Biochemis y and Molecula Biology
Compa a i e E alua ion o Ciga e e Smoke and a Hea ed
Tobacco P oduc on Co neal Oxida i e S ess in an
Ai /Liquid In e ace Model
Sebas iano Giallongo,1F ancesco Bellia,2And ea Russo,3Ma eo Fallico,3Ricca do Polosa,4,5
Niccolò Cas ellino,3An onio Longo,3Rosalia Emma,4,5Kons an inos Pa sine elos,2,5
Massimo Ca uso,2,5A ie S. Ka asasmi a,6Giuseppe S e azzo,2Ignazio Albe o Ba bagallo,2
Rosa io Cal abiano,7Giuseppe B oggi,7Ame M. Alanazi,8and Gio anni Li Vol i2,5
1Depa men o Su ge y and Medicine, Uni e si y o Enna “Ko e,” Enna, I aly
2Depa men o Biomedical and Bio echnological Sciences, Uni e si y o Ca ania, Ca ania, I aly
3Depa men o Oph halmology, Uni e si y o Ca ania, Ca ania, I aly
4Depa men o Clinical and Expe imen al Medicine, Uni e si y o Ca ania, Ca ania, I aly
5Cen e o Excellence o he Accele a ion o Ha m Reduc ion (CoEHAR), Uni e si y o Ca ania, Ca ania, I aly
6Depa emen o Oph halmology Facul y o Medicine Uni e si as Padjadja an (Na ional Eye Cen e Cicendo Eye Hospi al),
Wes Ja a, Indonesia
7Depa men o Medical, Su gical Sciences and Ad anced Technologies “G.F. Ing assia,” Uni e si y o Ca ania, Ca ania, I aly
8Pha maceu ical Bio echnology Labo a o y, Depa men o Pha maceu ical Chemis y, College o Pha macy, King Saud
Uni e si y, Riyadh, Saudi A abia
Co espondence: Gio anni Li Vol i,
Depa men o Biomedical and
Bio echnological Sciences,
Uni e si y o Ca ania, Via S. So ia 97,
Ca ania 95125, I aly;
li [email p o ec ed].
Recei ed: Oc obe 28, 2024
Accep ed: Ma ch 5, 2025
Published: Ap il 1, 2025
Ci a ion: Giallongo S, Bellia F, Russo
A, e al. Compa a i e e alua ion o
ciga e e smoke and a hea ed
obacco p oduc on co neal
oxida i e s ess in an ai /liquid
in e ace model. In es Oph halmol
Vis Sci. 2025;66(4):4.
h ps://doi.o g/10.1167/io s.66.4.4
PURPOSE.Tobacco smoke ha bo s oxic combus ion by-p oduc s con ibu ing o
in lamma o y diseases. Ciga e e smoke’s impac on ocula diseases has been poo ly
cha ac e ized, despi e conjunc i al mucosa’s sensi i i y o hese oxican s. O no e,
ciga e e smoke igge s edness, ea ing, and discom o , accoun ing as a isk ac o
o glaucoma, macula degene a ion, ca a ac s, and o he eye condi ions. Low qui a es
o cessa ion highligh he need o al e na i es. Hea ed obacco p oduc s (HTPs), may
ep esen a less oxic al e na i e o hose smoke s. This s udy e alua es ciga e e smoke
and HTPs e ec s on co nea unde s anda d and clinically ele an condi ions.
METHODS.Co neal issues collec ed om dono s and in i o model in wo di e en cell
lines o co neal epi helium we e exposed o ciga e e (1R6F) smoke and HTPs apo .
Ai exposu e was included as a con ol. Tissue pa hological e alua ion was ca ied ou
by hema oxylin and eosin s aining. Reac i e oxygen species (ROS) we e measu ed, and
quan i a i e PCR assessed in lamma o y and an ioxidan genes exp ession. P o eome
analysis was used o e alua e di e en ially exp essed p o eins ela ed o he oxida i e
s ess. Sc a ch assay measu ed smoke and HTPs impac on cells.
RESULTS.Hema oxylin & eosin s aining highligh ed ha ciga e e smoke impai s co neal
issue in eg i y, leading o ROS accumula ion and in lamma ion, as p o ed by qPCR
analysis. P o eomic analysis showed ha co neal issue’s p o eins we e di e en ly
oxidized by he di e en expe imen al condi ions. HTP a ge ed s uc u al in acellu-
la p o eins, whe eas 1R6F a ec s di e en membe s o collagen amily. Finally, ciga e e
smoke, bu no HTPs, impai s epi helial cells wound closu e.
CONCLUSIONS.Smoking inc eases oxida i e s ess, leading o signi ican co neal damage
and in lamma ion. HTPs may o e a less oxic al e na i e.
Keywo ds: co nea, oxida i e s ess, ciga e e smoke, obacco hea ed p oduc , p o eomics
Tobacco smoke ha bo s se e al combus ion-de i ed oxi-
can s, including a signi ican numbe o ee adicals.
These accoun o he onse , main enance, and p og ession
o se e al diseases cha ac e ized by an al e ed in lamma-
o y p o ile.1In his con ex , he e ec o ciga e e smoke
on ocula diseases has been so a poo ly cha ac e ized. To
his ega d, he conjunc i al mucosa is ex emely sensi i e
o oxican s.2In pa icula , obacco combus ion byp od-
uc lead o mild conjunc i al edness and excessi e ea -
ing, and igge he conjunc i al- ee ne e endings, caus-
ing uncom o able sensa ions such as s inging, bu ning, and
p ickling.3Smoking is also linked o a ious eye pa holog-
ical condi ions such as glaucoma, sugges ing ha smoking
may con ibu e o inc ease in aocula p essu e.4Fu he -
Copy igh 2025 The Au ho s
io s.a ojou nals.o g | ISSN: 1552-5783 1
This wo k is licensed unde a C ea i e Commons A ibu ion-NonComme cial-NoDe i a i es 4.0 In e na ional License.
