Cellula Immunology 366 (2021) 104393
A ailable online 12 June 2021
0008-8749/© 2021 The Au ho s. Published by Else ie Inc. This is an open access a icle unde he CC BY license (h p://c ea i ecommons.o g/licenses/by/4.0/).
Resea ch pape
The ole o si uin 1 on he induc ion o ained immuni y
Ve a P. Mou i s
a
,
1
, Leonie S. Helde
a
,
1
, Vasiliki Ma za aki
a
,
b
, Vale ie A.C.M. Koeken
a
,
c
,
Laszlo G oh
a
, L. Cha lo e J. de B ee
a
,
d
,
e
, Simone J.C.F.M. Moo lag
a
, Cha lo e D.C.
C. an de Heijden
a
, Samuel T. Kea ing
a
,
, Jelme H. an Pu elen
a
,
g
, Ma in Jaege
a
, Leo A.
B. Joos en
a
,
h
,
*
,
2
, Mihai G. Ne ea
a
,
i
,
*
,
2
a
Depa men o In e nal Medicine, Radboud Cen e o In ec ious Diseases (RCI), Radboud Uni e si y Medical Cen e , Nijmegen, he Ne he lands
b
Depa men o Gene ics, Uni e si y o G oningen, Uni e si y Medical Cen e G oningen, G oningen, he Ne he lands
c
Depa men o Compu a ional Biology o Indi idualised In ec ion Medicine, Cen e o Indi idualised In ec ion Medicine (CiiM) & TWINCORE, Join Ven u es Be ween
he Helmhol z-Cen e o In ec ion Resea ch (HZI) and he Hanno e Medical School (MHH), Hanno e , Ge many
d
Resea ch Cen e o Vi amins and Vaccines, Bandim Heal h P ojec , S a ens Se um Ins i u , Copenhagen, Denma k
e
Odense Pa ien Da a Explo a i e Ne wo k, Uni e si y o Sou he n Denma k/Odense Uni e si y Hospi al, Odense, Denma k
Depa men o Biology, Uni e si y o Copenhagen, Copenhagen, Denma k
g
Depa men o Heal h E idence, Radboud Uni e si y Medical Cen e , Nijmegen, he Ne he lands
h
Depa men o Medical Gene ics, Iuliu Hațieganu Uni e si y o Medicine and Pha macy, Cluj-Napoca, Romania
i
Depa men o Genomics & Immuno egula ion, Li e and Medical Sciences Ins i u e (LIMES), Uni e si y o Bonn, Bonn, Ge many
ARTICLE INFO
Keywo ds:
T ained immuni y
Si uin 1
In lamma ion
ABSTRACT
Si uin 1 (SIRT1) has been desc ibed o modi y immune esponses by modula ion o gene ansc ip ion. As
ansc ip ional ep og amming is he molecula subs a e o ained immuni y, a de ac o inna e immune
memo y, we in es iga ed he ole o SIRT1 in he induc ion o ained immuni y. We iden i ied a ious SIRT1
gene ic single nucleo ide polymo phisms a ec ing inna e and adap i e cy okine p oduc ion o human pe iphe al
blood mononuclea cells (PBMCs) in esponse o a ious s imuli on he one hand, and in i o induc ion o ained
immuni y on he o he hand. Fu he mo e, inhibi ion o SIRT1 up egula ed p o-in lamma o y inna e cy okine
p oduc ion upon s imula ion o PBMCs. Howe e , inhibi ion o SIRT1 in i o had no e ec on cy okine esponses
upon induc ion o ained immuni y, while ac i a ion o SIRT1 mildly modi ied ained immuni y esponses. In
conclusion, SIRT1 modi ies inna e cy okine p oduc ion by PBMCs in esponse o a ious mic obes, bu has only a
seconda y ole o BCG and β-glucan-induced ained immuni y esponses.
