scieee Science in your language
[en] (orig)

Determination of Phenotypic and Molecular detection of mecA and mecC genes in Staphylococcus aureus isolated from patients admitted in an emergency unit of a tertiary healthcare facility in Lagos, Nigeria

Author: Idakari, Chinedu Nweke; Emelobe, Godwin Macueley; Nwosu, Patrick Chinazam; Uche-Omovoh, Ifeoma Cecilia; Agwu, Ikechukwu Francis; Ene, Chidiebere Brown; Akpa, Winifred Chinwendu; Akpa, Christian Obasi; Chioma, Ogochukwu; Ezekwesili, Ngozi Maryjane; Amagwu
Publisher: Zenodo
DOI: 10.5281/zenodo.17699153
Source: https://zenodo.org/records/17699153/files/GSCBPS-2025-0413.pdf
 Co esponding au ho : Chinedu Nweke Idaka i
Copy igh © 2025 Au ho (s) e ain he copy igh o his a icle. This a icle is published unde he e ms o he C ea i e Commons A ibu ion License 4.0.
De e mina ion o Pheno ypic and Molecula de ec ion o mecA and mecC genes in
S aphylococcus au eus isola ed om pa ien s admi ed in an eme gency uni o a
e ia y heal hca e acili y in Lagos, Nige ia
Chinedu Nweke Idaka i 1, *, Godwin Macueley Emelobe 2, Pa ick Chinazam Nwosu 3, I eoma Cecilia Uche-
Omo oh 4, Ikechukwu F ancis Agwu 5, Chidiebe e B own Ene 6, Wini ed Chinwendu Akpa 7, Ch is ian Obasi
Akpa 8, Ogochukwu Chioma 9, Ngozi Ma yjane Ezekwesili 10, Chinedum Ch is abel Amagwu 11, Uchenna
Samuel Okpa aoka 12 and Ogechukwu Rejoice Idaka i 13
1 Depa men o Medical Mic obiology and Pa asi ology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki
(AEFUTHA) Ebonyi S a e, Nige ia.
2 Depa men o Medical Mic obiology and Pa asi ology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki
(AEFUTHA), Ebonyi S a e, Nige ia.
3 Clinical Lead Rehabili a ion and Quali y Depa men / San Remo Nu sing and Rehabili a ion Cen e 3550 Shiloh Road,
Ga land Texas, USA.
4 Depa men o Obs e ics and Gynaecology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki, Ebonyi S a e,
Nige ia.
5 Depa men o Medical Mic obiology and Pa asi ology, Uni e si y o Uyo Teaching Hospi al, Uyo Akwa Ibom S a e,
Nige ia.
6 Depa men o Medical Mic obiology and Pa asi ology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki
Ebonyi S a e, Nige ia.
7 Depa men o Medical Mic obiology and Pa asi ology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki
(AEFUTHA.
8 Depa men o Communi y Medicine Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki (Abakaliki), Ebonyi
S a e, Nige ia.
9 Depa men o Su ge y, Fede al Medical Cen e Ke i Nasa awa.
10 Depa men o Medical Mic obiology and Pa asi ology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki
(AEFUTHA.
11 Depa men o Medical Mic obiology and Pa asi ology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki.
12 Depa men o Ana omic Pa hology, Alex-Ekwueme Fede al Uni e si y Teaching Hospi al Abakaliki (AEFUTHA), Ebonyi
S a e, Nige ia.
13 Depa men o Ci il Law, Facul y o Law, Ebonyi S a e Uni e si y, Abakaliki Ebonyi S a e Nige ia.
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
Publica ion his o y: Recei ed on 18 Sep embe 2025; e ised on 19 Oc obe 2025; accep ed on 22 Oc obe 2025
A icle DOI: h ps://doi.o g/10.30574/gscbps.2025.33.1.0413
Abs ac
Backg ound: S aphylococcus au eus is a G am-posi i e bac e ia pa hogen esponsible o bo h communi y acqui ed
and heal hca e associa ed in ec ions. Me hicillin- esis an S. au eus (MRSA) emains a signi ican global heal h conce n
due o i s high mo bidi y and mo ali y. This s udy in es iga ed he pheno ypic and molecula de ec ion o mecA and
mecC genes in S. au eus isola es om pa ien s admi ed o he eme gency uni o a e ia y heal hca e acili y in Lagos,
Nige ia.