Downloaded om io s.a ojou nals.o g on 11/21/2025
Toxicological P o ile o IQOS and 1R6F in Co nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 2
mo e, smoking is a known isk ac o o age- ela ed macu-
la disease (AMD), a leading cause o se e e ision impai -
men . Smoking may indeed exace ba e AMD h ough a ious
mechanisms, such as p omo ing ocula ascula emodeling
and inc easing oxida i e s ess, wo ac o s ul ima ely ig-
ge ing e inal damage.5O he condi ions such as ca a ac s
and d y eye synd ome ha e been linked o ciga e e smoke.
Smoke s ha e a no ably highe isk o de eloping nuclea
ca a ac s o al e a ion o he ea ilm, e en ually igge -
ing ision impai men .6,7Finally, smoking con ibu es o
ischemic diseases, inc easing he isk o h ombosis and
a he oscle osis, which can ad e sely a ec ocula heal h.
A he oscle o ic plaques, as he ones accumula ing du ing
acu e an e io ischemic op ic neu opa hy (AION) pa hogene-
sis, exace ba e indeed e inal ischemic e en s.8These condi-
ions migh lead o ision loss, unde sco ing he de imen al
e ec s o smoking on eye heal h. Qui ing smoking can mi i-
ga e hese isks, aligning he heal h ou comes close o hose
o non-smoke s. Howe e , he numbe o smoke s who a e
willing o able o qui is ela i ely low, and he e o e o he
app oaches a e necessa y o p e en o educe he isk o
ocula complica ions in hea y smoke s.9
In ecen yea s, p oduc s ha do no equi e combus-
ion o deli e nico ine, such as hea ed obacco p oduc s
(HTPs), a e inc easingly eplacing con en ional ciga e es
wo ldwide. Compa ed o adi ional ciga e es, hese al e -
na i es signi ican ly educe exposu e o ha m ul chemical
cons i uen s such as phenol, o maldehyde, and ac olein.10
Fo his eason, combus ion- ee nico ine deli e y sys ems
a e being conside ed o smoking ha m educ ion.11
Howe e , despi e he bene i s p o ided by hem, conce ns
ha e been aised in ol ing HTPs impac on G a es’ o bi opa-
hy and d y eye diseases, shading a ligh on he ha m ul
impac o hese de ices.12,13 The e o e, he aim o his wo k
is o assess he impac o ciga e e combus ion and HTPs
on co neal issue by using s anda d and clinically ele an
condi ions.
MATERIAL AND METHODS
Smoke Exposu e
The 1R6F e e ence ciga e es (Cen e o Tobacco Re e -
ence P oduc s, Uni e si y o Ken ucky, Lexing on, KY, USA)
we e used o smoke exposu e. These ciga e es ha e been
epo ed o p oduce 46.8 mg TPM, 29.1 mg a , and 1.896 mg
nico ine pe ciga e e smoked a e HCI egime (Cen e o
Tobacco Re e ence P oduc s, Uni e si y o Ken ucky; 2018).
Ciga e es we e condi ioned a 22°C ±1°C and 60% ±3%
o ela i e humidi y o a leas 48 hou s acco ding o ISO
3402:1999 guidelines. LM1 smoking machine (Bo gwald
KC GmbH, Hambu g, Ge many) was used o smoke wo
pu s o 1R6F ciga e e a e HCI egime, which ensu es a
55 mL, wo-second du a ion bell-shape p o ile, pu e e y
30 seconds wi h il e en blocked. The numbe o pu s
o 1R6F o HTP de i es om ou p e ious expe imen s o
ob ain compa able amoun o nico ine wi h a clinically ele-
an concen a ion.14 Vapo exposu e was ca ied ou using
an HTP, IQOS Lumia (Philip Mo is P oduc s, S am o d, CT,
USA). Te ea “Sienna Selec ion” was used o IQOS Lumia.
Vapo exposu e was pe o med using LM4E aping machine
(Bo gwald KC GmbH). IQOS Lumia was aped using modi-
ied HCI egime wi hou blocking he il e en s, o a oid
he de ice o e hea ing, o wo. The ENDS p oduc ba e ies
we e ully cha ged be o e use.14
Co nea Isola ion and Ai -Liquid In e ace
Exposu e
A e e hical commi ee app o al (Azienda Ospedalie o-
Uni e si a ia Policlinico “G.Rodolico-San Ma co”, n.
83/2023/PO), Human co neal issues we e ob ained om
co nea dono s employed o Desceme s ipping au oma ed
endo helial ke a oplas y. Fo hei su gical use, issues had
o be ansplan ed wi hin six days upon emo al om
he dono . Be o e ansplan a ion he issues we e s o ed
in Isco e’s modi ied Dulbecco’s medium (no. 51471C;
Sigma-Ald ich Co p., S . Louis, MO, USA) a he empe a u e
o 20°C o 31°C. Co neal issue, ob ained om he ou e
co neal laye desc ibed abo e, was exposed o smok-
ing/ aping ae osol a ai -liquid in e ace (ALI). Memb anes
we e placed on 12 mm T answells inse s (Co ning Inco -
po a ed, Co ning, NY, USA), and h ee inse s wo inse s
pe es p oduc we e ansi ioned o he exposu e chambe
wi h 20 mL o PBS in he basal compa men . This exposu e
me hod is he mos physiologically ele an o epi helial
cell lines exposing hem o all ac ions and componen s
o smoke/ apo .15 Mo eo e , 1 nega i e con ol consis s
o 1 seeded inse wi hou apical media (AIR) in he
incuba o .
His opa hological Analysis
Co neal issue was o malin- ixed, pa a in-embedded and
ea ed o his ological examina ion using a s anda d
me hod.16 Two pa hologis s (R.C. and G.B.) sepa a ely e al-
ua ed all his ological slides, blinded o sample iden i y.
His ological ea u es we e assessed on 5 μm- hick sec ions
s ained wi h hema oxylin and eosin (H&E) as p e iously
desc ibed.17
Ex acellula Reac i e Oxygen Species (ROS)
E alua ion
Upon ai -liquid in e ace exposu e, co neal issue was le
in esh media a 37°C, 5% CO2 o 24 hou s. Upon his
ime, he media was collec ed and spun in a cen i uge o
a oid any esidue o in luence he analysis. The e o e he
media was collec ed and incuba ed, a oiding ligh expo-
su e, o 30 minu es a 37 °C wi h 2,7-Dichlo o luo escein
ace a e 10mM (no. 35848; Sigma-Ald ich Co p.). A e his
ime, luo escence in ensi y (λex =505 nm; λem =526 nm)
was assessed by using Syne gy HT (Bio-Tek, Winooski, VT,
USA).