1. In oduc ion
Si uins a e a amily o highly conse ed nico inamide adenine
dinucleo ide (NAD)
+
-dependen p o ein deace ylases. The mammalian
si uin amily consis s o se en p o eins (SIRT1-7), which a e in ol ed in
a a ie y o cellula p ocesses including cell di e en ia ion, me abolism,
and s ess esponses [1,2]. Si uins deace yla e lysine esidues o bo h
his one p o eins and nonhis one subs a es, including ansc ip ion
ac o s [1]. An inc easing body o e idence demons a es ha SIRT1
modi ies immune esponses and in lamma ion [3]. On one hand, mos
s udies show ha acu e in lamma ion dec eases he exp ession le el o
SIRT1, which leads o a p o-in lamma o y esponse [4–7]. This can
occu ia he deace yla ion o NF-κB subuni RelA/p65, o indi ec ly by
inducing ep essi e ansc ip ional complexes [3,8]. On he o he hand,
p olonged mic obial exposu e led o an inc ease in SIRT1 le els and
caused immunosupp ession [9]. Addi ionally, SIRT1 has been desc ibed
o suppo he swi ch om glycolysis o a y acid oxida ion in a THP-1
monocy e cell line du ing adap a ion o acu e in lamma ion, in
conjunc ion wi h SIRT6, h ough an epigene ic-based mechanism [10].
SIRT1 is able o deace yla e H1 his ones a lysine (K) 26, as well as H3
his ones a lysine 9 (H3K9), lysine 14 (H3K14), and H4 his ones a lysine
16 (H4K16) [9,11,12], his esul s in pleio opic e ec s.
* Co esponding au ho s a : Depa men o In e nal Medicine (463), Radboud Uni e si y Medical Cen e , Gee G oo eplein 8, 6525 GA Nijmegen, The
Ne he lands.
E-mail add esses: [email p o ec ed] (L.A.B. Joos en), [email p o ec ed] (M.G. Ne ea).
1
Sha ed i s au ho ship.
2
Sha ed senio au ho ship.
Con en s lis s a ailable a ScienceDi ec
Cellula Immunology
jou nal homepage: www.else ie .com/loca e/ycimm
h ps://doi.o g/10.1016/j.cellimm.2021.104393
Recei ed 26 No embe 2020; Recei ed in e ised o m 31 May 2021; Accep ed 5 June 2021
Cellula Immunology 366 (2021) 104393
2
The e m ained immuni y desc ibes he p ocess by which inna e
immune cells unde go unc ional ep og amming a e ce ain s imula-
ions/in ec ions, o moun a de ac o immune memo y ha suppo s
long- e m al e ed immune esponses o seconda y non-speci ic s imu-
la ion [13,14]. Bo h β-glucan, a cell wall componen o many ungal
species, and he bacillus Calme e-Gu´
e in (BCG) accine, which is
cu en ly used o p e en ion o ube culosis, ha e been ex ensi ely
s udied he las yea s o hei abili y o induce ained immuni y [13].
This non-speci ic inna e immune memo y is cha ac e ized by epigene ic
and me abolic ewi ing and esul s in enhanced p o-in lamma o y
cy okine p oduc ion. β-glucan-induced ained immuni y is media ed
by binding o he Dec in-1 ecep o , subsequen ac i a ion o mTOR/
HIF-1
α
[15], and up egula ion o bo h glycolysis and oxida i e phos-
pho yla ion [16]. Fu he mo e, H3K4me3 and H3K27ac en ichmen a
p omo e s o p o-in lamma o y genes is associa ed wi h ch oma in
accessibili y in ained cells, esul ing in inc eased ansc ip ion o p o-
in lamma o y genes [17].
In con as , lipopolysaccha ide (LPS) om g am-nega i e bac e ia
can induce a ole an mac ophage pheno ype, which is e ac o y o
immune s imula ion and cha ac e ized by dec eased p o-in lamma o y
cy okine p oduc ion [18]. SIRT1 has been shown o play a ole du ing
endo oxin ole ance [9], as i s inhibi ion signi ican ly imp o ed su i al
o sepsis in oden s [3,19]. A low SIRT1 ac i i y is obse ed in ch onic
in lamma o y diseases, he e o e inc easing SIRT1 ac i i y would be
bene icial in his s a e [3]. In e es ingly, SIRT1 exp ession was ound o
be dec eased upon β-glucan-induced ained immuni y in monocy es
[15].