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
288
Me hods: This is a c oss-sec ional s udy conduc ed in an eme gency uni o Lagos Uni e si y Teaching Hospi al Idi-
A aba Lagos. Consen ing adul pa ien s admi ed in eme gency uni we e en olled in o he s udy. I was conduc ed
be ween Is June, 2019 o 30 h May, 2020.
Resul : A o al o 300 pa ien s clinically diagnosed wi h in ec ions we e ec ui ed o he s udy. S aphylococcus au eus
was iden i ied as he causa i e agen in 43 o hese cases. Female pa ien s cons i u ed 51.2% o hose in ec ed, while
males accoun ed o 48.8%. The p e alence o me hicillin- esis an S aphylococcus au eus (MRSA) among he isola es
was 41.8%. All MRSA isola es ca ied he mecA gene, and one isola e was ound o possess bo h mecA and mecC genes.
Conclusion: The obse ed high p e alence o MRSA and he p esence o bo h mecA and mecC genes highligh he
epidemiological signi icance o his s udy. Con inuous an ibio ic esis ance moni o ing and ou ine sc eening o
me hicillin- esis an S aphylococcus au eus a e he e o e s ongly ecommended.
Keywo ds: S aphylococcus au eus; mecA; MRSA; Pa ien s; An ibio ics
1. In oduc ion
S aphylococcus au eus a e g am posi i e bac e ia ha majo ly causes communi y and heal h ca e associa ed in ec ions.
I is a common human pa hogen ha is able o elici a wide ange o in ec ions, including skin and so issue in ec ions,
oxin-media ed diseases, and pneumonia [1]. S. au eus exhibi s inc easing i ulence and esis ance o a ious
an ibio ics, complica ing p e en ion and ea men o in ec ions [1,2]. Howe e , o he pas ew decades, S. au eus has
been mo e and mo e di icul o ea because o i s cons an e olu ion and esis ance o ea men wi h d ugs such as
me hicillin and ancomycin [3].
Me hicillin esis an S aphylococcus au eus (MRSA) is a subs an ial public heal h p oblem wo ldwide causing signi ican
mo bidi y and mo ali y and in la ed heal h ca e cos s [4]. I is conside ed a majo heal h p oblem o many yea s, MRSA
has been conside ed he p o o ype o mul i- esis an hospi al acqui ed pa hogens, which causes in ec ions in high- isk,
hospi alized pa ien s [5]. MRSA is one o he majo causes o bo h hospi al and communi y acqui ed in ec ions in
humans, [6], esis ance o S aph au eus o me hicillin occu s due o he acquisi ion o mecA gene ha is ca ied on a
la ge mobile gene ic elemen o he s aphylococcal casse e ch omosome and which encodes a low a ini y penicillin
binding p o ein 2a (PBP2a) o β-lac am an ibio ics excep he i h-gene a ion cephalospo ins, he mecA gene complex
also con ains inse ion si es o plasmids and ansposons ha acili a e acquisi ion o esis ance o o he an ibio ics
such as e y h omycin, clindamycin, gen amicin, co imoxazole, and cip o loxacin [7], he p esence o mecC genes may
also media e me hicillin esis ance. Me hicillin esis an S aph. au eus causes skin and so issue in ec ions, blood
s eam in ec ion, in ec i e endoca di is, os eoa h i is, pleu opulmona y in ec ions, p os he ic de ice in ec ions and
espi a o y ac in ec ions, MRSA is equally esponsible o oxin media ed diseases. MRSA in ec ions ha e been
epo ed o be esponsible o inc eased leng h o hospi aliza ion, economic issues, and high mo ali y a e. A numbe
o in es iga ions ha e epo ed ha S. au eus is among he mos equen ly encoun e ed bac e ial species in
mic obiology labo a o ies in Nige ia [8,9]. In he pas an ibio ic suscep ibili y es ing o S. au eus in Nige ia was based
on pheno ypic es ing especially he disk di usion echnique which is now accompanied wi h he use o PCR o
de ec ion o he speci ic genes (mecA and mecC genes) o he iden i ica ion and con i ma ion o MRSA [10]. The
inc ease o MRSA has caused esea che s o end mo e owa ds s udies o he na u e o genes encoding esis ance o
me hicillin and o he an ibio ics and he mechanism by which hese genes sp ead and e ol e. Howe e , due o changes
in he heal hca e sys em along wi h he e olu ion o he mic oo ganisms, MRSA can now also be conside ed a majo
cause o communi y-acqui ed in ec ions (CA-MRSA) [5].