QPCR
Gene exp ession on co nea was assayed by quan i a i e
PCR. Fo his pu pose, Co neal sec ions we e dissol ed in
TRIzol (The mo Fishe Scien i ic, Wal ham, MA, USA). The e-
o e RNA ex ac ion was pe o med by chemical sepa a ion
as p e iously desc ibed.18 The co esponding cDNA was
ob ained by using High-Capaci y cDNA Re e se T ansc ip-
ion Ki (no. 4368814; The mo Fishe Scien i ic) acco ding
o manu ac u e ’s p o ocol. Gene exp ession was analyzed
using B illian III Ul a-Fas SYBR G een QPCR Mas e Mix
(Agilen Technologies, Winooski, VT, USA) and Ro o -Gene
Q 2plex (Qiagen, Hilden, Ge many). Fo each sample, he
ela i e exp ession le el o he mRNA o in e es was de e -
mined by compa ison wi h he con ol housekeeping ibo-
Downloaded om io s.a ojou nals.o g on 11/21/2025
ToxicologicalP o ileo IQOSand1R6FinCo nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 3
TABLE.Lis o he P ime s Used o qPCR
Gene Fo wa d P ime Re e se P ime
GST AAGTTCCAGGACGGAGACCT GCTGGTCCTTCCCATAGAGC
HMOX-1 TGTTGGAGCCACTCTGTTCC GCTCAAAAACCACCCCAACC
IL1βATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA
IL6 GAAAGCAGCAAAGAGGCACT TTTCACCAGGCAAGTCTCCT
PTGS2 CTGGCGCTCAGCCATACAG CGCACTTATACTGGTCAAATCCC
TGFβCGTCTGCTGAGGCTCAAGT CGCCAGGAATTGTTGCTGTA
18S CTTAGAGGGACAAGTGGCG ACGCTGAGCCAGTCAGTGTA
somal RNA 18S using he 2−C me hod. P ime s used o
his assay a e epo ed in he Table.
Sample P epa a ion o P o eomic Analysis
The co nea issue was homogenized in RIPA bu e o
60 seconds using an Ul a-Tu ax homogenize (Janke
and Kunkel, S au en, Ge many) se a maximum speed
(24,000 pm). The p o ein con en was p ecipi a ed wi h
p echilled ace one (−20°C) o 30 minu es. A e cen i u-
ga ion (10,000g), he pelle was esuspended in 8M u ea,
and he p o ein con en was quan i ied using he BCA
assay. The p o ein sul hyd yl g oups we e educed wi h
1.6 mM di hio h ei ol and alkyla ed wi h 7 mM iodoac-
e amide. The samples we e dilu ed wi h 50 mM NH4HCO3 o
a inal u ea concen a ion o 0.8 M; he p o ein con en was
diges ed wi h ypsin a 37°C o 16 hou s (enzyme a io
1:50 w/w). The esul ing samples we e analyzed by liquid
ch oma og aphy–mass spec ome y.
Analysis o T yp ic Diges s by Liquid
Ch oma og aphy–Mass Spec ome y
Hyd oly ic pep ides we e analyzed using a UHPLC sys em
(Dionex Ul iMa e 3000 RSLCnano; The mo Fishe Scien i ic)
coupled wi h an O bi ap Fusion T ib id mass spec om-
e e (Q-OT-qIT) (The mo Fishe Scien i ic). The samples
ob ained by in-solu ion yp ic diges ion we e dilu ed wi h a
5% aqueous FA solu ion. Pep ides we e elu ed on a PepMap
RSLC C18 column (EASYSp ay, 75 μm ×50 cm, 2 μm,
100 Å; The mo Fishe Scien i ic) and sepa a ed by elu ion
a a low a e o 0.250 μL/min, a 40°C, wi h a linea g adi-
en o sol en B(CH
3CN +0.1% FA) in sol en A (H2O+
0.1% FA). The elu ed pep ides we e ionized by nanosp ay
(Easy-sp ay ion sou ce; The mo Fishe Scien i ic) using a
capilla y empe a u e and ol age se o 275°C and 1.7
kV, espec i ely. Pep ide p ecu so scans in he m/z ange
o 400–1600 we e pe o med wi h a esolu ion o 120,000
(200 m/z) wi h an AGC a ge o O bi ap de ec ion o 4.0
×105and a maximum injec ion ime o 50 ms. Tandem
mass spec ome y (MS/MS) spec a we e acqui ed using
a no malized collision ene gy (HCD) o 35. The dynamic
exclusion du a ion was se o 60 seconds wi h a ole -
ance o 10 ppm a ound he selec ed p ecu so and i s
iso opes. The AGC a ge alues and maximum injec ion
ime (ms) o MS/MS spec a we e 1.0 ×104and 100,
espec i ely. The mass spec ome e was calib a ed using
he Pie ce LTQ Velos ESI posi i e ion calib a ion solu-
ion (The mo Fishe Scien i ic). MS da a acquisi ion was
pe o med using Xcalibu so wa e . 3.0.63 (The mo Fishe
Scien i ic).
Mass spec a we e analyzed using MaxQuan so wa e
( e sion 2.5.1.0). The ini ial maximum allowed mass de i-
a ion was se o 6 ppm o monoiso opic p ecu so ions
and 0.5 Da o MS/MS peaks. The enzyme speci ici y was
se o ypsin, de ined as C- e minal o a ginine and lysine,
excluding p oline, wi h a maximum o wo missed clea -
ages allowed. Ca bamidome hylcys eine was se as a ixed
modi ica ion, while N- e minal ace yla ion and me hionine
oxida ion we e se as a iable modi ica ions. Spec a we e
analyzed using he And omeda sea ch engine agains he
homo sapiens Unip o sequence da abase. Quan i ica ion
in MaxQuan was pe o med using he in eg a ed label-
ee quan i ica ion algo i hm based on ex ac ed ion ch o-
ma og ams and using as label- ee quan i ica ion. The alse
disco e y a e was se o 1% a he pep ide le el and 1% a
he p o ein le el, wi h a minimum pep ide leng h o se en
amino acids equi ed. S a is ical analyses we e pe o med
using Pe seus so wa e ( e sion 2.1.3). Only p o eins ha
we e p esen and quan i ied in a leas wo ou o h ee
echnical eplica es we e conside ed posi i ely iden i ied in a
sample and used o s a is ical analyses. The p o ein-p o ein
in e ac ion ne wo k was pe o med using he STRING (h ps:
//s ing-db.o g).