T ained immuni y is pi o al o he bene icial he e ologous e ec s o
some accines, bu also in media ing dele e ious e ec s in in lamma o y
diseases in which i is inapp op ia ely ac i a ed [13,20]. I is hus
essen ial o iden i y he mechanisms ha egula e ained immuni y
esponses [13,21] in o de o design no el immunomodula o y s a e-
gies. Gi en ha SIRT1 a ec s he immune esponse by me abolic and
epigene ic mechanisms, we sough o in es iga e he ole o SIRT1 in
inna e immune memo y using gene ic and pha macological app oaches.
2. Resul s
2.1. SIRT1 gene ic polymo phisms a e associa ed wi h cy okine esponses
upon PBMC s imula ion
To explo e he in ol emen o SIRT1 in immune esponses, we i s
assessed he e ec o SIRT1 single nucleo ide polymo phisms (SNPs) on
cy okine esponses o heal hy indi iduals in esponse o di e en mi-
c obial s imuli. This was in es iga ed in a coho o 534 heal hy in-
di iduals (500FG s udy), in which isola ed pe iphe al blood
mononuclea cells (PBMCs) we e s imula ed ex i o wi h a ious mi-
c oo ganisms o (non-)mic obial p oduc s, and cy okine p oduc ion was
subsequen ly measu ed [22,23]. Bo h inna e (IL-6, TNF-
α
, IL-1β a e
s imula ion o 24 h) and adap i e (IL-22, IL-17, IFN-γ a e s imula ion
o 7 days) cy okine esponses we e in luenced by SNPs in he SIRT1
gene known as exp ession quan i a i e ai loci (eQTLs), in esponse o
bac e ia (Bac e oides ( agilis), Bo elia (bu gdo e i), Coxiella bu ne i,
Esche ichia coli, Mycobac e ium ube culosis, S aphylococcus au eus), ungi
(Aspe gillus umiga us conidia), yeas s (C yp ococcus, Candida albicans
and hyphae), TLR ligands (CpG oligodeoxynucleo ides, LPS, Pam3Cys)
and non-mic obial s imuli (monosodium u a e c ys als (MSU) +pal-
mi ic acid (C16.0)) (Table 1). Fo a mino i y o he s imuli (hea -killed
C. albicans, in luenza i us, MSU alone, phy ohemagglu inin, o poly I:
C), no e ec s o SIRT1 gene ic a ian s we e obse ed.
2.2. SIRT1 inhibi ion inc eases inna e p o-in lamma o y cy okine
p oduc ion in PBMCs
This p omp ed us o in es iga e whe he inhibi ion o SIRT1 a ec s
in lamma o y cy okine p oduc ion in PBMCs isola ed om heal hy
indi iduals in i o. PBMCs we e exposed o he syn he ic SIRT1 inhib-
i o EX-527 a a ious concen a ions (1–100 µM), and s imula ed o 24
h wi h TLR4 ligand LPS o TLR1/2 ligand Pam3Cys. These concen a-
ions o EX-527 we e no oxic o he cells (Supplemen a y Fig. 1).
T ansc ip ion o IL6, TNFA, and IL1B was inc eased upon SIRT1 inhi-
bi ion, al hough his was no s a is ically signi ican (Fig. 1A). Acco d-
ingly, PBMC s imula ion wi h LPS oge he wi h inhibi ion o SIRT1
esul ed in a 1.2–1.4 old inc eased p oduc ion o p o-in lamma o y
cy okines IL-1β, IL-6, and TNF-
α
(Fig. 1B). A simila , hough less p o-
nounced, signi ican inc ease in IL-6 and IL-1β p oduc ion was obse ed
in esponse o SIRT1 inhibi ion and Pam3Cys s imula ion (Fig. 1B). In
con as , SIRT1 inhibi ion in Candida albicans-s imula ed PBMCs did no
a ec p oduc ion o adap i e cy okines IFN-γ, IL-22, and IL-17 a e 7
days (Fig. 2). Addi ionally, inhibi ion o SIRT1 di ec ly a ec ed su ace
exp ession o human monocy e ma ke s CD14, CD11b, and HLA-DR.
