171
A new species o he genus Lep ob achella (Amphibia, Anu a,
Megoph yidae) om he Da ongshan Na u e Rese e,
Guangxi, China
Wei-Cai Chen1,2 , Yong-Jian Bei3,4, Peng Li1
1 Key Labo a o y o En i onmen Change and Resou ces Use in Beibu Gul Minis y o Educa ion, Nanning No mal Uni e si y, Nanning 530001, China
2 Guangxi Key Labo a o y o Ea h Su ace P ocesses and In elligen Simula ion, Nanning No mal Uni e si y, Nanning 530001, China
3 College o Biology and Pha macy, Yulin No mal Uni e si y, Yulin 537000, China
4 Key Labo a o y o Moun ain Biodi e si y Conse a ion, Educa ion Depa men o Guangxi Zhuang Au onomous Region, Yulin No mal Uni e si y, Yulin 537000, China
Co esponding au ho s: Wei-Cai Chen ([email p o ec ed]); Yong-Jian Bei ([email p o ec ed])
Copy igh : © Wei-Cai Chen e al.
This is an open access a icle dis ibu ed unde
e ms o he C ea i e Commons A ibu ion
License (A ibu ion 4.0 In e na ional – CC BY 4.0).
Resea ch A icle
Abs ac
A new species o he genus Lep ob achella, L. da ongshanensis sp. no ., is desc ibed
om he Da ongshan Na u e Rese e, Yulin Ci y, Guangxi, China, in eg a ing molecu-
la , mo phological, and bioacous ic e idence. The new species can be dis inguished
om i s congene s by a combina ion o he ollowing cha ac e s: (1) medium body
size (SVL 24.9–27.7 mm in males; 32.0–35.4 mm in emales); (2) do sal skin ough
wi h small, aised ube cles and idges; (3) en al su ace c eamy whi e wi h minu e
i egula ex u es and iny pale b own spo s la e ally on he belly; (4) lanks bea ing
i egula black spo s; (5) dis inc black sup a ympanic line; (6) udimen a y oe web-
bing on oes I–IV and absence o la e al de mal inges on oes; (7) dis inc , con in-
uous en ola e al glandula line; (8) i is bicolo ed, uppe hal ange ine, lowe hal
sil e wi h black e icula ions, pupil black wi h ange ine edges; (9) ibio a sal a icu-
la ion eaching he pos e io ma gin o he eye when adp essed; (10) ad e isemen
calls wi h dominan equencies o 6.1–6.7 kHz a 20.0 °C. Phylogene ic analyses
based on he mi ochond ial 16S RNA gene indica e ha L. da ongshanensis sp. no .
and L. shiwandashanensis a e sis e axa. The new species is cu en ly known only
om mon ane e e g een o es s a ele a ions be ween 800 and 1,200 m wi hin he
Da ongshan Na u e Rese e, whe e i is sympa ic wi h L. yunkaiensis.
Key wo ds: Bioacous ics, mo phology, phylogeny, sympa ic dis ibu ion, axonomy
In oduc ion
The genus Lep ob achella Smi h, 1925 is widely dis ibu ed ac oss sou he n
China, no heas e n India, Myanma , Thailand, Vie nam, Peninsula Malaysia,
Bo neo, and Na una Island (F os 2024). Cu en ly comp ising 110 species, 45
occu in China (AmphibiaChina 2025). Recen yea s ha e seen a su ge in de-
sc ip ions o new Lep ob achella species, indica ing ha he di e si y o his
genus emains unde es ima ed. Mos species occupy specialized mic ohabi-
a s, such as headwa e s eams in mon ane o es s. Thei small body size and
c yp ic habi s make hem challenging o loca e in he ield.
Academic edi o : An hony He el
Recei ed:
8 June 2025
Accep ed:
28 Oc obe 2025
Published:
19 No embe 2025
ZooBank: h ps://zoobank.
o g/0F8F8B32-7095-45BC-806B-
71854F223827
Ci a ion: Chen W-C, Bei Y-J, Li P
(2025) A new species o he genus
Lep ob achella (Amphibia, Anu a,
Megoph yidae) om he Da ongshan
Na u e Rese e, Guangxi, China.
ZooKeys 1260: 171–194. h ps://doi.
o g/10.3897/zookeys.1260.161514
ZooKeys 1260: 171–194 (2025)
DOI: 10.3897/zookeys.1260.161514
172
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
The Da ongshan Na u e Rese e is loca ed in Yulin Ci y, Guangxi, China. I
encompasses he Da ongshan moun ain ange, wi h Lo us Peak eaching he
highes ele a ion o 1,275.6 m. Si ua ed on he sou he n edge o he Sou h
Sub opical Monsoon Clima e Zone, he ese e is p edominan ly co e ed by
monsoon e e g een b oad-lea ed o es s. The annual a e age empe a u e
anges om 16.8 °C o 19.6 °C (July a e age: 26.1 °C). Annual p ecipi a ion
is 1,800–2,200 mm, p ima ily be ween June and Sep embe , wi h an a e age
annual ela i e humidi y o 82.8% (Zheng and Qin 2022).
Du ing amphibian su eys conduc ed om 2023 o 2025 wi hin he Da ong-
shan Na u e Rese e, wo mo pho ypes o Lep ob achella we e encoun e ed.
No species o Lep ob achella had been p e iously epo ed om his ese e.
Phylogene ic analysis using he mi ochond ial 16S RNA gene e ealed ha
one mo pho ype (he ea e e e ed o as he pu a i e new species) o med a
sis e clade o L. shiwandashanensis Chen, Peng, Pan, Liao, Liu & Huang, 2021,
while he o he mo pho ype clus e ed closely wi h L. yunkaiensis Wang, Li,
Lyu & Wang, 2018. Mo phological cha ac e iza ion and bioacous ic analyses
demons a ed signi ican di e ences be ween he pu a i e new species and L.
shiwandashanensis, suppo ing i s ecogni ion as a dis inc species. The sec-
ond mo pho ype showed only mino mo phological di e gence om L. yunk-
aiensis, bu due o he lack o ocal compa isons wi h opo ypic L. yunkaiensis,
we conse a i ely iden i y i as L. c . yunkaiensis.
Ma e ial and me hods
Sampling
Twen y- h ee adul specimens we e collec ed wi hin he Da ongshan Na u e
Rese e, Yulin Ci y, Guangxi, China (Fig. 1). Specimens we e eu hanized using
iso lu ane, ixed in 10% o malin, and subsequen ly s o ed in 75% e hanol as
ouche s deposi ed a Nanning No mal Uni e si y (NNU). Muscle issue sam-
ples we e p ese ed in 100% e hanol o molecula analysis.
Figu e 1. Locali ies o he new species, L. shiwandashanensis, and L. yunkaiensis.
China
Vie nam
Guangxi
Guangdong
L. da ongshanensis sp. no .
L. shiwandashanensis
L. yunkaiensis
N
Da ongshan Rese e
Dawuling, Guangdong (Type locali y)
Ehuangzhang ese e, Guangdong
Lidong, Guangxi
Da ongshan ese e, Guangxi
173
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Mo phological compa isons
Compa a i e mo phological da a we e ob ained om he li e a u e (Suppl.
ma e ial 2: able S1) and museum specimens (Suppl. ma e ial 2: able S2).
Fou een mo phological cha ac e s we e measu ed using digi al calipe s o
he nea es 0.1 mm, ollowing Rowley e al. (2016): snou - en leng h (SVL),
head leng h (HL, om ip o snou o pos e io ma gin o jaw a icula ion),
head wid h (HW, maximum wid h be ween le and igh jaw a icula ions),
snou leng h (SNT, om ip o snou o an e io co ne o eye), eye diame-
e (ED, ho izon al diame e o exposed eyeball), in e o bi al dis ance (IOD,
sho es dis ance be ween an e io co ne s o o bi s), ho izon al ympanum
diame e (TD), in e na ial dis ance (IN, minimum dis ance be ween inne
ma gins o ex e nal na es), ibia leng h (TIB, om knee o a sus), o elimb
leng h (FLL, om elbow o ip o hi d inge ), leng h o oo and a sus (TFL,
om ibio a sal a icula ion o ip o oe IV), manus leng h (ML, om ip o
hi d digi o p oximal edge o inne palma ube cle), hindlimb leng h (HLL,
om ip o ou h oe o en ), and dis ance om p oximal edge o emo al
gland o knee (FG-knee). Sex was de e mined based on di ec obse a ion
o calling beha io in he ield o he p esence o in e nal ocal sac openings.
