scieee Science in your language
[en] (orig)

Hybrid Hydroxyapatite–Metal Complex Materials Derived from Amino Acids and Nucleobases

Author: Jiménez Pérez, Alondra; MARTÍNEZ ALONSO, MARTA; Garcia Tojal, Javier
Publisher: Zenodo
DOI: 10.3390/molecules29184479
Source: https://zenodo.org/records/17659128/files/Jimenez-molecules_2024.pdf
7.44.2
Hyb id Hyd oxyapa i e–Me al
Complex Ma e ials De i ed om
Amino Acids and Nucleobases
Alond a Jiménez-Pé ez, Ma a Ma ínez-Alonso and Ja ie Ga cía-Tojal
Special Issue
Ad ances in Coo dina ion Chemis y 2.0
Edi ed by
P o . D . Juan Niclós-Gu ié ez and D . Miquel Ba celó-Oli e
Re iew
h ps://doi.o g/10.3390/molecules29184479
Ci a ion: Jiménez-Pé ez, A.;
Ma ínez-Alonso, M.; Ga cía-Tojal, J.
Hyb id Hyd oxyapa i e–Me al
Complex Ma e ials De i ed om
Amino Acids and Nucleobases.
Molecules 2024,29, 4479. h ps://
doi.o g/10.3390/molecules29184479
Academic Edi o s: Juan
Niclós-Gu ié ez and Miquel
Ba celó-Oli e
Recei ed: 30 July 2024
Re ised: 12 Sep embe 2024
Accep ed: 15 Sep embe 2024
Published: 20 Sep embe 2024
Copy igh : © 2024 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
molecules
Re iew
Hyb id Hyd oxyapa i e–Me al Complex Ma e ials De i ed om
Amino Acids and Nucleobases
Alond a Jiménez-Pé ez , Ma a Ma ínez-Alonso and Ja ie Ga cía-Tojal *
Depa amen o de Química, Facul ad de Ciencias, Uni e sidad de Bu gos, Plaza Misael Bañuelos s/n,
09001 Bu gos, Spain; [email p o ec ed] (A.J.-P.); [email p o ec ed] (M.M.-A.)
*Co espondence: [email p o ec ed]
Abs ac : Calcium phospha es (CaPs) and hei subs i u ed de i a i es encompass a la ge numbe o
compounds wi h a as p esence in na u e ha ha e a oused a g ea in e es o decades. In pa icula ,
hyd oxyapa i e (HAp, Ca
10
(OH)
2
(PO
4
)
6
) is he mos abundan CaP mine al and is signi ican in he
biological wo ld, a leas in pa due o being a majo compound in bones and ee h. HAp exhibi s
excellen p ope ies, such as sa e y, s abili y, ha dness, biocompa ibili y, and os eoconduc i i y, among
o he s. E en some o i s d awbacks, such as i s agili y, can be edi ec ed hanks o ano he essen ial
ea u e: i s g ea e sa ili y. This is based on he compound’s endency o unde go subs i u ions
o i s cons i uen ions and o inco po a e o ancho new molecules on i s su ace and po es. Thus,
i s a ini y o biomolecules makes i an op imal compound o mul iple applica ions, mainly, bu
no only, in biological and biomedical ields. The p esen e iew p o ides a chemical and s uc u al
con ex o explain he a ini y o HAp o biomolecules such as p o eins and nucleic acids o gene a e
hyb id ma e ials. A size-dependen c i e ium o inc easing complexi y is applied, anging om
amino acids/nucleobases o he co esponding mac omolecules. The inco po a ion o me al ions o
me al complexes in o hese unc ionalized compounds is also discussed.
Keywo ds: amino acid; calcium phospha e; hyb id ma e ial; hyd oxyapa i e; nucleobase; nucleic
acid; pep ide; p o ein
1. In oduc ion
The geological ele ance o phospha es is conside able. They a e ound in se e al
o ma ions, such as ossils and abou 200 g oups o mine als p esen in igneous and sedi-
men a y phospha e ocks (PRs) [
1
–
4
]. In pa icula , calcium phospha es (CaPs) ha e gained
a en ion due o bo h hei geological ele ance as p ima y phospho us o es and hei bio-
logical oles. The abundance o apa i e- ype mine als (chlo o-, luo -, and hyd oxy-apa i e),
wi h he o mulae Ca
10
(Cl,F,OH)
2
(PO
4
)
6
, make hem s and ou as o es om a mining poin
o iew. O he p ominen examples o CaP mine als a e b ushi e CaHPO
4·
2H
2
O, dahli e
3Ca3(PO4)2·CaCO3, mone i e CaHPO4, and whi locki e Ca9Mg(HPO4)(PO4)6.
Ne e heless, many o he CaPs, apa om he abo e-men ioned mine al phases, ha e
been s udied in dep h [
5
]. Thei o mulae usually exhibi a omic Ca/P a ios be ween
0.5 and 2 (in gene al, he lowe he Ca/P a io, he mo e acidic and soluble he calcium
phospha e phase). Table 1shows some o he CaPs we will discuss in his wo k due o
hei in ol emen in he p ocesses desc ibed he e [
6
]. None heless, he mos common
membe s o his amily, acco ding o hei solubili y p oduc s [
7
], a e hyd oxyapa i e
and he polymo phic o ms o icalcium phospha e (TCP). F om now on, i mus be
emphasized ha he o mulae gi en in he p esen e iew ollow he In e na ional Union
o Pu e and Applied Chemis y (IUPAC) ecommenda ions o chemical nomencla u e, bu
we ha e e ained he adi ional names gi en in he li e a u e o a be e unde s anding
and connec ion wi h he sou ces [8].
Molecules 2024,29, 4479. h ps://doi.o g/10.3390/molecules29184479 h ps://www.mdpi.com/jou nal/molecules
Molecules 2024,29, 4479 2 o 39
Table 1. Selec ed calcium phospha e phases and s uc u al de ails.
Name (Abb e ia ion)
Fo mula
Ca/P
Ra io
Sys em (Space G oup)
Cell Pa ame e s (Å, 0)Re s.
Monocalcium phospha e anhyd ous (MCPA)
Ca(H2PO4)20.50
T iclinic (P1)
a = 7.5577(5), b = 8.2531(6), c = 5.5504(3)
α= 109.87(1), β= 93.68(1), γ= 109.15(1)
[9]
Monocalcium phospha e monohyd a e (MCPM)
Ca(H2PO4)2·H2O0.50
T iclinic (P1)
a = 5.6261(5), b = 11.889(2), c = 6.4731(8)
α= 98.633(6), β= 118.262(6), γ= 83.344(6)
[10]
Dicalcium phospha e anhyd ous (DCPA, mone i e)
CaHPO41.00
T iclinic P1)
a = 6.90(1), b = 6.65(1), c = 7.00(1)
α= 96.35(2), β= 103.90(2), γ= 88.73(2)
[11]
Dicalcium phospha e dihyd a e (DCPD, b ushi e)
CaHPO4·2H2O1.00
Monoclinic (Ia)
a = 5.812(2), b = 15.180(3), c = 6.239(2)
β= 116.42(2)
[12]
Amo phous calcium phospha es (ACPs) 1
CaxHy(PO4)z·nH2O (n = 3.0–4.5) 21.20–2.20 3
Oc acalcium phospha e (OCP)
Ca8H2(PO4)6·5H2O1.33
T iclinic P1)
a = 19.692(4), b = 9.523(2), c = 6.835(2)
α= 90.15(2), β= 92.54(2), γ= 108.65(2)
[13,14]
α- icalcium phospha e (α-TCP)
α-Ca3(PO4)21.50
Monoclinic (P21/a)
a = 12.887(2), b = 27.280(4), c = 15.219(2)
β= 126.20(1)
[15]
β- icalcium phospha e (β-TCP, syn he ic whi locki e)
β-Ca3(PO4)21.50
Rhombohed al (R3c)
(hexagonal se ing)
a = b = 10.439(1), c = 37.375(6)
[16]
Hyd oxyapa i e (HAp)
Ca10(OH)2(PO4)61.67 Hexagonal (P63/m)
a = b = 9.424(4), c = 6.879(4) [17]
Hyd oxyapa i e (HApM)
M-Ca10(OH)2(PO4)61.67
Monoclinic (P21/b)
a = 9.419(3), b = 18.848(6), c = 6.884(2)
β= 119.98(2)
[18]
Oxyapa i e (OAp, oelcke i e) 4
Ca10O(PO4)61.67 Hexagonal P6)
a = b = 9.432, c = 6.881 [19]
Te acalcium phospha e (TTCP, hilgens ocki e)
Ca4O(PO4)22.00
Monoclinic (P21)
a = 7.023(1), b = 11.986(4), c = 9.473(2)
β= 90.90(1)
[20]
Dicalcium diphospha e dihyd a e (DCDD)
Ca2(P2O7)·2H2O1.00
T iclinic P1)
a = 7.365(4), b = 8.287(4), c = 6.691(4)
α= 102.96(1), β= 72.73(1), γ= 95.01(1)
[21]
1
ACPs a e p obably me as able amo phous s a es o di e en c ys alline calcium phospha es. Roughly speaking,
a dozen phospha e phases could exis in an amo phous s a e (e.g., amo phous HAp, amo phous TCP, e c.). An
excellen e iew abou hem was published by Do ozhkin [
22
].
2
The amoun o wa e a ies be ween 15 and
20%.
3
The ange is wide , bu he majo i y exhibi a Ca/P alue close o 1.5. This would be consis en wi h he
p esence o Posne ’s clus e s, common uni s in ACPs, wi h o mula Ca
9
(PO
4
)
6
[
23
], which would e ol e in o
di e en c ys alline phases h ough dis inc expe imen al condi ions.
4
The na u e and c ys al s uc u e o his
compound emains con o e sial. The c ys allog aphic in o ma ion gi en in he able comes om he wo k by
Henning e al. An in e es ing his o ical backg ound abou he di e en p oposals published up o da e is co e ed
by Bulina e al. [24].
Rega ding he CaP-con aining apa i e Ca
10
X
2
(PO
4
)
6
amily, di e en mine als wi h a
Ca/P=1.67mola a iocanbe ounddependingon heXanion,suchas luo apa i e(Ca
10
F
2
(PO
4
)
6
),
ca bona e– luo apa i e (Ca
10
F
2
(PO
4
,CO
3
)
6
) and chlo apa i e (Ca
10
Cl
2
(PO
4
)
6
) [
25
]. They exhibi
a ying le els o c ys allini y and solubili y [
26
]. Amongs hem, hyd oxyapa i e (HAp,
Ca
10
(OH)
2
(PO
4
)
6
) is he mos signi ican compound in he con ex o bo h biology and
geology. In he li ing wo ld, HAp is in ol ed in calci ica ion, which is he biological
Molecules 2024,29, 4479 3 o 39
p ocess o he deposi ion o calcium in issues and body s uc u es. In e ms o weigh ,
HAp is he main componen o bones and ee h in e eb a es. In his sense, abou 60–70%
o bone [
27
,
28
] and e en 96% o oo h enamel [
29
,
30
] is HAp, wi h a sligh amoun o
eplacemen o he PO
43−
/OH
−
g oups by anions, mainly CO
32−
(2–8%, gene a ing he
so-called bioapa i e [31,32]).
HAp can ypically be ound in wo c ys allog aphic o ms [
33
,
34
]: he hexagonal and
monoclinic phases (see Table 1). S oichiome ic HAp gi es ise o he he modynamically
mo e s able monoclinic polymo ph [
35
–
37
]. Howe e , ac o s such as he inclusion o ions
and he o ma ion o acancies cause i o ake he hexagonal o m, he mos common
phase in he mine al and biological wo lds. In hexagonal HAp, hyd oxide OH
−
ions
s ack in channels along he [001] di ec ion. The a angemen o e ahed al phospha e ions
dis ibu es he calcium ions (Ca
2+
) in wo di e en c ys allog aphic si es. Ca1 is pa allel o
he c-axis and links o nine oxygen a oms om six di e en phospha e e ahed a: h ee
phospha e oxyanions ac as monoden a e ligands h ough he O1 oxygen a oms, and he
o he h ee phospha es beha e as biden a e h ough he O2 and O3 se s o a oms. The Ca2
a oms a e placed on he hexagonal sc ew axes, in polyhed a wi h an i egula se en old
coo dina ion whose en i onmen con ains one O1, one O2, and ou O3 phospha e a oms
and a hyd oxide ion [
38
,
39
]. Di e ences wi h he monoclinic s uc u e a e sub le and mainly
in ol e he o ien a ion o hyd oxide anions. In he hexagonal cell, wo adjacen hyd oxides
poin in he opposi e di ec ion, bu in he monoclinic s uc u e, all he hyd oxides in a gi en
column poin in he same di ec ion, which is e e sed in he nex column [40] (Figu e 1).
ff
ff
− − −
−
⁺ ff
ff
ff
−
−ff
Figu e 1. View o he hexagonal c ys al s uc u e o HAp (a). PO
43−
e ahed a a e ep esen ed in
pu ple, he posi ions o he OH
−
anions in ed, and he wo di e en si es o he Ca
2+
ions in blue.
The me al ions a e depic ed as balls (Ca2) and blue polyhed a (Ca1), espec i ely. (b) Schema ic
d awings o he hyd oxide a angemen s o hexagonal (le ) and monoclinic ( igh ) s uc u es along
he z-axis.
HAp is a highly e sa ile ma e ial and, he e o e, he ield o applicabili y o his
ce amic co e s se e al a eas. I has ound use in biomedical esea ch (implan s and bone
egene a ion; sca olds o issue enginee ing and d ug deli e y), wa e pu i ica ion (ad-
so ben o seques e ing con aminan s like hea y me als, dyes, and o ganic and ino ganic
pollu an s, such as hyd oca bons and phospha es, and o educing wa e ha dness), ba e -
ies (ene gy s o age), ca alysis (ca alys s, such as pho oca alys s, o as ac i e phase suppo ),
nanoca ie o biocides o elici o s in ag icul u e, ion exchange (memb anes and il e s o
he sepa a ion and pu i ica ion o liquids), and senso s (gas, empe a u e, biomolecule, ion,
and pH senso s) [41–45].
The e sa ili y o HAp and i s mul iple applica ions can be ailo ed by a ho ough
con ol o ce ain design ac o s. These ac o s, which can be modi ied by di e en syn he ic
me hods, a e he eac ion ime, p essu e, a e, na u e and o de o he p ecu so ’s addi ion,
Molecules 2024,29, 4479 4 o 39
concen a ion o he eac an s, pH, and empe a u e [
46
–
49
]. The a ained p oduc s show
dis inc composi ion (e.g., Ca/P a io), pa icle size (powde , g anula , mac o- o mic o-
po ous), deg ee o c ys allini y, and mo phology. Nume ous syn he ic ou es o ob ain
polyc ys alline HAp powde ha e been de eloped o e he las decades. Pos -syn hesis
pa ame e s, such as e-imme sion in solu ions o he isola ed solids o u he he mal
ea men s, ha e also been analyzed [
50
]. All hese p ocedu es can be summa ized in ou
di e en g oups o me hods (Figu e 2) [51–56].
ff
ff
ff
ff−
−
−
Figu e 2. Summa y o me hods o he syn hesis o HAp.
The mo phology and c ys al size o HAp depend on he c ys al o ma ion a e. The
la e , in u n, is in luenced by supe sa u a ion, which co ela es wi h he ini ial concen-
a ions o calcium (i[Ca]) and phospha e (i[PO
4
]) ions, he so-called iCa/P a io, and ipH
o he solu ion [
57
]. In a s udy conduc ed by Sz e ne and Bie na [
58
], i was ound ha
lowe [Ca] le els (0.025 and 0.050 mol/dm
3
) p oduced HAp whiske s, whe eas highe
concen a ions (0.1 and 0.2 mol/dm
3
) led o he o ma ion o hexagonal ods. Fu he mo e,
he c ys alli e size o HAp nanopa icles diminishes wi h dec easing [Ca]. These esul s
sugges a signi ican in luence o calcium ion concen a ion on he shape and size o HAp
c ys als du ing syn hesis [59].
The ela ionship be ween he pH and shape o HAp c ys als is c ucial. The modi i-
ca ion o he ipH alue causes a change in he s uc u e and mo phology o he c ys als,
including sphe es, ods, needles, wi es, whiske s, sphe uli es, bel s, e c. [
60
–
66
]. pH is
a pi o al pa ame e o be conside ed o he solubili y and dissolu ion o se e al ions in
solu ion. Va ia ions in his alue gene a e di e en concen a ions o OH
−
and H
3
O
+
ions,
he eby inducing changes in Ca
2+
and PO
43−
le els [
67
,
68
]. In he p ocess o syn hesizing
HAp, inco po a ing a base like NH
4
OH leads o an ele a ed concen a ion o OH
−
ions,
consequen ly boos ing he eac ion’s alkalini y. This occu ence a ises om he elease
o addi ional hyd oxide ions, which can acili a e p ecipi a ion du ing syn hesis. HAp
is p e e en ially o med unde neu al o alkaline condi ions. Acidic condi ions gi e ise
o he o ma ion o di e en phases [
69
,
70
]. Depending on he pH alue, a ious c ys-
alline phases a e ob ained, p ima ily due o he p e alence o he phospha e anion. In
ac , H
2
PO
4−
ions emain s able a pH le els be ween 3 and 6. I he pH inc eases be-
ween 8 and 11, HPO
42−
ions become p edominan , bu beyond pH 12, phospha e ions
PO
43−
p e ail [
71
]. Thus, he in e play be ween empe a u e, pH, and he o de o he
addi ion o p ecu so s yields CaP p ecipi a es, usually as mix u es o he OCP, DCPA, and
HAp phases, whe e HAp ends o be he mos abundan phase a pH > 5.3, whe eas he
o me p e ails a pH < 3.8 [72,73].
Tempe a u e and p essu e du ing syn hesis also ha e a signi ican impac on he
c ys al g ow h o HAp [
74
], i.e., c ys al size and shape. An op imal me hod o achie ing

Molecules 2024,29, 4479 5 o 39
pu e and uni o m HAp in ol es using high empe a u es and p essu es, as lowe alues
esul in he o ma ion o di e se c ys alline phases [58,66].