Ou da a indica e inc eased CD14 exp ession a e 24 h exposu e o
10 µM EX-527. Simila ly, a mino bu signi ican inc ease in CD11b
exp ession on CD14 +monocy es was obse ed in 100 µM EX-527
ea ed cells. Though no signi ican , we obse ed a end owa ds
dec eased exp ession o HLA-DR on CD14 +monocy es (Supplemen a y
Fig. 2).
2.3. SIRT1 gene ic polymo phisms a e associa ed wi h ained immuni y
in i o
A e con i ming he impo ance o SIRT1 o modula ing di ec
cy okine p oduc ion, we sough o in es iga e whe he gene ic a ia ion
in he SIRT1 gene in luences ained immuni y. The e ec o SIRT1 SNPs
on cy okine p oduc ion upon induc ion o ained immuni y in i o was
in es iga ed in PBMCs isola ed om 267 heal hy indi iduals o he
300BCG coho [24]. Monocy es we e s imula ed wi h β-glucan, BCG, o
RPMI medium as con ol, o 24 h. The ea e , cells we e washed, es ed
o 5 days, and on day 6 es imula ed wi h he non-speci ic s imulus LPS
o 24 h. Subsequen ly, cy okine p oduc ion (IL-6 and TNF-
α
) was
measu ed in he supe na an o assess ained immuni y esponses. The
impac o SIRT1 gene polymo phisms on ained immuni y was assessed
by co ela ing indi idual SNPs wi h he magni ude o ained immuni y
esponses, measu ed by cy okine p oduc ion in ained cells compa ed
o un ained cells (RPMI con ol). As shown in Fig. 3, a gene ic a ian
( s10740283 a ch omosome 10) in close p oximi y o he SIRT1 gene
(desc ibed as SIRT1 eQTL in whole blood [25]), in luenced IL-6 p o-
duc ion in cells ained wi h BCG (P =0.004 and P =0.01). SNP
s2485679 (also known as SIRT1 eQTL in whole blood [25]), in luenced
he old change o TNF-
α
p oduc ion upon β-glucan aining (bo de line
signi icance o P =0.05 and P =0.07). Nex , we in es iga ed he impac
o SIRT1 polymo phisms on in i o ained immuni y esponses. This was
assessed by QTL mapping o SNP geno ypes and S. au eus-induced
cy okine esponses ex i o o BCG- accina ed heal hy indi iduals om
he 300BCG coho . Howe e , no signi ican impac o SIRT1 poly-
mo phisms on in i o induc ion o ained immuni y was obse ed (P >
Table 1
SIRT1 gene ic polymo phisms a e associa ed wi h cy okine e-
sponses upon PBMC s imula ion. QTL mapping o SIRT1 gene ic
a ian s om heal hy indi iduals o he 500FG coho and cy okine
p oduc ion o PBMCs in esponse o s imula ion in i o wi h a ious
s imuli (see Me hods). The s onges signi ican ly associa ed gene ic
a ian s o a speci ic cy okine-s imuli combina ion a e shown.
18S FW GATGGGCGGCGGAAAATAG
18s RV GCGTGGATTCTGCATAATGGT
TNFA FW AACGGAGCTGAACAATAGGC
TNFA RV TCTCGCCACTGAATAGTAGGG
IL1B FW ATCACTGAACTGCACGCTCC
IL1B RV TGGAGAACACCACTTGTTGC
IL6 FW AGCCCACCGGGAACGA
IL6 RV GGACCGAAGGCGCTTGT
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
3
0.05).