Cell Cul u e and Ai Liquid In e ace Exposu e
Immo alized human co neal epi helial cells (HCEC)
(P10863-IM; Innop o , Bizkaia, Spain) we e cul u ed wi h
endo helial cell medium (P60104; Innop o ) acco ding
o manu ac u e ’s ins uc ion. S a ens Se umins i u Rabbi
Co nea cells (SIRC) (CCL-60; ATCC, Milan, I aly) we e
cul u ed in minimum essen ial medium (The mo Fishe
Scien i ic) supplemen ed wi h 10% e al bo ine se um
(The mo Fishe Scien i ic), 1% penicillin/s ep omycin cock-
ail (The moFishe Scien i ic) and 1% nonessen ial amino
acids (The mo Fishe Scien i ic). Cells we e passaged e e y
wo o h ee days by using ypsin 1x (The mo Fishe Scien-
i ic) and main ained a 5% CO2, 37°C.
Subsequen ly, SIRC we e used as in i o model o es
smoke damage. When he 80% con luency was eached,
he apical medium was emo ed om each inse and wo
inse s pe es p oduc we e ansi ioned o he exposu e
chambe wi h 20 mL o PBS in he basal compa men o
pe o m he ALI exposu e. A nega i e con ol, consis ing o
one seeded inse wi hou apical media (ai ) in he incuba o
was also included.
Sc a ch Assay
Sc a ch assay was pe o med as al eady desc ibed.18 B ie ly,
cells we e seeded in 24-well inse s and cul u ed un il
con luence. A his s age, cells we e exposed ei he o
Downloaded om io s.a ojou nals.o g on 11/21/2025
Toxicological P o ile o IQOS and 1R6F in Co nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 4
obacco o hea ed- obacco smoke using he ALI exposu e
me hod. Cell cul u e was sc aped wi h a 10 μL mic opipe e
ip. Wound closu e was de ec ed a 0, 24, 48, and 72 hou s
using Cy ell cell imaging sys em (Imsol, P es on, UK). The
unco e ed wound a ea was measu ed and quan i ied a
di e en in e als wi h ImageJ 1.37 (NIH, Be hesda, MD,
USA).
S a is ical Analysis
S a is ical analysis was pe o med using P ism So wa e, o
compa ison o n≥3 g oups, one-way o wo-way ANOVA
wi h Holm–Sidak pos hoc es o mul iple compa isons
we e used whe e app op ia e (G aphPad So wa e Inc., San
Diego, CA, USA; RRID: id_000081). Da a a e exp essed as
mean ±SD, unless o he wise s a ed. Fo all s a is ical es s,
P alues <0.05 we e conside ed s a is ically signi ican .
RESULTS
Ciga e e Smoke Exposu e Impai s Co neal
In eg i y
Smoking exposes epi helial issues o se e al chemicals
impai ing issue s uc u e.19 The e o e we sough o assess
he in eg i y o co neal issue 24 hou s a e smoke expo-
su e. Fo hese pu pose issues we e s ained wi h H&E o
assess he in eg i y o he co nea epi helium a e ai , HTP,
and 1R6F exposu e. In e es ingly, ou da a (Fig. 1)showed
no e iden signs o damage a e ai o HTP exposu e.
By con as , co nea exposed o 1R6F, exhibi ed a signi ica-
i e damage on he epi helial (E) bu no on s omal (S)
laye o he issue and al e a ions o he ex acellula ma ix
(Fig. 1). These da a show ha con en ional ciga e e smoke
migh hampe epi helial co neal cells s uc u e on co neal
issue.
FIGURE 1. Co nea cha ac e iza ion. H&E s aining o co neal epi helia. Image has been labeled ma king s oma (S) and epi helium (E)
Rep esen a i e images showing co neal mo phology a e ai , HTP, and 1R6F exposu e. Images a e ep esen a i e o ou di e en eplica es.
Downloaded om io s.a ojou nals.o g on 11/21/2025
ToxicologicalP o ileo IQOSand1R6FinCo nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 5
FIGURE 2. E alua ion o oxida i e s ess and in lamma ion on ou co neal issues. (A) Assessmen o ROS le el on co nea a e h ee hou s’
ai , HTP, and 1R6F exposu e. (B–G) The qPCR e alua ing IL6, IL1B, TGFB, HMOX1, PTGS2, and GSTP1 exp ession on 24 hou s’ exposu e
o ai , HTP, and 1R6F. Images a e ep esen a i e o ou biological eplica es. (*P≤0.05; **P≤0.01; ***P≤0.001; ****P≤0.0001).
Co nea Epi helium Exhibi s Inc eased Oxida i e
S ess A e HTP and 1R6F Exposu e
The obse ed damage on epi helial cells migh be d i en
by he se e al chemicals con ained in smoking, e en ually
igge ing oxida i e s ess on epi helial cells. The e o e we
assessed he le el o ROS eleased in he ex acellula media
o co neal issue 24 hou s a e ai , HTP, and 1R6F expo-
su e (Fig. 2). In e es ingly, a e 1R6F exposu e we obse ed
an inc eased ROS concen a ion in compa ison o ai and
HTP exposu e (Fig. 2A). The e o e, o u he con i m he
oxida i e s ess igge ed by 1R6F exposu e, we sough also
o assess he exp ession o di e en genes in ol ed in he
oxida i e s ess signaling cascade. In e es ingly, qPCR anal-
ysis showed an inc ease in he exp ession o in e leukin-6
(IL6), In e leukin-1β(IL1B); Tumo g ow h ac o -β(TGFB),
heme-oxygenase 1 (HMOX1), p os aglandin-endope oxide
syn hase 2 a e 24 hou s’ 1R6F exposu e compa ed o ai
and HTP coun e pa s (Figs. 2B–F). O no e, we also de ec ed
a ma ked dec eased exp ession o glu a hione S- ans e ase
pi 1 (GSTP1) a e bo h HTP and 1R6F exposu e (Fig. 2G).