Molecula analyses
Genomic DNA was ex ac ed om issue samples using comme cial ki s
(Tiangen Bio ech Co. L d., Beijing, China). A agmen o he mi ochond ial 16S
RNA gene was ampli ied and sequenced ollowing Palumbi e al. (1991) using
p ime s 16Sa _L (5’–CGCCTGTTTACCAAAAACAT–3’) and 16Sb _H (5’–CCG-
GTCTGAACTCAG ATCACGT–3’). Polyme ase chain eac ion (PCR) condi ions
we e: ini ial dena u a ion a 94 °C o 5 min; 35 cycles o dena u a ion a 94
°C o 35 s, annealing a 58 °C o 40 s, ex ension a 72 °C o 40 s; inal ex-
ension a 72 °C o 10 min. PCR p oduc s we e sequenced di ec ly on an ABI
P ism 3730 au oma ed DNA sequence (Applied Biosys ems, USA). New se-
quences we e deposi ed in GenBank (Accession nos. PX480157–PX480169,
PX480170–PX480176).
Phylogene ic analyses employed Maximum Likelihood (ML) and Bayesian In-
e ence (BI). The bes - i nucleo ide subs i u ion model (GTR+F+I) was selec ed
using ModelFinde 2.2.0 (Kalyaanamoo hy e al. 2017) implemen ed in Phylo-
Sui e . 1.2.3 (Zhang e al. 2020), based on he Bayesian In o ma ion C i e ion
(BIC). ML analysis was pe o med in IQ- ee 2.2.2 (Nguyen e al. 2015) wi h 2000
ul a as boo s ap eplica es. BI was conduc ed using M Bayes . 3.2 (Ronquis
e al. 2012), unning wo independen analyses wi h ou Ma ko chains each
o 30 million gene a ions, sampling e e y 1000 gene a ions. The i s 25% o
sampled ees we e disca ded as bu n-in. Unco ec ed pai wise (p) dis ances
we e calcula ed in MEGA . 11 (Tamu a e al. 2021) using de aul se ings.
Bioacous ics analyses
Ad e isemen calls we e eco ded using a SONY PCM-A10 eco de . Ambien
ai empe a u e du ing eco dings was 20.0 °C, measu ed wi h a Deli LE505
hand-held wea he me e . Calls we e analyzed and isualized using Ra en P o
174
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
. 1.6.1 (Co nell Labo a o y o O ni hology, I haca, NY, USA). Spec og ams we e
gene a ed using a Fas Fou ie T ans o m (FFT) size o 512 poin s, 50% o e lap,
g id spacing o 172 Hz, and Hanning windows (Köhle e al. 2017).
Resul s
Molecula analyses
The inal alignmen consis ed o 126 sequences o he 16S RNA agmen (Table 1).
Bo h ML and BI analyses yielded simila ee opologies (Fig. 2). Specimens collec -
ed om Da ongshan o med wo dis inc monophyle ic lineages. One lineage, L.
da ongshanensis sp. no ., was s ongly suppo ed (BPP = 1.00, UFB = 100) as he
sis e axon o L. shiwandashanensis. The second lineage clus e ed wi hin spec-
imens iden i ied as L. yunkaiensis om i s ype locali y. Unco ec ed p-dis ances
be ween L. da ongshanensis sp. no . and L. shiwandashanensis anged om 2.6%
o 3.0%. Dis ances be ween he Da ongshan L. c . yunkaiensis specimens and o-
po ypic L. yunkaiensis anged om 1.4% o 2.7% (Suppl. ma e ial 2: able S3).
Bioacous ics
Ad e isemen calls o h ee indi iduals o L. da ongshanensis sp. no . and
h ee indi iduals o L. c . yunkaiensis we e eco ded a app oxima ely 20.0 °C.
The calls o L. da ongshanensis sp. no . di e ed signi ican ly om hose o he
sympa ic L. c . yunkaiensis in call du a ion (59.1–109.2 ms, mean ± SD: 77.9
± 14.5 ms, n = 75 calls s 25.8–46.6 ms, 35.6 ± 6.2 ms, n = 23), call in e al
(334.8–763.7 ms, 521.2 ± 106.7 ms, n = 74 in e als s 150.1–559.5 ms, 309.5
± 132.5 ms, n = 23), and dominan equency (6.1–6.7 kHz s 4.9–5.3 kHz).
The calls o L. da ongshanensis sp. no . also di e ed ma kedly om i s sis e
species, L. shiwandashanensis, in call du a ion (59.1–109.2 ms, 77.9 ± 14.5 ms,
n = 75 s 194.0–277.0 ms, 226.6 ± 16.4 ms, n = 80), call in e al (334.8–763.7
ms, 521.2 ± 106.7 ms, n = 74 s 134.0–186 ms, mean: 153.1 ms, n = 23), and
dominan equency (6.1–6.7 kHz s 5.3–5.7 kHz) (Table 2, Fig. 3).
Table 1. DNA sequences used in his s udy. ‘*’ ep esen s ype locali y.
ID Species Locali y Vouche no. 16S RNA Re e ence
1L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001152 PX480157 This s udy
2L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001153 PX480158 This s udy
3L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001157 PX480159 This s udy
4L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001158 PX480160 This s udy
5L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001159 PX480161 This s udy
6L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001160 PX480162 This s udy
7L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001161 PX480163 This s udy
8L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001390 PX480164 This s udy
9L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001391 PX480165 This s udy
10 L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001392 PX480166 This s udy
11 L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001393 PX480167 This s udy
12 L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001394 PX480168 This s udy
13 L. da ongshanensis sp. no . Da ongshan Na u e Rese e, Guangxi, China* NNU001395 PX480169 This s udy
175
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
ID Species Locali y Vouche no. 16S RNA Re e ence
14 L. shiwanshanensis M . Shiwandashan, Guangxi, China* NNU202103213 MZ326692 Chen e al. 2021a
15 L. shiwanshanensis M . Shiwandashan, Guangxi, China* NNU202103214 MZ326693 Chen e al. 2021a
16 L. shiwanshanensis M . Shiwandashan, Guangxi, China* NNU202103215 MZ326694 Chen e al. 2021a
17 L. shiwanshanensis M . Shiwandashan, Guangxi, China* NNU202103146 MZ326691 Chen e al. 2021a
18 L. shiwanshanensis M . Shiwandashan, Guangxi, China* NNU202103261 MZ326695 Chen e al. 2021a
19 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001147 PX480170 This s udy
20 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001148 PX480171 This s udy
21 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001149 PX480172 This s udy
22 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001150 PX480173 This s udy
23 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001151 PX480174 This s udy
24 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001155 PX480175 This s udy
25 L. c . yunkaiensis Da ongshan Na u e Rese e, Guangxi, China NNU001156 PX480176 This s udy
26 L. yunkaiensis Dawuling, Guangdong, China* SYS a004666 MH055933 Chen e al. 2018
27 L. yunkaiensis Lidong, Guangxi, China KIZ018211 MH055931 Chen e al. 2018
28 L. yunkaiensis Ehuangzhang Na u e Rese e, Guangdong, China KIZ047782 MH055932 Chen e al. 2018
29 L. yunkaiensis Dawuling, Guangdong, China* SYS a004663 MH605584 Wang e al. 2018
30 L. yunkaiensis Dawuling, Guangdong, China* SYS a004664 MH605585 Wang e al. 2018
31 L. yunkaiensis Dawuling, Guangdong, China* SYS a004665 MH605586 Wang e al. 2018
32 L. yunkaiensis Dawuling, Guangdong, China* SYS a004666 MH605587 Wang e al. 2018
33 L. yunkaiensis Dawuling, Guangdong, China* SYS a004667 MH605588 Wang e al. 2018
34 L. yunkaiensis Dawuling, Guangdong, China* SYS a004668 MH605589 Wang e al. 2018
35 L. yunkaiensis Dawuling, Guangdong, China* SYS a004669 MH605590 Wang e al. 2018
36 L. yunkaiensis Dawuling, Guangdong, China* SYS a004690 MH605591 Wang e al. 2018
37 L. ae ea Quang Binh, Vie nam ZFMK 86362 JN848409 Ohle e al. 2011
38 L. alpina Caiyanghe, Yunnan, China KIZ049024 MH055867 Chen e al. 2018
39 L. applebyi Phong Dien Na u e Rese e, Thua Thien-Hue, Vie nam KIZ010701 MH055947 Chen e al. 2018
40 L. a ayai Bo neo, Malaysia* AE100/S9 DQ642119 Vei h e al. 2006
41 L. a dens Kon Ka Kinh Na ional Pa k, Gia Lai, Vie nam* ZMMU-NAP-06099 MH055949 Chen e al. 2018
42 L. aspe a Huanglianshan Na u e Rese e, Lyuchun, Yunnan,
China* SYS a007743 MW046199 Wang e al. 2020
