vie nam, based on Tukey’s es o he mos in luen ial loadings on PC1–PC3.
E. da wini
sp. no .Cha ac e E. subanu a E. ngoclinhensis E. pa idens E. kuzne so i E. o lo i
C anium BIOF, LZA BIOF, LZA, CAL,
FMW
BIOF, LZA, CAL BIOF, LZA, CAL, PL BIOF, CAL, PL, MH, FMW
Maxilla y den i ion P1–P4, C–P4, P4–
M3, C–M3, M1–M3
P1–P4, PWCC, P1–P4, C–P4, I1–C,
CCW, PWCC, PWM2M2,
PWM3M3
I1–C, CCW, PWCC,
PWM2M2, PWM3M3
P1–P4, C–P4, I1–C, I1–M3,
M1–M3, M2–M2W, CCW,
PWCC
Mandibula den i ion i1–c, m1–m3, p4–
m3, p1–m3, p1–p4
i1–c, m1–m3, p1–p4i1–p1i1–c, m1–m3, p4–m3,
i1–p1
i1–c
262
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Compa ed o E. pa idens, he c anium o E. da wini is mo e slende , wi h a
na owe basal b ead h and educed pala al leng h. GLS is signi ican ly sho e
(30.51–31.01 mm s 33.53–34.76 mm), BB is na owe (13.77–14.26 mm s
14.11–15.32 mm), and he wid h be ween uppe canine CCW is educed (3.64–
3.85 mm s 3.79–4.41 mm). The mandible is likewise smalle (ML: 18.93–
19.37 mm s 20.61–22.02 mm), wi h sho ened m1–m3 (4.89–5.29 mm s
5.17–5.59 mm), i1–p1 (2.95–3.19 mm s 3.52–3.88 mm) segmen s, yielding a
mo e compac jaw p opo ion.
Eu oscap o da wini di e s om E. o lo i and E. kuzne so i in ha ing a small-
e c anium, sho e pala al leng h (PL: 11.61–12.16 mm s 13.31–13.65 mm in
E. o lo i), and lesse pos e io zygoma ic oo wid h (PZRW: 10.09–10.37 mm
s 10.44–10.79 mm). These p opo ions esul in a no iceably mo e compac
and domed neu oc anial p o ile in do sal iew. Fu he mo e, he uppe mola s
o E. da wini a e less ans e sely expanded han hose o E. kuzne so i, as in-
dica ed by a na owe M2–M2 wid h (6.71–7.17 mm in E. da wini s ≤ 7.8 mm in
E. kuzne so i). The mandibula symphysis in E. da wini is ela i ely sho e and
mo e e ically aligned, con ibu ing o a blun e jaw p o ile compa ed o he
mo e elonga ed mandibles seen in la ge Eu oscap o .
C anial mo phome ics and size di e ences in Eu oscap o da wini
sp. no .
P incipal Componen Analysis (PCA) o 36 log- ans o med c anioden al mea-
su emen s e ealed mo phome ic di e en ia ion in all Vie namese Eu oscap o
axa (Fig. 9a). The di e ences among axa we e de ec ed by one-way ANOVA (P
< 0.05) wi h ac o loadings o each a iable p esen ed in Table 6. PC1, accoun -
ing o 67.70% o he o al a iance, p ima ily e lec s o e all size di e ences, es-
pecially in mandibula , maxilla y leng hs and oo h ow p opo ions. PC2 con ib-
u es an addi ional 9.37% o he a ia ion. Eu oscap o da wini and E. subanu a
o m a igh and comple ely o e lapping clus e in he nega i e PC1 space. No
signi ican sepa a ion is obse ed be ween hem along PC1 (p = 0.784). Eu os-
cap o ngoclinhensis occupies a mo e cen al posi ion along PC1 and is clea ly
sepa a ed om he E. da wini–E. subanu a clus e . PC1 sco es o E. da wini a e
signi ican ly lowe han hose o la ge -bodied axa, including E. pa idens, E. o -
lo i, and E. kuzne so i (One-way ANOVA, P < 0.01). E. pa idens o ms a disc e e
clus e in PC1 and PC2 quad an , signi ican ly sepa a ed om bo h E. o lo i and
E. kuzne so i (P < 0.01). Meanwhile, E. o lo i and E. kuzne so i exhibi pa ial
o e lap bo h in PC1 and PC2 ( - es , = 1.204, p = 0.237), bu emain dis inc
om he smalle -bodied E. da wini–E. subanu a g oup.