Signi ican inc ease in he p e alence and eme gence o MRSA is a se ious public heal h conce n and has a se ious
nega i e impac on medical p ac ices [11].
The e was an es ima e o 94,360 in asi e MRSA in ec ions in he Uni ed S a es in 2005, causing mo e han 18,000 dea hs
pe yea [12]. Me hicillin- esis an S. au eus p e alence has inc eased o e he las 10 yea s; MRSA- ela ed hospi al
discha ges ha e doubled o e 10 yea s, wi h hospi al discha ges o MRSA skin and so issue in ec ion ipling since
2004 [13].
2. P oblem s a emen
Me hicillin Resis an S aphylococcus au eus (MRSA) is a majo public heal h conce n and is esponsible o bo h hospi al
and communi y associa ed in ec ions wo ldwide, MRSA inc eases he use o medical esou ces, as well as cos o
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
289
ea men and du a ion o heal hca e associa ed and communi y associa ed s aphylococcal in ec ions, i is also one o
he majo causes o high mo ali y and hospi aliza ion a es. These a e majo public heal h p oblems wo ldwide,
especially in de eloping coun ies whe e in ec ion a es a e highe due o o e c owding, poo in ec ion p e en ion and
con ol p ac ices, an ibio ics misuse and o he s leading o e olu ion and sp ead o me hicillin esis an s ain.
2.1. Jus i ica ion o he s udy
Based on he inc eased incidence o me hicillin esis an s aphylococcal in ec ions Wo ldwide i is impo an o s udy
he sp ead o me hicillin esis an S aphylococcus au eus, also o de ec and unde s and he na u e o genes encoding
esis ance. To help imp o e on ou p e en ion and con ol p ac ices and help in p ope ea men o he pa ien s
posi i e o MRSA in he adul wa d o Lagos Uni e si y Teaching Hospi al.
This s udy aimed a de e mining bo h pheno ypic and molecula cha ac e is ic o me hicillin esis an S aphylococcus
au eus isola ed om adul pa ien s admi ed in an eme gency uni o a e ia y heal hca e acili y in Lagos, Nige ia.
2.2. S udy a ea
This s udy was unde aken a he adul medical eme gency uni s o he Lagos Uni e si y Teaching Hospi al (LUTH) Idi-
A aba, Lagos s a e, Nige ia. This is one o he la ges hospi als in he coun y and i is cosmopoli an ci y in Nige ia. The
s udy pa icipan s we e ec ui ed om pa ien s on admission he adul medical wa d o LUTH.
2.3. S udy design
This s udy was a c oss-sec ional s udy o all he pa ien s a bo h male and emale adul s in he medical eme gency uni
o Lagos Uni e si y Teaching Hospi al Idi-A aba, Lagos. Samples we e collec ed om pa ien s based on he na u e and
si e o in ec ion be o e adminis a ion o an ibio ics. Mac oscopy, mic oscopy, cul u e and sensi i i y es ing was ca ied
ou on he specimens, Mul iplex PCR o mecA and mecC gene de ec ion was hen ca ied ou on S aphylococcus au eus
isola es ha we e posi i e o esis ance es ing using ce oxi in disc di usion es .