The chemical composi ion and acancies p esen in he HAp c ys al s uc u e allow
o a wide a ie y o anionic subs i u ions (in ol ing hyd oxide o phospha e g oups) o
ca ionic subs i u ions (like mono-, di-, and i alen me als). The eplacemen s cause dis u -
bances in he c ys alline ne wo k, which dec eases c ys allini y and he e o e inc eases i s
capaci y o eabso p ion in physiological media. Ionic subs i u ion in his ce amic ma e ial
has gained impo ance in ecen yea s, as summa ized in Figu e 3, which shows some o
he eplacemen s ca ied ou [75–84].
Figu e 3. Alphabe ically o de ed ions in doped HAp, bo h ca ionic and anionic posi ions.
The in e ac ion o biologically ac i e me al ion complexes wi h ha d issues, like bones
o ee h, has p opelled he s udy o he in e play be ween HAp and coo dina ion com-
pounds [
85
,
86
]. In some cases, an inhibi ion o HAp g ow h in he p esence o a me al
complex has been shown [
87
]. In addi ion, he sea ch o HAp-con aining mul i unc ional
ma e ials wi h new o imp o ed p ope ies has led o he ab ica ion o hyb id HAp–me al
complexes as new s eps in he p ocess o achie ing sys ems wi h inc easing complexi y.
Thus, coo dina ion compounds o med by ansi ion me al ions linked o ca boxyla es,
phosphona es, Schi bases, o polypy idyl- ype ligands, amongs o he s, ha e been inco -
po a ed in o he ino ganic HAp ke nel [
88
–
96
]. A ew yea s ago, Ba bosa e al. w o e a e y
in e es ing e iew in his ield [
97
]. E en hough a deep bibliog aphic sea ch on his ma e
alls ou side he scope o he p esen e iew, he ligand beha io o mos biomolecules is
a nexus o hese sys ems, including o he e na y HAp–biomolecule–me al sys ems ha
will be discussed la e . This has p omp ed us o include he sho insigh gi en in his
pa ag aph. Some HAp–biomolecule–me al compounds ha e been published ecen ly. One
o hem inco po a es glucose-6-phospha e and Cu(II)/Zn(II) ions in o he HAp ma ix,
gene a ing HAp- unc ionalized nanopa icles wi h good su i abili y and adhesion o
os eoblas cells [
98
]. Ano he example links polydopamine o an algina e/S (II)/HAp
composi e, p omo ing os eogenic di e en ia ion and ascula iza ion [
99
]. In ano he case,
β
-cyclodex in eac s wi h an ino ganic zinc phospha e@HAp ma ix, gi ing ise o a
composi e ha se es as a nanoca ie o he an i umo al d ug cispla in [100].
Cu en ly, a ious e o s a e unde way o achie e he syn hesis o new ma e ials om
biomime ic and bio-inspi ed pe spec i es [
30
,
101
,
102
]. This sea ch mus ake in o accoun
he ea u es in ol ed in he biomine aliza ion p ocesses, which a e induced by physical and
chemical ac o s, bu also condi ioned by he biological en i onmen o p esence o di e en
li ing o ganisms [
103
–
108
]. In pa icula , esea ch on inno a i e bioma e ials aimed a
bone issue egene a ion h ough he co alen unc ionaliza ion o ce amic ma e ials wi h
biomolecules, o closely ela ed models, has been ui ul [
109
–
111
]. O cou se, CaPs a e
among he ino ganic ma e ials ha a e mos likely o be used in bone healing [
112
–
115
].
Bu he ele ance o hese s udies is also ela ed o he da k side o he biomine aliza ion
p ocess o HAp and o he CaPs, which a e in ol ed in he o ma ion o u ina y s ones
and in ascula calci ica ion, which can p omo e ca dio ascula diseases [
116
,
117
]. The
knowledge o he unde lying mechanisms in bo h biologically essen ial and undesi able
p ocesses can be applied o di e en he apeu ic s a egies.
In he case o bone [
118
–
122
], mine aliza ion occu s on he bone su ace, whe e cells
called os eoblas s sec e e ma ix s uc u al p o eins (mainly collagen, bu also glycop o eins
Molecules 2024,29, 4479 6 o 39
and p o eoglycans) and he pep ide ho mone os eocalcin. The laye s o med by ype I col-
lagen, mic o ib ils con aining iple-helix collagen, ac as empla es in a complex p ocess
ha has no ye been ully cla i ied. A e a possible ansien o ma ion o ACP pa icles,
he p ocess leads o he deposi ion o HAp nanoc ys als wi h pla ele shapes and hei
c-axis aligned wi h he collagen ib ils. Hence, he mine alized collagen ibe s cons i u e he
s uc u al uni s o bones [
123
,
124
]. In pa icula , he beha io o he ino ganic ma ix was
explo ed by a combined Raman/
31
P-NMR s udy whose syn he ic me hodology p o ided
a slow inco po a ion o base (NH
3
) om pH 2 o pH 10 [
125
]. The s udy ound ha he
concen a ion o he es ed biological componen s (a syn he ic polyaspa a e mimicking
non-collagenous p o eins, ci a e, and collagen) could con ol he usual sequence o solid
p ecipi a es, ep esen ed in Equa ion (1), o each he inal c ys alline HAp. Thus, polyas-
pa a e s abilized OCP and ci a e inhibi ed i s o ma ion and p ecluded HAp p ecipi a ion,
whe eas he g ea in luence o collagen in he s uc u e o HAp showed no dependence on
he concen a ion.
Solu ion 0–96 min
−−−−−→ ACP 96–480 min
−−−−−−→ OCP 480 min–6days
−−−−−−−−→ HAp (1)
As a esul , bone issue is p oduced. By weigh , i s a e age composi ion is app oxi-
ma ely 65% ino ganic componen s, 25% o ganic componen s, and 10% wa e . The main
ino ganic componen is calcium-de icien ca bona e hyd oxyapa i e (90%). In he case o
he o ganic ac ion, i is la gely ype I collagen (a ound 90%), non-collagenous p o eins
(like os eocalcin, os eopon in, bone sialop o ein, os eonec in, and SPARC, among o he s,
2.50–3.75%), oge he wi h small amoun s o ci a e (1.5–2.0%) and lipids (1–10%) [
126
–
129
].
In he case o ee h, h ee ha d s uc u es can be dis inguished: den in, cemen , and
enamel. The amoun o ino ganic apa i e ma ix in den in and cemen is simila o ha
in bones, 70 and 65% in weigh , espec i ely, and he pe cen ages o o ganic and wa e
con en a e 20 and 10% in bo h cases. None heless, he HAp con en eaches nea ly
95–97% in enamel [
130
–
132
], whe e amelogenin is he mos abundan p o ein in he o ganic
ma ix [133].
The way o ackle he inco po a ion o biomolecules in he HAp bone/ ee h ma ix
in ol es ensu ing he e ec i e immobiliza ion o biomolecules on he su ace o HAp. Thus,
i equi es high a ini y and speci ici y wi h he ce amic moie y, achie ing a p ecise immo-
biliza ion a he desi ed si e and ensu ing he main enance o biological ac i i y [
134
]. In
esea ch on he unc ionaliza ion o HAp wi h biomolecules, a ious syn he ic app oaches
ha e been desc ibed [
135
]. Gi en ha we will ocus ou e iew on he ancho age o pep-
ides and nucleic acid de i a i es on HAp, we will p o ide, in he ollowing pa ag aphs, a
e y b ie su ey on he unc ionaliza ion o HAp wi h ca bohyd a es, lipids, and i amins.
-
The biodeco a ion o HAp wi h ca bohyd a es has been achie ed by di ec ly and
co alen ly bonding nanos uc u ed apa i e g anules o a ious polysaccha ides, like
cellulose [
136
,
137
], chi osan [
138
], pec ine [
139
], ca ageenan [
140
], algina e [
141
],
hyalu onic acid [
142
,
143
], and, e y ecen ly, acemannan mucopolysaccha ide [
144
].
Addi ionally, monosaccha ides such as D-glucose, D-galac ose, and L- uc ose a e also
u ilized in his con ex [145,146].
-
The in e ac ion o HAp wi h di e en ca boxylic acids has been ex ensi ely an-
alyzed based on he a ini y o Ca
2+
ions o ca boxyla e g oups, such as hose
p esen in alipha ic (p opionic, malonic, glu a ic, adipic, maleic, uma ic
. . .
), a o-
ma ic, polyca boxylic, and lac ic/glycolic acid de i a i es o e en mo e complex
ca boxyla e-con aining o ganic compounds [
147
–
151
]. S udies ha e also included
a y acids and lipids, including s ea ic acid, icinoleic acid, linoleic acid, and oleic acid,
among o he s [
152
–
155
]. In ac , he p esence o lipids p omo es he p ecipi a ion o
HAp [
156
], gi en, a leas in pa , ha phospholipids igge he
in i o
ans o ma ion
o OCP in o HAp [
157
]. These phase ansi ions seem o be c ucial in he ea ly s ages
o bone biosyn hesis, p obably boos ed by he o ma ion o calcium–phospholipid
complexes [158].
Molecules 2024,29, 4479 7 o 39
-
The c ea ion o hyb id ma e ials o HAp ma ices unc ionalized wi h i amins,
such as olic acid [159] and bio in [160], has been desc ibed in he li e a u e.
The a o emen ioned indings highligh he essen ial ole ha HAp plays in he con-
s uc ion o he ha d issues o e eb a es. Thei o ganic componen s a e mainly p o eins.
Because o his, he p esen e iew is ocused on he s udy o syn he ic HAp–biomolecule
ma e ials con aining p o eins, o hei simples cons i uen s, such as amino acids and
pep ides. We ha e also included HAp–nucleic acid bioma e ials and hei nucleobase bio-
logical b icks, emphasizing he ele ance o phospha e anions in many biological p ocesses,
including hose in ol ing ene gy o in o ma ion ans e ence. As a as we a e awa e, no
nea e iews simul aneously co e ing bo h aspec s—p o eins and nucleic acids o hei con-
s i u ing b icks—ha e been published up o da e. No wi hs anding his, pe haps he mos
in e es ing no el y o he p esen e iew a e he sec ions dealing wi h he inco po a ion o
me al complexes, which we ha e included a he end o each chap e .
A bibliog aphic insigh in o he scien i ic li e a u e on hese sys ems gi es an im-
p ession o he cumula i e e o s dedica ed o hem o yea s. Wi h his pu pose, we
ca ied ou a sea ch in he Web o Science da abase using “hyd oxyapa i e” AND “(amino
acid OR pep ide OR p o ein)” as key e ms p esen in abs ac s. The sea ch yielded
23,958 esul s [
161
]; he oldes pape was he ea ly Ca ie publica ion om 1948 [
162
]. In
he same way, 2554 esul s we e ob ained o “hyd oxyapa i e” AND “(nucleic acid OR
nucleo ide OR nucleobase)”. Figu e 4depic s he esul s published om 1961 o 2023,
showing a o al o 23,569 and 2537 esul s o he pep ide and nucleo ide amilies, espec-
i ely. As can be seen, pape s on HAp–p o ein ela ed sys ems a e much mo e nume ous
han hose dealing wi h nucleic acid de i a i es. Thus, his e iew is no an exhaus i e
desc ip ion o he ex ensi e bibliog aphy abou HAp–pep ide–nucleo ide sys ems bu an
essay aiming o in oduce hem. The pe spec i e o his wo k is chemical, and i is mainly
aimed a beginne s o esea che s who wish o ha e an ini ial and b ie in oduc ion o
hese hyb id sys ems.
≈
ffi
Figu e 4. Ch onological e olu ion o he numbe o en ies in he bibliog aphic sea ch on
HAp–(AA–pep ide–p o ein) (in blue) and HAp–(nucleobase/nucleo ide/nucleic acid) (in o ange)
sys ems. The ange o yea s co e ed in he igu e is om 1961 o 2023. Da a we e collec ed om Web
o Science (see main ex ).
2. Func ionaliza ion o HAp wi h Amino Acids, Pep ides, P o eins, and Me al
Complex Hyb ids
2.1. HAp and Amino Acids
Amino acids (AAs) ha e a wide ange o biological unc ions. They a e he building
blocks o p o eins and play essen ial oles in me abolism, enzyma ic ac i i y, cellula
signaling, ni ogen balance, and de oxi ica ion [
163
]. The s uc u al AAs inside p o eins
ha e a ca boxyl (-COOH) agmen , an amino (-NH
2
) moie y, and o ganic R-subs i uen s
Molecules 2024,29, 4479 8 o 39
co alen ly bonded o he same ca bon a om (Figu e 5). Amino acids a e classi ied as
acidic, basic, o neu al, depending on he na u e o hei side chains. Ou o he 20 known
AAs wi h which cells o m p o eins, 9 canno be syn hesized by mammals (i.e., hey a e
die a y essen ial).
≈
ffi
Figu e 5. Gene al s uc u e o p o ein- o ming AAs, wi h one- and h ee-cha ac e codes in pa en heses.
P ebio ically ele an AAs, such as his idine, cys eine and a ginine, ha e been epo ed
o enhance phospha e adso p ion on o i on oxy(hyd oxide) mine als by
≈
30% [
164
]. In
he con ex o he in e play be ween AAs and phospha e ions, i can be expec ed ha
he a angemen o phospha e and calcium ions in he c ys al s uc u e o HAp [
165
]
could a o hei binding o AAs. In ac , he a ini y be ween HAp and AAs es s on he
p esence o bo h ca boxyl and amino unc ional g oups in AAs, as well as in he side chain
subs i uen s (R) such as he -COOH (e.g., aspa ic acid (Asp), glu amic acid (Glu)), -NH
2
(e.g., lysine (Lys), a ginine (A g)), and -OH g oups (e.g., se ine (Se ), h eonine (Th )). These
subs i uen s a e able o o m co alen , ionic, and hyd ogen bonds wi h he calcium and/o
phospha e ions on he su ace o HAp, a ec ing i s s uc u e and i s physical, chemical, and
biological p ope ies.
Se e al p epa a i e me hods ha e been applied o ob ain HAp-AA hyb id ma e ials.
Some o hem in ol e di ec syn hesis in wa e unde con olled condi ions using solu ions
o soluble calcium and phospha e sal s, such as Ca(NO
3
)
2·
4H
2
O and (NH
4
)
2
HPO
4
. The
desi ed amino acid is added o he phospha e solu ion be o e adjus ing he pH abo e
9 wi h NH
4
OH. Reac ions a e o en ca ied ou in a ni ogen a mosphe e o a oid ca -
bona ion p ocesses in such a basic medium. No e ha ca bona e ions a e inco po a ed
in o he HAp s uc u e by pa ial eplacemen o he OH
−
(subs i u ion in he A-si es) o
PO
43−
ions (subs i u ion in he B-si es) [
166
–
169
]. Finally, he hyb ids a e ob ained as
solids and, some imes, u he ea men s (like mode a e hea ing o hyd o he mal) a e
pe o med [
170
]. No wi hs anding his, many o he me hods such as ul asonic and mi-
c owa e i adia ion ha e been applied [
171
]. Bu ega dless o he kinds o me hods used,
he expe imen al esul s un eil he complexi y o he HAp/AA in e ac ion. S udies show
ha complexes o med be ween cha ged AAs and Ca
2+
and PO
43−
ions a e ime-dependen
and eac di e en ly ollowing pa hways ha depend on hei le el o o ganiza ion and
s uc u e. Consequen ly, he ime be ween he p epa a ion o he solu ion o he p ecu so
and hei mix should be aken in o accoun as an impo an a iable in any biomine aliza-
ion expe imen [172].
The su ace o HAp is neu al o sligh ly nega i ely cha ged in aqueous suspensions
a neu al pH alues. In he case o a basic pH, amino acids exis in hei ca boxyla e ion
(-COO
−
) o m wi h a neu al amino g oup. Due o hese nega i e cha ges, he elec os a ic
HAp-AA in e ac ion could be conside ed weak because o he cha ge epulsion. No wi h-
s anding his, an in es iga ion pe o med wi h he simples AA (Gly) showed ha he
HAp–glycine (HAp-Gly) in e ac ion modula ed he mo phology and size o he pa icles:
he g ea e he amoun o Gly, he smalle he size o he HAp-Gly c ys als [
173
]. In o he
wo ds, he c ys allini y o HAp dec eased wi h an inc easing amoun o Gly. And, mo e
impo an ly, his esul sugges ed ha , o he in e ac ion mechanism, he coo dina ion o
Molecules 2024,29, 4479 15 o 39
molecules and ions p esen on he HAp su ace, o ming he hyd a ion and he non-apa i e
laye s, espec i ely, a ec he immobiliza ion o p o eins on he pa icle [232].
This e iew will co e non-collagenous p o eins (NCPs) in a b oad manne bu will
p ima ily ocus on he ole o Clg in hei linkage o he ino ganic CaP ma ix, as colla-
gen ep esen s he mos abundan p o ein in mammals, a a ound 20–30% o he p o ein
weigh [233].
As men ioned in he In oduc ion, bones a e composed o 65–70% mine als and 30–35%
o ganic molecules, p edominan ly ype I collagen [
234
]. Type I collagen is cha ac e ized by
i s high con en o p oline, glycine, and hyd oxyp oline, which oge he ep esen o e 50%
o he amino acid composi ion, o en a anged as Gly-X-Y epea s (whe e X and Y a e P o
o Hyp). These amino acids assemble in o Clg ib ils o ming he undamen al iple-helix
seconda y s uc u e. A ep esen a ion o he p ima y s uc u e o Clg is gi en in Figu e 7.
α α
ffi
γ
ff α
ff
−
ff
Figu e 7. P ima y s uc u e o collagen.
The s uc u al o ganiza ion o his p o ein is ele an o he deposi ion o HAp wi hin
bone issue. Type I collagen ib ils consis o opocollagen as hei basic uni , composed o
h ee chains: wo
α
-1 collagen chains (COL1A1) and one
α
-2 collagen chain (COL1A2) [
235
].