2.4. The e ec o SIRT1 on induc ion o ained immuni y
In a ollowing se o expe imen s, we assessed he e ec s o pha -
macological inhibi ion o SIRT1 by EX-527 on ained immuni y induced
by β-glucan o BCG, o ole ance induced by LPS. The addi ion o EX-527
did no a ec ei he ained immuni y o ole ance in e ms o IL-6 and
TNF-
α
p oduc ion a e es imula ion wi h LPS (Fig. 4A). To alida e
hese esul s, we in es iga ed he e ec o SIRT1 ac i a o SRT1720
[26]. Cells ained wi h BCG in he p esence o SRT1720 exhibi ed
ele a ed p oduc ion o IL-6 and TNF-
α
. On he o he hand, cells ained
wi h β-glucan in he p esence o SRT1720 did no p oduce mo e TNF-
α
han cells ained wi h β-glucan unde no mal condi ions, bu induced a
small, ye signi ican dec ease in IL-6 p oduc ion (Fig. 4B). In addi ion o
cy okine p oduc ion, he e ec s o EX-527 on me abolic changes
induced by ained immuni y we e in es iga ed by means o lac a e
measu emen p io o and a e es imula ion wi h LPS. Lowe le els o
lac a e we e measu ed in he supe na an s o β-glucan ained cells in he
p esence o 100 µM EX-527, indica ing lowe glycoly ic ac i i y in hese
cells (Fig. 4C).
3. Discussion
In he p esen s udy, we show ha gene ic a ia ion in SIRT1 in-
luences he induc ion o in lamma ion as e lec ed by cy okine p o-
duc ion upon s imula ion o PBMCs, as well as he induc ion o ained
immuni y in an in i o expe imen al model. In con as , SIRT1 poly-
mo phisms did no a ec he in i o induc ion o ained immuni y by
BCG accina ion. Pha macological inhibi ion o SIRT1 in luenced acu e
p o-in lamma o y inna e cy okine p oduc ion, whe eas i did no
modula e he induc ion o ained immuni y by BCG o β-glucan. On he
o he hand, pha macological SIRT1 ac i a ion a ec ed ained immu-
ni y esponses in i o.
SIRT1 has p e iously been desc ibed o modula e in lamma ion, wi h
ei he inhibi o y [3,27,28] o s imula o y e ec s [29], depending on he
expe imen al model. Fo example, SIRT1 o e exp ession in a h i is
pa ien s is associa ed wi h inc eased p o-in lamma o y cy okine p o-
duc ion [30,31], whe eas SIRT1 ac i a ion did no a ec PBMCs de i ed
om heal hy indi iduals in he same s udy [30]. In he cu en s udy, we
IL1B
0
100
200
300
400
500
600
700Con ol
1uM EX-527
10 uM EX-527
100 uM EX-527
RPMI LPS P3C
Fold change
TNFA
0
20
40
60
80
RPMI LPS P3C
Fold change
IL6
0
50
100
150
200
250
300
350
RPMI LPS P3C
Fold change
IL-1
0
2000
4000
6000
8000
RPMI LPS P3C
*****
p=0.05 Con ol
1 M EX-527
10 M EX-527
100 M EX-527
pg/ml
IL-6
0
5000
10000
15000
20000****
**
RPMI LPSP3C
pg/ml
TNF
0
200
400
600*
RPMI LPS P3C
pg/ml
Fig. 1. SIRT1 inhibi ion inc eases inna e cy okine p oduc ion o PBMCs. (A) RT-qPCR esul s o IL1B and TNFA (n =7), IL6 (n =5), and (B) cy okine p oduc ion o
IL-1β, IL-6, TNF-
α
in supe na an (n ≥10), o PBMCs isola ed om heal hy indi iduals we e s imula ed wi h LPS (10 ng/mL) o Pam3Cys (10 µg/mL), o non-
s imula ed (RPMI con ol), o 24 h in combina ion wi h EX-527 (1–100 µM). Mean ±SEM, *P <0.05, **P <0.01, ***P <0.001, Wilcoxon signed- ank es .