43 L. baluensis Sabah, Bo neo, Malaysia* SP 21604 LC056792 E o e al. 2015
44 L. bashaensis Basha Na u e Rese e, Guizhou, China* GIB196404 MW136295 Lyu e al. 2020
45 L. bidoupensis Bidoup-Nui Ba Na ional Pa k, Lam Dong, Vie nam* ZMMU-A-4797-01454 MH055945 Chen e al. 2018
46 L. bijie Bijie Ci y, Guizhou, China* SYS a007313 MK414532 Wang e al. 2020
47 L. bo s o di Lao Cai, Vie nam* AMS R 176540 MH055952 Chen e al. 2018
48 L. bou e i Mao’e Shan, Guangxi, China KIZ019389 MH055869 Chen e al. 2018
49 L. b e ic us Sa awak, Bo neo, Malaysia* ZMH A09365 KJ831302 Obe humme e al. 2014
50 L. chishuiensis Guizhou, China* CIBCS20190518047 MT117053 Li e al. 2020
51 L. c ocea Thua Thien-Hue, Vie nam ZMMU-NAP-02274 MH055955 Chen e al. 2018
52 L. damingshanensis Wuming Coun y, Guangxi, China* NNU202103281 MZ145229 Chen e al. 2021b
53 L. dayaoshanensis Dayaoshan, Jinxiu Coun y, Guangxi, China* NNU202103018 PQ476281 Yu e al. 2024
54 L. dong Tongdao Coun y, Hunan, China* CIB SSC1757 OP764530 Liu e al. 2023
55 L. do sospina Yushe Fo es Pa k, Shuicheng, Guizhou, China* SYS a004961 MW046194 Wang e al. 2020
56 L. d ingi Bo neo, Malaysia* KUHE:55610 AB847553 Ma sui e al. 2014a
57 L. eos Phongsaly, Laos* MNHN 2004.0274 JN848452 Ohle e al. 2011
58 L. eii Yunnan, China* KIZ048894 MT302634 Chen e al. 2020
59 L. i hi Kon Tum, Vie nam* AMS: R 176524 JQ739206 Rowley e al. 2012
60 L. la iglandulosa Xiaoqiaogou Na u e Rese e, Yunnan, China* KIZ016072 MH055934 Chen e al. 2018
61 L. i inniens Danum Valley Field Cen e , Sabah, Malaysia FMNH 244800 MH055971 Chen e al. 2018
62 L. uliginosa Phe chabu i, Thailand KUHE:20197 LC201988 Ma sui e al. 2017
63 L. g acilis Buki Kana, Sa awak, Malaysia FMNH 273682 MH055972 Chen e al. 2018
64 L. guinanensis Shangsi Coun y, Guangxi, China* NNU00557 OP548561 Chen e al. 2024
65 L. hamidi Bo neo, Malaysia* KUHE 17545 AB969286 Ma sui e al. 2014b
176
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
ID Species Locali y Vouche no. 16S RNA Re e ence
66 L. he e opus Peninsula , Malaysia KUHE 15487 AB530453 Ma sui e al. 2010
67 L. isos Gia Lai, Vie nam* AMS R 176480 KT824769 Rowley e al. 2015a
68 L. i iokai Gunung Mulu Na ional Pa k, Sa awak, Malaysia* KUHE:55897 LC137805 E o e al. 2016
69 L. jinshaensis Lengshuihe Na u e Rese e, Jinsha Coun y, Guizhou,
China* CIBJS20200516001 MT814014 Cheng e al. 2021
70 L. jinyunensis M . Jinyun, Beibei Dis ic , Chongqing, China* CIB 119039 OQ024778 Shi e al. 2023
71 L. juliand ingi Sa awak, Bo neo, Malaysia* KUHE 17557 LC056784 E o e al. 2015
72 L. kajangensis Tioman, Malaysia* LSUHC:4439 LC202002 Ma sui e al. 2017
73 L. kalonensis Binh Thuan, Vie nam* IEBR A.2014.15 KR018114 Rowley e al. 2015b
74 L. kecil Came on, Malaysia * KUHE:52439 LC202003 Ma sui e al. 2017
75 L. khasio um Meghalaya, India* SDBDU 2009.329 KY022303 Mahony e al. 2017
76 L. ko i i Doi In hanon, Thailand* KUHE 19134 LC741033 Ma sui e al. 2023
77 L. laui Wu ongshan, Shenzhen ci y, China* SYS a001507 KM014544 Sung e al. 2014
78 L. liui Wuyishan, Fujian, China * ZYCA907 MH055908 Chen e al. 2018
79 L. mac ops Dak Lak, Vie nam* AMS R177663 KR018118 Rowley e al. 2015b
80 L. maculosa Ninh Thuan, Vie nam* AMS: R 177660 KR018119 Rowley e al. 2015b
81 L. mangshanensis Mangshan, Hunan, China* MSZTC201701 MG132196 Hou e al. 2018
82 L. maoe shanensis Mao’e Shan, Guangxi, China KIZ07614 MH055927 Chen e al. 2018
83 L. ma mo a a Bo neo, Malaysia* KUHE 53227 AB969289 Ma sui e al. 2014b
84 L. mau a Bo neo, Malaysia SP 21450 AB847559 Ma sui e al. 2014a
85 L. melanoleuca Kapoe, Ranong, Thailand KIZ018031 MH055967 Chen e al. 2018
86 L. melica Ra anaki i, Cambodia* MVZ 258198 HM133600 Rowley e al. 2010a
87 L. minima Doi Phu Fa, Nan, Thailand KIZ024317 MH055852 Chen e al. 2018
88 L. mjobe gi Sa awak, Bo neo, Malaysia* KUHE 47872 LC056787 E o e al. 2015
89 L. nahangensis Tuyen Quang, Vie nam* ROM 7035 MH055853 Chen e al. 2018
90 L. namdongensis Thanh Hoa, Vie nam* VNUF A.2017.95 MK965390 Hoang Chen e al. 2019
91 L. neangi Veal Veng Dis ic , Pu sa , Cambodia* CBC 1609 MT644612 S ua and Rowley 2020
92 L. ni eimon is Yongde Coun y, Yunnan, China * KIZ028276 MT302620 Chen e al. 2020
93 L. oshanensis Emei Shan, Sichuan, China* Tissue ID: YPX37492 MH055896 Chen e al. 2018
94 L. pallida Lam Dong, Vie nam* UNS00510 KR018112 Rowley e al. 2015b
95 L. pa a Mulu Na ional Pa k, Sa awak, Malaysia* KUHE:55308 LC056791 E o e al. 2015
96 L. pelody oides NA TZ819 AF285192 Ziegle 2000
97 L. pe ops Ba Vi Na ional Pa k, Ha Tay, Vie nam ROM 13483 MH055901 Chen e al. 2018
98 L. phiadenensis Phia Oac-Phia Den NP, Cao Bang P o ., Vie nam* IEBR A.5205 OR405872 Luong e al. 2023
99 L. phiaoacensis Phia Oac-Phia Den NP, Cao Bang P o ., Vie nam* IEBR A. 5195 OR405871 Luong e al. 2023
100 L. pic a Bo neo, Malaysia UNIMAS 8705 KJ831295 Obe humme e al. 2014
101 L. plu ialis Lao Cai, Vie nam* MNHN:1999.5675 JN848391 Ohle e al. 2011
102 L. puhoa ensis Nghe An, Vie nam* VNMN 2016 A.22 KY849586 Rowley e al. 2017a
103 L. pu pu us Yunnan, China * SYSa006530 MG520354 Yang e al. 2018
104 L. pu pu a en a Guizhou, China * SYSa007281 MK414517 Wang e al. 2019
105 L. py hops Loc Bac, Lam Dong, Vie nam* ZMMU-A-4873-00158 MH055950 Chen e al. 2018
106 L. owleyae Da Nang Ci y, Vie nam* ITBCZ2783 MG682552 Nguyen e al. 2018
107 L. sabahmon anus Bo neo, Malaysia* BORNEENSIS 12632 AB847551 Ma sui e al. 2014a
108 L. shangsiensis Shangsi Coun y, China* NHMG1401032 MK095460 Chen e al. 2019
109 L. shimen aina Shimen ai Na u e Rese e, Guangdong, China* SYS a004712 MH055926 Chen e al. 2018
110 L. sino ensis Mae Hong Son, Thailand* KUHE 19816 LC741036 Ma sui e al. 2023
111 L. sola Gunung S ong, Kelan an, Malaysia KU RMB20973 MH055973 Chen e al. 2018
112 L. suiyangensis Guizhou, China * GZNU20180606005 MK829649 Luo e al. 2020
113 L. sungi Vinh Phuc, Vie nam * ROM 20236 MH055858 Chen e al. 2018
114 L. adungensis Dak Nong, Vie nam* UNS00515 KR018121 Rowley e al. 2015b
115 L. engchongensis Yunnan, China * SYSa004598 KU589209 Yang e al. 2016
116 L. ube osa Kon Ka Kinh Na ional Pa k, Gia Lai, Vie nam* ZMMU-NAP-02275 MH055959 Chen e al. 2018
117 L. en ipunc a a Zhushihe, Yunnan, China * SYSa004536 MH055831 Chen e al. 2018
177
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
ID Species Locali y Vouche no. 16S RNA Re e ence
118 L. e ucosa Lianshan Bijiashan Na u e Rese e, Guangdong, China GEP a059 OP279589 Lin e al. 2022
119 L. wuhuangmon is Pubei Coun y, Guangxi, China * SYS a003486 MH605578 Wang e al. 2018
120 L. wulingensis Hunan, China * CSUFT194 MT530316 Qian e al. 2020
121 L. yeae Moun Emei, Sichuan, China * CIBEMS20190422HLJ1-6 MT957019 Shi e al. 2021
122 L. yingjiangensis Yunnan, China * SYSa006532 MG520351 Yang e al. 2018
123 L. yunyangensis Yunyang Coun y, Chongqing, China * GZNU20210622001 OL800364 Luo e al. 2022
124 L. zhangyapingi Chiang Mai, Thailand * KIZ07258 MH055864 Chen e al. 2018
125 Xenoph ys majo Kon Tum P o ince, Vie nam AMS R173870 KY476333 Rowley e al. 2017b
126 Lep ob achium chapaense Lao Cai P o ince, Vie nam AMS R 171623 KR018126 Rowley e al. 2015b
Mo phology
Phylogene ic esul s indica ed L. da ongshanensis sp. no . is closely ela ed o
L. shiwandashanensis. Howe e , i di e s om L. shiwandashanensis in se e al
mo phological cha ac e s, including i is colo a ion, ela i e eye diame e , su-
p a ympanic line colo , oe webbing de elopmen , and en ola e al glandula
line con inui y (see Compa isons below). Specimens o he second lineage (L.