To cla i y he mo phological di e gence be ween Eu oscap o da wini and
i s closes ela i e E. subanu a, PCA analyses we e conduc ed using only spec-
imens o hese wo species (Fig. 9b–e). The i s h ee PCs explain 67.57% o
he o al a iance, wi h PC1 accoun ing 42.73%, PC2: 16.10%, and PC3: 8.74%
(Table 6). These componen s collec i ely e eal a pa e n o sub le ye consis-
en di e en ia ion be ween he wo axa. PC1, which e lec s o e all c anial
size and p opo ions, is p ima ily in luenced by a iables associa ed wi h p e-
mola and mola ow leng hs: C–P4 (0.24), M1–M4 (0.29), I1–P3 (0.26), m1–m3
(0.31), and p4–m3 (0.25). PC2 is mos in luenced by BIOF (0.44) and i1–c (0.55)
poin ing o di e ences in in ao bi al o amina b ead h and mandibula inciso
263
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
spacing. The nega i e loading o LZA (–0.45) u he highligh s a ia ion in zy-
goma ic a ch leng h. PC3, which accoun s o 9.07% o he a iance and con-
ibu es o addi ional sepa a ion among axa, is domina ed by C–P4 (–0.38),
I1–P3 (–0.37), P4–M3 (0.31) and P1–P4 (–0.36), wi h he la e con ibu ing neg-
a i ely o he axis and e lec ing di e ences in p emola spacing and alignmen .
Mul i a ia e analysis p o ides quan i a i e suppo o he mo phological dis-
inc i eness o E. da wini ela i e o E. subanu a. Among he a iables con ibu -
ing mos s ongly o species sepa a ion, leng h o he zygoma ic a ch (LZA) and
b ead h be ween he in ao bi al o amina (BIOF) p esen he mos p onounced di-
e gence. Specimens o E. da wini consis en ly display a mo e elonga ed zygoma -
ic a ch (LZA: 7.88–8.22 mm) and no iceably na owe in e o bi al b ead h (BIOF:
5.59–5.77 mm in emales, 5.41 mm in he male) compa ed o E. subanu a (BIOF:
6.17–6.21 mm in males, 6.21 mm in he emale; Table 5, Fig. 10a, b). In he bi a ia e
plo o BIOF agains LZA (Fig. 10b), al hough BIOF emains ela i ely consis en
ac oss mos Eu oscap o species in Vie nam, E. da wini exhibi s a dis inc ly low-
e alue o his ai . This de ia ion esul s in a conspicuous le wa d shi o he
E. da wini clus e in he plo (Fig. 10b), clea ly sepa a ing i om all o he congene s.
Se e al a iables including C–P4, I1–P3, I1–M3, P1–P4, and P4–M3, cons an ly
indica ed high loadings ac oss mul iple PCs (Table 6) and we e signi ican ly
smalle in E. da wini, e lec ing i s ela i ely educed and compac c anial and
den al a chi ec u e. Pai wise cha ac e compa isons u he co obo a e hese
indings (Table 7), which demons a e signi ican di e en ia ion be ween E. da -
wini and E. subanu a in nea ly all den al measu emen s, indica ing bo h c anial
and mandibula di e gence obse ed in he PCA esul s. Besides E. subanu a,
E. da wini also di e s om o he Eu oscap o congene s in key a iables such
as BIOF, LZA, CAL and I1–C (Table 7).