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
4
alida ed he ole o SIRT1 in he modula ion o he in lamma o y
esponse by iden i ying SIRT1 SNPs ha impac cy okine esponses upon
s imula ion wi h a ious mic oo ganisms, TLR ligands, and non-
mic obial s imuli. Some o hese SNPs we e mos s ongly associa ed
wi h cy okine p oduc ion induced by up o ou dis inc s imuli
( s12360310 and s7083505), whe eas o he SNPs mos signi ican ly
a ec ed cy okines only a e speci ic s imula ions.
We con i med he an i-in lamma o y ole o SIRT1 in acu e s imu-
la ion o human PBMCs by pha macological inhibi ion. In e es ingly,
SIRT1 seems o be speci ically in ol ed in he modula ion o he cy o-
kines ha a e mainly p oduced by inna e immune cells, bu much less in
he egula ion o cy okines p oduced mainly by he adap i e immune
cells (IFN-γ, IL-17, IL-22). Mo e s udies a e needed o un a el he
mechanisms by which SIRT1 a ec s cy okine esponses o di e en
s imuli, and in speci ic cell ypes. Because EX-527 inhibi s SIRT1 en-
zymes by exploi ing hei NAD
+
-dependen deace yla ion mechanism
[32], his e ec may include modi ied deace yla ion o NF-κB subuni
RelA/p65, which mainly egula es he exp ession o in lamma o y genes
by myeloid cells [5,6].
To iden i y possible mechanisms egula ing ained immuni y e-
sponses, we in e oga ed he ole o SIRT1 in he induc ion o ained
immuni y using gene ic and pha macological app oaches. Fi s , we
showed ha SIRT1 SNP s10740283 in luences BCG-induced ained
immuni y esponses in PBMCs o heal hy indi iduals in i o. This SNP
has p e iously been shown o a ec SIRT1 exp ession in human whole
blood [25]. SIRT1 SNP s2485679, which is also a SIRT1 eQTL in human
whole blood, in luenced β-glucan-induced ained immuni y bo de line
signi ican . To iden i y whe he SIRT1 also plays a ole in induc ion o
ained immuni y in i o, we assessed he e ec o hese polymo phisms
on ained immuni y esponses induced by BCG accina ion in heal hy
indi iduals. Howe e , we did no obse e signi ican associa ions be-
ween SIRT1 SNPs and BCG-induced ained immuni y esponse, sug-
ges ing ha SIRT1 has a limi ed con ibu ion o he p ocess o ained
immuni y in i o. The sample size o he 300BCG coho migh
con ibu e o he ac ha SIRT1 gene ic a ian s do no show a signi -
ican e ec on cy okine esponses upon induc ion o ained immuni y.
To u he assess he e ec o SIRT1 on ained immuni y, we used
pha macological modula o s o SIRT1. We did no obse e an e ec o
SIRT1 inhibi o EX-527 on ained immuni y esponses, and we
obse ed only limi ed al e a ions in ained immuni y esponses by
using he SIRT1 ac i a o SRT1720. Unexpec edly, a small bu signi i-
can dec ease in IL-6 p oduc ion (bu no TNF-
α
) was obse ed upon
β-glucan-induced ained immuni y in combina ion wi h SRT1720. In
con as , BCG-induced ained immuni y in combina ion wi h SRT1720
inc eased IL-6 and TNF-
α
p oduc ion. Because SRT1720 ac i a es SIRT1
by an unknown mechanism [33], i is impossible o specula e on he
cause o he disc epancy compa ed o he esul s using SIRT1 inhibi o
EX-527. Liu e al. iden i ied SIRT1 o play a ole in gene a ing endo oxin
ole ance [9]. He e, we could no ecapi ula e he in luence o SIRT1 on
ole ance in human monocy es. This appa en inconsis ency may be due
o he di e en model and cells used: in con as o he s udy o Liu e al.