c . yunkaiensis) we e mo phologically highly simila o opo ypic L. yunkaiensis
(see Taxonomic accoun o L. yunkaiensis).
Based on he cong uen esul s om molecula phylogene ics, bioacous ics,
and mo phology, we desc ibe he i s lineage as a new species, L. da ongshan-
ensis sp. no . The second lineage is iden i ied as L. c . yunkaiensis, ep esen -
ing a new popula ion eco d.
Taxonomic accoun
Lep ob achella da ongshanensis sp. no .
h ps://zoobank.o g/9F3C1115-FFF1-4D04-A88C-5939173E1F40
Fig. 4A–F
Type ma e ial. Holo ype • NNU 001390, adul male, collec ed a Da ongshan
Na u e Rese e, Yulin Ci y, Guangxi, China (22.868°N, 110.202°E; ele a ion
1048 m) by Wei-Cai Chen on 19 Ma ch 2025.
Pa a ypes • NNU 001152–001153 ( wo adul males), NNU 001157–001161
( ou adul emales), collec ed a he same locali y as he holo ype on 17 May
2023 by Wei-Cai Chen and Yong-Jian Bei. • NNU 001391–001393 ( h ee adul
males), NNU 001394–001397 ( ou adul emales), collec ed a he same local-
i y as he holo ype on 19 Ma ch 2025 by Wei-Cai Chen.
Diagnosis. Lep ob achella da ongshanensis sp. no . is assigned o he ge-
nus Lep ob achella based on molecula phylogene ic esul s and he ollowing
gene ic mo phological cha ac e s: small size, p esence o an inne me aca -
pal ube cle, absence o ome ine ee h, dis inc ympanum, and he p esence
Table 2. Compa isons o cha ac e s o ad e isemen calls o he new species, L. shiwandashanensis, and L. c . yunkaiensis.
Species Dominan equency (kHz) Call du a ion (ms) Call in e al (ms) Tempe a u e (°C) Re e ences
L. da ongshanensis sp. no . 6.1–6.7 77.9 (59.1–109.2) 521.2 (334.8–763.7) 20.0 This s udy
L. shiwandashanensis 5.3–5.7 226.6 (194.0–277.0) 153.1 (134.0–186.0) 23.0 Chen e al. 2021a
L. c . yunkaiensis 4.9–5.3 35.6 (25.8–46.6) 309.5 (150.1–559.5) 20.0 This s udy
178
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Figu e 2. BI ees based on 16S RNA agmen s wi h Bayesian pos e io p obabili ies/boo s ap suppo s on b anches.
Sold black means Bayesian pos e io p obabili ies g ea e han 0.95 (uppe hal ) and ul a as boo s ap suppo s g ea e
han 90 (lowe hal ).
0.1
L. yunkaiensis
MH605584
L. yunkaiensis MH605586
L. yunkaiensis MH605589
L. yunkaiensis MH055933
L. yunkaiensis MH605587
L. yunkaiensis MH605588
L. yunkaiensis MH605591
L. yunkaiensis MH605590
L. yunkaiensis MH605585
NNU001147
NNU001149
NNU001148
NNU001155
NNU001150
NNU001151
NNU001156
L. yunkaiensis MH055931
L. yunkaiensis MH055932
L. dayaoshanensisPQ476281
L. e ucosaOP279589
L. liuiMH055908
L. mangshanensisMG132196
L. shimen ainaMH055926
L. bashaensisMW136295
L. maoe shanensisMH055927
L. lauiKM014544
L. la iglandulosaMH055934
L. phiaoacensisOR405871 L. bijieMK414532
L. jinyunensisOQ024778
L. chishuiensisMT117053
L. suiyangensisMK829649
L. jinshaensisMT814014
L. pu pu a en aMK414517
L.bou e iMH055869
L. dongOP764530
L. ni eimon isMT302620
L. yunyangensisOL800364
L. yeaeMT957019
L. alpinaMH055867
L. pu pu usMG520354
L. do sospinaMW046194
L. wulingensisMT530316
L. eosJN848452L. ko i iLC741033
L. sino ensisLC741036
L. oshanensisMH055896
L. engchongensisKU589209
L. khasio umKY022303
L. yingjiangensisMG520351
L. namdongensisMK965390
L. puhoa ensisKY849586
L. pe opsMH055901
L. sungiMH055858
L. zhangyapingiMH055864
L. i hiJQ739206
L. isosKT824769
NNU001157
NNU001392
NNU001158
NNU001160
NNU001159
NNU001390
NNU001393
NNU001394
NNU001153
NNU001161
NNU001152
NNU001391
NNU001395
L. shiwandashanensisMZ326691
L. shiwandashanensisMZ326693
L. shiwandashanensisMZ326694
L. shiwandashanensisMZ326692
L. shiwandashanensisMZ326695
L. wuhuangmon isMH605578
L. ae eusJN848409
L. pelody oidesAF285192
L. minimaMH055852
L. guinanensisOP548561
L. en ipunc a aMH055831
L. aspe aMW046199
L. eiiMT302634
L. phiadenensisOR405872
L. shangsiensisMK095460
L. plu ialisJN848391
L. nahangensisMH055853
L. damingshanensisMZ145229
L. bidoupensisMH055945
L. kalonensisKR018114
L. pallidaKR018112
L. adungensisKR018121
L. mac opsKR018118
L. maculosaKR018119
L. py hopsMH055950
L. applebyiMH055947
L. melicusHM133600
L. owleyaeMG682552
L. a densMH055949
L. ube osaMH055959
L. c oceaMH055955
L. bo s o diMH055952
L. uliginosusLC201988
L. melanoleucusMH055967
L. neangiMT644612 L. b e ic usKJ831302
L. i iokaiLC137805
L. pa aLC056791
L. baluensisLC056792
L. mjobe giLC056787
L. juliand ingiLC056784
L. d ingiAB847553
L. sabahmon anus AB847551
L. pic usKJ831295
L. i inniensMH055971
L. g acilisMH055972
L. a ayaiDQ642119
L. hamidiAB969286
L. ma mo a usAB969289
L. mau usAB847559 L. he e opus AB530453
L. solusMH055973
L. kecilLC202003
L. kajangensisLC202002
Lep ob achium chapaense KR018126
Xenoph ys majo KY476333
L. c . yunkaiensis om Da ongshan Rese e
L. da ongshanensis sp. no .
L. yunkaiensis om ype
locali y
179
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
o mac o-glands (pec o al and emo al glands, o en including sup a-axilla y
and en ola e al glands). Lep ob achella da ongshanensis sp. no . can be dis-
inguished om i s congene s by he ollowing combina ion o cha ac e s: (1)
medium body size (SVL 24.9–27.7 mm in males; 32.0–35.4 mm in emales);
(2) do sal skin ough wi h small, aised ube cles and idges; (3) en al su ace
c eamy whi e wi h minu e i egula ex u es and iny pale b own spo s la e ally
on he belly; (4) lanks bea ing i egula black spo s; (5) dis inc black sup a-
ympanic line ex ending om pos e io co ne o eye o sup a-axilla y gland;
(6) udimen a y oe webbing p esen be ween oes I–IV, la e al de mal inges
absen on oes; (7) en ola e al glandula line dis inc and con inuous; (8) i is
bicolo ed, uppe hal ange ine, lowe hal sil e wi h black e icula ions; pupil
black wi h ange ine edges; (9) ibio a sal a icula ion eaching he pos e io
ma gin o he eye when hindlimb is adp essed along body; (10) ad e isemen
call dominan equency 6.1–6.7 kHz a 20.0 °C.