Figu e 10. a. Boxplo s showing ange (minimum o maximum, mean alue indica ed by ho izon al lines), in e qua ile
ange ( ep esen ed by he ec angula box) o he mos con ibu ing measu emen s o high ac o loadings ac oss mul-
iple PCs; b. Plo s o he b ead h be ween in ao bi al o amina (BIOF) agains he inne leng h o zygoma ic a ch (LZA)
o he genus Eu oscap o in Vie nam.
270
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Feijó A, Wen Z, Cheng J, Ge D, Xia L, Yang Q (2019) Di e gen selec ion along ele a ional
g adien s p omo es gene ic and pheno ypic dispa i ies among small mammal popu-
la ions. Ecology and E olu ion 9(12): 7080–7095. h ps://doi.o g/10.1002/ece3.5273
Hall TA (1999) BioEdi : A use - iendly biological sequence alignmen edi o and analy-
sis p og am o Windows 95/98/NT. Nucleic Acids Symposium Se ies 41(2): 95–98.
h ps://doi.o g/10.14601/PHYTOPATHOL_MEDITERR-14998U1.29
Hamme Ø, Ha pe DAT, Ryan PD (2001) PAST: Paleon ological s a is ics so wa e pack-
age o educa ion and da a analysis. Palaeon ologia Elec onica 4(1).
He K, Shinoha a A, Jiang XL, Campbell KL (2014) Mul ilocus phylogeny o alpine moles
(Talpini, Talpidae, Eulipo yphla) and i s implica ions o sys ema ics. Molecula Phy-
logene ics and E olu ion 70: 513–521. h ps://doi.o g/10.1016/j.ympe .2013.10.002
He ing SW (2007) Mas ica o y muscles and he skull: A compa a i e pe spec i e.
A chi es o O al Biology 52(4): 296–299. h ps://doi.o g/10.1016/j.a cho al-
bio.2006.09.010
Hoang DT, Che nomo O, Haesele AV, Bui QM, Le SV (2018) UFBoo 2: Imp o ing he
ul a as boo s ap app oxima ion. Molecula Biology and E olu ion 35(2): 518–522.
h ps://doi.o g/10.1093/molbe /msx281
Hu e e R (2005) O de So icomo pha. In: Wilson DE, Reede DM (Eds) Mammal species
o he wo ld. A axonomic and geog aphic e e ence, 3 d edn. The Johns Hopkins Uni-
e si y P ess, Bal imo e, 220–311.
Huxley JS (1938) Species o ma ion and geog aphical isola ion. P oceedings o he Lin-
nean Socie y o London 150(4): 253–264. h ps://doi.o g/10.1111/j.1095-8312.1938.
b00182g.x
Kalyaanamoo hy S, Minh BQ, Wong TK, Von Haesele A, Je miin LS (2017) ModelFinde :
Fas model selec ion o accu a e phylogene ic es ima es. Na u e Me hods 14(6):
587–589. h ps://doi.o g/10.1038/nme h.4285
Kawada SI (2016) Mo phological e iew o he Japanese moun ain mole (Eulipo yphla,
Talpidae) wi h he p oposal o a new genus. Mammal S udy 41(4): 191–205. h ps://
doi.o g/10.3106/041.041.0404
Kawada S, Shinoha a A, Kobayashi S, Ha ada M, Oda S, Lin L-K (2007) Re ision o he
mole genus Moge a (Mammalia: Lipo yphla: Talpidae) om Taiwan. Sys ema ics and
Biodi e si y 5(2): 223–240. h ps://doi.o g/10.1017/S1477200006002271
Kawada SI, Yasuda M, Shinoha a A, Lim BL (2008) Redesc ip ion o he Malaysian Mole
as o be a ue species, Eu oscap o malayana (Insec i o a, Talpidae). Memoi s o he
Na ional Science Museum 45: 65–74.
Kawada S, Nguyen TS, Dang NC (2009) Moles (Insec i o a, Talpidae, Talpinae) o Vie -
nam. Bulle in o he Na ional Na u e and Science Museum. Se ies A. Zoology: Analy-
sis o Complex Sys ems, ZACS 35: 89–101.