2.4. Type o samples collec ed
Clinically ele an samples including blood, u ine, wound swab, wound biopsy, spu um was collec ed based on he
na u e and si es o in ec ion in o de o inc ease he chances o isola ing he pa hogen o in e es .
2.5. Rec ui men o pa ien s
Adul s on admission in eme gency uni we e ec ui ed o his s udy a e in o med consen . Demog aphic da a and
clinical in o ma ion o pa ien s was ob ained om he pa ien ’ medical eco d ile.
2.6. Inclusion c i e ia
All adul pa ien s wi h clinical diagnoses o in ec ions we e en olled in o he s udy
2.7. Exclusion c i e ia
Pa ien s wi hou clinical diagnoses o in ec ions we e exemp ed om he s udy
3. Tools and echniques o sample and da a collec ion
3.1. Ques ionnai e
A s uc u ed ques ionnai e was adminis e ed o pa ien s o ob ain demog aphic and medical eco d e iew which
cap u ed da a on age, sex and clinical symp oms and leng h o hospi aliza ion o he pa ien s.
3.2. Sample Collec ion and T anspo
Blood cul u e bo le was gi en o he a ending physicians o collec blood sample om adul s on admission ollowing
examina ion by he a ending physician. S e ile bo le was gi en o pa ien s wi h u ina y ac in ec ions o u ine
sample collec ion. Wound swabs we e collec ed om pa ien s wi h any o m o skin and so issues in ec ions, pus,
ce eb ospinal luid and all samples collec ed was anspo ed o he Mic obiology labo a o y o he Lagos Uni e si y
Teaching Hospi al o immedia e p ocessing.
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
290
3.3. Quali y Con ol
Quali y con ol s ains we e ob ained om Depa men o Medical Mic obiology, College o Medicine Uni e si y o
Lagos. Quali y con ol o An imic obial Suscep ibili y Tes ing was ca ied ou acco ding o he clinical Labo a o y
S anda ds Ins i u e (CLSI) guidelines using ATCC 43300 S. au eus as con ol s ain [14].
3.4. Labo a o y Specimen P ocessing
SPUTUM, WOUND BIOPSY, URINE, WOUND SWAB SPECIMEN PROCESSING
Specimens we e inocula ed on chocola e (incuba ed unde 5% ca bon dioxide o 24hou s) and MacConkey aga
(incuba ed unde 37ºC o 24hou s).
3.5. Blood Cul u e P ocessing
Incuba ed he blood cul u e bo les in he BACT ALERT machine a 37ºc, subcul u e b o h om a posi i e lagged on
chocola e (incuba ed unde 5% ca bon dioxide o 24hou s) and MacConkey aga (incuba ed unde 37ºC o 24hou s).
Bo les wi h no mic obial ac i i ies lagged nega i e on he 5 h day o being loaded in he machine
3.6. Iden i ica ion
The iden i ica ion o he S aphylococcus au eus was con i med by s anda d me hods including, g ow h on manni ol sal
aga , colony mo phology, G am s ain and biochemical cha ac e is ics. G am posi i e cocci isola es we e subjec ed o
ca alase es and all g am-posi i e ca alase posi i e isola es we e subjec ed o coagulase es . Ca alase and Coagulase
posi i e o ganisms we e iden i ied as S. au eus while coagulase- nega i e o ganisms will be iden i ied as coagulase-
nega i e s aphylococcus.
3.7. Manni ol sal Aga
Manni ol sal aga is a selec i e and di e en ial medium i con ains high concen a ion o (abou 7.5-10%) o sal (NaCl)
which is inhibi o y o mos bac e ia, making i selec i e o g am posi i e bac e ia (S aph au eus, En e ococcus) ha
can ole a e high sal concen a ion.