Figu e 3. Ad e isemen call spec og ams o L. da ongshanensis sp. no . and L. c . yunkaiensis.
Lep ob achella da ongshanensis sp. no .
A
BLep ob achella c . yunkaiensis
186
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Table 4. Measu emen s o L. c . yunkaiensis om he Da ongshan Na u e Rese e, Yulin
Ci y, Guangxi, China.
Males Female
Ranges (mm) (n = 7) Mean ± SD (mm) n = 1
SVL 24.6–27.2 25.8 ± 0.9 30.1
HL 9.3–10.5 9.9 ± 0.4 11.3
HW 9.4–10.5 9.8 ± 0.4 10.7
SNT 3.4–4.2 3.9 ± 0.3 4.0
ED 3.5–4.2 3.8 ± 0.2 4.2
IOD 2.7–3.2 2.8 ± 0.2 3.3
TD 1.7–2.1 1.9 ± 0.2 2.1
IN 2.5–3.1 2.8 ± 0.2 3.2
TIB 12.3–13.8 13.0 ± 0.6 13.7
FLL 11.9–13.7 12.8 ± 0.6 13.8
TFL 16.8–19.0 18.2 ± 0.8 19.2
ML 6.6–7.4 7.0 ± 0.3 6.8
HLL 36.3–40.7 38.9 ± 1.7 40.2
FG-knee 3.9–5.3 4.6 ± 0.4 5.1
Figu e 6. Mo phological cha ac e s o L. c . yunkaiensis om Guangxi (adul male, ouche no. NNU 001147). A. Do sal
iew; B. Do sola e al iew; C. Ven al iew; D. Ven al iew o hand; E. Ven al iew o oo .
187
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
eplaced by indis inc de mal idges; inne me a a sal ube cle elonga ed; ou e
me a a sal ube cle absen ; ibio a sal a icula ion eaching mid-eye le el when
leg adp essed; heels mee ing when highs held a igh angles o body.
Do sal skin ough wi h small ube cles; en al skin smoo h; pec o al glands
ounded, c eamy whi e, ~1.3 mm diame e ; emo al glands o al, ~1.6 mm diame-
e , close o knee han en ; sup a-axilla y glands small, ound, ~0.5 mm diame e ;
en ola e al glandula line dis inc and con inuous; limbs wi h spa se ube cles.
Do sum b own wi h spa se pale yellow ma kings; da k b own in e o bi al ian-
gle; ympanum b own; b own sup a ympanic line; da k b own spo s on uppe lip;
lanks wi h i egula black spo s and c eamy yellow ube cles; do sal high wi h
3–5 dis inc ans e se da k b own ba s; do sal o ea ms wi h h ee dis inc ans-
e se da k b own ba s; elbows and uppe a ms ange ine; en al su ace pink o
c eamy whi e wi h minu e i egula c eamy ex u es; en al limbs wi h iny i egula
c eamy yellow spo s; pec o al, emo al, sup a-axilla y glands c eamy yellow; pupil
black; i is bicolo ed, uppe hal ange ine, lowe hal sil e (Fig. 6, Suppl. ma e ial 1).
Dis ibu ion. The ype locali y o L. yunkaiensis is Dawuling Fo es S a ion, Mao-
ming Ci y, Guangdong, China (Wang e al. 2018). P e ious eco ds include Ehuang-
zhang Na u e Rese e, Guangdong and Lidong, Bobai Ci y, Guangxi, China (Chen
e al. 2018; Yu e al. 2024). The Da ongshan Na u e Rese e, Yulin Ci y, Guangxi,
epo ed he ein, ep esen s he ou h known locali y o his species (Fig. 1).
Discussion
The conse ed ex e nal mo phology o Lep ob achella species makes iden i ica ion
challenging, con ibu ing o he p e alence o c yp ic di e si y. In eg a ing molecu-
la phylogene ics and bioacous ic analyses has signi ican ly ad anced he axono-
my o his genus (Chen e al. 2024; Yu e al. 2024). Ad e isemen calls, exhibi ing
species-speci ic di e ences, a e a pa icula ly aluable cha ac e o delinea ing
Lep ob achella species (Köhle e al. 2017; Yu e al. 2024). In his s udy, he syn opic
L. da ongshanensis sp. no . and L. yunkaiensis possess en i ely dis inc ocaliza-
ions, di e ing in dominan equency, call du a ion, and call in e al. Phylogene ic
analysis iden i ied L. da ongshanensis sp. no . as sis e o L. shiwandashanensis.
Howe e , he p o ound acous ic di e gence—e iden in dominan equency, call
du a ion, and call in e al—be ween L. da ongshanensis sp. no . and L. shiwan-
dashanensis, coupled wi h mo phological dis inc ions, p o ides obus suppo o
ecognizing he Da ongshan lineage as a dis inc new species.
Geog aphically, he Da ongshan Na u e Rese e and he ype locali y o L.
yunkaiensis (Dawuling Fo es S a ion) bo h lie wi hin he Yunkai moun ain ange,
sepa a ed by a s aigh -line dis ance o ca. 120 km. Phylogene ic analysis con-
i ms ha he L. c . yunkaiensis popula ion om Da ongshan is closely ela ed o
opo ypic L. yunkaiensis. Howe e , we no e ha wo specimens p e iously iden i-
ied as L. yunkaiensis—KIZ018211 ( om Lidong, Guangxi; GenBank MH055931)
and KIZ047782 ( om Ehuangzhang Na u e Rese e, Guangdong; GenBank
MH055932)—exhibi ela i ely high gene ic di e gence (3.3–3.9%) om opo-
ypic L. yunkaiensis (Suppl. ma e ial 2: able S3). This di e gence exceeds he
ypical in aspeci ic h eshold sugges ed o amphibians (Vences e al. 2005).
These specimens we e ini ially iden i ied as Lep ob achella liui (Chen e al. 2018)
and la e assigned o L. yunkaiensis based solely on phylogeny wi hou comp e-
hensi e mo phological e-e alua ion (Yu e al. 2024). The e o e, he axonomic
188
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
s a us o specimens KIZ018211 and KIZ047782 equi es u he in es iga ion
inco po a ing mo phological and bioacous ic da a o con i m hei iden i y.
The disco e y o L. da ongshanensis sp. no ., cu en ly known only om a
small a ea wi hin he Da ongshan Na u e Rese e, highligh s he ongoing po-
en ial o unco e ing new amphibian di e si y in sou he n China’s mon ane
egions. I s specialized habi a nea headwa e s eams and limi ed known dis-
ibu ion wa an a en ion o conse a ion assessmen .
Acknowledgemen s
We hank he s a o he Da ongshan Na u e Rese e o hei suppo du ing
ieldwo k.
Addi ional in o ma ion
Con lic o in e es
The au ho s ha e decla ed ha no compe ing in e es s exis .
E hical s a emen
No e hical s a emen was epo ed.
Use o AI
No use o AI was epo ed.
Funding
This wo k was suppo ed by he Na ional Na u al Science Founda ion o China (g an
numbe s 32360128 and 32060116) and Guangxi Na u al Science Founda ion, China
(2020GXNSFDA238022).
Au ho con ibu ions
CWC concei ed and designed he s udy and p epa ed he manusc ip . CWC and LP pe -
o med he molecula expe imen s and analyzed he da a. CWC and BYJ conduc ed ield
su eys. All au ho s ead and app o ed he inal e sion o he manusc ip
Au ho ORCIDs
Wei-Cai Chen h ps://o cid.o g/0000-0002-2398-4079
Peng Li h ps://o cid.o g/0000-0001-8311-0544
Da a a ailabili y
All o he da a ha suppo he indings o his s udy a e a ailable in he main ex o
Supplemen a y In o ma ion.
Re e ences
AmphibiaChina (2025) The da abase o Chinese amphibians. Kunming Ins i u e o Zo-
ology (CAS), Yunnan, China. h p://www.amphibiachina.o g/ [accessed 3 June 2025]
Boulenge GA (1893) Concluding epo on he ep iles and ba achians ob ained in Bu -
ma by Signo L. Fea dealing wi h he collec ion made in Pegu and he Ka in Hills in
1887–1888. Annali del Museo Ci ico di S o ia Na u ale di Geno a 13: 304–347.