T opocollagen has a diame e o 1.5 nm and a leng h o 300 nm. These opocollagen uni s
a e aligned in an o ganized manne , and he egions be ween he ib ils, known as “hole
zones”, a e app oxima ely 40 nm in leng h and 5 nm in wid h [
236
], exhibi ing a high
cha ge densi y, which is c i ical o mine al nuclea ion. These hole zones c ea e a o able
condi ions o he accumula ion o mine al ions, ini ia ing he o ma ion o incipien nuclei,
which subsequen ly g ow in o la ge , o ganized mine al s uc u es. Fu he mo e, he size o
hese holes appea s o limi ino ganic g ow h. Bone sialop o eins, os eonec in, os eopon in,
os eocalcin, and/o den in ma ix p o eins—all NCPs—bind o opocollagen and egula e
he mine aliza ion p ocess o hyd oxyapa i e. These NCPs a e ich in acidic amino acid
esidues o expe ience pos - ansla ional modi ica ions ha add acidic g oups in o hei
sequences, enhancing hei a ini y o Ca
2+
ions. Wi hin bone p o eins, os eocalcin s ands
ou o ha ing a dis inc amino acid esidue ha binds o calcium,
γ
-ca boxyglu amic acid
(Gla), so os eocalcin is also called bone Gla p o ein (BGP) [237].
App oxima ely 28 ypes o collagens ha e been iden i ied, each sha ing a iple-helix
(TH) s uc u e while di e ing in he composi ion o hei
α
chains, he eby con ibu ing o
hei dis inc unc ional p ope ies.
The i e main ypes o collagens and hei oles include he ollowing [238–242]:
-
Type I o ms 90% o o ganic bone mass and is a majo p o ein cons i uen in a ious
issues, such as endons, ligamen s, he co nea, o he skin.
- Type II is ound in elas ic ca ilage, p o iding esilience and suppo o join s.
-
Type III is p esen in muscles, a e ies, and o gans, o e ing s uc u al suppo and elas ici y.
-
Type IV is loca ed in skin laye s, con ibu ing o basemen memb anes and
issue o ganiza ion.

Molecules 2024,29, 4479 16 o 39
-
Type V is ound in he co nea o he eye, some skin laye s, hai , and placen al issue,
con ibu ing owa ds issue s abili y and unc ion.
S udies on he mine aliza ion o apa i e in he p esence o p o ein sugges ha collagen
ib ils acili a e he o ma ion o apa i e om low [Ca
2+
] and [PO
43−
] alues [
243
]. B ad
e al. [
244
] desc ibed a we me hod o he a ainmen o mine alized Clg gel by mixing
an acid calcium-con aining Clg solu ion wi h a bu e ed neu alized phospha e solu ion.
This p ocess allowed o he simul aneous assembly o collagen ib ils and p ecipi a ion o
amo phous calcium phospha e (ACP), which subsequen ly ans o med in o c ys alline
HAp. The c ys alliza ion o HAp on he ib ils imp o ed wi h he addi ion o polyaspa a e,
a syn he ic polyme ha mimics NCP unc ion. Ano he app oach s udied by Qu e al. [
245
]
employed ype I collagen subs a es imme sed in a solu ion called simula ed body luid
(SBF), which con ained ino ganic ions ( om sal s such as NaCl, NaHCO
3
, KH
2
PO
4
, MgCl
2
,
and CaCl
2
) in simila concen a ions o hose in human blood plasma. The p e o med
subs a es ac ed as empla es o HAp deposi ion, gels on which mine als could nuclea e
and g ow, mimicking he na u al mine aliza ion p ocess in biological issues like bones and
ee h. The binding o Ca
2+
o nega i ely cha ged ca boxyla e g oups in collagen was ound
o be c ucial in acili a ing his nuclea ion [
246
]. Molecula dynamic simula ions o he
in e ac ion mechanism o aspa ic acid esidues in collagen on he c ys al HAp su ace ha e
e ealed he impac o calcium acancies on ca boxyla e adso p ion and he s abilizing ole
o hyd ogen phospha e in he p ocess [
247
]. In addi ion, i has been p oposed ha HAp
nuclea ion mainly occu s a ound cha ged amino acid esidues in human ype I collagen.
In pa icula , a ginine seems o play a pi o al ole in he p ocess. The he modynamic
ba ie heigh o he o ma ion o complexes wi h Glu and Asp wi h PO
43−
is highe han
hose wi h Lys and A g [
248
]. Mo eo e , he phospho yla ion (inco po a ion o nega i ely
cha ged phospha e g oups) o Clg nano ibe s p omo ed he deposi ion o HAp [249].
Mesopo ous hyd oxyapa i e nanopa icles coa ed wi h collagen ha e been success ully
syn hesized o he selec i e deli e y o d ugs o cance cells [
250
]. These NPs exhibi ed
biocompa ibili y, non oxici y, and an i-in lamma o y p ope ies, highligh ing hei po en ial
o u u e biomedical applica ions.
Rega ding esea ch on non-collagenous p o eins, i has been demons a ed ha ce -
ain highly acidic NCPs, cha ac e ized by mul iple phospho yla ion si es [
219
] o an
in eg in-binding RGD (A g-Gly-Asp) domain, can bind HAp h ough hei acidic p o-
ein egions [
251
] and di ec ly in luence con olled mine aliza ion [
252
]. Some NCPs used
as linke molecules o unc ionalize he su ace o HAp include bo ine se um albumin
(BSA) and a small in eg in-binding ligand, N-linked glycop o ein (SIBLING). P o eins om
he SIBLING amily loca ed on human ch omosome 4q21 include den in ma ix p o ein 1
(DMP1), den in sialophosphop o ein (DSPP), ma ix ex acellula phosphoglycop o ein
(MEPE), os eopon in (OPN), and bone sialop o ein (BSP). BSP and OPN a e ound in highe
concen a ions in bone issues, whe eas DMP1, DSP, and DPP a e p edominan ly ound in
den in. These p o eins a e cha ac e ized by domains ha media e cell adhesion and can
unc ionalize mine aliza ion by inhibi ing calci ica ion. Despi e hei s ong a ini y o
HAp c ys al su aces, hei s uc u al lexibili y enables o he pa s o he molecule o in e -
ac wi h o he p o eins o acili a e cell binding h ough he exposed RGD in eg in-binding
domains. SIBLING p o eins a e cha ac e ized by a high con en o acidic amino acids such
as Asp and Glu, bu also con ain basic esidues like A g and Lys. Upon ioniza ion, hese
esidues, along wi h Gln, Gly, P o, and Se , a e known dis up o s o he p o ein s uc-
u e, which may in luence he long- e m o de ing o hei main con o ma ional s abili y.
Addi ionally, he SIBLING p o ein amily has been obse ed o s ably bind o Clg ib ils.
The concen a ion o o ganic addi i es, like collagen, ci a e, and a syn he ic polyas-
pa a e mimicking an NCP, in luences HAp c ys alliza ion. This concen a ion was ound
o modi y he sequence o HAp o ma ion (usually, i s ACP, a e wa ds OCP, and, inally,
HAp) [
253
]. The mos ou s anding esul in his wo k was ha con inemen he mo-
dynamically d i es HAp o ma ion by slowing down he kine ics in he o ma ion o
CaP p ecu so s.
Molecules 2024,29, 4479 17 o 39
Apa om bones, HAp is also p esen in ee h. As p e iously men ioned, amelogenin
is he mos abundan p o ein in enamel (abou 90% o he p o ein con en ). The e, his
hyd ophobic pep ide sel -assembles o o m an ex acellula ma ix which ac s as a empla e
o he con inuously g owing HAp c ys als, p esumably h ough nanosphe e o ma ion
ia oligome s [
254
]. Habeli z e al. e ealed ha he enamel p o ein amelogenin adop s
ibbon-like sup amolecula s uc u es ha empla e he g ow h o highly o ien ed HAp
nano ibe s. The mechanism is egula ed by enzyma ic p ocessing and in e ac ion wi h
acidic nonamelogenin p o eins [
255
]. I is ema kable ha e y small a ia ions in he
amino acid p ima y sequence can d as ically in luence he biomine aliza ion o HAp. Thus,
he change in one amino acid, p oline o h eonine, wi hin he sequence in amelogenin,
gi es ise o de ec i e enamel; his is p esen in a g oup o congeni al diso de s known as
amelogenesis impe ec a [256].
Rega ding o he p o eins, Kolla h e al. [
201
] explo ed me hods o imp o e he adso p-
ion capaci y o HAp powde o p o eins such as BSA. Unde neu al pH condi ions in an
aqueous solu ion, HAp has a neu al o sligh ly nega i e cha ge, while BSA is nega i ely
cha ged. Speci ic linke molecules (L-A g, L-Lys, and O-phospho-L-Se ) we e used as
unc ionalizing agen s o modi y he cha ge o BSA. Thus, he elec os a ic in e ac ions on
he su ace o he c ys alline ma e ial we e al e ed, imp o ing he a ac ion be ween he
powde and he p o ein. The ca boxyl g oup o hese linke molecules can in e ac wi h
Ca
2+
ions p esen on he HAp su ace h ough elec os a ic eac ions, lea ing he amino
g oup a ailable o eac wi h BSA. Addi ionally, he amino g oup can o m a hyd ogen
bond wi h he HA su ace ia a wa e molecule, al hough his in e ac ion is weake . Lys
and A g inc eased p o ein adso p ion, whe eas phosphose ine educed i . This inc ease
seemed o be due o a change in he su ace cha ge o apa i e, making he posi i ely
cha ged esidues mo e p ominen a e unc ionaliza ion, he eby enhancing he adso p-
ion o nega i ely cha ged BSA. A sligh inc ease in he ze a po en ial also signi ican ly
boos ed p o ein adso p ion. The indings indica ed ha adso p ion capaci y can be con-
olled h ough di e en unc ionaliza ion, depending on he speci ic p o ein–ca ie pai
unde conside a ion.
Medicinal esea ch on bioma e ials, which includes he sea ch o nanoca ie s o be
used as d ug deli e y sys ems, has success ully ound good candida es in hyb id com-
pounds o med by HAp unc ionalized wi h p o eins such as ke a in [257], collagen [258],
BSA [
259
], and bu e milk p o eins [
260
], among o he s. Howe e , no only HAp, bu o he
CaPs, oo, ha e been used as bioce amics de i ed om collagen sca olds, including
β
–TCP
o a silicon-based bioac i e glass composed o 60% SiO
2
, 36% CaO, and 4% P
2
O
5
(mol%)
o yield a SiO
2
–CaO–P
2
O
5
ne wo k [
261
]. The use o CaPs as ino ganic ma ices o bone
mo phogene ic p o eins (BNPs) has also been in es iga ed and ecen ly e iewed [
262
–
264
],
oge he wi h he ield o p o ein-based ac i e coa ings in biomedical ma e ials [
265
]. In
ac , he c ea ion o a syn he ic bi- unc ional usion p o ein has allowed o he a ge ing
and moni o ing o HAp biomine aliza ion p ocesses [266].
2.4. HAp–Pep ide–Me al Complex Hyb ids
The in e ac ion o unc ionalized HAp–pep ide hyb ids wi h me al ions and coo dina-
ion compounds has been explo ed. Fo ins ance, he use o HAp o emo ing Cu(II) ions
in solu ion was in es iga ed in he p esence o Gly and ligands (e hylenediamine, en, and
e hylenediamine e aace ic acid, EDTA). The s udy a i ied ha he ligand seques a ion
e ec minimizes he inco po a ion o ansi ion me al ions in o he HAp ma ix [
267
]. Bu
Cu(II) ions ha e also been included in o calcium-de icien hyd oxyapa i e/mul i-(amino
acid) copolyme s, showing good capaci y o angiogenesis and os eogenesis [268].
The in e ac ion o Zn-subs i u ed OCP and he co esponding Ca-de icien Zn-HAp
de i a i e wi h AAs (Asp, Cys, Glu, His, and Lys) was analyzed by Suzuki e al. [
269
], who
epo ed ha he elease o Zn
2+
ions in he p esence o AAs was la ge in he case o Cys
and His.
Molecules 2024,29, 4479 18 o 39
Hyb id Sm-doped luo oapa i es (Sm-FAp) unc ionalized wi h Asp, Glu, Gly, and
His we e es ed as ca alys s in he syn hesis o 1,2,4- iazole om 2-ni obenzaldehyde and
hiosemica bazide, highligh ing he excellen yield o he Gly hyb id [
270
]. Fe-de i a i es
in he same luo oapa i e–AA sys em showed good ca aly ic ac i i y in he syn hesis o
hio- iazole compounds, in pa icula in he a ainmen o 1,2,4- iazolidine-3- hione p od-
uc s [
271
]. Fluo escence in Cd-FAp-Glu/His hyb ids e ealed ha luo escence in ensi y
enhanced wi h he amoun o AA adso bed [272]
In u n, Ch issan opoulos e al. [
273
] c ea ed a e na y o ganome allic–AA–HAp by
eac ion o i anocene wi h Gly/Ala and HAp, whose g ow h was ound o be inhibi ed in
he p esence o he complex.
Li e al. cap u ed phospho yla ed pep ides by means o a hyb id compound o med
by a magne ic Fe-con aining me al–o ganic amewo k (Fe-MOF buil wi h benzene-1,3,5-
ica boxylic acid) and ino ganic HAp nanowi es [274].
In he case o p o eins, he adso p ion o myoglobin on he su ace o HAp mod-
i ied wi h Ni
2+
, Cu
2+
, and Zn
2+
has been analyzed [
275
]. Fo hei pa , Kalidas and
Suma hi [
276
] ha e ecen ly epo ed he p epa a ion o a sca old o bone issue engi-
nee ing based on a gela in/poly inyl alcohol/silk ibe ein o ced wi h Cu-subs i u ed
HAp, which showed an imic obial ac i i y, biocompa ibili y, s ong mechanical s eng h,
and p omising os eos imula ion clues. On he con a y, he p esence o Pb
2+
was ound o
inhibi he binding o os eocalcin o hyd oxyapa i e [277].
No only complexes, bu also me al nanopa icles ha e been linked o HAp-AA sca -
olds, like he hyd oxyapa i e/gold nanopa icles/A g nanocomposi e designed by Vuko-
mano i´c e al. [
278
], o ice e sa, as in he case o he cons uc ion o a silica/HAp/gold
nanopa icle assembly o be used in phage display echniques [
279
]. The opposi e s a egy
allowed o he cons uc ion o Asp-capped gold nanopa icles o induce HAp c ys alliza-
ion [
280
]. F om he same pe spec i e, PEGyla ed, pep ide-coa ed supe pa amagne ic i on
oxide nanopa icles (SPIONs) we e in es iga ed o bind he HAp p esen , in small amoun s,
in diseased ca dio ascula issues, in o de o de ec a he oscle osis o ao ic s enosis [
281
].
Finally, he use o sil e nanopa icles in den is y, which in ol es in e ac ions wi h CaP–
p o ein composi es, has ecen ly been e iewed [282].
3. Func ionaliza ion o HAp wi h Nucleobases, Nucleo ides, Nucleic Acids, and Nucleic
Acid–Me al Complex Hyb ids
3.1. HAp and Nucleobases
Nucleobases, o ni ogenous bases, a e o ganic compounds ha make up nucleo ides,
which a e he essen ial building blocks o deoxy ibonucleic acid (DNA) and ibonucleic acid
(RNA). The e a e di e en nucleobases, bu hose likely ound in DNA and RNA and hus
in ol ed in he gene ic code a e i e: adenine (Ade, A), guanine (Gua, G), cy osine (Cy ,
C), hymine (Thy, T), and u acil (U a, U). Se e al au ome ic o ms o hem a e possible.
In he case o Ade, he h ee monoca ionic au ome s wi h he lowes ene gy a e shown
in Figu e 8; one o hem is p o ona ed a N1 o he 9H au ome o Ade, ano he a N3 o
he 7H au ome , and he las one a N3 o he 9H au ome [
283
]. A physiological pH,
app oxima ely 7.4, he i e main nucleobases exis almos comple ely in hei ke o and
amino au ome ic o ms. The co esponding pKa alues a e shown in Table 4[284–287].
The lack o unc ional g oups o es ablish s ong enough linkages wi h HAp p e-
cludes he di ec binding o nucleobases o CaPs, so no pape s dealing wi h his i em ha e
been ound. The ein, he in o ma ion gi en he e mus be placed in he con ex o he
whole sec ion.
Molecules 2024,29, 4479 19 o 39
ff
ć
ff
Figu e 8. Nucleobases in hei unp o ona ed o m and he h ee lowes -ene gy au ome s o
p o ona ed Ade.
Table 4. pKa alues o nucleic acid ni ogenous bases. Ni ogen acidic a oms a e indica ed.
Base A om pKa
U acil N3 9.63
Thymine N3 10.30
Guanine N1 9.56
Guanine N7 3.11
Cy osine N3 4.60
Adenine N1 4.10
3.2. HAp and Nucleo ides
Nucleo ides a e essen ial o ganic compounds ha , a anged in an an i con o ma-
ion, ac as he monome ic cons i uen s o nucleic acids. Nucleo ides ha e a wide ange
o unc ions, se ing as he p ima y ene gy cu ency in cells, as coenzymes o co ac-
o s in enzyma ic eac ions, as second messenge s in signal ansduc ion, and playing
a c ucial ole in he me abolism o ca bohyd a es, lipids, and p o eins, e c. Figu e 9
ep esen s he basic nucleo ide s uc u e and he a om numbe ing. As can be seen, a
nucleo ide comp ises h ee undamen al componen s: a ni ogenous base, pen ose suga
(a i e-ca bon monosaccha ide), and om one o h ee phospha e g oups. Nucleo ides can
adop nume ous con o ma ions in solu ion, engaging in apid dynamic equilib ium [
288
].
′
′
− − −
′
ff
′− − − ′ ′
− − − ′
− − − ′ ′ −
Figu e 9. Basic s uc u e o nucleo ides wi h hei h ee essen ial componen s. The ni ogenous base
can be ei he a pu ine o a py imidine; he pen ose suga is ei he ibose o deoxy ibose, and he
phospha e g oup is a ached o he 5′ca bon o he suga .