The e o e hese da a show ha 1R6F exposu e signi ican ly
inc ease co nea oxida i e s ess and he in lamma o y s a us.
P o eomic Analysis Demons a es a Di e en
Oxida ion Pa e n A e HTP and 1R6F Exposu e
The chemical and physical boos coming om bo h he
HTP and 1R6F exposu e may somehow a ec he p o eome
homeos asis. To moni o di e en ly exp essed p o eins (i
any) upon he ea men o co neal issue wi h HTP and
Downloaded om io s.a ojou nals.o g on 11/21/2025
Toxicological P o ile o IQOS and 1R6F in Co nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 6
FIGURE 3. Mass spec ome y-based p o eomic analysis on co neal issue. (A) Venn diag am showing he di e en ly oxidized p o eins wi hin
he h ee expe imen al g oups. (B) Sequence logo de analysis o he oxidized pep ides, cen e ed on he amino esidues oxidized. In e ac ing
ne wo k o HTP (C) and 1R6F (D) exclusi ely oxidized p o eins (FC >5; adjus ed P≤0.01). (E) Gene on ology anno a ion on biological
p ope ies o he main exclusi ely oxidized p o eins de ec ed o ea men wi h HTP and 1R6F. Images a e ep esen a i e o ou biological
eplica es.
1R6F, we used a p o eomic app oach based on MS. As
many as 524 p o eins we e iden i ied in all he samples
analyzed. Volcano plo s (Supplemen a y Fig. S1) show
ha he e a e no di e en ially exp essed p o eins; his
means ha he p o eomic pa e n o issues exposed o
ai does no signi ican ly change when he co nea samples
we e ea ed wi h he HTPs apo o he ciga e e smoke.
Smoke and apo om HTPs o con en ional ciga e es also
ha bo a ple ho a o highly uns able ee adicals e en-
ually enhancing ROS le els, which migh be esponsible
o he pos - ansla ional modi ica ions (PTMs) o se e al
p o eins. Oxida ion, ni a ion, ci ullina ion, ca bamyla ion
and glycosyla ion a e some o he PTMs mainly induced
by con en ional ciga e es. Oxida ion is he mos signi ican
p ocess among hem, because i can a ec se e al amino
acid esidues (His, Ty , T p, Cys, Me ) and in ol es a ious
o he biological subs a es. The e o e we sough o moni o
he oxida ion o all he p o eins p e iously de ec ed. One
hund ed wen y-nine ou o 524 p o eins a e oxidized in
he sample coming om con ol issues (Fig. 3A). In e es -
ingly, such a alue inc eases o each 186 o 152 p o eins
when co nea is exposed o HTP o 1R6F, espec i ely. A
Downloaded om io s.a ojou nals.o g on 11/21/2025
ToxicologicalP o ileo IQOSand1R6FinCo nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 7
FIGURE 4. The 1R6F exposu e impai s epi helial cell wound closu e abili y. (A) Wound healing assay on HCEC ollowing ALI exposu e o ai ,
HTP and 1R6F. Images a e ep esen a i e o ou ime poin s 0, 24, 48, and 72 hou s. (B) Wound healing assay on SIRC a e ALI exposu e
o ai , HTP and 1R6F. Images a e ep esen a i e o h ee ime poin s 0, 24, and 48 hou s. (C) Quan i ica ion o wound closu e pe cen age
on HCEC and (D) SIRC exposed o ai , HTP and 1R6F. (**P≤0.01; ****P≤0.0001).
de ailed analysis o he p o ein sequence a he oxida-
ion si e shows ha me hionine is he only amino acid
esidue a ec ed by oxida ion unde ou expe imen al condi-
ions (Fig. 3B). Mo eo e , he equency dis ibu ion o all
he o he esidues loca ed in he p oximi y o he oxida-
ion si e plainly excludes he p esence o any consensus
sequence. Ou da a also e eal 18, 61, and 29 di e en ly
oxidized p o eins exclusi ely a ec ed by ai , HTP and 1R6F,
espec i ely (Fig. 3A). Mo eo e , 11 p o eins we e commonly
oxidized by ai and HTP, whe eas nine we e oxidized by
bo h ai and 1R6F (Fig. 3A). Fu he mo e, 91 p o eins we e
oxidized by all h ee expe imen al condi ions, whe eas 23
we e oxidized by HTP and 1R6F (Fig. 3A).
To in es iga e he g oups o p o eins exclusi ely oxidized
in he ai , HTP and 1R6F samples, we he e o e pe o med
a ne wo k analysis. The oxidized p o eins om ai do no
show a speci ic ne wo k clus e (Supplemen a y Fig. S2).
On he o he hand, he ou pu coming om he HTP-
ea ed sample e eals a peculia clus e o p o eins oxidized
(Fig. 3C) which mos ly di e s om ha o igina ed by he
p o eins oxidized in he 1R6F sample (Figs. 3D, 3E). Wi h
ou da a aken oge he , we showed ha bo h HTP and
1R6F p o oundly change he oxida ion pa e n o co neal
epi helia.
The 1R6F and HTP Exposu e Impai Human and
Rabbi Co neal Epi helial Cells Wound Healing
Gi en he e idence collec ed on co neal issues we sough o
assess he impac o HTP and 1R6F exposu e on wo di e -
en in i o models o human and abbi co neal epi helial
cells. The e o e we pe o med a sc a ch assay o e alua e
how ai , HTP, and 1R6F a ec cell p oli e a ion (Figs. 4A, 4B).
Measu ing he wound closu e pe cen age on HCEC we
obse ed a comple e closu e upon 72 hou s o cells exposed
o ai and HTP. In e es ingly, 1R6F-exposed cells we e no
able o close he wound (Fig. 4C). Once exposed o ai and
HTP, SIRC comple ely closed he wound in 48 hou s. The
1R6F-exposed cells, on he o he hand, we e no able o close
he wound a his ime poin (Fig. 4 D). O e all, hese da a
show ha 1R6F exposu e impai s wound healing abili y o
HCEC and SIRC.