189
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Boulenge GA (1900) Desc ip ions o new ba achians and ep iles om he La u
Hills, Pe ak. Annals & Magazine o Na u al His o y 6(32): 186–193. h ps://doi.
o g/10.1080/00222930008678356
Chen JM, Poya ko J NJ, Suwannapoom C, La h op A, Wu YH, Zhou WW, Yuan ZY,
Jin JQ, Chen HM, Liu HQ, Nguyen TQ, Nguyen SN, Duong TV, E o K, Nishikawa K,
Ma sui M, O lo NL, S ua BL, B own RM, Rowley JJL, Mu phy RW, Wang YY, Che J
(2018) La ge-scale phylogene ic analyses p o ide insigh s in o un ecognized di e -
si y and his o ical biogeog aphy o Asian lea -li e ogs, genus Lep olalax (Anu a:
Megoph yidae). Molecula Phylogene ics and E olu ion 124: 162–171. h ps://doi.
o g/10.1016/j.ympe .2018.02.020
Chen WC, Liao X, Zhou SC, Mo YM (2019) A new species o Lep ob achella (Anu a: Me-
goph yidae) om sou he n Guangxi, China. Zoo axa 4563(1): 067–082. h ps://doi.
o g/10.11646/zoo axa.4563.1.3
Chen JM, Xu K, Poya ko NA, Wang K, Yuan ZY, Hou M, Suwannapoom C, Wang J, Che J
(2020) How li le is known abou “ he li le b own ogs”: desc ip ion o h ee new species
o he genus Lep ob achella (Anu a: Megoph yidae) om Yunnan P o ince, China. Zoo-
logical Resea ch 41(3): 292–313. h ps://doi.o g/10.24272/j.issn.2095-8137.2020.036
Chen WC, Peng W, Pan W, Liao N, Liu Y, Huang Y (2021a) A new species o Lep ob a-
chella Smi h 1925 (Anu a: Megoph yidae) om sou he n Guangxi, China. Zoo axa
5020(3): 581–596. h ps://doi.o g/10.11646/zoo axa.5020.3.8
Chen WC, Yu GD, Cheng ZY, Meng T, Wei H, Zhou GY, Lu YW (2021b) A new species o
Lep ob achella (Anu a: Megoph yidae) om cen al Guangxi, China. Zoological Re-
sea ch 42(6): 783–788. h ps://doi.o g/10.24272/j.issn.2095-8137.2021.179
Chen WC, Li P, Peng WX, Liu YJ, Huang Y (2024) The ou h species o Lep ob achella
(Anu a, Megoph yidae) ound a Shiwandashan Na ional Na u e Rese e, Guangxi,
China. ZooKeys 1192: 257–279. h ps://doi.o g/10.3897/zookeys.1192.98352
Cheng YL, Shi SC, Li J, Liu J, Li SZ, Wang B (2021) A new species o he Asian lea li e
oad genus Lep ob achella Smi h, 1925 (Anu a, Megoph yidae) om no hwes Guizhou
P o ince, China. ZooKeys 1021: 81–107. h ps://doi.o g/10.3897/zookeys.1021.60729
Dehling JM (2012) Eine neue A de Ga ung Lep olalax (Anu a: Megoph yidae) om
Gunung Benom, Wes malaysia / A new species o he genus Lep olalax (Anu a: Me-
goph yidae) om Gunung Benom, Peninsula Malaysia. Sau ia 34: 9–21.
Dehling JM, Ma sui M (2013) A new species o Lep olalax (Anu a: Megoph yidae) om
Gunung Mulu Na ional Pa k, Sa awak, Eas Malaysia (Bo neo). Zoo axa 3670(1): 33–
44. h ps://doi.o g/10.11646/zoo axa.3670.1.2
D ing J (1983) F ogs o he genus Lep ob achella (Peloba idae). Amphibia-Rep ilia 4(2):
89–102. h ps://doi.o g/10.1163/156853883X00012
Dubois A (1987) Miscellanea axinomica ba achologica (I). Aly es 5: 7–95.
E o K, Ma sui M, Nishikawa K (2015) Desc ip ion o a new species o he genus Lep o-
b achella (Amphibia, Anu a, Megoph yidae) om Bo neo. Cu en He pe ology 34(2):
128–139. h ps://doi.o g/10.5358/hsj.34.128
E o K, Ma sui M, Nishikawa K (2016) A new highland species o dwa li e og genus
Lep ob achella (Amphibia, Anu a, Megoph yidae) om Sa awak. The Ra les Bulle in
o Zoology 64: 194–203.
E o K, Ma sui M, Hamidy A, Muni M, Iskanda DT (2018) Two new species o he ge-
nus Lep ob achella (Amphibia: Anu a: Megoph yidae) om Kaliman an, Indonesia.
Cu en He pe ology 37(2): 95–105. h ps://doi.o g/10.5358/hsj.37.95
Fei L, Ye C, Huang Y (1990) Key o Chinese amphibians. Publishing House o Scien i ic
and Technological Li e a u e, 364 pp.
190
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
F os DR (2024) Amphibian Species o he Wo ld: an Online Re e ence. Ve sion 6.2. Ame -
ican Museum o Na u al His o y, New Yo k, USA. h ps://doi.o g/10.5531/db. z.0001
G isme LL, G isme JL, Youmans TM (2004) A new species o Lep olalax (Anu a: Mego-
ph yidae) om Pulau Tioman, Wes Malaysia. Asian He pe ological Resea ch 10: 8–11.
Gün he ACLG (1872) On he ep iles and amphibians o Bo neo. P oceedings o he
Zoological Socie y o London 1872: 586–600.
Gün he A (1895) The ep iles and ba achians o he Na una Islands. No i a es Zoolog-
icae 2: 499–502.
Hoang CV, Nguyen TT, Luu VQ, Nguyen TQ, Jiang JP (2019) A new species o Lep ob a-
chella Smi h 1925 (Anu a: Megoph yidae) om Thanh Hoa P o ince, Vie nam. The
Ra les Bulle in o Zoology 67: 536–556. h ps://doi.o g/10.26107/RBZ-2019-0042
Hou YM, Zhang MF, Hu F, Li SY, Shi SC, Chen J, Mo XY, Wang B (2018) A new species o
he genus Lep olalax (Anu a, Megoph yidae) om Hunan, China. Zoo axa 4444(3):
247–266. h ps://doi.o g/10.11646/zoo axa.4444.3.2
Inge RF, S uebing RB (1992) A new species o og o he genus Lep ob achella Smi h
(Anu a: Peloba idae), wi h a key o he species om Bo neo. The Ra les Bulle in o
Zoology 39: 99–103.
Inge RF, Lakim M, Biun A, Yambun P (1997) A new species o Lep olalax (Anu a:
Megoph yidae) om Bo neo. Asia ic He pe ological Resea ch 7: 48–50. h ps://doi.
o g/10.5962/bhl.pa .18855
Inge RF, O lo N, Da e sky I (1999) F ogs o Vie nam: A epo on new collec ions. Field-
iana. Zoology 92: 1–46.
Jiang K, Yan F, Suwannapoom C, Chomdej S, Che J (2013) A new species o he ge-
nus Lep olalax (Anu a: Megoph yidae) om no he n Thailand. Asian He pe ological
Resea ch 4(2): 100–108. h ps://doi.o g/10.3724/SP.J.1245.2013.00100
Kalyaanamoo hy S, Minh BQ, Wong TK, Von Haesele A, Je miin LS (2017) ModelFinde :
Fas model selec ion o accu a e phylogene ic es ima es. Na u e Me hods 14(6):
587–589. h ps://doi.o g/10.1038/nme h.4285
Köhle J, Jansen M, Rod íguez A, Kok PJR, Toledo LF, Emm ich M, Glaw F, Haddad CFB,
Rödel MO, Vences M (2017) The use o bioacous ics in anu an axonomy: Theo y,
e minology, me hods and ecommenda ions o bes p ac ice. Zoo axa 4251(1):
1–124. h ps://doi.o g/10.11646/zoo axa.4251.1.1
La h op A, Mu phy RW, O lo N, Ho CT (1998) Two new species o Lep olalax (Anu a:
Megoph yidae) om no he n Vie nam. Amphibia-Rep ilia 19(3): 253–267. h ps://
doi.o g/10.1163/156853898X00160
Li SZ, Liu J, Wei G, Wang B (2020) A new species o he Asian lea li e oad genus
Lep ob achella (Amphibia, Anu a, Megoph yidae) om sou hwes China. ZooKeys
943: 91–118. h ps://doi.o g/10.3897/zookeys.943.51572
Li S, Li W, Cheng Y, Liu J, Wei G, Wang B (2024) Desc ip ion o a new Asian Lea Li e
Toad o he genus Lep ob achella Smi h, 1925 (Anu a, Megoph yidae) om sou h-
e n Guizhou P o ince, China. Biodi e si y Da a Jou nal 12: e113427. h ps://doi.
o g/10.3897/BDJ.12.e113427
Lin SS, Li YH, Lu YH, Su HL, Wang SB, Zhang QQ, Mo MJ, Xiao SJ, Pan Z, Zeng ZC, Wang
J (2022) A new species o he genus Lep ob achella (Anu a, Megoph yidae) om
no hwes e n Guangdong P o ince, China. He pe ozoa (Wien) 35: 165–178. h ps://
doi.o g/10.3897/he pe ozoa.35.e89981
Liu J, Shi S, Li S, Zhang M, Xiang S, Wei G, Wang B (2023) A new Asian lea li e oad o
he genus Lep ob achella (Amphibia, Anu a, Megoph yidae) om cen al sou h China.