Molecules 2024,29, 4479 20 o 39
The p o ona ion si es in 2
′
- deoxynucleo ides (dNXP
n
whe e N = pu ine o py imidine;
X = M, D and T; n =
−
2,
−
3 and
−
4, espec i ely) exhibi g ea e basici y compa ed o
hei ibose analogs (NXP
n
). The pK
a
alues o 2
′
-deoxy ibose a e mo e basic han hose o
ibose nucleo ides. Table 5shows he acid s eng hs o he di e en nucleo ides: adenosine
5
′
-mono-, di-, and iphospha e (AMP
2−
, ADP
3−
, ATP
4−
); 2
′
-deoxyadenosine 5
′
-mono-, di-,
and iphospha e (dAMP
2−
, dADP
3−
, dATP
4−
); guanosine 5
′
-mono-, di-, and iphospha e
(GMP
2−
, GDP
3−
, GTP
4−
); 2
′
-deoxyguanosine 5
′
-mono-, di-, and iphospha e (dGMP
2−
,
dGDP
3−
, dGTP
4−
); cy osine 5
′
-mono-, di-, and iphospha e (CMP
2−
, CDP
3−
, CTP
4−
);
2
′
-deoxycy osine 5
′
- mono-, di-, and iphospha e (dCMP
2−
, dCDP
3−
, dCTP
4−
); u idine
5
′
-mono-, di-, and iphospha e (UMP
2−
, UDP
3−
, UTP
4−
); and hymidine 5
′
-mono-, di-,
and iphospha e (dTMP2−, dTDP3−, dTTP4−).
Table 5. Compa ison o pK
a
alues o se e al deoxy- and ibonucleo ides as de e mined by po en io-
me ic pH i a ions in wa e a 25
◦
C and I = 0.1 M (NaNO
3
). Adap ed wi h pe mission om [
289
].
Copy igh © 2008 WILEY VCH Ve lag GmbH & Co. KGaA, Weinheim.
Re s. Acid
NXP/dNXP
pKa o N1H+o N7H+
NXP/dNXP (4a)
pKa o PO2(OH)−
NXP/dNXP (5a)
pKa o N1H o N3H
NXP/dNXP (6a)
[290,291] H2(GMP)±/H2(dGMP)±2.48 ±0.04/2.69 ±0.03 6.25 ±0.02/6.29 ±0.01 9.49 ±0.02/9.56 ±0.02
[289,290]
H
2
(AMP)
±
/H
2
(dAMP)
±3.84 ±0.02/3.97 ±0.02 6.21 ±0.01/6.27 ±0.04
[292,293] H2(CMP)±/H2(dCMP)±4.33 ±0.04/4.46 ±0.01 6.19 ±0.02/6.24 ±0.01
[293] H(UMP)−/H(dTMP) 6.15 ±0.01/6.36 ±0.01 9.45 ±0.02/9.90 ±0.03
[289,294] H2(GDP)−/H2(dGDP)−2.67 ±0.02/2.91 ±0.07 6.38 ±0.01/6.46 ±0.03 9.56 ±0.03/9.64 ±0.04
[289,295] H2(ADP)−/H2(dADP)−3.92 ±0.02/4.00 ±0.03 6.40 ±0.01/6.45 ±0.01
[296] H3(CDP)±6.39 ±0.02/
[296] H2(UDP)−/H2(dTDP) 6.38 ±0.02/6.44 ±0.01 9.47 ±0.02/9.93 ±0.02
[289,297]
H
2
(GTP)
2−
/H
2
(dGTP)
2−2.94 ±0.02/3.16 ±0.05 6.50 ±0.02/6.64 ±0.02 9.57 ±0.02/9.66 ±0.04
[289,297]H2(ATP)2−/H2(dATP)2−4.00 ±0.01/4.14 ±0.02 6.47 ±0.01/6.62 ±0.03
[297,298]H2(CTP)2−4.55 ±0.02 6.55 ±0.02
[297,298]H2(UTP)2−/H2(dTTP)2−6.45 ±0.01/6.52 ±0.02 9.57 ±0.02/10.08 ±0.05
Taking H
2
(GMP) as an example, h ee dep o ona ion eac ions can occu : om (a)
N7H
+
si e; (b) PO
3
(OH)
−
g oup; and c) N1H uni . Thus, in a gene al o mula ion, he
dep o ona ion eac ions o nucleoside 5
′
-mono-, di-, and iphospha es (NP
2−
/
3−
/
4−
) a e
desc ibed in Equa ions (4)–(6) [289], which yield he pKa alues gi en in Table 5.
H2(NP)±/−/2−⇌H(NP)−/2−/3−+H+(4a)
KH
H2(NP)=[H(NP)−/2−/3−][H+
[H2(NP)±/−/2−](4b)
H(NP)−/2−/3−⇌NP2−/3−/4−+H+(5a)
KH
H(NP)=[NP2−/3−/4−]H+
[HNP)−/2−/3−(5b)
NP2−/3−/4−⇌(NP −H)3−/4−/5−+H+(6a)
whe e NP minus H means a N1H si e o a guanine esidue o he N3H si e o a u acil/ hymine
esidue loses i s H.
KH
NP =[(NP −H)3−/4−/5−][H+]
[NP2−/3−/4−](6b)
Depending on he speci ic nucleobase, only ce ain equilib ia a e applied. The nu-
cleo ides GXP and dGXP ollow equilib ia (4a), (5a), and (6a). Fo he nucleo ides A/CXP
and dA/CXP, only equilib ia (4a) and (5a) a e impo an , as hey conside he dep o o-
na ion o he N1H
+
si e (4b) and he monop o ona ed phospha e g oup (5b). Fo he

Molecules 2024,29, 4479 21 o 39
nucleo ides U/TXP and dU/TXP, i is only necessa y o conside equilib ia (5a) and (6a),
which quan i y he elease o he p o on om he monop o ona ed phospha e esidue and
he dep o ona ion o he N3H si e (6b).
An inc ease in basici y a ises om he eplacemen o he 2
′
OH g oup wi h a
2
′
H a om, which diminishes he hyd ophilici y o he nucleo ide. As a esul , he nu-
cleo ide sol a ion by wa e molecules is a ec ed, leading o changes in i s dep o ona ion
beha io . Among all he nucleo ides, he one wi h guanine is he mos impac ed, wi h
he N7 si e showing a no able inc ease in basici y, leading o a highe acidi y cons an .
Consequen ly, he e ec on he phospha e g oups and N1H o N1H
+
is smalle , bu s ill
p esen . These e ec s become mo e p onounced again only when he phospha e chain is
long enough o o m a mac ochela e wi h N7, as in he case o iphospha es.
The bases o ansphospho yla ion, he exchange o phospha e g oups, be ween nu-
cleo ides and HAp ha e been explo ed. In 1962, specula ion began abou he possibili y
o a s uc u al ela ionship be ween nucleo ides and he su ace o apa i e ha could ex-
plain he accele a ed ansphospho yla ion eac ion ound [
299
]. Se e al nucleosides di-
and iphospha e we e es ed, oge he wi h ino ganic py ophospha e, in hei eac ion
wi h di e en phospha es, including subs i u ed apa i es wi h S o Pb. The binding o
nucleo ides o apa i es was ound o be mo e e icien han ha o o he phospha es. In
addi ion, he p oduc ion o ino ganic py ophospha e in he eac ion wi h nucleo ides was
de ec ed. The e minal PO
43−
o he nucleo ide was eleased o combine wi h a phospha e
om he apa i e c ys al, o ming P2O74−. Fu he s udies e idenced he ole o P2O74−as
an inhibi o o he biomine aliza ion o HAp [300,301].
Mo e ecen s udies ha e demons a ed ha adso p ion on he HAp ma ix is a ec ed
by he cha ge o he nucleo ide [
302
]. The p esence o a ca ionic o neu al cha ge in a
nucleo ide esul s in absen o signi ican ly educed adso p ion. Con e sely, a ne nega i e
cha ge p omo es signi ican chemical adso p ion, which can be neu alized by acidi ica ion.
Addi ionally, a neu al pH, i is known ha he me e p esence o phospha es in he
nucleo ide does no ensu e adso p ion on HAp. The numbe o phospha es can only
in luence he adso p ion e iciency o a molecule i i ca ies an o e all nega i e cha ge.
3.3. HAp and Nucleic Acids
Nucleic acids a e essen ial biological mac omolecules ha s o e and ansmi gene ic
in o ma ion, play a c ucial ole in p o ein syn hesis, and a e also in ol ed in egula ing
gene exp ession and ac i a ing speci ic genes. These unc ions a e undamen al o he
de elopmen , machine y, and ep oduc ion o all li ing o ganisms. The e a e wo main
ypes o nucleic acids: RNA and DNA (Figu e 10). In 1953, Wa son and C ick (WC) [
303
]
p oposed he h ee-dimensional model o DNA s uc u e, which consis s o wo s ands o
nucleo ides ha wind oge he o o m a double helix, whe eas RNA is single-s anded.
The base pai ing in DNA in ol es he ni ogenous base A always combined wi h T, and
C wi h G. This speci ic pai ing is go e ned by he o ma ion o hyd ogen bonds be ween
complemen a y bases: A-T o ms wo hyd ogen bonds and C-G o ms h ee hyd ogen
bonds. These hyd ogen bonds play a c i ical ole in he s abili y and speci ici y o double-
s anded DNA.
DNA and RNA de i a i es a e known o be able o adso b on o HAp [
303
]. In ac ,
like in he case o p o eins, some o he ea lies s udies on he in e ac ion be ween HAp and
(poly)nucleo ides a ose om he u iliza ion o ino ganic ma ices in ch oma og aphy [
304
].
Soon, he e iciency o HAp was disco e ed o be ema kable as a esul o he high a ini y
o phospha e g oups in he nucleo ides [
305
–
307
], allowing e en ine sepa a ions o double-
s anded DNA, single-s anded DNA, and RNA [308].
Molecules 2024,29, 4479 22 o 39
(a) (b)
ffi
ffi
ffi
Figu e 10. S uc u e o (a) double-helix DNA and (b) single-s anded RNA.
One o he i s applica ions o he nucleic acid condensa ion induced by CaP was i s
use by G aham and Van De Eb o ca ying and deli e ing adeno i us 5 DNA in o KB
cells [
309
]. S udies on HAp pa icles as ec o s o DNA deli e y in gene he apy ha e
ecen ly been e iewed by Zhu e al. [310].
Baglioni e al. [
311
] s udied he in e ac ions be ween DNA and CaPs in he sea ch o
composi es o be used in nanomedicine. Ino ganic ca ie s play a c ucial ole in enhancing
cell adhesion and acili a ing he en y o he apeu ic ma e ials in o cells. In addi ion, and
ollowing he same idea, D oue ’s esea ch g oup e alua ed he adso p ion o DNA on
HAp, e i ying he s ong binding a ini y be ween DNA and HAp. They also s udied he
deso p ion p ocess igge ed when he e is an excess o phospha e ions in he medium by
he compe i ion o ee phospha es wi h he DNA–phospha e backbone [312].
Yazaki e al. used lipids o p o oke he p ecipi a ion o DNA on o he HAp
su ace [
313
,
314
], which has been demons a ed o enhance he gene exp ession o mes-
enchymal s em genes [
315
]. Fu he mo e, s udies conduc ed by Gibbs e al. [
316
] suppo ed
a model o p ebio ic polynucleo ide syn hesis in which a mine al, such as HAp, wi h anion
exchange p ope ies immobilizes high-molecula -weigh p oduc s o a empla e-di ec ed
eac ion. This a oids he spon aneous hyd olyza ion p ocesses ha b eak he oligonu-
cleo ides in solu ion and a e incompa ible wi h he su i al o long p e o med oligome s.
These au ho s obse ed ha HAp adso bs polyu idylic acid (poly(U)) om aqueous so-
lu ion almos comple ely, wi hou educing i s abili y o unc ion as a empla e o he
syn hesis o oligoadenyla es. The adenine ni ogenous base (monome ic A) was ound
no o bind HAp di ec ly; howe e , he unc ionalized HAp/poly(U) hyb id was ound
o inco po a e 74% ee adenine om he solu ion. The p esence o HAp in he p ebio ic
en i onmen could ha e led o he s abiliza ion o nucleo ides on i s su ace and made
possible he u he acc e ion o monome s o o m polynucleo ides. In his sense, i mus be
conside ed ha wo ac o s, an inc ease in he molecula weigh and he seconda y s uc u e
o he oligonucleo ide, go e n he HAp/polynucleo ide binding. Rega ding he seconda y
s uc u e, i has been known o a long ime ha he linkage o double-s anded nucleo ides
and HAp is s onge han he one wi h single-s anded polynucleo ides. T iple-s anded
is e en s onge han double-s anded, and quad uplexes e en mo e so [
317
,
318
]. In he
case o DNA, he nega i ely cha ged polyanion can be s abilized by posi i e cha ges, like
Ca
2+
ions in HAp, sugges ing ha DNA sequences will ha e an a ini y o he c ys alline
mine al. The adso p ion a ini y cons an , K
a
, may change as he seconda y s uc u e is
modi ied by inc easing ionic s eng h. I has been shown ha ap ame sequences wi h
G-quad uplex s uc u es ha e a highe a ini y o apa i e, ela i e o o he sequences, when
highe ionic s eng h is used o s abilize he G-quad uplex [319].
Molecules 2024,29, 4479 23 o 39
The use o DNA ap ame s ob ained by he p ocess known as SELEX (Sys ema ic
E olu ion o Ligands by EXponen ial en ichmen ) bonded o calcium phospha e ma e ials
has ecen ly been s udied. Ap ame s a e single-s anded oligonucleo ides, ypically ang-
ing om 15 o 100 nucleo ides in leng h [
320
]. Expe imen al and compu a ional s udies
ha e shown ha DNA ap ame s a e in ol ed in he mine aliza ion p ocess and ac as
c ucial a ini y eagen s o ma ke s, enabling he di e en ia ion be ween amo phous and
c ys alline ma e ials. Du y e al. [
321
] selec ed h ee ap ame s (wi h a highe pe cen age o
G nucleo ides) and checked hei a ini y o HAp, ACP, and
β
-TCP. La ge and simila K
a
alues and binding a low ap ame concen a ions (~50 nM) indica ed he s ong a ini y
o h ee ap ame s o HAp (Table 6). The ap ame s showed high selec i i y o c ys alline
HAp o e ACP and TCP. Kine ic analysis o he ap ame s e ealed a highe o wa d a e
cons an (k ) o ap ame 1, wi h he mos compac G-quad uplex seconda y s uc u e.
Table 6. Sequence, Gibbs ee ene gy, a ini y, and kine ics o ap ame s o binding o HAp (*).
Adap ed wi h pe mission om [321]. Copy igh © 2020 Else ie B.V.
Ap ame Sequence k (min−1) Ka (M−1)∆G
(Kcal·mol−1)
1
CAGGGCGCTACGGTATGTGTTGGGTCTGGCG
TAGGGCTGGC 12 ±2×1053±1×106−7.37
2
GAGCGCGCTACGGTATGTGTTGCGTGTGGCG
TAGCGGTGCG 6±1×1057±4×106−8.54
3CAGCGCCCTACGCTATGTCTT
GCGTCTCGCCTAGCGCTCGC 2±2×1057±4×106−7.99
* K : kine ic a e cons an ; Ka : adso p ion a ini y cons an ; ∆G: Gibbs ee ene gy o olding o ap ame s.
3.4. HAp–Nucleic Acid–Me al Complex Hyb ids
Me al ions play a ious oles in nucleic acid chemis y [
287
] and can be ca ego ized
as ollows:
1.
Na u al coun e ions: Common cellula ions like K
+
, Mg
2+
, and Na
+
ac o neu alize
he cha ges o polyanionic nucleic acids.
2.
Folding and s abiliza ion: These a e essen ial o he p ope olding o nucleic acids
and o he s abiliza ion o many RNA s uc u es, as well as o he ca aly ic unc-
ion o ibozymes, main aining DNA s uc u es such as Gua-qua e s in elome es
and in Holliday junc ions, and o he c oss-shape s uc u es o med du ing gene ic
ecombina ion.
3.
Exogenous ions and mimic y: Bo h physiological and non-physiological (exoge-
nous) me al ions can mimic na u al ions, a ec ing nucleic acid s abili y and cha ge
neu aliza ion and po en ially causing DNA condensa ion o mu a ions.
4.
Damage by Reac i e Oxygen Species (ROS): Redox-ac i e me al ions can cause
damage o nucleic acids by b eaking DNA s ands. These ions can be essen ial (e.g.,
Cu
+
, Fe
2+
), bo h in ce ain disease s a es and in he apeu ic and DNA sequencing
applica ions.
5.
Phosphodies e eac ions: Me al ions a e in ol ed in he o ma ion and deg ada-
ion o nucleic acid phosphodies e bonds. They can p o ide he OH
−
nucleophile,
pola ize P-O bonds, o s abilize ansi ion s a es o lea ing g oups.
Nucleobases in he s uc u e o nucleic acids a e ypically uncha ged wi hin he phys-
iological pH ange (4 < pH < 9). Me al coo dina ion, like o he chemical modi ica ions
o nucleobases, al e s hei acid–base p ope ies and causes changes in pK
a
alues. The
binding o me als o nucleic bases has been s udied by se e al au ho s [
322
–
326
]. S udies
by Sigel demons a e ha he p o ons o endocyclic NH g oups become mo e acidic when
a me al ion binds o an a ailable ni ogen a om in he nucleobase ing. This phenomenon
leads o changes in pK
a
alues, which can shi in ei he di ec ion as he me al ion displaces
a p o on om he nucleobase and eloca es i wi hin he he e ocycle, he eby gene a ing
a me al-s abilized a e au ome . Me al–nucleobase bond o ma ion occu s h ough he
Molecules 2024,29, 4479 24 o 39
ollowing con ibu ions: (a) elec os a ic in e ac ion: be ween a me al ion and he nucle-
obase dipole, dominan in he gas phase bu in luenced by sol en pola i y in solu ion o
solid s a es; (b) hyd ogen bond o ma ion: be ween a me al’s coligands and nucleobase,
con ibu ing o he s abili y o he complex; and (c) pola iza ion and cha ge ans e e ec s:
in ol ing elec on edis ibu ion wi hin he me al–nucleobase complex, less in luenced by
sol en s and coun e ions. As expec ed, he subs i u ion o nucleobase p o ons wi h me al
ions inc eases his con ibu ion compa ed o he binding o he me al o an a ailable lone
pai o a ing ni ogen a om o an exocyclic oxygen.
The discussion will ocus on guanine, which has a huge dipole momen and a o able
o ien a ion in he isola ed base, esul ing in high a ini y o me al ions o he N7 posi ion.