DISCUSSION
Tobacco smoke ha bo s a complex mix u e o di e en
chemicals, e en ually being esponsible o he oxida i e
s ess cha ac e izing smoke s.20 As a consequence, smoke
has been associa ed o se e al pa hologies cha ac e ized by
an enhanced in lamma o y esponse.21 Among hem, se e al
ocula diseases ha e been linked o he oxic e ec s o
smoke exposu e on co neal epi helium, in u n igge ing an
in lamma o y and oxida i e s ess esponse.22 In he la es
yea s, no el de ices named HTPs, eme ged as a po en-
ial al e na i e o con en ional ciga e es, e en ually educ-
ing he exposu e o ciga e es’ ha m ul chemical compo-
nen s.11 The e o e HTPs eme ged as a combus ion- ee nico-
ine deli e y sys em conside ed o smoking ha m educ ion,
in u n also eleasing an ae osol expec ed o be much less
oxic o he eye.11 To in es iga e his aspec , we explo ed he
impac o con en ional ciga e es and HTPs on he co nea
by using s anda d and clinically ele an condi ions.
Downloaded om io s.a ojou nals.o g on 11/21/2025
Toxicological P o ile o IQOS and 1R6F in Co nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 8
By H&E s aining we de ec ed signi ican damage o
human co neal epi helial cells a e con en ional ciga e e
exposu e, cha ac e ized by a signi ican spall o he ou e
a ea o he co nea i sel . This ou come migh be ela ed o
he la ge amoun o oxida i e chemicals in ciga e es, which
ha e been ex ensi ely epo ed o lead o se e e issue
damage.23 In pa icula , ciga e e smoke has been desc ibed
as a majo isk ac o o pulmona y ib osis h ough a
mechanism in ol ing al e a ions in al eola epi helial cells,
e en ually becoming mo e pe meable, dec easing su ac-
an p oduc ion, and mis egula ing in lamma o y cy okines
and g ow h ac o p oduc ion.24 Fu he insigh highligh ed
he mechanisms o such an issue as elying on neu ophils
and monocy es, which, once ac i a ed, impai issue a chi-
ec u e by deg ada i e enzymes de i ed om such in lam-
ma o y cells.25 In lamma ion and oxida i e s ess, he e-
o e, a e wo o he main issue associa ed o smoke, which
migh also be esponsible o issue damage.24,25 Co obo-
a ing his, ou da a show a signi ica i e enhancemen o
ROS concen a ion ollowing 1R6F exposu e, suppo ed by
an inc eased exp ession o IL6, IL1B, TGFB, HMOX1, and
PTGS2, bu no o GSTP1, in u n dec eased upon expo-
su e o con en ional ciga e es. These ou comes a e ela -
able o he di e en wo ks cha ac e izing issues associa ed
o ciga e e smoke and claiming a signi ica i e numbe o
highly uns able ee adicals inc easing ROS p oduc ion and
he e o e leading o an enhancemen o oxida i e s ess and
in lamma ion.1,20,26 Co obo a ing ou analysis i has been
also epo ed ha in lamma o y and oxida i e ma ke s as
IL6, IL1B, TGFB, HMOX1 and PTGS2 a e up egula ed by
con en ional ciga e e in di e en models.27–30 In e es ingly,
GSTP1 down egula ion has been associa ed o be induced
ollowing a d ama ic inc ease in ROS concen a ion as he
one we obse ed ollowing 1R6F exposi ion.31 O no e, he
same end was no e idenced o HTP, which did no
al e IL6, IL1B, TGFB, HMOX1, and PTGS2 exp ession o
hose ma ke s. In e es ingly, p olonged in lamma ion in he
co nea is associa ed wi h pe sis en epi helial de ec , e en-
ually linking abagism wi h an inc eased isk o eye- ela ed
diseases.32 The inc eased oxida i e s ess migh also lead o
pos - ansla ional modi ica ions, e en ually a ec ing se e al
pa hways which migh impai co neal homeos asis. The MS-
based p o eomic in es iga ion a e 1R6F and HTP expo-
su e e ealed se e al p o eins di e en ly oxidized by HTP
and con en ional ciga e es. O no e, he oxidized p o eins
om ai do no show a speci ic ne wo k clus e meaning
ha he oxida ion p ocess migh ha e an unspeci ic o igin,
like he na u al p opensi y o me hionine o be oxidized
du ing he sample ea men . The oxida ion induced by
HTP, on he o he hand, mainly add esses p o eins linked
o he ubulin and myosin ne wo ks HTP, whe eas 1R6F
mainly a ec s he oxida ion o collagen chains and ex acel-
lula p o ein componen s. In e es ingly, i has been epo ed
ha , once oxidized, collagen ne wo k impai s connec i e
issue, an e en usually associa ed o aging and e en u-
ally suppo ing he esul s we obse ed by H&E s aining.33
On he o he hand, we ound ubulin, myosin and ac in
among he p o eins oxidized by HTP, an ou come ela ed
o cy oskele on ea angemen .34 In e es ingly, u he unc-
ional app oach aiming o p o ide he ou comes gi en by
p o ein oxida ion on hei unc ionali y would be he gold
s anda d o dissec he impac o ciga e e smoke and HTPs
impac on co neal p o eome. Mo eo e , we also assayed he
impac o con en ional ciga e es and HTP on an in i o
model o abbi epi helial co neal cells. The de ec ion o
wound closu e a e he exposi ion un eiled a simila end
o human and abbi co neal epi helial cells exposed o ai
o HTP, whe eas 1R6F-exposed cells we e impai ed in hei
abili y o closing he wound. The impai men in wound heal-
ing migh be ela able o he signi ican amoun o ROS ig-
ge ed by 1R6F exposi ion, as co obo a ed by he in i o
da a ob ained on a model zeb a ish (Danio Re io)la a.
35
The e o e he s ess induced by ciga e es migh also impai
cell p oli e a ion and hei abili y in closing he wound.