S aphylococcus au eus p oduces yellow colonies wi h yellow zones while coagulase nega i e S aph p oduces pink o ed
colonies wi h no change o he medium
3.8. Ca alase Tes
• P ocedu e: A d op o 3% hyd ogen pe oxide solu ion was placed on a clean, glass slide; he edge o ano he
clean slide was used o pick he es o ganism. The o ganism was dipped in o hyd ogen pe oxide. Bubble
o ma ion was ega ded as posi i e.
• P inciple: he enzyme ca alase p oduced by he isola e media es he b eakdown o he hyd ogen pe oxide in o
oxygen and wa e leading o p oduc ion o bubbles.
3.9. Coagulase Tes
Coagulase es was pe o med o di e en ia e coagulase posi i e cocci (S aphylococcus au eus) om coagulase nega i e
S aphylococci.
• P ocedu e: colony was placed on a clean, glass slide 10ul o human plasma was added. This was ocked o
some ew minu es and he p esence o agglu ina ion indica ed a posi i e eac ion.
• P inciple; coagulase is an enzyme-like p o ein, i causes he plasma o clo by con e ing ib inogen o ib in.
3.10. An ibio ic suscep ibili y es ing
Disc e e colonies o iden i ied isola es we e emulsi ied in 3-5ml o no mal saline and he u bidi y o he esul ing
suspension was ma ched agains 0.5 McFa land s anda d. The suspension was s eaked on Muelle Hin on aga using a
s e ile swab s ick. Cip o loxacin (CIP), Penicillin(P), Gen amicin (CN), Clindamycin (DA), E y h omycin(E), Linezolid
(LZD), Le o loxacin (LEV), Te acycline (TE) and T ime h op im-Sulphame hozole (SXT) we e es ed on all he S. au eus
isola es. The pla es we e incuba ed o 24hou s. Then check and measu e he clea zone o inhibi ion a ound he
an ibio ic disc wi h a me e ule [14].
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
291
An ibio ic sensi i i y and esis ance we e de e mined by he Clinical and Labo a o y S anda ds Ins i u e (CLSI) disk
di usion es on Muelle -Hin on Aga , using calib a ed inoculum o he isola es based on McFa land s anda d [14].
3.11. Pheno ypic de ec ion o me hicillin esis an S aphylococcus au eus (MRSA)
Me hicillin esis ance was es ed in all S aphylococcus species using ce oxi in disk
• P inciple: Ce oxi in inhibi s he g ow h o S.au eus ha a e no me hicillin esis an while esis an s ains
show educed zone o inhibi ion o me hicillins, oxacillins, and ce oxi in. Me hicillin esis ance is media ed by
PBP-2a, al e na i e penicillin – binding p o ein encoded by mecA gene, which pe mi s he o ganism o g ow
and mul iply in he p esence o me hicillin and o he be a- lac am an ibio ics. Ce oxi in is ecommended as a
su oga e o disc di usion es ing o MRSA because i is a be e induce o mecA gene. The p inciple o his
es is ha he me hicillin esis an S aphylococcus au eus (MRSA) shows educed zone o inhibi ion o ce oxi in
disc because o he p esence o al e na i e binding p o ein.
• P ocedu e: he suspension o 0.5 McFa land s anda ds o he isola e was inocula ed on Muelle Hin on aga
using s e ile swab and ce oxi in disc placed on he aga . The aga was incuba ed a 35⁰C o 37⁰C o 24 hou s in
an ambien ai .
• Resul : he esul was conside ed as esis an i he zone o inhibi ion is less han 22mm.
• Quali y con ol: his was done using S. au eus ATCC 43300 and S. au eus ATCC 25923 as posi i e and nega i e
con ols espec i ely [14].
3.12. Molecula es ing
Mul iplex PCR, which u ilizes mul iple p ime se s wi hin a single PCR, was used o de ec mecA and mecC gene.
• P inciple o PCR: I is a p ime media ed enzyma ic ampli ica ion o DNA which in ol es h ee s ages
dena u a ion a 94˚C o 15 o 30 seconds, annealing a 54˚C-60˚C o 20 o 40seconds and elonga ion a 72˚C-
80˚C, he DNA polyme ase will syn hesize new s ands o DNA complemen a y o he o e ed empla e.