ZooKeys 1149: 103–134. h ps://doi.o g/10.3897/zookeys.1149.85895
191
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Luo T, Xiao N, Gao K, Zhou J (2020) A new species o Lep ob achella (Anu a, Megoph y-
idae) om Guizhou P o ince, China. ZooKeys 923: 115–140. h ps://doi.o g/10.3897/
zookeys.923.47172
Luo T, Wang W, Peng D, Lei B, Deng H, Ji S, Huang H, Zhou J (2022) A new species o he
Asian lea li e oad genus Lep ob achella (Amphibia, Anu a, Megoph yidae) om
Chongqing Ci y, Sou hwes China. Asian He pe ological Resea ch 13: 75–95. h ps://
cs .cn/32242.14.j.cnki.ah .210052
Luong AM, Hoang CV, Pham CT, Ziegle T, Nguyen TQ (2023) Two new species o Lep o-
b achella Smi h 1925 (Amphibia: Megoph yidae) om Cao Bang P o ince, Vie nam.
Zoo axa 5369(3): 301–335. h ps://doi.o g/10.11646/zoo axa.5369.3.1
Lyu JC, Dai LL, Wei PF, He YH, Yuan ZY, Shi WL, Zhou SL, Ran SY, Kuang ZF, Guo X,
Wei G, Yuan G (2020) A new species o he genus Lep ob achella Smi h, 1925
(Anu a, Megoph yidae) om Guizhou, China. ZooKeys 1008: 139–157. h ps://doi.
o g/10.3897/zookeys.1008.56412
Mahony S, Foley NM, Biju SD, Teeling EC (2017) E olu iona y his o y o he Asian ho ned
ogs (Megoph yinae): In eg a i e app oaches o ime ee da ing in he absence
o a ossil eco d. Molecula Biology and E olu ion 34(3): 744–771. h ps://doi.
o g/10.1093/molbe /msw267
Malkmus R (1992) Lep olalax pic us sp. no . (Anu a: Peloba idae) om Moun Kinabalu/
No d Bo neo. Sau ia 14: 3–6.
Ma sui M (1997) Call cha ac e is ics o Malaysian Lep olalax wi h a desc ip ion o
wo new species (Anu a: Peloba idae). Copeia 1997(1): 158–165. h ps://doi.
o g/10.2307/1447851
Ma sui M (2006) Th ee new species o Lep olalax om Thailand (Amphibia, Anu a, Me-
goph yidae). Zoological Science 23(9): 821–830. h ps://doi.o g/10.2108/zsj.23.821
Ma sui M, Belabu DM, Ahmad N, Yong HS (2009) A new species o Lep olalax (Amphibia,
Anu a, Megoph yidae) om Peninsula Malaysia. Zoological Science 26(3): 243–247.
h ps://doi.o g/10.2108/zsj.26.243
Ma sui M, Hamidy A, Mu phy RW, Khonsue W, Yambun P, Shimada T, Ahmad N,
Belabu DM, Jiang JP (2010) Phylogene ic ela ionships o megoph yid ogs o he
genus Lep ob achium (Amphibia, Anu a) as e ealed by m DNA gene sequences.
Molecula Phylogene ics and E olu ion 56(1): 259–272. h ps://doi.o g/10.1016/j.
ympe .2010.03.014
Ma sui M, Nishikawa K, Yambun P (2014a) A new Lep olalax om he moun ains o
Sabah, Bo neo (Amphibia, Anu a, Megoph yidae). Zoo axa 3753(3): 440–452. h ps://
doi.o g/10.11646/zoo axa.3753.5.3
Ma sui M, Zainudin R, Nishikawa K (2014b) A new species o Lep olalax om Sa -
awak, Wes e n Bo neo (Anu a: Megoph yidae). Zoological Science 31(11): 773–779.
h ps://doi.o g/10.2108/zs140137
Ma sui M, E o K, Nishikawa K, Hamidy A, Belabu D, Ahmad N, Panha S, Khonsue W,
G isme LL (2017) Mi ochond ial phylogeny o Lep olalax om Malay Peninsula and
Lep ob achella (Anu a, Megoph yidae). Cu en He pe ology 36(1): 11–21. h ps://
doi.o g/10.5358/hsj.36.11
Ma sui M, Panha S, E o K (2023) Two new species o Lep ob achella om no he n Thai-
land (Amphibia, Anu a, Megoph yidae). Cu en He pe ology 42(1): 83–97. h ps://
doi.o g/10.5358/hsj.42.83
Nguyen LT, Schmid HA, Von HA, Minh BQ (2015) IQ-TREE: A Fas and E ec i e S ochas-
ic Algo i hm o Es ima ing Maximum Likelihood Phylogenies. Molecula Biology
and E olu ion 32(1): 268–274. h ps://doi.o g/10.1093/molbe /msu300
192
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Nguyen LT, Poya ko NA, Le DT, Vo BD, Ninh HT, Duong TV, Mu phy RW, Sang NV (2018)
A new species o Lep olalax (Anu a: Megoph yidae) om Son T a Peninsula, cen al
Vie nam. Zoo axa 4388(1): 1–21. h ps://doi.o g/10.11646/zoo axa.4388.1.1
Nguyen LT, Tapley B, Nguyen CT, Luong HV, Rowley JJL (2021) A new species o Lep-
ob achella (Anu a, Megoph yidae) om Moun Pu Ta Leng, no hwes Vie nam.
Zoo axa 5016(3): 301–332. h ps://doi.o g/10.11646/zoo axa.5016.3.1
Obe humme E, Ba en C, Schweize M, Das I, Haas A, He wig ST (2014) Desc ip ion o
he adpoles o h ee a e species o megoph yid ogs (Amphibia: Anu a: Megoph y-
idae) om Gunung Mulu, Sa awak, Malaysia. Zoo axa 3835(1): 59–79. h ps://doi.
o g/10.11646/zoo axa.3835.1.3
Ohle A, Ma quis O, Swan S, G osjean S (2000) Amphibian biodi e si y o Hoang Lien
Na u e Rese e (Lao Cai P o ince, no he n Vie nam) wi h desc ip ion o wo new
species. He pe ozoa (Wien) 13(1/2): 71–87.
Ohle A, Wollenbe g KC, G osjean S, Hend ix R, Vences M, Ziegle T, Dubois A (2011)
So ing ou Lalos: Desc ip ion o new species and addi ional axonomic da a on me-
goph yid ogs om no he n Indochina (genus Lep olalax, Megoph yidae, Anu a).
Zoo axa 3147(1): 1–83. h ps://doi.o g/10.11646/zoo axa.3147.1.1
Palumbi SR, Ma in R, Romano S, McMillan WO, S ice L, G abowski G (1991) The Simple
Fool’s Guide To PCR, 2.0. Special publica ion o he Uni e si y o Hawaii Depa men
o Zoology and Kewalo Ma ine Labo a o y.
Qian TY, Xia X, Cao Y, Xiao N, Yang D (2020) A new species o Lep ob achella (Anu a:
Megoph yidae) Smi h, 1925 om Wuling Moun ains in Hunan P o ince, China. Zoo -
axa 4816(4): 491–526. h ps://doi.o g/10.11646/zoo axa.4816.4.4
Ronquis F, Teslenko M, Van De Ma k P, Ay es DL, Da ling A, Höhna S, La ge B, Liu L,
Sucha d MA, Huelsenbeck JP (2012) M bayes 3.2: E icien bayesian phylogene ic
in e ence and model choice ac oss a la ge model space. Sys ema ic Biology 61(3):
539–542. h ps://doi.o g/10.1093/sysbio/sys029
Rowley JJ, Hoang DH, Le TT, Dau QV, Cao TT (2010) A new species o Lep olalax (Anu a:
Megoph yidae) om Vie nam and u he in o ma ion on Lep olalax ube osus. Zoo -
axa 2660(1): 33–45. h ps://doi.o g/10.11646/zoo axa.2660.1.3
Rowley JJL, S ua BL, Neang T, Emme DA (2010a) A new species o Lep olalax (Anu a:
Megoph yidae) om no heas e n Cambodia. Zoo axa 2567(1): 57–68. h ps://doi.
o g/10.11646/zoo axa.2567.1.3
Rowley JJL, S ua BL, Richa ds SJ, Phimmachak S, Si ongxay N (2010) A new species
o Lep olalax (Anu a: Megoph yidae) om Laos. Zoo axa 2681(1): 35–46. h ps://doi.