Ou da a, based on wo di e en expe imen al models,
demons a ed using s anda d and clinically ele an condi-
ions ha smoking has o be accoun ed as a isk ac o
o epi helial co nea ela ed diseases. Smoke migh indeed
igge ch onic in lamma ion, delaying wound healing and
exace ba ing d y eye synd ome by educing ea p oduc ion
and damaging he ocula su ace. Fu he mo e, chemicals in
obacco smoke can ha m he co neal epi helium and impai
i s unc ion.36 Co obo a ing his, we show he e ha con en-
ional ciga e es enhance oxida i e s ess, in u n oxidizing
se e al p o eins downs eam. As a esul , he epi helium
unde goes a signi ica i e damage, showing also a ma ked
g ade o in lamma ion. In his con ex , e en i HTP migh
ep esen a aluable al e na i e o con en ional ciga e es,
bo h he smoking app oaches a e oxida i e s ess induc-
e s ha an in-deep p o eomic in es iga ion o PTMs clea ly
e ealed. This is he eason why qui ing smoke emains he
mos eliable s a egy o a oid smoke- ela ed complica ions.
Acknowledgmen s
This wo k has been conduc ed hanks o ools and high-end
equipmen p ope y o and kindly p o ided ee o cha ge by
ECLAT S l, a spin-o o he Uni e si y o Ca ania ha deli e s
solu ions o global heal h p oblems wi h pa icula emphasis
on ha m minimiza ion and echnological inno a ion. This wo k
was unded by he esea che s suppo ing p ojec unds (No.
RSP2024R261), King Saud Uni e si y, Riyadh, Saudi A abia. The
au ho s g a e ully acknowledge he Bio-nano ech Resea ch and
Inno a ion Towe (BRIT) inanced by I alian Minis y o Educa-
ion e and Resea ch (MIUR).
Au ho S a emen : RP is p o esso o Medicine and Di ec o o
he Ins i u e o In e nal Medicine a Ca ania Uni e si y. He has
ecei ed he ollowing EU and go e nmen al compe i i e g an s:
U-BIOPRED, AIR-PROM, In eg al Rheuma ology & Immunol-
ogy Specialis s Ne wo k (IRIS), and Minis e o dell Uni e si a’
e della Rice ca (MUR) PNRR 3277/2021, PNRR 341/2022, and
PNRR 411/2021 unded by Nex Gene a ionEU o he Eu opean
Commission. He has also ecei ed in es iga o ini ia ed g an s
om Founda ion o a Smoke F ee Wo ld, P ize , GlaxoSmi hK-
line, CV The apeu ics, Neu oSea ch A/S, Sandoz, Me k Sha p &
Dohme, Boeh inge Ingelheim, No a is, A bi G oup S l., Duska
The apeu ics, and Fo es Labo a o ies. He is ounde o he
Cen e o Tobacco P e en ion and T ea men and o he Cen e
o Excellence o he Accele a ion o Ha m Reduc ion a Ca a-
nia Uni e si y. He has been consul ing o P ize , Boeh inge
Ingelheim, Duska The apeu ics, Fo es Labo a o ies, CV The a-
peu ics, Se mo Inc., GRG Heal h, Cla i a e Analy ics, Guidepoin
Expe Ne wo k, and GLG G oup. He ecei es ex books oyal-
ies om Else ie and EDRA. He is also Chai o he Eu opean
Technical Commi ee o S anda diza ion on “Requi emen s and
es me hods o emissions o elec onic ciga e es” (CEN/TC
437; WG4) and scien i ic ad iso a RIDE2Med Founda ion.
Disclosu e: S. Giallongo,None;F. Bellia,None;A. Russo,
None; M. Fallico,None;R. Polosa,None;N. Cas ellino,None;
A. Longo,None;R. Emma,None;K. Pa sine elos,None;
M. Ca uso,None;A.S. Ka asasmi a,None;G. S e azzo,
Downloaded om io s.a ojou nals.o g on 11/21/2025
ToxicologicalP o ileo IQOSand1R6FinCo nea IOVS | Ap il 2025 | Vol. 66 | No. 4 | A icle 4 | 9
None; I.A. Ba bagallo,None;R. Cal abiano,None;G. B oggi,
None; A.M. Alanazi,None;G. Li Vol i,None
Re e ences
1. Emma R, Ca uso M, Campagna D, Pul i en i R, Li Vol i
G. The impac o obacco ciga e es, aping p oduc s and
obacco hea ing p oduc s on oxida i e s ess. An ioxidan s.
2022;11:1829.
2. Rashidi M, Mohammadpoo asl A, Sahebihagh MH. En i on-
men al obacco smoke and educa ional sel - egula ion and
achie emen in i s g ade high school s uden s. JMedLi e.
2020;13:229–234.
3. Come o-Muniz JE, Cain WS. Senso y i i a ion. Rela ion
o indoo ai pollu ion. Ann N Y Acad Sci. 1992;641:137–
151.
4. Pe ez-de-A celus M, Toledo E, Ma inez-Gonzalez MA,
Ma in-Cal o N, Fe nandez-Mon e o A, Mo eno-Mon anes
J. Smoking and incidence o glaucoma: The SUN Coho .
Medicine. 2017;96:e5761.
5. Velilla S, Ga cia-Medina JJ, Ga cia-Layana A, e al. Smoking
and age- ela ed macula degene a ion: e iew and upda e.
J Oph halmol. 2013;2013:895147.
6. Ta iq MA, Amin H, Ahmed B, Ali U, Mohiuddin A. Associa-
ion o d y eye disease wi h smoking: a sys ema ic e iew
and me a-analysis. Indian J Oph halmol. 2022;70:1892–
1904.
7. Raju P, Geo ge R, Ve Ramesh S, A ind H, Baska an M,
Vijaya L. In luence o obacco use on ca a ac de elopmen .
B J Oph halmol. 2006;90:1374–1377.
8. Chung SM, Gay CA, McC a y JA, 3 d. Nona e i ic ischemic
op ic neu opa hy. The impac o obacco use. Oph halmol-
ogy. 1994;101:779–782.
9. Toll BA, Rojewski AM, Duncan LR, e al. “Qui ing smok-
ing will bene i you heal h”: he e olu ion o clinician
messaging o encou age obacco cessa ion. Clin Cance Res.
2014;20:301–309.
10. Upadhyay S, Rahman M, Johanson G, Palmbe g L, Ganguly
K. Hea ed obacco p oduc s: insigh s in o composi ion and
oxici y. Toxics. 2023;11:667.