3.12.1. Ex ac ion (ki om Nige ia ins i u e o Medical Resea ch)
Ex ac ion ki s con en ; (lysis bu e , wo bo les o wash bu e , elusion bu e )
A day-old pu e cul u e was g own on chocola e aga hen in oduce in o yp ycase soy b o h and he p ocedu e was
ca ied ou acco ding o he manu ac u e ’s ins uc ion.
3.13. DETECTION OF Meca AND Mecc GENES BY Mul iplex PCR
Mul iplex PCR was used o de ec mecA and mecC genes in all me hicillin esis an S. au eus s ains. The mecA- speci ic
p ime se mecA1 (AAAATCGATGGTAAAGGTTGGC) and mecA2
(5’AGTTCTGCAGTACCGGATTTTGC3’) wi h 155pb weigh and mecC- speci ic p ime se mecC1 (5’GAA AAA AAGGCT
TAG AAC GCC TC3’) and mecC2 (5’GAA GAT CTT TTC CGT TTTCAG C3’) wi h 188bp weigh was used o ampli ica ion.
PCR was pe o med in a 20μl o a eac ion mix u e con aining 1x PCR Bu e (Solis Biodyne), 1.5 mM MgCl2, 200 μM o
each dNTP (Solis Biodyne), 20 pMol o each p ime , 2.5 uni s o TaqDNA polyme ase (Solis Biodyne), 20ng o ex ac ed
DNA, and s e ile dis illed wa e was used o make up he eac ion mix u e. A e ampli ica ion aga osegels
elec opho esis was used o sepa a e he DNA s ands. The PCR condi ions we e as ollows: Ini ial dena u a ion a 95°C
o 5 minu es ollowed by dena u a ion a 94°C o 30 seconds (30 cycles), annealing a 54°C o 40 seconds (cycles 30),
elonga ion a 72°C o 4 minu es (30 cycles) and inal elonga ion a 72°C o 10 minu es. S. au eus NCTC 13552 was used
as he posi i e con ol s ain [15,16].
3.14. Da a Analysis
The s a is ical analysis so wa e e sion 21 (SPSS) and excel was used o da a analysis.
The da a we e en e ed in o Excel Mic oso and s a is ical analysis was done using Social Sciences (SPSS) so wa e,
e sion 25. The a iables we e exp essed in pe cen ages and equency. The p- alues less han 0.05 was in e p e ed as
s a is ically signi ican .

GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
292
3.15. E hical App o al
The e hical app o al o he s udy conduc ion was ob ained om Lagos Uni e si y Teaching Hospi al Resea ch E hical
Commi ee (IREC). The s udy was conduc ed acco ding o decla a ion o Helsinki. Bo h e bal and w i en in o med
consen s we e ob ained om all he pa icipan s a e he de ail o he s udy was explained o hem.
4. Resul
4.1. Socio-demog aphy o pa ien s in ec ed wi h S aphylococcus au eus in he adul medical eme gency uni o
LUTH
Ou o he 300 pa ien s en olled in he s udy who had a clinical diagnosis o in ec ion, S aphylococcus au eus was isola ed
om 43 cases. The age dis ibu ion o pa ien s in ec ed wi h S. au eus showed ha he highes p opo ion (46.5%) we e
wi hin he 41–50 yea s age g oup, ollowed by 23.3% in he 31–40 yea s g oup. Pa ien s aged 51–60 yea s accoun ed
o 14%, while hose aged 18–30 yea s and abo e 61 yea s ep esen ed 11.6% and 4.6%, espec i ely. Among he
in ec ed pa ien s, 22 (51.2%) we e emales and 21 (48.8%) we e males, wi h a mean age o 47.7 yea s (SD ± 14.39).
Fu he mo e, 18 (41.86%) o he S. au eus isola es we e iden i ied as me hicillin- esis an S aphylococcus au eus
(MRSA) (Table 1).