o g/10.11646/zoo axa.2681.1.3
Rowley JJ, Hoang HD, Dau VQ, Le TT, Cao TT (2012) A new species o Lep olalax
(Anu a: Megoph yidae) om cen al Vie nam. Zoo axa 3321(1): 56–68. h ps://doi.
o g/10.11646/zoo axa.3321.1.4
Rowley JJ, Dau VQ, Nguyen TT (2013) A new species o Lep olalax (Anu a: Megoph y-
idae) om he highes moun ain in Indochina. Zoo axa 3737(4): 415–428. h ps://
doi.o g/10.11646/zoo axa.3737.4.5
Rowley JJ, S ua BL, Neang T, Hoang HD, Dau VQ, Nguyen TT, Emme DA (2015a) A new
species o Lep olalax (Anu a: Megoph yidae) om Vie nam and Cambodia. Zoo axa
4039(3): 401–417. h ps://doi.o g/10.11646/zoo axa.4039.3.1
Rowley JJL, T an DT, F ankham GJ, Dekke AH, Le DT, Nguyen TQ, Dau VQ, Hoang HD
(2015b) Undiagnosed c yp ic di e si y in small, mic oendemic ogs (Lep olalax)
om he Cen al Highlands o Vie nam. PLOS ONE 10(5): e0128382. h ps://doi.
o g/10.1371/jou nal.pone.0128382
193
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Rowley JJ, T an DT, Le DT, Dau VQ, Peloso PL, Nguyen TQ, Hoang HD, Nguyen TT,
Ziegle T (2016) Fi e new, mic oendemic Asian Lea -li e F ogs (Lep olalax) om he
sou he n Annami e moun ains. Zoo axa 4085(1): 63–102. h ps://doi.o g/10.11646/
zoo axa.4085.1.3
Rowley JJL, Dau QV, Cao TT (2017a) A new species o Lep olalax (Anu a: Megoph yidae)
om Vie nam. Zoo axa 4273(1): 61–79. h ps://doi.o g/10.11646/zoo axa.4273.1.5
Rowley JJL, Dau VQ, Hoang HD, Le DT, Cu aja TP, Nguyen TT (2017b) A new species
o Lep olalax (Anu a: Megoph yidae) om no he n Vie nam. Zoo axa 4243(3): 544–
564. h ps://doi.o g/10.11646/zoo axa.4243.3.7
Shi SC, Hou YM, Song ZB, Jiang JP, Wang B (2021) A new lea li e oad o Lep ob achella
Smi h, 1925 (Anu a, Megoph yidae) om Sichuan P o ince, China wi h supplemen-
a y desc ip ion o L. oshanensis. Asian He pe ological Resea ch 12(2): 143–166.
h ps://doi.o g/10.16373/j.cnki.ah .200118
Shi SC, Shen T, Wang X, Jiang JP, Wang B (2023) Mul iple da a sou ces e eal a new
Asian Lea Li e Toad o Lep ob achella Smi h, 1925 (Anu a, Megoph yidae)
om sou hwes e n China. Asian He pe ological Resea ch 14: 65–94. h ps://doi.
o g/10.16373/j.cnki.ah .220065
Smi h MA (1925) Con ibu ions o he he pe ology o Bo neo. Sa awak Museum Jou nal
3: 15–34.
Smi h MA (1931) The he pe ology o M . Kinabalu, No h Bo neo, 13,455 . Bulle in o
he Ra les Museum 5: 3–32.
S ua BL, Rowley JJL (2020) A new Lep ob achella (Anu a: Megoph yidae) om he
Ca damom Moun ains o Cambodia. Zoo axa 4834(4): 556–572. h ps://doi.
o g/10.11646/zoo axa.4834.4.4
Sung YH, Yang J, Wang Y (2014) A new species o Lep olalax (Anu a: Megoph yidae)
om sou he n China. Asian He pe ological Resea ch 5(2): 80–90. h ps://doi.
o g/10.3724/SP.J.1245.2014.00080
Tamu a K, S eche G, Kuma S (2021) MEGA11: Molecula E olu iona y Gene ics Anal-
ysis e sion 11. Molecula Biology and E olu ion 38(7): 3022–3027. h ps://doi.
o g/10.1093/molbe /msab120
Taylo EH (1962) The amphibian auna o Thailand. The Uni e si y o Kansas Science
Bulle in 43(8): 265–599. h ps://doi.o g/10.5962/bhl.pa .13347
Vei h M, F omhage L, Kosuch J, Vences M (2006) His o ical biogeog aphy o Wes e n
Palaea c ic peloba id and pelody id ogs: A molecula phylogene ic pe spec i e.
Con ibu ions o Zoology (Ams e dam, Ne he lands) 75(03–04): 109–120. h ps://
doi.o g/10.1163/18759866-0750304001
Vences M, Thomas M, Van de Meijden A, Chia i Y, Viei es DR (2005) Compa a i e
pe o mance o he 16S RNA gene in DNA ba coding o amphibians. F on ie s in
Zoology 2(1): 5. h ps://doi.o g/10.1186/1742-9994-2-5
Wang J, Yang JH, Li Y, Lyu ZT, Zeng ZC, Liu ZY, Ye YH, Wang YY (2018) Mo phology and
molecula gene ics e eal wo new Lep ob achella species in sou he n China (Anu a,
Megoph yidae). ZooKeys 776: 105–137. h ps://doi.o g/10.3897/zookeys.776.22925
Wang J, Li YL, Li Y, Chen HH, Zeng YJ, Shen JM, Wang YY (2019) Mo phology, molecula
gene ics, and acous ics e eal wo new species o he genus Lep ob achella om
no hwes e n Guizhou P o ince, China (Anu a, Megoph yidae). ZooKeys 848: 119–
154. h ps://doi.o g/10.3897/zookeys.848.29181
Wang J, Lyu ZT, Qi S, Zeng ZC, Zhang WX, Lu LS, Wang YY (2020) Two new Lep ob ach-
ella species (Anu a, Megoph yidae) om he Yunnan-Guizhou Pla eau, sou hwes e n
China. ZooKeys 995: 97–125. h ps://doi.o g/10.3897/zookeys.995.55939
194
ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514
Wei-Cai Chen e al.: A new species o Lep ob achella om Guangxi
Yang JH, Wang YY, Chen GL, Rao DQ (2016) A new species o he genus Lep olalax
(Anu a: Megoph yidae) om M . Gaoligongshan o wes e n Yunnan P o ince, China.
Zoo axa 4088(3): 379–394. h ps://doi.o g/10.11646/zoo axa.4088.3.4
Yang JH, Zeng ZC, Wang YY (2018) Desc ip ion o wo new sympa ic species o he
genus Lep olalax (Anu a: Megoph yidae) om wes e n Yunnan o China. Pee J
6(e4586): 1–32. h ps://doi.o g/10.7717/pee j.4586
Yu GD, Qin K, Meng T, Li P, Peng WX, Chen WC (2024) A new species o he genus
Lep ob achella (Amphibia, Anu a, Megoph yidae) om Dayaoshan Na ional Na u e
Rese e, Guangxi, China. ZooKeys 1219: 105–122. h ps://doi.o g/10.3897/zook-
eys.1219.121027
Zhang D, Gao F, Jako lić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSui e: An in-
eg a ed and scalable desk op pla o m o s eamlined molecula sequence da a
managemen and e olu iona y phylogene ics s udies. Molecula Ecology Resou ces
20(1): 348–355. h ps://doi.o g/10.1111/1755-0998.13096
Zheng DS, Qin L (2022) E alua ion o ca bon seques a ion and oxygen elease se ice
unc ion o o es ege a ion in Da ongshan Na u e Rese e o Guangxi Au onomous
egion. Sou h China Ag icul u e 16(18): 107–109.
Ziegle T (2000) Resea ch on he he pe o auna in a we land p ese e in he sou h o
No h Vie nam. PhD Thesis, Uni e si y o Bonn.
Supplemen a y ma e ial 1
Supplemen a y igu e S1
Au ho s: Wei-Cai Chen, Yong-Jian Bei, Peng Li
Da a ype: pd
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1260.161514.suppl1
Supplemen a y ma e ial 2
Supplemen a y ables S1–S4
Au ho s: Wei-Cai Chen, Yong-Jian Bei, Peng Li
Da a ype: xlsx
Copy igh no ice: This da ase is made a ailable unde he Open Da abase License
(h p://openda acommons.o g/licenses/odbl/1.0/). The Open Da abase License
(ODbL) is a license ag eemen in ended o allow use s o eely sha e, modi y, and
use his Da ase while main aining his same eedom o o he s, p o ided ha he
o iginal sou ce and au ho (s) a e c edi ed.
Link: h ps://doi.o g/10.3897/zookeys.1260.161514.suppl2