In double-helical DNA, he a ini y o me al ions o G-N7 is in luenced by he na u e o
he base a he 5
′
side, hus depending on he molecula elec os a ic po en ial and N7 ac-
cessibili y. Addi ionally, wi hin nucleic acids, he a ini y o me al ions is highe o DNA
G-N7 han o RNA G-N7 [
289
]. Pla ina ed DNA agmen s con i m ha guanine esidues
become mo e acidic a e P coo dina ion a N7 [
327
–
329
]. Con e sely, he dipole momen
and o ien a ion o adenine make i less a o able o me al binding a N7, compounded by
he s e ic hind ance o he exocyclic amino g oup.
As has been indica ed be o e, HAp has been ex ensi ely used in column ch oma og a-
phy, and he li e a u e co e s mul iple examples o his echnical app oach. Howe e , as
a as we a e awa e, he way unc ionalized HAp–nucleic acid hyb ids engage wi h me al
ions and coo dina ion compounds has been in es iga ed li le. In one o he ew ins ances,
Benede i e al. [
302
] ocused hei s udy on he adso p ion o pla ina ed nucleo ide analogs
on o HAp. The adso p ion o hese nucleo ide complexes occu s h ough elec os a ic
in e ac ions be ween he nega i e phospha e g oups and posi i e ions on he su ace o
hyd oxyapa i e c ys als (Figu e 11). Bu he me e p esence o phospha es does no ensu e
he adso p ion o he nucleo ide o HAp. The adso p ion e iciency o hese nucleo ide
de i a i es was ound o be in luenced by he o e all elec ical cha ge o he me al complex.
Pla ina ed compounds wi h a ne nega i e cha ge exhibi ed signi ican chemical adso p ion
on o he HAp su ace, which could be e e sed by acidi ica ion. In con as , complexes
wi h ca ionic o neu al cha ges showed e y low adso p ions.
ffi
ffi
′
ffi
ffi
Figu e 11. S uc u e and in e ac ion o he pla inum complex wi h he apa i e su ace.
On he o he hand, guanosine 5
′
- iphospha e (GTP) was ancho ed o he su ace
o Zn-subs i u ed HAp nanopa icles, and i s ac i i y agains os eosa coma cells (Saos-2)
was e alua ed [
330
]. The unc ionalized nanopa icles induced di e en ia ion in o no mal
os eoblas cells in Saos-2 and p o oked an enhancemen o in acellula GTP con en .
In o he wo k, luminescen HAp nanopa icles con aining Eu
3+
ions we e p epa ed by
amida ion o p e iously inse ed AMP and inal unc ionaliza ion o he nano ods wi h
poly(e hylene glycol) me hac yla e (PEGMA) [331].
Molecules 2024,29, 4479 31 o 39
122.
Pa amasi an, M.; Sampa h Kuma , T.S.; Kanniyappan, H.; Mu hu ijayan, V.; Chand a, T.S. Mic obial biomine aliza ion o
hyd oxyapa i e nanoc ys als using Bacillus equilensis. Ce am. In . 2023,49, 5621–5629. [C ossRe ]
123.
Olsz a, M.J.; Cheng, X.; Jee, S.S.; Kuma , R.; Kim, Y.Y.; Kau man, M.J.; Douglas, E.P.; Gowe , L.B. Bone s uc u e and o ma ion: A
new pe spec i e. Ma e . Sci. Eng. R Rep. 2007,58, 77–116. [C ossRe ]
124.
Blai , H.C.; La ou u e, Q.C.; Tou ko a, I.L.; Nelson, D.J.; Dob owolski, S.F.; Schlesinge , P.H. Epi helial-like anspo o mine al
dis inguishes bone o ma ion om o he connec i e issues. J. Cell. Biochem. 2023,124, 1889–1899. [C ossRe ]
125.
Robin, M.; Von Euw, S.; Renaudin, G.; Gomes, S.; K a , J.M.; Nassi , N.; Azaïs, T.; Cos en in, G. Insigh s in o OCP iden i ica ion
and quan i ica ion in he con ex o apa i e biomine aliza ion. C ys EngComm 2020,22, 2728–2742. [C ossRe ]
126.
Feng, X. Chemical and biochemical basis o cell-bone ma ix in e ac ion in heal h and disease. Cu . Chem. Biol. 2009,3, 189–196.
[PubMed]
127.
Schwa cz, H.P. The ul as uc u e o bone as e ealed in elec on mic oscopy o ion-milled sec ions. Semin. Cell De . Biol. 2015,46,
44–50. [C ossRe ]
128.
Pang, S.; Schwa cz, H.P.; Jasiuk, I. In e acial bonding be ween mine al pla ele s in bone and i s e ec on mechanical p ope ies o
bone. J. Mech. Beha . Biomed. Ma e . 2021,113, 104132. [C ossRe ]
129.
Hong, M.H.; Lee, J.H.; Jung, H.S.; Shin, H.; Shin, H. Biomine aliza ion o bone issue: Calcium phospha e-based ino ganics in
collagen ib illa o ganic ma ices. Bioma e . Res. 2022,26, 42. [C ossRe ]
130.
Godbe g, M.; Kulka ni, A.B.; Young, M.; Boskey, A. Den in: S uc u e, composi ion and mine aliza ion. F on . Biosci. 2011,3, 711.
131.
Hu, D.; Ren, Q.; Li, Z.; Zhang, L. Chi osan-based biomime ically mine alized composi e ma e ials in human ha d issue epai .
Molecules 2020,25, 4785. [C ossRe ] [PubMed]
132.
Du, M.; Chen, J.; Liu, K.; Xing, H.; Song, C. Recen ad ances in biomedical enginee ing o nano-hyd oxyapa i e including
den is y, cance ea men and bone epai . Compos. Pa B Eng. 2021,215, 108790. [C ossRe ]
133.
Jagadeeshanayaka, N.; Awas hi, S.; Jambagi, S.C.; S i as a a, C. Bioac i e su ace modi ica ions h ough he mally sp ayed
hyd oxyapa i e composi e coa ings: A e iew o selec i e ein o cemen s. Bioma e . Sci. 2022,10, 2484–2523. [C ossRe ]
134.
Fukumo o, S.; Nakamu a, T.; Yamada, A.; A akaki, M.; Sai o, K.; Xu, J.; Fukumo o, E.; Yamada, Y. New insigh s in o he unc ions
o enamel ma ices in calci ied issues. Jpn. Den . Sci. Re . 2014,50, 47–54. [C ossRe ]
135.
Lama-Od ía, M.C.; Valle, L.J.; Puiggalí, J. Hyd oxyapa i e biobased ma e ials o ea men and diagnosis o cance . In . J. Mol. Sci.
2022,23, 11352. [C ossRe ]
136.
Salama, A. Cellulose/calcium phospha e hyb ids: New ma e ials o biomedical and en i onmen al applica ions. In . J. Biol.
Mac omol. 2019,127, 606–617. [C ossRe ] [PubMed]
137.
Yamada, T.; Ki amu a, T.; Mo i a, Y.; Mizuno, M.; Yubu a, K.; Teshima, K. G ow h o dispe sed hyd oxyapa i e c ys als highly
in e wined wi h TEMPO-oxidized cellulose nano ibe . C ys EngComm 2020,22, 4933–4941. [C ossRe ]
138.
F ohbe gh, M.E.; Ka sman, A.; Bo a, G.P.; Laza o ici, P.; Schaue , C.L.; Wegs , U.G.K.; Lelkes, P.I. Elec ospun hyd oxyapa i e-
con aining chi osan nano ibe s c osslinked wi h genipin o bone issue enginee ing. Bioma e ials 2012,33, 9167–9178. [C ossRe ]
[PubMed]
139.
Ni, P.; Fox, J.T. Syn hesis and app aisal o a hyd oxyapa i e/pec in hyb id ma e ial o zinc emo al om wa e . RSC Ad . 2019,9,
21095–21105. [C ossRe ]
140.
Alina az, S.; Mahda inia, G.R.; Ja a i, H.; Haz a i, M.; Akba i, A. Hyd oxyapa i e (HA)-based hyb id bionanocomposi e
hyd ogels: Cip o loxacin deli e y, elease kine ics and an ibac e ial ac i i y. J. Mol. S uc . 2021,1225, 129095. [C ossRe ]
141.
Szu kowska, K.; Zgadzaj, A.; Ku as, M.; Kolmas, J. No el hyb id ma e ial based on Mg
2+
and SiO
44-
co-subs i u ed nano-
hyd oxyapa i e, algina e and chond oi in sulpha e o po en ial use in bioma e ials enginee ing. Ce am. In . 2018,44, 18551–18559.
[C ossRe ]
142.
Xiong, H.; Du, S.; Ni, J.; Zhou, J.; Yao, J. Mi ochond ia and nuclei dual- a ge ed he e ogeneous hyd oxyapa i e nanopa icles o
enhancing he apeu ic e icacy o doxo ubicin. Bioma e ials 2016,94, 70–83. [C ossRe ] [PubMed]
143.
Kong, L.; Mu, Z.; Yu, Y.; Zhang, L.; Hu, J. Polye hyleneimine-s abilized hyd oxyapa i e nanopa icles modi ied wi h hyalu onic
acid o a ge ed d ug deli e y. RSC Ad . 2016,6, 101790–101799. [C ossRe ]
144.
Negi, D.; Bha ya, K.; Pal, D.; Singh, Y. Acemannan coa ed, cobal -doped biphasic calcium phospha e nanopa icles o im-
munomodula ion egula ed bone egene a ion. Bioma e . Sci. 2024,12, 3672–3685. [C ossRe ]
145.
Russo, L.; Landi, E.; Tampie i, A.; Na alello, A.; Doglia, S.M.; Gab ielli, L.; Cipolla, L.; Nico a, F. Suga -deco a ed hyd oxyapa i e:
An ino ganic ma e ial bioac i a ed wi h ca bohyd a es. Ca bohyd . Res. 2011,346, 1564–1568. [C ossRe ]
146.
Sand ia, M.; Na alellob, A.; Binib, D.; Gab iellib, L.; Cipolla, L.; Nico a, F. Swee and sal ed: Suga s mee hyd oxyapa i e. Synle
2011,13, 1845–1848.
147.
Skinne , J.C.; P esse , H.J.; Sco , R.P.; Wilson, A.D. Adhesion o ca boxyla e cemen s o hyd oxyapa i e. I. The e ec o he
s uc u e o alipha ic ca boxyla es on hei up ake by hyd oxyapa i e. Bioma e ials 1986,7, 438–440. [C ossRe ]
148.
Sco , R.P.; Jackson, A.M.; Wilson, A.D. Adhesion o ca boxyla e cemen s o hyd oxyapa i e. II. Adso p ion o a oma ic ca boxy-
la es. Bioma e ials 1990,11, 341–344. [C ossRe ] [PubMed]
149.
Ellis, J.; Sco , R.P.; Jackson, A.M.; Wilson, A.D. Adhesion o ca boxyla e cemen s o hyd oxyapa i e. III. Adso p ion o
poly(alkenoic acids). Bioma e ials 1990,11, 379–384. [C ossRe ]
150.
Tenhuisen, K.S.; B own, P.W.; Reed, C.S.; Allcock, H.R. Low empe a u e syn hesis o a sel -assembling composi e: Hyd oxyapa i e-
poly[bis(sodium ca boxyla ophenoxy)phosphazene]. J. Ma e . Sci. Ma e . Med. 1996,7, 673–682. [C ossRe ]

Molecules 2024,29, 4479 32 o 39
151.
Soheilmoghaddam, M.; Padmanabhan, H.; Coope -Whi e, J.J. Biomime ic cues om poly(lac ic- co -glycolic acid)/hyd oxyapa i e
nano- ib ous sca olds d i e os eogenic commi men in human mesenchymal s em cells in he absence o os eogenic ac o
supplemen s. Bioma e . Sci. 2020,8, 5677–5689. [C ossRe ]
152.
Placen e, D.; Benedini, L.A.; Baldini, M.; Laiuppa, J.A.; San illán, G.E.; Messina, P.V. Mul i-d ug deli e y sys em based on lipid
memb ane mime ic coa ed nano-hyd oxyapa i e o mula ions. In . J. Pha m. 2018,548, 559–570. [C ossRe ] [PubMed]
153.
Le , J.A.; Sunda eswa i, M.; Ra ichand an, K.; La ha, M.B.; Sagade an, S.; Bin Johan, M.R. Tailo ing he mo phological ea u es o
sol-gel syn hesized mesopo ous hyd oxyapa i e using a y acids as an o ganic modi ie . RSC Ad . 2019,9, 6228–6240. [C ossRe ]
[PubMed]
154.
Qi, M.; Yao, S.; Wang, W.; Qi, L.; Wang, Y.; Zhang, H. Hyd oxyapa i e nanoma e ials wi h ailo ed leng h egula ed by di e en
a y acids. Mic o Nano Le . 2021,16, 649–655. [C ossRe ]
155.
Wang, Y.C.; Wang, J.N.; Xiao, G.Y.; Huang, S.Y.; Xu, W.L.; Yan, W.X.; Lu, Y.P. In es iga ion o a ious a y acid su ac an s on he
mic os uc u e o lexible hyd oxyapa i e nano ibe s. C ys EngComm 2021,23, 7049–7055. [C ossRe ]
156.
Odu uga, A.A.; P ou , R.E.S.; Hoa e, R.J. Hyd oxyapa i e p ecipi a ion
in i o
by lipids ex ac ed om mammalian ha d and so
issues. A ch. O al Biol. 1975,20, 311–316. [C ossRe ]
157.
Wu hie , R.E.; Eanes, E.D. E ec o phospholipids on he ans o ma ion o amo phous calcium phospha e o hyd oxyapa i e
in i o. Calci . Tissue Res. 1975,19, 197–210. [C ossRe ]
158.
Boskey, A.L.; Posne , A.S. The ole o syn he ic and bone ex ac ed Ca-phospholipid-PO
4
complexes in hyd oxyapa i e o ma ion.
Calci . Tissue Res. 1977,23, 251–258. [C ossRe ]
159.
Ve ma, G.; She ake, N.G.; Pand eka , S.; Pandey, B.; Hassan, P.; P iyada sini, K. De elopmen o su ace unc ionalized hyd oxya-
pa i e nanopa icles o enhanced speci ici y owa ds umo cells. Eu . J. Pha m. Sci. 2020,144, 105206. [C ossRe ]
160.
Baeza, A.; Izquie do-Ba ba, I.; Valle -Regí, M. Bio inyla ion o silicon-doped hyd oxyapa i e: A new app oach o p o ein ixa ion
o bone issue egene a ion. Ac a Bioma e . 2010,6, 743–749. [C ossRe ] [PubMed]
161. Web o Science. A ailable online: h ps://www.webo science.com/wos/ (accessed on 11 July 2024).
162.
Ca ie , P. Les cons i uan s mine aux des issus calci ies. 1.La s uc u e mine ale de los, de la den ine e du cemen . Bull. Soc.
Chim. Biol. 1948,30, 65–73.
163.
Uneyama, H.; Kobayashi, H.; Tonouchi, N. New Func ions and po en ial applica ions o amino acids. In Amino Acid Fe men a ion;
Yoko a, A., Ikeda, M., Eds.; Ad ances in Biochemical Enginee ing/Bio echnology; Sp inge : Tokyo, Japan, 2016; Volume 159.
164.
Flo es, E.; Ma inez, E.; Rod iguez, L.E.; Webe , J.M.; Khodaya i, A.; Vande elde, D.G.; Ba ge, L.M. E ec s o amino acids on
phospha e adso p ion on o i on (oxy)hyd oxide mine als unde ea ly ea h condi ions. ACS Ea h Space Chem. 2021,5, 1048–1057.
[C ossRe ]
165. Kay, M.I.; Young, R.A.; Posne , A.S. C ys al s uc u e o hyd oxyapa i e. Na u e 1964,204, 1050. [C ossRe ] [PubMed]
166. Flee , M.E. In a ed spec a o ca bona e apa i es: ν2- egion bands. Bioma e ials 2009,30, 1473–1481. [C ossRe ]
167.
Pham Minh, D.; T an, N.D.; Nzihou, A.; Sha ock, P. Ca bona e-con aining apa i e (CAP) syn hesis unde mode a e condi ions
s a ing om calcium ca bona e and o hophospho ic acid. Ma e . Sci. Eng. C 2013,33, 2971–2980. [C ossRe ]
168.
G unenwald, A.; Keyse , C.; Sau e eau, A.M.; C ubézy, E.; Ludes, B.; D oue , C. Re isi ing ca bona e quan i ica ion in apa i e
(bio)mine als: A alida ed FTIR me hodology. J. A chaeol. Sci. 2014,49, 134–141. [C ossRe ]
169.
Hayashi, K.; Kishida, R.; Tsuchiya, A.; Ishikawa, K. T ans o mable ca bona e apa i e chains as a no el ype o bone g a . Ad .
Heal hc. Ma e . 2024,13, e2303245. [C ossRe ]
170.
Boanini, E.; To icelli, P.; Gazzano, M.; Gia dino, R.; Bigi, A. Nanocomposi es o hyd oxyapa i e wi h aspa ic acid and glu amic
acid and hei in e ac ion wi h os eoblas -like cells. Bioma e ials 2006,27, 4428–4433. [C ossRe ]
171.
Indi a, J.; Mala hi, K.S. Compa ison o empla e media ed ul asonic and mic owa e i adia ion me hod on he syn hesis o
hyd oxyapa i e nanopa icles o biomedical applica ions. Ma e . Today P oc. 2021,51, 1765–1769. [C ossRe ]
172.
Jah omi, M.T.; Ce u i, M. Amino acid/ion agg ega e o ma ion and hei ole in hyd oxyapa i e p ecipi a ion. C ys . G ow h Des.
2015,15, 1096–1104. [C ossRe ]
173.
Moussa, S.B.; Bachouâ, H.; G uselle, M.; Beaunie , P.; Flamba d, A.; Bad aoui, B. Hyb id o ganic-ino ganic ma e ials based on
hyd oxyapa i e s uc u e. J. Solid S a e Chem. 2017,248, 171–177. [C ossRe ]
174.
K ukowski, S.; Lysenko, N.; Kolodziejski, W. Syn hesis and cha ac e iza ion o nanoc ys alline composi es con aining calcium
hyd oxyapa i e and glycine. J. Solid S a e Chem. 2018,264, 59–67. [C ossRe ]
175.
Chen, Z.; Fu, Y.; Cai, Y.; Yao, J. E ec o amino acids on he c ys al g ow h o hyd oxyapa i e. Ma e . Le . 2012,68, 361–363.
[C ossRe ]
176.