4.2. Dis ibu ion o S aphylococcus au eus in ec ions among pa ien s he adul medical eme gency uni o
LUTH by sample si e
S aphylococcus au eus was isola ed om a ious clinically ele an samples, majo i y 17() was isola ed om he blood
s eam, ollowed by skin and so issue 15(), UTI was 7 and RTI was 4. MRSA was majo ly isola ed SSTI (10), ollowed
by BSI (5), UTI was 2, RTI was 2. (Figu e 1).
4.3. An ibio ic Suscep ibili y Pa e n o MRSA isola ed om pa ien s in he adul medical eme gency uni o
LUTH
All he MRSA isola es we e esis an o e y h omycin and penicillin, ollowed by e acycline and clindamycin which
had 17 (94.4%) and 16 (88.9%) esis ance espec i ely. All isola es we e suscep ible o ancomycin while 16 (88.9%)
o hem we e suscep ible o linezolid. See able 2.
4.4. Molecula de ec ion o gene om MRSA isola ed om pa ien s in he adul medical eme gency uni s o
LUTH
All he isola es iden i ied as MRSA using pheno ypic me hod we e all posi i e o MRSA gene de ec ion using mul iplex
PCR. 17 (94.4%) o he MRSA isola es had MecA gene only while 1 (5.6%) had bo h MecA and MecC gene. See igu e 3
and 4.
Table 1 Sociodemog aphic cha ac e is ics o he pa ien s
Va iable
F equency (n=43)
Pe cen age (%)
Age g oup (Yea s)
18-30
5
11.6
31-40
10
23.3
41-50
20
46.5
51-60
6
14.0
≥61
2
4.6
Means Age
47.7±14.4
Gende
Female
22
51.2
Male
21
48.8
MRSA Posi i e Po
18
41.9%
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
293
4.5. Pa ien s (PX)
Figu e 1 Dis ibu ion o 18 MRSA in ec ions in he adul medical eme gency uni o LUTH by sample ype. (BSI (22%)
= blood sample, RTI (11%) = spu um sample, UTI (11%) = U ine sample, SSTI (56%) = Wound swab and wound
biopsy)
Table 2 An ibio ic suscep ibili y and esis ance p o ile o S aphylococcus au eus isola ed om pa ien s he adul medical
eme gency o LUTH
An ibio ics
Sensi i e
Numbe (%)
Resis an
Numbe (%)
1
E y h omycin
10 (23.3%)
33 (76.7%)
2
Gen amicin
17 (39.5%)
26 (60.5%)
3
Te acycline
10 (23.3%)
33 (76.7%)
4
Penicillin
13 (30.2%)
30 (69.8%)
5
Clindamycin
20 (46.5%)
23 (53.5%)
6
Le o loxacin
31 (72.1%)
12 (27.9%)
7
Vancomycin
43 (100%)
0 (0%)
8
Linezolid
41 (95.3%)
2 (4.7%)
9
T ime h op im-Sulphame hozole
21 (48.8%)
22 (51.2%)
10
Cip o loxacin
17 (39.5%)
26 (60.5%)
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
294
Figu e 2 An ibio ic Suscep ibili y P o ile o Me hicillin Resis an S aphylococcus au eus isola ed om pa ien s in he
adul eme gency uni o LUTH
(E y h omycin and Penicillin= 100% esis ance, Gen amicin =73.2%R, Te acycline = 94.4%R, Clindamycin =11.1%S
and 88.9%R, T ime hop im-sulphame azole and Cip o loxacin had 66.7%R, Le o loxacin had 33.3%R o una ely,
Linezolid had 88.9% sensi i e while all he isola es we e sensi i e o Vancomycin).