Kawada SI, Nguyen TS, Dang NC (2012) A new species o mole o he genus Eu oscap-
o (So icomo pha, Talpidae) om no he n Vie nam. Jou nal o Mammalogy 93(3):
839–850. h ps://doi.o g/10.1644/11-MAMM-A-296.1
Koche TD, Thomas WK, Meye A, Edwa ds SV, Pääbo S, Villablanca FX, Wilson AC
(1989) Dynamics o mi ochond ial DNA e olu ion in animals: Ampli ica ion and
sequencing wi h conse ed p ime s. P oceedings o he Na ional Academy o Sci-
ences o he Uni ed S a es o Ame ica 86(16): 6196–6200. h ps://doi.o g/10.1073/
pnas.86.16.6196
Ko le MJ (1978) Cha les Da win’s biological species concep and heo y o geog aphic
specia ion: The ansmu a ion no ebooks. Annals o Science 35(3): 275–297. h ps://
doi.o g/10.1080/00033797800200251
271
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
K yš u ek B, Mo okawa M (2018) Family Talpidae (Moles, Desmans, S a –nosed moles
and Sh ew moles). In: Wilson DE, Mi e meie RA (Eds) Handbook o he mammals o
he wo ld. Vol. 8. Insec i o es, Slo hs and Colugos. Lynx Edi ions, 552–619.
Le VK, Nguyen XH, Nguyen TN (2015) Zoogeog aphy. Vie nam Na ional Uni e si y P ess,
Hanoi, 403 pp. [In Vie namese]
May E (1942) Sys ema ics and he o igin o species om he iewpoin o a zoolo-
gis . Columbia Uni e si y P ess, New Yo k, 334 pp. h ps://ia801404.us.a chi e.
o g/13/i ems/in.e ne .dli.2015.20284/2015.20284.Sys ema ics-And-The-O i-
gin-O -Species.pd
Mille GS (1940) No es on some moles om Sou heas e n Asia. Jou nal o Mammalogy
21(4): 442–444. h ps://doi.o g/10.2307/1374883
Mindell DP, Dick CW, Bake RJ (1991) Phylogene ic ela ionships among megaba s, mi-
c oba s, and p ima es. P oceedings o he Na ional Academy o Sciences o he Uni ed
S a es o Ame ica 88(22): 10322–10326. h ps://doi.o g/10.1073/pnas.88.22.10322
Mo okawa M, Lin L-K (2002) Geog aphic a ia ion in he mole–sh ew Anou oso ex
squamipes. Mammal S udy 27(2): 113–120. h ps://doi.o g/10.3106/mammals-
udy.27.113
Ne o E (1985) Specia ion in ac ion and adap a ion in sub e anean mole a s:
Pa e ns and heo y. Bolle ino di Zoologia 52(1–2): 65–95. h ps://doi.
o g/10.1080/11250008509440344
Ne o E (1999) Mosaic e olu ion o sub e anean mammals: Reg ession, p og ession,
and global con e gence. Ox o d Uni e si y P ess, Ox o d, UK, 413 pp. h ps://doi.
o g/10.1093/oso/9780198575726.001.0001
Nguyen LT, Schmid HA, on Haesele A, Bui QM (2015) IQ–TREE: A as and e ec i e
s ochas ic algo i hm o es ima ing maximum–likelihood phylogenies. Molecula Bi-
ology and E olu ion 32(1): 268–274. h ps://doi.o g/10.1093/molbe /msu300
Okabe S, Mo okawa M (2024) Geog aphic a ia ion o Dymecodon pili os is (Eulipo y-
phla, Talpidae) wi h an insigh in o moun ain island in Japan. Mammal S udy 49(4):
345–357. h ps://doi.o g/10.3106/ms2023-0013
Pa ha R, Chauhan BK, Fe ei a Z, Robinson JD, La h op K, Nischal KK, Chikina M, Cla k
NL (2017) Sub e anean mammals show con e gen eg ession in ocula genes
and enhance s, along wi h adap a ion o unneling. eLi e 6: e25884. h ps://doi.