Bigi, E.A.; Boanini, M.; Gazzano, M.A.; Ko decki, K. Rubini. Mic os uc u al in es iga ion o hyd oxyapa i e-polyelec oly e
composi es. J. Ma e . Chem. 2004,14, 274–279. [C ossRe ]
177.
Jack, K.S.; Vizca a, T.G.; T au, M. Cha ac e iza ion and su ace p ope ies o amino acid-modi ied, ca bona e-con aining
hyd oxyapa i e pa icles. Langmui 2007,23, 12233–12242. [C ossRe ] [PubMed]
178.
Gonzalez-McQui e, R.; Chane-Ching, J.Y.; Vignaud, E.; Lebuglec, A.; Manna, S. Syn hesis and cha ac e iza ion o amino
acid- unc ionalized hyd oxyapa i e nano ods. J. Ma e . Chem. 2004,14, 2277–2281. [C ossRe ]
179.
Kou sopoulos, S.; Dalas, E. The e ec o acidic amino acids on hyd oxyapa i e c ys alliza ion. J. C ys . G ow h 2000,217, 410–415.
[C ossRe ]
Molecules 2024,29, 4479 33 o 39
180.
Kou sopoulos, S.; Dalas, E. Hyd oxyapa i e c ys alliza ion in he p esence o se ine, y osine and hyd oxyp oline amino acids
wi h pola side g oups. J. C ys . G ow h 2000,216, 443–449. [C ossRe ]
181.
Kou sopoulos, S.; Dalas, E. The c ys alliza ion o hyd oxyapa i e in he p esence o lysine. J. Colloid In . Sci. 2000,231, 207–212.
[C ossRe ]
182.
Kou sopoulos, S.; Dalas, E. Inhibi ion o hyd oxyapa i e o ma ion in aqueous solu ions by amino acids wi h hyd ophobic side
g oups. Langmui 2000,16, 6739–6744. [C ossRe ]
183.
Kou sopoulos, S.; Dalas, E. Hyd oxyapa i e c ys alliza ion in he p esence o amino acids wi h uncha ged pola side g oups:
glycine, cys eine, cys ine, and glu amine. Langmui 2001,17, 1074–1079. [C ossRe ]
184.
Spanos, N.; Klepe sanis, P.G.; Kou soukos, P.G. Model s udies on he in e ac ion o amino acids wi h biomine als: The e ec o
L-se ine a he hyd oxyapa i e-wa e in e ace. J. Colloid In e ace Sci. 2001,236, 260–265. [C ossRe ]
185.
Dalas, E.; Malkaj, P.; Vasileiou, Z.; Kanellopoulou, D.G. The e ec o Leucine on he c ys al g ow h o calcium phospha e. J. Ma e .
Sci. Ma e . Med. 2008,19, 277–282. [C ossRe ] [PubMed]
186.
Ta a oghi, M.; Ce u i, M. The ole o amino acids in hyd oxyapa i e mine aliza ion. J. R. Soc. In e ace 2016,13, 20160462.
[C ossRe ]
187.
Ho , S.E.; Liu, J.; Heinz, H. Binding mechanism and binding ee ene gy o amino acids and ci a e o hyd oxyapa i e su aces as
a unc ion o c ys allog aphic ace , pH, and elec oly es. J. Colloid In e ace Sci. 2022,605, 685–700. [C ossRe ]
188.
K esak, M.; Mo eno, E.C.; Zah adnik, R.T.; Hay, D.I. Adso p ion o amino acids on o hyd oxyapa i e. J. Colloid In e ace Sci. 1977,
59, 283–292. [C ossRe ]
189.
Sha ma, R.; Pandey, R.R.; Gup a, A.A.; Ka , S.; Dhayal, M. In si u amino acid unc ionaliza ion and mic os uc u e o ma ion o
hyd oxyapa i e nanopa icles syn hesized a di e en pH by p ecipi a ion ou e. Ma e . Chem. Phys. 2012,133, 718–725. [C ossRe ]
190.
Ra na ilaka Na Bhuke , P.; Li, Y.; Yu, S.M. F om collagen mime ics o collagen hyb idiza ion and back. Acc. Chem. Res. 2024,57,
1649–1657. [C ossRe ]
191.
Sau a , S.; Sha ma, P.; Kuma , A.; Tabassum, Z.; Gi dha , M.; Mamidi, N.; Mohan, A. Ha nessing na u al polyme s o nano-
sca olds in bone issue enginee ing: A comp ehensi e o e iew o bone disease ea men . Cu . Issues Mol. Biol. 2024,46,
585–611. [C ossRe ]
192.
Kawasaki, A.; Kawano, K.; Te ada, Y.; Hi ayasu, R. In e ac ion o hyd oxyapa i e wi h amino acids. J. Jpn. P os odon hic Soc. 1989,
33, 522–527. [C ossRe ] [PubMed]
193.
El Sha ei, G.M.S.; Moussa, N.A. Adso p ion o some essen ial amino acids on hyd oxyapa i e. J. Colloid In e ace Sci. 2001,238,
160–166. [C ossRe ]
194.
Chauhan, N.; Singh, Y. L-his idine con ols he hyd oxyapa i e mine aliza ion wi h pla e-like mo phology: E ec o concen a ion
and media. Ma e . Sci. Eng. C 2021,120, 111669. [C ossRe ] [PubMed]
195.
Go buno , M.J.; Timashe , S.N. The in e ac ion o p o eins wi h hyd oxyapa i e. III. Mechanism. Anal. Biochem. 1984,136,
440–445. [C ossRe ]
196.
El Rhilassi, A.; Mou abe , M.; Bennani-Zia ni, M.; El Ham i, R.; Tai ai, A. In e ac ion o some essen ial amino acids wi h
syn hesized poo ly c ys alline hyd oxyapa i e. J. Saudi Chem. Soc. 2016,20, S632–S640. [C ossRe ]
197.
El Rhilassi, A.; Oukkass, O.; Bennani-Zia ni, M. Iso he ms, kine ics, and he modynamics o me hionine adso p ion on o poo ly
c ys alline hyd oxyapa i e wi h di e en Ca/P a ios. Cu . Chem. Le . 2023,12, 781–798. [C ossRe ]
198.
Go buno , M.J. The in e ac ion o p o eins wi h hyd oxyapa i e. I. Role o p o ein cha ge and s uc u e. Anal. Biochem. 1984,136,
425–432. [C ossRe ]
199.
Wassell, D.T.H.; Hall, R.C.; Embe y, G. Adso p ion o bo ine se um albumin on o hyd oxyapa i e. Bioma e ials 1995,16, 697–702.
[C ossRe ]
200.
Go buno , M.J. The in e ac ion o p o eins wi h hyd oxyapa i e. II. Role o acidic and basic g oups. Anal. Biochem. 1984,136,
433–439. [C ossRe ]
201.
Kolla h, V.O.; den B oeck, F.V.; Fehé , K.; Ma ins, J.C.; Luy en, J.; T aina, K.; Mullens, S.; Cloo s, R. A modula app oach o s udy
p o ein adso p ion on su ace modi ied hyd oxyapa i e. Chem. Eu . J. 2015,21, 10497–10505. [C ossRe ]
202.
Vic o , S.P.; Sha ma, C.P. T yp ophan complexed hyd oxyapa i e nanopa icles o immunoglobulin adso p ion. J. Ma e . Sci.
Ma e . Med. 2011,22, 2219–2229. [C ossRe ] [PubMed]
203.
Uddin, M.H.; Ma sumo o, T.; Ishiha a, S.; Nakahi a, A.; Okazaki, M.; Sohmu a, T. Apa i e con aining aspa ic acid o selec i e
p o ein loading. J. Den . Res. 2010,89, 488–492. [C ossRe ] [PubMed]
204.
Holden, D.T.; Mo a o, N.M.; Cooks, R.G. Aqueous mic od ople s enable abio ic syn hesis and chain ex ension o unique pep ide
isome s om ee amino acids. P oc. Na l. Acad. Sci. USA 2022,119, e2212642119. [C ossRe ]
205.
Poun os, I.; Pan eli, M.; Lamp opoulos, A.; Jones, E.; Calo i, G.M.; Giannoudis, P.V. The ole o pep ides in bone healing and
egene a ion: A sys ema ic e iew. BMC Med. 2016,14, 103. [C ossRe ]
206.
He nández-Ledesma, B.; Hsieh, C.C. Chemop e en i e ole o ood-de i ed p o eins and pep ides: A e iew. C i . Re . Food Sci.
Nu . 2017,57, 2358–2376. [C ossRe ] [PubMed]
207.
Cice o, A.F.G.; Fogacci, F.; Colle i, A. Po en ial ole o bioac i e pep ides in p e en ion and ea men o ch onic diseases: A
na a i e e iew. B . J. Pha macol. 2017,174, 1378–1394. [C ossRe ]
208. Owji, H.; Neza a , N.; Negahda ipou , M.; Hajieb ahimi, A.; Ghasemi, Y. A comp ehensi e e iew o signal pep ides: S uc u e,
oles, and applica ions. Eu . J. Cell Biol. 2018,97, 422–441. [C ossRe ]
Molecules 2024,29, 4479 34 o 39
209.
Wang, X.; Xu, J.; Kang, Q. Neu omodula ion o bone: Role o di e en pep ides and hei in e ac ions ( e iew). Mol. Med. Rep.
2021,23, 320. [C ossRe ]
210.
Pé ez, J.J. Exploi ing knowledge on s uc u e-ac i i y ela ionships o designing pep idomime ics o endogenous pep ides.
Biomedicines 2021,9, 651–669. [C ossRe ]
211. Kas in, A.J. (Ed.) Handbook o Biological Ac i e Pep ides; Else ie : Ams e dam, The Ne he lands, 2006.
212.
Zhao, N.; Yan, L.; Zhao, X.; Chen, X.; Li, A.; Zheng, D.; Zhou, X.; Dai, X.; Xu, F.J. Ve sa ile ypes o o ganic/ino ganic nanohyb ids:
F om s a egic design o biomedical applica ions. Chem. Re . 2019,119, 1666–1762. [C ossRe ]
213.
Li, Q.; Wang, Y.; Zhang, G.; Su, R.; Qi, W. Biomime ic mine aliza ion based on sel -assembling pep ides. Chem. Soc. Re . 2023,52,
1549–1590. [C ossRe ] [PubMed]
214.
D oue , C.; Al-Ka an, A.; Choime , M.; Tou e e, A.; San an, V.; Dexpe -Ghys, J.; Pipy, B.; B ouille , F.; Tou bin, M. Biomime ic
apa i e-based unc ional nanopa icles as p omising newcome s in nanomedicine: O e iew o 10 yea s o ini ia o y esea ch. J.
Gen. P ac . Med. Diagn. 2015,1, 1–9. [C ossRe ] [PubMed]
215.
Mi agoli, M.; Ce io i, P.; Ia isco, M.; Vacchiano, M.; Sal a ani, N.; Alogna, A.; Ca ullo, P.; Rami ez-Rod íguez, G.B.; Pa ício,
T.; Espos i, L.D.; e al. Inhala ion o pep ide-loaded nanopa icles imp o es hea ailu e. Sci. T ansl. Med. 2018,10, eaan6205.
[C ossRe ] [PubMed]
216.
Ia isco, M.; Ca ella, F.; Degli Espos i, L.; Adamiano, A.; Ca alucci, D.; Modica, J.; B agonzi, A.; Vi ali, A.; To elli, R.; Sanguine i,
M.; e al. Biocompa ible an imic obial colis in loaded calcium phospha e nanopa icles o he coun e ac ion o bio ilm o ma ion
in cys ic ib osis ela ed in ec ions. J. Ino g. Biochem. 2022,230, 111751. [C ossRe ] [PubMed]
217.
Cap io i, L.A.; Beebe, T.P.; Schneide , J.P. Hyd oxyapa i e su ace-induced pep ide olding. J. Am. Chem. Soc. 2007,129, 5281–5287.
[C ossRe ]
218.
Fujisawa, R.; Mizuno, M.; Nodasaka, Y.; Kuboki, Y. A achmen o os eoblas ic cells o hyd oxyapa i e c ys als by a syn he ic
pep ide (Glu
7
-P o-A g-Gly-Asp-Th ) con aining wo unc ional sequences o bone sialop o ein. Ma ix Biol. 1997,16, 21–28.
[C ossRe ]
219.
Ling, C.; Zhao, W.; Wang, Z.; Chen, J.; Us iyana, P.; Gao, M.; Sahai, N. S uc u e-ac i i y ela ionships o hyd oxyapa i e-binding
pep ides. Langmui 2020,36, 2493–2742. [C ossRe ]
220.
Smi h, G.P. Filamen ous usion phage-no el exp ession ec o s ha display cloned an igens on he i ion su ace. Science 1985,
228, 1315–1317. [C ossRe ] [PubMed]
221. Bu on, D.R. Phage display. Immuno echnology 1995,1, 87–94. [C ossRe ]
222. Smi h, G.P.; Pe enko, V.A. Phage display. Chem. Re . 1997,97, 391–410. [C ossRe ]
223.
Addison, W.N.; Mille , S.J.; Ramaswamy, J.; Mansou i, A.; Kohn, D.H.; McKee, M.D. Phospho yla ion-dependen mine al- ype
speci ici y o apa i e-binding pep ide sequences. Bioma e ials 2010,31, 9422–9430. [C ossRe ] [PubMed]
224.
Zhao, W.; Xu, Z.; Cui, Q.; Sahai, N. P edic ing he s uc u e-ac i i y ela ionship o hyd oxyapa i e-binding pep ides by enhanced-
sampling molecula simula ion. Langmui 2016,32, 7009–7022. [C ossRe ]
225.
Do Nascimen o, M.; Almeida, A.R.S.; Hi a a, M.C.; Elzubai , A.; da Rocha, D.N.; da Sil a, M.H.P. Biomine aliza ion o calcium
phospha es unc ionalized wi h hyd oxyapa i e-binding pep ide. J. Mech. Beha . Biomed. Ma e . 2023,146, 106082. [C ossRe ]
226.
Gué in, M.; Leb un, A.; Kuhn, L.; Azaïs, T.; Lau en , G.; Ma san, O.; D oue , C.; Sub a, G. One-po syn hesis o bioinspi ed
pep ide-deco a ed apa i e nanopa icles o nanomedicine. Small 2024,20, e2306358. [C ossRe ]
227.
Ca pino, L.A.; Han, G.Y. 9-Fluo enylme hoxyca bonyl unc ion, a new base-sensi i e amino-p o ec ing g oup. J. Am. Chem. Soc.
1970,92, 5748–5749. [C ossRe ]
228.
DeG ado, W.F.; Lea , J.D. Induc ion o pep ide con o ma ion a apola wa e in e aces. 1. A s udy wi h model pep ides o de ined
hyd ophobic pe iodici y. J. Am. Chem. Soc. 1985,107, 7684–7689.
229.
Xia, J.; Wang, W.; Jin, X.; Zhao, J.; Chen, J.; Li, N.; Xiao, S.; Lin, D.; Song, Z. E ec s o chain leng hs and backbone chi ali y on he
bone- a ge ing abili y o poly(glu amic acid)s. Bioma e . Sci. 2024,12, 3896–3904. [C ossRe ]
230.
Be na di, G.; Cook, W.H. Sepa a ion and cha ac e iza ion o he wo high densi y lipop o eins o egg yolk,
α
- and
β
-lipo i ellin.
BBA Biochim. Biophys. Ac a 1960,44, 96–105. [C ossRe ]
231.
Be na di, G.; Kawasaki, T. Ch oma og aphy o polypep ides and p o eins on hyd oxyapa i e columns. BBA P o ein S uc . 1968,
160, 301–310. [C ossRe ]
232.
Kimu a, R.; Noda, D.; Liu, Z.; Shi, W.; Aku su, R.; Tagaya, M. Biological su ace laye o ma ion on bioce amic pa icles o
p o ein adso p ion. Biomime ics 2024,9, 347. [C ossRe ]
233. Rica d-Blum, S. The collagen amily. Cold Sp ing Ha b. Pe spec . Biol. 2011,3, a004978. [C ossRe ] [PubMed]
234.
Palme , L.C.; Newcomb, C.J.; Kal z, S.R.; Spoe ke, E.D.; S upp, S.I. Biomime ic sys ems o hyd oxyapa i e mine aliza ion inspi ed
by bone and enamel. Chem. Re . 2008,108, 4754–4783. [C ossRe ] [PubMed]
235.
Iijima, K.; Hashizume, M. U iliza ion o p o eins and pep ides o c ea e o ganic-hyd oxyapa i e hyb ids. P o ein Pep . Le . 2018,
25, 25–33. [C ossRe ] [PubMed]
236. De Yo eo, J.J.; Vekilo , P.G. P inciples o c ys al nuclea ion and g ow h. Re . Mine al. Geochem. 2003,54, 57–93. [C ossRe ]
237.
Nishimo o, S.K.; A aki, N.; Robinson, F.D.; Wai e, J.H. Disco e y o bone gamma-ca boxyglu amic acid p o ein in mine alized
scales. The abundance and s uc u e o Lepomis mac ochi us bone gamma-ca boxyglu amic acid p o ein. J. Biol. Chem. 1992,267,
11600–11605. [C ossRe ]
Molecules 2024,29, 4479 35 o 39
238.
Rico-Llanos, G.A.; Bo ego-González, S.; Moncayo-Donoso, M.; Bece a, J.; Visse , R. Collagen ype I bioma e ials as sca olds o
bone issue enginee ing. Polyme s 2021,13, 599. [C ossRe ]
239.
Cui, P.; Shao, T.; Liu, W.; Li, M.; Yu, M.; Zhao, W.; Song, Y.; Ding, Y.; Liu, J. Ad anced e iew on ype II collagen and pep ide:
P epa a ion, unc ional ac i i ies and ood indus y applica ion. C i . Re . Food Sci. Nu . 2023,2023., 1–18. [C ossRe ]
240. McCo mick, R.J. The lexibili y o he collagen compa men o muscle. Mea Sci. 1994,36, 79–91. [C ossRe ]
241.
Ab eu-Velez, A.M.; Howa d, M.S. Collagen IV in no mal skin and in pa hological p ocesses. N. Am. J. Med. Sci. 2012,4, 1–8.
[C ossRe ]
242.