Figu e 3 Aga ose gel elec opho esis o PCR p oduc s o MRSA isola e 1-10
(Meca genes. M = DNA ma ke agmen s, PC = MRSA posi i e con ol, NC= Nega i e con ol, Lane 1, 2, 3, 4, 5, 6, 7, 9 and
10 indica e he Meca posi i e MRSA while 8 ep esen bo h Meca and Mecca posi i e MRSA. The DNA agmen s o
155bp we e ampli ied om Meca gene (Meca p ime weigh =155bp) while he DNA agmen o 188bp we e ampli ied
om Mecca gene (Mecca p ime weigh =188bp).
GSC Biological and Pha maceu ical Sciences, 2025, 33(01), 287-299
295
(mecA genes. M = DNA ma ke agmen s, PC = MRSA posi i e con ol, NC= Nega i e con ol, Lane 11, 12, 13, 14, 15, 16, 17 and 18 indica e he
mecA posi i e MRSA. The DNA agmen s o 155bp we e ampli ied om mecA gene (mecA p ime weigh =155bp).
Figu e 4 Aga ose gel elec opho esis o PCR p oduc s o MRSA isola e 11-18
5. Discussion
Resis ance o S aphylococcus au eus o me hicillin is linked wi h he acquisi ion o mec genes known o code o
esis ance o be a-lac am an ibio ics, S. au eus has been an impedimen o an imic obial chemo he apy, and he
in oduc ion o new classes o an ibio ic is usually ollowed by he eme gence o esis an o ms o his pa hogen [17,18].
All he Me hicillin esis an S. au eus iden i ied using pheno ypic me hod in his s udy we e all posi i e o esis ance
gene de ec ion, his shows ha esis ance o S aphylococcus au eus isola ed om he pa ien in he adul medical
eme gency uni o LUTH was media ed by mecA and mecC genes, 17 (94.4%) had mecA only while one which was
isola ed om he wound biopsy collec ed om a 52yea s emale pa ien had bo h mecA and mecC, al hough he
p e alence o MRSA among he S aphylococcus au eus in his s udy was high i is a g ea elie e ha all he MRSA isola es
we e sensi i e o ancomycin which is he d ug o choice.
In his s udy, he p e alence o me hicillin esis ance among he S aphylococcus au eus isola ed om he pa ien s
admi ed in he adul medical eme gency uni o LUTH was 18 which is 41.9% o he o al S aphylococcus au eus isola es
his p e alence is high and in acco dance wi h 42.3% and alls wi hin he ange o 25% o 40% p e alence in Nige ia
[19], bu less han he p e alence 46.5% MRSA epo ed in a esea ch ca ied ou in Kenya [20] and 59% epo ed in a
simila mul icen e s udy in Lagos [21].
S aphylococcus au eus was isola ed om a ious clinical specimens (Spu um, Blood, U ine, wound swab/ biopsy)
ob ained om di e en in ec ion si e, wi h he highes sample being om blood (39.5%) and he lowes being
spu um(9.3%) his is in con as wi h a simila s udy ca ied ou in Eki i s a e [22] whe e u ine has he highes
occu ence (25.5%) o S. au eus and also a simila s udy ca ied ou by Shi u and Lin, mo e han 80% o he o al
numbe o isola es eco e ed we e om in ec ed wounds. Howe e , MRSAs we e mos ly (55%) isola ed om skin and
so issue in ec ions in his s udy his is in acco dance o a ious s udies in Nige ia, A ica and o he pa o he wo ld
[22,23]. S. au eus is ubiqui ous in i s dis ibu ion, and al hough i is a no mal lo a o he an e io na es, skin, and geni al
ac o humans, i can cause in ec ions in i ually any o gan o pa o he body, in ec ions o he wounds, skin and so
issue, blood, and he lowe u ina y ac a e pa icula ly common.
The an imic obial suscep ibili y pa e n o S. au eus isola es a ies wi h loca ion and ime. The highes deg ee o
an ibio ic esis ance in his s udy was o e acycline (76.7%), E y h omycin (76.7%) and Penicillin (69.8%) his is
pa ially in ag eemen wi h a simila esea ch by Olowe e al., whe e penicillin G (82.7%) and e acycline (65.4%) has