o g/10.7554/eLi e.25884
Pé ez MJ, Ba quez RM, Díaz MM (2017) Mo phology o he limbs in he semi- osso ial
dese oden species o Tympanoc omys (Oc odon idae, Roden ia). ZooKeys 710:
77–96. h ps://doi.o g/10.3897/zookeys.710.14033
Pujola JM, Blom MPK, Ree e AH, Kennedy JD, Ma ki PZ, Ko neliussen TS, F eeman
BG, Sam K, Linck E, Ha yoko T, Io a B, Koane B, Maiah G, Paul L, I es ed M, Jøns-
son KA (2022) The o ma ion o a ian mon ane di e si y ac oss ba ie s and along
ele a ional g adien s. Na u e Communica ions 13(1): 268. h ps://doi.o g/10.1038/
s41467-021-27858-5
Ronquis F, Teslenko M, an de Ma k P, Ay es DL, Da ling A, Höhna S, La ge B, Liu L,
Sucha d MA, Huelsenbeck JP (2012) M Bayes 3.2: E icien Bayesian phylogene ic
in e ence and model choice ac oss a la ge model space. Sys ema ic Biology 61(3):
539–542. h ps://doi.o g/10.1093/sysbio/sys029
Sansalone G, Colangelo P, Loy A, Raia P, W oe S, Pi as P (2019) Impac o ansi ion o
a sub e anean li es yle on mo phological dispa i y and in eg a ion in alpid moles
(Mammalia, Talpidae). BMC E olu iona y Biology 19(1): 179. h ps://doi.o g/10.1186/
s12862-019-1506-0
272
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Sha p AC, Du el H, Wa son PJ, G öning F, C ump on N, Fagan MJ, E ans SE (2023) As-
sessmen o he mechanical ole o c anial su u es in he mammalian skull: Com-
pu a ional biomechanical modelling o he a skull. Jou nal o Mo phology 284(3):
e21555. h ps://doi.o g/10.1002/jmo .21555
Shinoha a A, Kawada SI, Nguyen TS, Koshimo o C, Endo H, Dang NC, Suzuki H (2014) Mo-
lecula phylogeny o Eas and Sou heas Asian osso ial moles (Lipo yphla, Talpidae).
Jou nal o Mammalogy 95(3): 455–466. h ps://doi.o g/10.1644/13-MAMM-A-135
Shinoha a A, Kawada SI, Nguyen TS, Dang NC, Sakamo o SH, Koshimo o C (2015) Molecula
phylogene ic ela ionships and in a–species di e si ies o h ee Eu oscap o spp. (Talpi-
dae, Lipo yphla, Mammalia) om Vie nam. The Ra les Bulle in o Zoology 63: 366–375.
Sikes RS, Gannon WL, Animal Ca e and Use Commi ee o he Ame ican Socie y o Mam-
malogis s (2011) Guidelines o he Ame ican Socie y o Mammalogis s o he use
o wild mammals in esea ch. Jou nal o Mammalogy 92(1): 235–253. h ps://doi.
o g/10.1644/10-MAMM-F-355.1
Smi h AL, G osse IR (2016) The biomechanics o zygoma ic a ch shape. The Ana omical
Reco d: Ad ances in In eg a i e Ana omy and E olu iona y Biology 299(12): 1734–
1752. h ps://doi.o g/10.1002/a .23484
Smi h AT, Xie Y (Eds.) (2008) A Guide o he Mammals o China. P ince on Uni e si y
P ess, P ince on, New Je sey, 544 pp.
S e ling EJ, Hu ley MM (2005) Conse ing biodi e si y in Vie nam: applying biogeog a-
phy o conse a ion esea ch. P oceedings o he Cali o nia Academy o Sciences
56(Suppl. I, 9): 98–114.