11. Polosa R, Mo ja ia JB, P ospe ini U, e al. Heal h ou comes
in COPD smoke s using hea ed obacco p oduc s: a 3-yea
ollow-up. In e n Eme g Med. 2021;16:687–696.
12. A anyosi JK, Galgoczi E, E dei A, e al. Di e en e ec s
o ciga e e smoke, hea ed obacco p oduc and e-ciga e e
apou on o bi al ib oblas s in G a es’ o bi opa hy; a s udy
by eal ime cell elec onic sensing. Molecules. 2022;27:
3001.
13. Mak ynio i D, Zago i i Z, Kou sojannis C, Mo gan PB,
Lagoumin zis G. Ocula condi ions and d y eye due o adi-
ional and new o ms o smoking: A e iew. Con Lens An e-
io Eye. 2020;43:277–284.
14. Ca uso M, Emma R, Dis e ano A, e al. Elec onic nico ine
deli e y sys ems exhibi educed b onchial epi helial cells
oxici y compa ed o ciga e e: he Replica P ojec . Sci Rep.
2021;11:24182.
15. Azzopa di D, Haswell LE, Foss-Smi h G, e al. E alu-
a ion o an ai -liquid in e ace cell cul u e model o
s udies on he in lamma o y and cy o oxic esponses o
obacco smoke ae osols. Toxicol In Vi o. 2015;29:1720–
1728.
16. B oggi G, Ve zi AE, Cal abiano R, Micali G, Laca -
ubba F. Co ela ion be ween in i o e lec ance con ocal
mic oscopy and ho izon al his opa hology in skin cance : a
e iew. F on Oncol. 2021;11:653140.
17. B oggi G, Sal a o elli L, Reibaldi M, e al. Soli a y ib ous
umo o he o bi al egion: epo o a case wi h
emphasis on he diagnos ic u ili y o STAT-6. Pa hologica.
2020;112:195–199.
18. Longhi ano L, Giallongo S, O lando L, e al. Lac a e ew i es
he me abolic ep og amming o u eal melanoma cells and
induces quiescence pheno ype. In J Mol Sci. 2022;24:24.
19. Yamaguchi NH. Smoking, immuni y, and DNA damage.
T ansl Lung Cance Res. 2019;8:S3–S6.
20. Cali i AW, Tommasi S, Besa a inia A. Rela ionships among
smoking, oxida i e s ess, in lamma ion, mac omolecu-
la damage, and cance . Mu a Res Re Mu a Res.
2021;787:108365.
21. Lee J, Taneja V, Vassallo R. Ciga e e smoking and in lam-
ma ion: cellula and molecula mechanisms. J Den Res.
2012;91:142–149.
22. Kulka ni A, Banai S. Th ough he smoke: an in-dep h
e iew on ciga e e smoking and i s impac on ocula heal h.
Cu eus. 2023;15:e47779.
23. Soleimani F, Doba ada an S, De-la-To e GE, Schmid TC,
Saeedi R. Con en o oxic componen s o ciga e e, ciga e e
smoke s ciga e e bu s: a comp ehensi e sys ema ic
e iew. Sci To al En i on. 2022;813:152667.
24. Checa M, Hagood JS, Velazquez-C uz R, e al. Ciga e e
smoke enhances he exp ession o p o ib o ic molecules in
al eola epi helial cells. PLoS One. 2016;11:e0150383.
25. McCuske K. Mechanisms o espi a o y issue inju y om
ciga e e smoking. Am J Med. 1992;93:18S–21S.
26. Isik B, Ceylan A, Isik R. Oxida i e s ess in smoke s and
non-smoke s. Inhal Toxicol. 2007;19:767–769.
27. Aldaham S, Foo e JA, Chow HH, Hakim IA. Smoking
s a us e ec on in lamma o y ma ke s in a andomized
ial o cu en and o me hea y smoke s. In J In lam.
2015;2015:439396.
28. Chu g A, Zhou S, Wang X, Wang R, W igh JL. The ole
o in e leukin-1be a in mu ine ciga e e smoke-induced
emphysema and small ai way emodeling. Am J Respi Cell
Mol Biol. 2009;40:482–490.
29. Baglole CJ, Sime PJ, Phipps RP. Ciga e e smoke-induced
exp ession o heme oxygenase-1 in human lung ib oblas s
is egula ed by in acellula glu a hione. Am J Physiol Lung
Cell Mol Physiol. 2008;295:L624–636.
30. Ma ey CA, Pollock SJ, Tu ne CK, e al. Ciga e e smoke
induces cyclooxygenase-2 and mic osomal p os aglandin E2
syn hase in human lung ib oblas s: implica ions o lung
in lamma ion and cance . Am J Physiol Lung Cell Mol Phys-
iol. 2004;287:L981–991.
31. Singh RR, Mohammad J, O M, Reindl KM. Glu a hione
S- ans e ase pi-1 knockdown educes panc ea ic duc al
adenoca cinoma g ow h by ac i a ing oxida i e s ess
esponse pa hways. Cance s. 2020;12:1501.
32. Du a T, Sangwan J, Mondal M, e al. P olonged in lam-
ma ion and in ec ious changes in he co neal epi he-
lium a e associa ed wi h pe sis en epi helial de ec (PED).
Pa hogens. 2023;12:261.
33. Hen o in Y, Debe g M, Ma hy-Ha e M, Deby-Dupon G.
Biochemical bioma ke s o oxida i e collagen damage. Ad
Clin Chem. 2009;49:31–55.
34. Fa ah ME, Si o kin V, Haa e B, Kakhniash ili D, Ambe g
DC. Di e se p o ec i e oles o he ac in cy oskele on du ing
oxida i e s ess. Cy oskele on. 2011;68:340–354.
35. Al a ez M, Cha ez MN, Mi anda M, Aedo G, Allende
ML, Egana JT. A no el in i o model o s udy impai ed
issue egene a ion media ed by ciga e e smoke. Sci Rep.
2018;8:10926.
36. Xiao C, Wu M, Liu J, e al. Acu e obacco smoke exposu e
exace ba es he in lamma o y esponse o co neal wounds
in mice ia he sympa he ic ne ous sys em. Commun Biol.
2019;2:33.
Downloaded om io s.a ojou nals.o g on 11/21/2025