Massoudi, D.; Malecaze, F.; Galiacy, S.D. Collagens and p o eoglycans o he co nea: Impo ance in anspa ency and isual
diso de s. Cell Tissue Res. 2016,363, 337–349. [C ossRe ]
243.
Boskey, A.L. Hyd oxyapa i e o ma ion in a dynamic collagen gel sys em: E ec s o ype I collagen, lipids, and p o eoglycans. J.
Phys. Chem. 1989,93, 1628–1633. [C ossRe ]
244.
B ad , J.H.; Me ig, M.; Te esiak, A.; Pompe, W. Biomime ic mine aliza ion o collagen by combined ib il assembly and calcium
phospha e o ma ion. Chem. Ma e . 1999,11, 2694–2701. [C ossRe ]
245.
Qu, H.; Xia, Z.; Knech , D.A.; Wei, M. Syn hesis o dense collagen/apa i e composi es using a biomime ic me hod. J. Am. Ce am.
Soc. 2008,91, 3211–3215. [C ossRe ]
246.
Rhee, S.H.; Lee, J.D.; Tanaka, J. Nuclea ion o hyd oxyapa i e c ys al h ough chemical in e ac ion wi h collagen. J. Am. Ce am.
Soc. 2000,83, 2890–2892. [C ossRe ]
247.
Sun, Y.; Wang, Y.; Ji, C.; Ma, J.; He, B. The impac o hyd oxyapa i e c ys al s uc u es and p o ein in e ac ions on bone’s
mechanical p ope ies. Sci. Rep. 2024,14, 9786. [C ossRe ]
248.
Tan, X.; Xue, Z.; Zhu, H.; Wang, X.; Xu, D. How cha ged amino acids egula e nuclea ion o biomime ic hyd oxyapa i e
nanopa icles on he su ace o collagen mime ic pep ides: Molecula dynamics and ee ene gy in es iga ions. C ys . G ow h Des.
2020,20, 4561–4572. [C ossRe ]
249.
Li, X.; Chang, J. P epa a ion o bone-like apa i e-collagen nanocomposi es by a biomime ic p ocess wi h phospho yla ed collagen.
J. Biomed. Ma e . Res. Pa A 2008,85, 293–300. [C ossRe ]
250.
Li, D.; He, J.; Cheng, W.; Wu, Y.; Hu, Z.; Tian, H.; Huang, Y. Redox- esponsi e nano ese oi s based on collagen end-capped
mesopo ous hyd oxyapa i e nanopa icles o a ge ed d ug deli e y. J. Ma e . Chem. B 2014,2, 6089–6096. [C ossRe ]
251.
Bolande , M.E.; Young, M.F.; Fishe , L.W.; Yamada, Y.; Te mine, J.D. Os eonec in cDNA sequence e eals po en ial binding egions
o calcium and hyd oxyapa i e and shows homologies wi h bo h a basemen memb ane p o ein (SPARC) and a se ine p o einase
inhibi o (o omucoid). P oc. Na l. Acad. Sci. USA 1988,85, 2919–2923. [C ossRe ]
252.
Geo ge, A.; Veis, A. Phospho yla ed p o eins and con ol o e apa i e nuclea ion, c ys al g ow h, and inhibi ion. Chem. Re . 2008,
108, 4670–4693. [C ossRe ]
253.
Robin, M.; To ani, C.B.; K a , J.-M.; Cos en in, G.; Azaïs, T.; Nassi , N. The concen a ion o bone- ela ed o ganic addi i es
d i es he pa hway o apa i e o ma ion. C ys . G ow h Des. 2021,21, 3994–4004. [C ossRe ]
254.
B omley, K.M.; Kiss, A.S.; Lokappa, S.B.; Lakshmina ayanan, R.; Fan, D.; Ndao, M.; E ans, J.S.; Mo adian-Oldak, J. Dissec ing
amelogenin p o ein nanosphe es: Cha ac e iza ion o me as able oligome s. J. Biol. Chem. 2011,286, 34643–34653. [C ossRe ]
255.
Bai, Y.; Yu, Z.; Acke man, L.; Zhang, Y.; Bonde, J.; Li, W.; Cheng, Y.; Habeli z, S. P o ein nano ibbons empla e enamel
mine aliza ion. P oc. Na l. Acad. Sci. USA 2020,117, 19201–19208. [C ossRe ]
256.
Tao, J.; Shin, Y.; Jayasinha, R.; Buchko, G.W.; Bu on, S.D.; Dohnalko a, A.C.; Wang, Z.; Shaw, W.J.; Ta ase ich, B.J. The ene ge ic
basis o hyd oxyapa i e mine aliza ion by amelogenin a ian s p o ides insigh s in o he o igin o amelogenesis impe ec a.
P oc. Na l. Acad. Sci. USA 2019,116, 13867–13872. [C ossRe ] [PubMed]
257.
Belca z, A.; Ginalska, G.; Zalewska, J.; Rzeski, W.; ´
Slósa czyk, A.; Kowalczuk, D.; Godlewski, P.; Nied´zwiadek, J. Co alen
coa ing o hyd oxyapa i e by ke a in s abilizes gen amicin elease. J. Biomed. Ma e . Res. Pa B Appl. Bioma e . 2009,89B, 102–113.
[C ossRe ]
258.
Ma sumo o, R.; Yoshii, T.; Egawa, S.; Hashimo o, M.; Hi ai, T.; Inose, H.; Oh, Y.; Fuji a, K.; Okawa, A.; So ome, S. Local supp ession
e ec o pacli axel-imp egna ed hyd oxyapa i e/collagen on b eas cance bone me as asis in a a model. Spine Su g. Rela . Res.
2022,6, 294–302. [C ossRe ]
259.
Li, G.; Tang, D.; Wang, D.; Xu, C.; Liu, D. E ec i e chemo he apy o lung cance using bo ine se um albumin-coa ed hyd oxyap-
a i e nanopa icles. Med. Sci. Moni . 2020,26, e919716. [C ossRe ] [PubMed]
260.
Iung, J.; Doyen, A.; Remonde o, G.; Poulio , Y.; B isson, G. The a ini y o milk a globule memb ane agmen s and bu e milk
p o eins o hyd oxyapa i e. J. Dai y Sci. 2024,107, 4235–4247.
261.
Qin, D.; Wang, N.; You, X.G.; Zhang, A.D.; Chen, X.G.; Liu, Y. Collagen-based biocomposi es inspi ed by bone hie a chical
s uc u es o ad anced bone egene a ion: Ongoing esea ch and pe spec i es. Bioma e . Sci. 2022,10, 318–353. [C ossRe ]
262.
Schickle, K.; Zu linden, K.; Be gmann, C.; Lindne , M.; Ki s en, A.; Laub, M.; Telle, R.; Jennissen, H.; Fische , H. Syn hesis o no el
icalcium phospha e-bioac i e glass composi e and unc ionaliza ion wi h hBMP-2. J. Ma e . Sci.: Ma e . Med. 2011,22, 763–771.
[C ossRe ]
263.
Cuylea , D.L.; Elghazali, N.A.; Kapila, S.D.; Desai, T.A. Calcium phospha e deli e y sys ems o egene a ion and biomine aliza-
ion o mine alized issues o he c anio acial complex. Mol. Pha m. 2023,20, 810–828. [C ossRe ] [PubMed]
264.
Ripamon i, U.; Dua e, R. Mechanis ic insigh s in o he spon aneous induc ion o bone o ma ion. Bioma e . Ad . 2024,158, 213795.
[C ossRe ] [PubMed]
Molecules 2024,29, 4479 36 o 39
265.
Fu, C.; Wang, Z.; Zhou, X.; Hu, B.; Li, C.; Yang, P. P o ein-based bioac i e coa ings: F om nanoa chi ec onics o applica ions. Chem.
Soc. Re . 2024,53, 1514–1551. [C ossRe ] [PubMed]
266.
Yuca, E.; Ka a as, A.Y.; Seke , U.O.S.; Gungo mus, M.; Dinle -Doganay, G.; Sa ikaya, M.; Tame le , C.
In i o
labeling o
hyd oxyapa i e mine als by an enginee ed p o ein. Bio echnol. Bioeng. 2011,108, 1021–1030. [C ossRe ]
267.
Fe nane, F.; Meche i, M.O.; Sha ock, P.; Fiallo, M.; Sipos, R. Hyd oxyapa i e in e ac ions wi h coppe complexes. Ma e . Sci. Eng.
C2010,30, 1060–1064. [C ossRe ]
268.
Mou, P.; Peng, H.; Zhou, L.; Li, L.; Li, H.; Huang, Q. A no el composi e sca old o Cu-doped nano calcium-de icien
hyd oxyapa i e/mul i-(amino acid) copolyme o bone issue egene a ion. In . J. Nanomed. 2019,14, 3331–3343. [C oss-
Re ]
269.
Honda, Y.; Anada, T.; Mo imo o, S.; Suzuki, O. Labile Zn ions on oc acalcium phospha e-de i ed Zn-con aining hyd oxyapa i e
su aces. Appl. Su . Sci. 2013,273, 343–348. [C ossRe ]
270.
Gangu, K.K.; Maddila, S.; Maddila, S.N.; Jonnalagadda, S.B. Nanos uc u ed sama ium doped luo apa i es and hei ca aly ic
ac i i y owa ds syn hesis o 1,2,4- iazoles. Molecules 2016,21, 1281. [C ossRe ]
271.
Gangu, K.K.; Maddila, S.; Maddila, S.N.; Jonnalagadda, S.B. E icien syn he ic ou e o hio- iazole de i a i es ca alyzed by
i on doped luo apa i e. Res. Chem. In e med. 2017,43, 1793–1811. [C ossRe ]
272.
Gangu, K.K.; Maddila, S.N.; Maddila, S.; Jonnalagadda, S.B. A s udy on beha io al in luence o glu amic acid and his idine on
mo phology and luo escence ac i i y o cadmium-doped luo apa i e. J. Alloys Compd. 2017,690, 817–824. [C ossRe ]
273.
Ch issan hopoulos, A.; Klou as, N.; N ala, C.; Se as os, D.; Dalas, E. Inhibi ion o hyd oxyapa i e o ma ion in he p esence o
i anocene–aminoacid complexes: An expe imen al and compu a ional s udy. J. Ma e . Sci. Ma e . Med. 2015,26, 15. [C ossRe ]
[PubMed]
274.
Huan, W.; Xing, M.; Cheng, C.; Li, J. Facile ab ica ion o magne ic me al-o ganic amewo k nano ibe s o speci ic cap u e o
phospho yla ed pep ides. ACS Sus ain. Chem. Eng. 2019,7, 2245–2254. [C ossRe ]
275.
Fa inas, C.S.; Reis, P.C.; Fe az, H.C.; Salim, V.M.M.; Al es, T.L.M. Adso p ion o myoglobin on o hyd oxyapa i e modi ied wi h
me al ions. Adso p . Sci. Technol. 2007,25, 717–727. [C ossRe ]
276.
Kalidas, S.; Suma hi, S. Coppe subs i u ed hyd oxyapa i e ein o ced gela in/poly inyl alcohol/silk ib e-based sca old o
bone issue enginee ing applica ion. Ma e . Chem. Phys. 2024,320, 129410. [C ossRe ]
277.
Dowd, T.L.; Rosen, J.F.; Gundbe g, C.M.; Gup a, R.K. The displacemen o calcium om os eocalcin a submic omola concen a-
ions o ee lead. BBA Mol. Basis Dis. 1994,1226, 131–137. [C ossRe ] [PubMed]
278.
Vukomano i´c, M.; Loga , M.; Škapin, S.D.; Su o o , D. Hyd oxyapa i e/gold/a ginine: Designing he s uc u e o c ea e
an ibac e ial ac i i y. J. Ma e . Chem. B 2014,2, 1557–1564. [C ossRe ]
279.
Cao, B.; Yang, M.; Mao, C. Phage as a gene ically modi iable sup amac omolecule in chemis y, ma e ials and medicine. Acc.
Chem. Res. 2016,49, 1111–1120. [C ossRe ]
280.
Rau a ay, D.; Mandal, S.; Sas y, M. Syn hesis o hyd oxyapa i e c ys als using amino acid-capped gold nanopa icles as a sca old.
Langmui 2005,21, 5185–5191. [C ossRe ]
281.
Meisel, C.L.; Bainb idge, P.; Mi sou as, D.; Wong, J.Y. Ta ge ed nanopa icle binding o hyd oxyapa i e in a high se um en i on-
men o ea ly de ec ion o hea disease. ACS Appl. Nano Ma e . 2018,1, 4927–4939. [C ossRe ]
282.
Zhang, O.L.; Niu, J.Y.; Yin, I.X.; Yu, O.Y.; Mei, M.L.; Chu, C.H. Bioac i e ma e ials o ca ies managemen : A li e a u e e iew.
Den . J. 2023,11, 59. [C ossRe ]
283.
Pede sen, S.Ø.; S øchkel, K.; Bysko , C.S.; Baggesen, L.M.; Nielsen, S.B. Gas-phase spec oscopy o p o ona ed adenine, adenosine
5´-monophospha e and monohyd a ed ions. Phys. Chem. Chem. Phys. 2013,15, 19748–19752. [C ossRe ] [PubMed]
284.
Le ene, P.A.; Bass, L.W.; Simms, H.S. The ioniza ion o py imidines in ela ion o he s uc u e o py imidine nucleosides. J. Biol.
Chem. 1926,70, 229–241. [C ossRe ]
285.
Wie zchowski, K.L.; Li onska, E.; Shuga , D. In a ed and ul a iole s udies on he au ome ic equilib ia in aqueous medium
be ween monoanionic species o u acil, hymine, 5- luo ou acil, and o he 2,4-dike opy imidines. J. Am. Chem. Soc. 1965,87,
4621–4629. [C ossRe ]
286.
Sigel, H. Acid-base p ope ies o pu ine esidues and he e ec o me al ions: Quan i ica ion o a e nucleobase au ome s. Pu e
Appl. Chem. 2004,76, 1869–1886. [C ossRe ]
287.
Lippe , B. Al e a ions o nucleobase pK
a
alues upon me al coo dina ion: O igins and consequences. In P og ess in Ino ganic
Chemis y; Ka lin, K.D., Ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2005; Volume 54, pp. 385–447.
288.
Roy, B.; Depaix, A.; Pe igaud, C.; Pey o es, S. Recen ends in nucleo ide syn hesis. Chem. Re . 2016,116, 7854–7897. [C ossRe ]
289.
Mucha, A.; Knobloch, B.; Je˙
zowska-Bojczuk, M.; Kozłowski, H.; Sigel, R.K.O. Compa ison o he acid–base p ope ies o ibose
and 2′-deoxy ibose nucleo ides. Chem. Eu . J. 2008,14, 6663–6671. [C ossRe ]
290.
Sigel, H.; Massoud, S.S.; Nicolas, A.C. Compa ison o he ex en o mac ochela e o ma ion in complexes o di alen me al ions
wi h guanosine (GMP
2-
), inosine (IMP
2-
), and adenosine 5
′
-monophospha e (AMP
2-
). The c ucial ole o N-7 basici y in me al
ion-nucleic base ecogni ion. J. Am. Chem. Soc. 1994,116, 2958–2971. [C ossRe ]
291.
Sigel, H.; Lippe , B. The e ec s o N7-coo dina ed cis-diammine-pla inum(II) on he acid-base p ope ies o guanine de i a i es.
Pu e Appl. Chem. 1998,70, 845–854. [C ossRe ]

Molecules 2024,29, 4479 37 o 39
292.
Song, B.; Feldmann, G.; Bas ian, M.; Lippe , B.; Sigel, H. Acid-base and me al ion-binding p ope ies o 2
′
-deoxycy idine 5
′
-
monophospha e (dCMP
2-
) alone and coo dina ed cis-diammine-pla inum(II). Fo ma ion o mixed me al ion nucleo ide complexes.
Ino g. Chim. Ac a 1995,235, 99–109. [C ossRe ]
293.
Massoud, S.S.; Sigel, H. Me al ion coo dina ing p ope ies o py imidine-nucleoside 5
′
-monophospha es (CMP, UMP, TMP) and
o simple phospha e monoes e s, including D- ibose 5-monophospha e. Es ablishmen o ela ions be ween complex s abili y and
phospha e basici y. Ino g. Chem. 1988,27, 1447–1453. [C ossRe ]
294.
Bianchi, E.M.; G iesse , R.; Sigel, H. In luence o dec easing sol en pola i y (1,4-dioxane/wa e mix u es) on he acid-base and
coppe (II)-binding p ope ies o guanosine 5′-diphospha e. Hel . Chim. Ac a 2005,88, 406–425. [C ossRe ]
295.
Bianchi, E.M.; Sajadi, S.A.A.; Song, B.; Sigel, H. S abili ies and isome ic equilib ia in aqueous solu ion o monome ic me al ion
complexes o adenosine 5
′
-diphospha e (ADP
3-
) in compa ison wi h hose o adenosine 5
′
-monophospha e (AMP
2-
). Chem. Eu . J.
2003,9, 881–892. [C ossRe ]
296.
Sajadi, S.A.A.; Song, B.; G egáˇn, F.; Sigel, H. Acid-base and me al ion-coo dina ing p ope ies o py imidine-nucleoside 5
′
-
diphospha es (CDP, UDP, dTDP) and o se e al simple diphospha e monoes e s. Es ablishmen o ela ions be ween complex
s abili y and diphospha e basici y. Ino g. Chem. 1999,38, 439–448. [C ossRe ]
297.
Sigel, H.; Bianchi, E.M.; Co û, N.A.; Kinjo, Y.; T ibole , R.; Ma in, R.B. Acid–base p ope ies o he 5
′
- iphospha es o guanosine
and inosine (GTP
4-
and ITP
4-
) and o se e al ela ed nucleobase de i a i es. J. Chem. Soc. Pe kin T ans. 2 2001,4, 507–511.
[C ossRe ]
298.
Sigel, H.; T ibole , R.; Malini-Balak ishnan, R.; Ma in, R.B. Compa ison o he s abili ies o monome ic me al ion complexes
o med wi h adenosine 5
′
- iphospha e (ATP) and py imidine-nucleoside 5
′
- iphospha es (CTP, UTP, TTP) and e alua ion o he
isome ic equilib ia in he complexes o ATP and CTP. Ino g. Chem. 1987,26, 2149. [C ossRe ]
299.