S e ling EJ, Hu ley MM, Le DM (2006) Vie nam: a na u al his o y. Yale Uni e si y P ess,
New Ha en & London, [x iii +] 423 pp. h ps://doi.o g/10.12987/9780300128215
Tamu a K, S eche G, Kuma S (2021) MEGA11: Molecula e olu iona y gene ics anal-
ysis e sion 11. Molecula Biology and E olu ion 38(7): 3022–3027. h ps://doi.
o g/10.1093/molbe /msab120
Tanabe AS (2011) Kakusan 4 and Aminosan: Two p og ams o compa ing nonpa i-
ioned, p opo ional and sepa a e models o combined molecula phylogene ic anal-
yses o mul ilocus sequence da a. Molecula Ecology Resou ces 11(5): 914–921.
h ps://doi.o g/10.1111/j.1755-0998.2011.03021.x
To do AW, T an QB, Nguyen TD, Le MH (2004) Sou ce Book o Exis ing and P oposed
P o ec ed A eas in Vie nam. Vol. 1, Second Edi ion. Bi dLi e In e na ional Indochina,
Hanoi. h ps:// hiennhien ie .o g. n/
To do AW, Bal ze MC, Fellowes JR, Pilg im JD, Langhamme PF (2012) Key biodi e si-
y a eas in he Indo–Bu ma ho spo : P ocess, p og ess and u u e di ec ions. Jou nal
o Th ea ened Taxa 4(8): 2779–2787. h ps://doi.o g/10.11609/JoTT.o3000.2779-87
Vaidya G, Lohman DJ, Meie R (2011) SequenceMa ix: Conca ena ion so wa e o he
as assembly o mul i–gene da ase s wi h cha ac e se and codon in o ma ion. Cla-
dis ics: The In e na ional Jou nal o he Willi Hennig Socie y 27(2): 171–180. h ps://
doi.o g/10.1111/j.1096-0031.2010.00329.x
Zemleme o a ED, Banniko a AA, Ab amo AV, Lebede VS, Rozhno VV (2013) New
da a on molecula phylogeny o he Eas Asian moles. Doklady Biological Sciences:
P oceedings o he Academy o Sciences o he USSR, Biological Sciences Sec ions
451(1): 257–260. h ps://doi.o g/10.1134/S0012496613040200
Zemleme o a ED, Banniko a AA, Lebede VS, Rozhno VV, Ab amo AV (2016) Sec e s
o he unde g ound Vie nam: An unde es ima ed species di e si y o he Asian moles
(Lipo yphla, Talpidae, Eu oscap o ). T udy Zoologicheskogo Ins i u a 320(2): 193–
220. h ps://doi.o g/10.31610/ udyzin/2016.320.2.193
273
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Supplemen a y ma e ial 1
Mo phological
Au ho s: Son T uong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu
Da a ype: docx
Explana ion no e: Lis o c anioden al measu emen s used in his s udy.
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1255.161942.suppl1
Supplemen a y ma e ial 2
Lis o skull specimens, mo phological
Au ho s: Son T uong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu
Da a ype: docx
Explana ion no e: Lis o Eu oscap o skull specimens om Vie nam examined in
his s udy.
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1255.161942.suppl2
Supplemen a y ma e ial 3
Lis o Cy b sequences, phylogene ic
Au ho s: Son T uong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu
Da a ype: docx
Explana ion no e: The lis o Cy b sequences used o pai wise compa isons.
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1255.161942.suppl3
274
ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942
Son T uong Nguyen e al.: New species o he genus Eu oscap o (Talpidae) in Vie nam
Supplemen a y ma e ial 4
Phylogene ic
Au ho s: Son T uong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu
Da a ype: xlsx
Explana ion no e: The aw p–dis ance ma ix o Cy b sequences used o compa isons
be ween E. da wini and E. subanu a popula ion.
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1255.161942.suppl4
Supplemen a y ma e ial 5
Lis o DNA accession numbe , phylogene ic, genomic
Au ho s: Son T uong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu
Da a ype: docx
Explana ion no e: Eu oscap o specimens wi h DNA Accession Numbe used in he Phy-
logene ic analyses based on conca ena ed mi ochond ial Cy b and 12S RNA gene
sequences. As e isks indica e holo ype (*) and hash sign indica e pa a ype (#) spec-
imens o bo h E. da wini and E. subanu a.
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1255.161942.suppl5