K ane, S.M.; Glimche , M.J. T ansphospho yla ion om nucleoside di- and iphospha es by apa i e c ys als. J. Biol. Chem. 1962,9,
2991–2998. [C ossRe ]
300.
Ta es, D.R.; Reedy, R.C. A s uc u al basis o ansphospho yla ion o nucleo ides wi h hyd oxyapa i e. Calc. Tiss. Res. 1969,3,
284–292. [C ossRe ]
301. O iss, I.R.; A ne , T.R.; Russell, G.G. Py ophospha e: A key inhibi o o mine aliza ion. Cu . Opin. Bio echnol. 2016,28, 57–68.
302.
Benede i, M.; An onucci, D.; De Cas o, F.; Gi elli, C.R.; Lelli, M.; Ro e i, N.; Fanizzi, F.P. Me ala ed nucleo ide chemiso p ion on
hyd oxyapa i e. J. Ino g. Biochem. 2015,153, 279–283. [C ossRe ]
303.
Wa son, J.D.; C ick, F.H.C. Molecula s uc u e o nucleic acids: A s uc u e o deoxy ibose nucleic acid. Na u e 1953,171,
737–738. [C ossRe ]
304. Be na di, G. Ch oma og aphy o nucleic acids on hyd oxyapa i e. Na u e 1965,206, 779–783. [C ossRe ] [PubMed]
305.
Be na di, G. Ch oma og aphy o nucleic acids on hyd oxyapa i e. III. Ch oma og aphy o RNA and poly ibonucleo ides. Biochim.
Biophys. Ac a 1969,174, 449–457. [C ossRe ]
306.
Bas ia, D.; Chiang, K.S.; Swi , H.; Sie sma, P. He e ogenei y, complexi y, and epe i ion o he chlo oplas DNA o Chlamydomonas
einha d ii. P oc. Na l. Acad. Sci. USA 1971,68, 1157–1161. [C ossRe ] [PubMed]
307.
Wi elsbe ge , S.C.; Hansen, J.N. Hyd oxyapa i e ch oma og aphy o sho single-s anded DNA. BBA Sec . Nucleic Acids P o ein
Syn h. 1979,565, 125–130. [C ossRe ]
308.
And ews-P annkoch, C.; Fad osh, D.W.; Tho pe, J.; Williamson, S.J. Hyd oxyapa i e-media ed sepa a ion o double-s anded
DNA, single-s anded DNA, and RNA genomes om na u al i al assemblages. Appl. En i on. Mic obiol. 2010,76, 5039–5045.
[C ossRe ] [PubMed]
309.
G aham, F.L.; an de Eb, A.J. A new echnique o he assay o in ec i i y o human adeno i us 5 DNA. Vi ology 1973,52, 456–467.
[C ossRe ]
310.
Xing, Z.; Chen, S.; Liu, Z.; Yang, X.; Zhu, X.; Zhang, X. Ha nessing he powe o hyd oxyapa i e nanopa icles o gene he apy.
Appl. Ma e . Today 2024,39, 102317. [C ossRe ]
311.
Ridi, F.; Meazzini, I.; Cas o lo io, B.; Bonini, M.; Be i, D.; Baglioni, P. Func ional calcium phospha e composi es in nanomedicine.
Ad . Colloid In e ace Sci. 2017,244, 281–295. [C ossRe ] [PubMed]
312.
G unenwald, A.; Keyse , C.; Sau e eau, A.M.; C ubézy, E.; Ludes, B.; D oue , C. Adso p ion o DNA on biomime ic apa i es:
Towa d he unde s anding o he ole o bone and oo h mine al on he p ese a ion o ancien DNA. Appl. Su . Sci. 2014,292,
867–875. [C ossRe ]
313.
Oyane, A.; Yazaki, Y.; A aki, H.; Sogo, Y.; I o, A.; Yamazaki, A.; Tsu ushima, H. Fab ica ion o a DNA-lipid-apa i e composi e
laye o e icien and a ea-speci ic gene ans e . J. Ma e . Sci. Ma e . Med. 2012,23, 1011–1019. [C ossRe ]
314.
Yazaki, Y.; Oyane, A.; Tsu ushima, H.; A aki, H.; Sogo, Y.; I o, A.; Yamazaki, A. Cop ecipi a ion o DNA-lipid complexes wi h
apa i e and compa ison wi h supe icial adso p ion o gene ans e applica ions. J. Bioma e . Appl. 2014,28, 937–945. [C ossRe ]
[PubMed]
315.
Wang, X.; I o, A.; Li, X.; Sogo, Y.; Hi ose, M.; Oyane, A.; Tsu ushima, H. DNA-lipid-apa i e composi e laye s enhance gene
exp ession o mesenchymal s em cells. Ma e . Sci. Eng. C 2013,33, 512–518. [C ossRe ]
316.
Gibbs, D.; Loh mann, R.; O gel, L.E. Templa e-di ec ed syn hesis and selec i e adso p ion o oligoadenyla es on hyd oxyapa i e.
J. Mol. E ol. 1980,15, 347–354. [C ossRe ]
317.
Ma inson, H.G. The basis o ac iona ion o single-s anded nucleic acids on hyd oxylapa i e. Biochemis y 1973,12, 2731–2736.
[C ossRe ] [PubMed]
Molecules 2024,29, 4479 38 o 39
318.
Fad osh, D.W.; And ews-P annkoch, C.; Williamson, S.J. Sepa a ion o single-s anded DNA, double-s anded DNA and RNA
om an en i onmen al i al communi y using hyd oxyapa i e ch oma og aphy. J. Vis. Exp. 2011,55, e3146. [C ossRe ]
319.
Shla e man, J.; Paige, A.; Mese e, K.; Miech, J.A.; Ge don, A.E. Selec ed DNA ap ame s in luence kine ics and mo phology in
calcium phospha e mine aliza ion. ACS Bioma e . Sci. Eng. 2019,5, 3228–3236. [C ossRe ]
320. Wu, Y.X.; Kwon, Y.J. Ap ame s: The “e olu ion” o SELEX. Me hods 2016,106, 21–28. [C ossRe ] [PubMed]
321.
Du y, E.; Flo ek, J.; Colon, S.; Ge don, A.E. Selec ed DNA ap ame s as hyd oxyapa i e a ini y eagen s. Anal. Chim. Ac a 2020,
1110, 115–121. [C ossRe ]
322. Cla ke, M.J.; Taube, H. Pen aammine u henium-guanine complexes. J. Am. Chem. Soc. 1974,96, 5413–5419. [C ossRe ]
323.
Chu, G.Y.H.; Mansy, S.; Duncan, R.E.; Tobias, R.S. Hea y me al nucleo ide in e ac ions. 11. S e eochemical and elec onic e ec s
in he elec ophilic a ack o cis- and ans-diamminepla inum(II) on 5
′
-guanosine monophospha e and polyguanyla e in aqueous
solu ion. J. Am. Chem. Soc. 1978,100, 593. [C ossRe ]
324. Sigel, H. Komplexbildung on nucleinbasen mi Cu2+.Eu . J. Biochem. 1968,3, 530–537. [C ossRe ] [PubMed]
325. Sigel, H. Zu ka ala ischen und pe oxida ischen ak i i ä on Cu2+-komplexen. Angew. Chem. 1969,81, 161–171. [C ossRe ]
326.
Sigel, H. Nucleic base-me al ion in e ac ions. Acidi y o he N(1) o N(3) p o on in bina y and e na y complexes o Mn
2+
,
Ni
2+
, and Zn
2+
wi h he 5
′
- iphospha es o inosine, guanosine, u idine, and hymidine. J. Am. Chem. Soc. 1975,97, 3209–3214.
[C ossRe ]
327.
Ca adonna, J.P.; Lippa d, S.J. Syn hesis and cha ac e iza ion o [d(ApGpGpCpCpT)]
2
and i s adduc wi h he an icance d ug
cis-diamminedichlo opla inum(II). Ino g. Chem. 1988,27, 1454–1466. [C ossRe ]
328.
Ga de en, C.J.; Al ona, C.; Reedijk, J. Con o ma ional changes in a single- and double-s anded nonanucleo ide upon complexa ion
o a mono unc ional pla inum compound as s udied by p o on NMR, phospho us-31 NMR and CD me hods. Ino g. Chem. 1990,
29, 1481–1487. [C ossRe ]
329.
Liu, Y.; Paci ico, C.; Na ile, G.; Sle en, E. An i umo ans pla inum complexes can o m c oss-links wi h adjacen pu ine g oups.
Angew. Chem. In . Ed. 2001,40, 1226–1228. [C ossRe ]
330.
Meshkini, A.; Sis anipou , E.; O eisi, H.; Asoodeh, A. Induc ion o os eogenesis in bone umou cells by pu ine-conjuga ed
zinc-hyd oxyapa i e. Bioinspi ed Biomim. Nanobioma e . 2021,10, 16–27. [C ossRe ]
331.
Zeng, G.; Liu, M.; Heng, C.; Huang, Q.; Mao, L.; Huang, H.; Hui, J.; Deng, F.; Zhang, X.; Wei, Y. Su ace polyPEGyla ion o Eu
3+
doped luminescen hyd oxyapa i e nano ods h ough he combina ion o ligand exchange and me al ee su ace ini ia ed a om
ans e adical polyme iza ion. Appl. Su . Sci. 2017,399, 499–505. [C ossRe ]
332.
Uskoko i´c, V. When 1 + 1 > 2: Nanos uc u ed composi es o ha d issue enginee ing applica ions. Ma e . Sci. Eng. C 2015,57,
434–451. [C ossRe ]
333.
Chang, Q.; Li, K.K.; Hu, S.L.; Dong, Y.G.; Yang, J.L. Hyd oxyapa i e suppo ed N-doped ca bon quan um do s o isible-ligh
pho oca alysis. Ma e . Le . 2016,175, 44–47. [C ossRe ]
334.
Picci illo, C.; Cas o, P.M.L. Calcium hyd oxyapa i e-based pho oca alys s o en i onmen emedia ion: Cha ac e is ics, pe o -
mances and u u e pe spec i es. J. En i on. Manag. 2017,193, 79–91. [C ossRe ] [PubMed]
335.
Calab ese, G.; Pe alia, S.; F anco, D.; Noci o, G.; Fabbi, C.; Fo e, L.; Guglielmino, S.; Squa zoni, S.; T aina, F.; Conoci, S. A new
Ag-nanos uc u ed hyd oxyapa i e po ous sca old: An ibac e ial e ec and cy o oxici y s udy. Ma e . Sci. Eng. C 2021,118,
111394. [C ossRe ] [PubMed]
336.
Mon e, J.P.; Fon es, A.; San os, B.S.; Pe ei a, G.A.L.; Pe ei a, G. Recen ad ances in hyd oxyapa i e/polyme /sil e nanopa icles
sca olds wi h an imic obial ac i i y o bone egene a ion. Ma e . Le . 2023,338, 134027. [C ossRe ]
337.
Inam, H.; Sp io, S.; Ta oni, M.; Abbas, Z.; Pupilli, F.; Tampie i, A. Magne ic hyd oxyapa i e nanopa icles in egene a i e medicine
and nanomedicine. In . J. Mol. Sci. 2024,25, 2809. [C ossRe ] [PubMed]
338.
Fa azin, A.; Mahjoubi, S. Dual- unc ional hyd oxyapa i e sca olds o bone egene a ion and p ecision d ug deli e y. J. Mech.
Beha . Biomed. Ma e . 2024,157, 106661. [C ossRe ]
339.
Gong, Y.; Gan, Y.; Wang, P.; Gong, C.; Han, B.; Li, P.; Liu, E.; Yu, Z.; Sheng, L.; Wang, X. Injec able oam-like sca olds elease
glucose oxidase-in eg a ed me al–o ganic amewo k hyb ids o diabe ic bone de ec s. Appl. Ma e . Today 2024,38, 102190.
[C ossRe ]
340.
Mush aq, A.; Zhang, H.; Cui, M.; Lin, X.; Huang, S.; Tang, Z.; Hou, Y.; Iqbal, M.Z.; Kong, X. ROS- esponsi e chlo in e6 and silk
ib oin loaded ul a hin magne ic hyd oxyapa i e nano ods o T1-magne ic esonance imaging guided pho odynamic he apy
in i o. Colloids Su aces A Physicochem. Eng. Asp. 2023,656, 130513. [C ossRe ]
341.
Li, X.; Zou, Q.; Chen, L.; Li, W. A e na y doped single ma ix ma e ial wi h dual unc ions o bone epai and mul imodal
acking o applica ions in o hopedics and den is y. J. Ma e . Chem. B 2018,6, 6047–6056. [C ossRe ]
342.
Meye s, M.A.; Chen, P.Y.; Lin, A.Y.M.; Seki, Y. Biological ma e ials: S uc u e and mechanical p ope ies. P og. Ma e . Sci. 2008,53,
1–206. [C ossRe ]
343.
He, B.; Zhao, J.; Ou, Y.; Jiang, D. Bio unc ionalized pep ide nano ibe -based composi e sca olds o bone egene a ion. Ma e . Sci.
Eng. C 2018,90, 728–738. [C ossRe ]
344.
Bai, X.; Gao, M.; Syed, S.; Zhuang, J.; Xu, X.; Zhang, X.Q. Bioac i e hyd ogels o bone egene a ion. Bioac . Ma e . 2018,3, 401–417.
[C ossRe ] [PubMed]
345.
Ozimek, J.; Łukaszewska, I.; Pielichowski, K. POSS and SSQ ma e ials in den al applica ions: Recen ad ances and u u e
ou looks. In . J. Mol. Sci. 2023,24, 4493. [C ossRe ] [PubMed]
Molecules 2024,29, 4479 39 o 39
346.
Baue , I.W.; Li, S.P.; Han, Y.C.; Yuan, L.; Yin, M.Z. In e naliza ion o hyd oxyapa i e nanopa icles in li e cance cells. J. Ma e . Sci.
Ma e . Med. 2008,19, 1091–1095. [C ossRe ]
347.
Xu, D.; Wan, Y.; Li, Z.; Wang, C.; Zou, Q.; Du, C.; Wang, Y. Tailo able hie a chical s uc u es o biomime ic hyd oxyapa i e
mic o/nano pa icles p omo ing endocy osis and os eogenic di e en ia ion o s em cells. Bioma e . Sci. 2020,8, 3286–3300.
[C ossRe ]
348.
Zhu, C.; Zhou, X.; Liu, Z.; Chen, H.; Wu, H.; Yang, X.; Zhu, X.; Ma, J.; Dong, H. The mo phology o hyd oxyapa i e nanopa icles
egula es ca go ecogni ion in cla h in-media ed endocy osis. F on . Mol. Biosci. 2021,8, 627015. [C ossRe ] [PubMed]
349.
I ia e, E.; Ga cía-Tojal, J.; San ana, J.; Jo ge-Villa , S.E.; Tei a, L.; Muñiz, J.; Ibañez, J.J. Geochemical and spec oscopic app oach o
he cha ac e iza ion o ea lies c ema ed human bones om he Le an (PPNB o Kha aysin, Jo dan). J. A chaeol. Sci. Rep. 2020,
30, 102211. [C ossRe ]
350. Gilbe , W. The RNA wo ld. Na u e 1986,319, 618. [C ossRe ]
351.
Ruiz-Mi azo, K.; B iones, C.; De La Escosu a, A. P ebio ic sys ems chemis y: New pe spec i es o he o igins o li e. Chem. Re .
2014,114, 285–366. [C ossRe ]
352.
D oue , C.; Au ay, M.; Rollin-Ma ine , S.; Vandecandelaè e, N.; G ossin, D.; Rossignol, F.; Champion, E.; Na o sky, A.; Rey, C.
Nanoc ys alline apa i es: The undamen al ole o wa e . Am. Mine al. 2018,103, 550–564. [C ossRe ]
353. Ca e , O.W.L.; Xu, Y.; Sadle , P.J. Mine als in biology and medicine. RSC Ad . 2021,11, 1939–1951. [C ossRe ]
354.
Luo, Y.; Liu, H.; Zhang, Y.; Liu, Y.; Liu, S.; Liu, X.; Luo, E. Me al ions: The un ading s a s o bone egene a ion- om bone
me abolism egula ion o bioma e ial applica ions. Bioma e . Sci. 2023,11, 7268–7295. [C ossRe ] [PubMed]
355.
Lin, K.; Wu, C.; Chang, J. Ad ances in syn hesis o calcium phospha e c ys als wi h con olled size and shape. Ac a Bioma e . 2014,
10, 4071–4102. [C ossRe ] [PubMed]
356.
Ellingham, S.T.D.; Thompson, T.J.U.; Islam, M.; Taylo , G. Es ima ing empe a u e exposu e o bu n bone—A me hodological
e iew. Sci. Jus ice 2015,55, 181–188. [C ossRe ] [PubMed]
357.
Haide , A.; Haide , S.; Han, S.S.; Kang, I.K. Recen ad ances in he syn hesis, unc ionaliza ion and biomedical applica ions o
hyd oxyapa i e: A e iew. RSC Ad . 2017,7, 7442–7458. [C ossRe ]
358.
Maia, M.T.; Luz, É.P.C.G.; And ade, F.K.; Rosa, M.d.F.; Bo ges, M.d.F.; A canjo, M.R.A.; Viei a, R.S. Ad ances in Bac e ial
cellulose/s on ium apa i e composi es o bone applica ions. Polym. Re . 2021,61, 736–764. [C ossRe ]
359.
Muni , M.U.; Salman, S.; Ihsan, A.; Elsaman, T. Syn hesis, cha ac e iza ion, unc ionaliza ion and bio-applica ions o hyd oxyap-
a i e nanoma e ials: An o e iew. In . J. Nanomed. 2022,17, 1903–1925. [C ossRe ]
360.
Deng, Z.; Jia, Z.; Li, L. Biomine alized ma e ials as model sys ems o s uc u al composi es: In ac ys alline s uc u al ea u es
and hei s eng hening and oughening mechanisms. Ad . Sci. 2022,9, 2103524. [C ossRe ]
Disclaime /Publishe ’s No e: The s a emen s, opinions and da a con ained in all publica ions a e solely hose o he indi idual
au ho (s) and con ibu o (s) and no o MDPI and/o he edi o (s). MDPI and/o he edi o (s) disclaim esponsibili y o any inju y o
people o p ope y esul ing om any ideas, me hods, ins uc ions o p oduc s e e ed o in he con en .