which assessed he e ec on SIRT1 sho ly a e LPS s imula ion (up o 4
h) in THP-1 cells, we s udied he e ec o SIRT1 upon non-speci ic
IFN-y
0
100
200
300
400
500
RPMI Candida
Con ol
1 M EX-527
10 M EX-527
100 M EX-527
pg/ml IFNy
IL-17
0
1000
2000
3000
RPMI Candida
pg/ml IL-17
IL-22
0
1000
2000
3000
4000
5000
RPMI Candida
pg/ml IL-22
Fig. 2. SIRT1 inhibi ion does no a ec adap i e cy okine p oduc ion o
PBMCs. Cy okine assessmen in supe na an o PBMCs isola ed om heal hy
indi iduals which we e s imula ed wi h C. albicans (1 ×10
6
cells/mL), o non-
s imula ed (RPMI con ol), o 7 days in combina ion wi h EX-527 (1–100 µM).
Mean ±SEM, n =n ≥3, n.s., Wilcoxon signed- ank es .
-glucan
GG TG TT
-2
-1
0
1n=201
n=64
n=4
p=0.05
p=0.07
TNF-
BCG
AA AC CC
-1.5
-1.0
-0.5
0.0
0.5
1.0 n=42
n=127
n=100
p=0.01
p=0.004
IL-6
Fig. 3. SIRT1 gene ic polymo phisms a e associa ed wi h in i o ained immuni y esponses. Adhe en cells o he PBMC ac ion de i ed om heal hy indi iduals o
he 300BCG coho we e s imula ed in i o wi h BCG (5 µg/mL) and β-glucan (2 µg/mL) o 24 h, subsequen ly washed, es ed o 5 days, and a day 6 es imula ed
o 24 h wi h 10 ng/mL LPS. IL-6 and TNF-
α
cy okine p oduc ion was measu ed in supe na an by ELISA (Mean, Mann Whi ney U es ).
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
5
es imula ion in human mac ophages 6 days a e 24 h EX-527
ea men .
To conclude, gene ic a ia ion in SIRT1 is associa ed wi h cy okine
esponses o PBMCs o s imula ion wi h a ious mic obial and non-
mic obial s imuli, whe e SIRT1 inhibi ion esul s in inc eased inna e
p o-in lamma o y cy okine p oduc ion o PBMCs in i o. Al hough
SIRT1 gene ic a ian s had a mode a e e ec on in i o BCG- and
β-glucan-induced ained immuni y, his e ec was no alida ed in in
i o models o BCG accina ion. Inhibi ion o SIRT1 unc ion did no
in luence he induc ion o ained immuni y in monocy es, whe eas
ac i a ion o SIRT1 only mildly modi ied ained immuni y esponses in
i o. The impac o SIRT1 inhibi ion o ac i a ion on he unc ion o
o he immune cells is emains o be in es iga ed. Taken oge he ,
despi e i s egula o y ole in he acu e induc ion o in lamma ion, SIRT1
does no play an impo an ole in BCG- and β-glucan-induced ained
immuni y.
4. Me hods
4.1. Reagen s
RPMI 1640 (Du ch modi ied; Gibco, Li e Technologies, MA) was used
as cul u e medium supplemen ed wi h 5 µg/ml gen amicin (Cen a a m
B.V., he Ne he lands), 2 mM L-glu amine (Gibco), and 1 mM py u a e
(Gibco). Syn he ic Pam3Cys (Pam3Cys) was pu chased om EMC
Mic ocollec ions (Ge many), Esche ichia coli lipopolysaccha ide (LPS;
se o ype 055:B5, Sigma-Ald ich), β-glucan (β −1,3-(D)-glucan) was
kindly p o ided by P o esso Da id Williams (Eas Tennessee S a e
Uni e si y, TN), and bacillus Calme e Gu´
e in (BCG) accine was pu -
chased om In e Vax (Ma kham, ON, Canada). SIRT1 inhibi o EX-527
was pu chased om Sigma-Ald ich, SIRT1 ac i a o SRT1720 was pu -
chased om Selleckchem. Candida albicans UC820 (ATCC MYA-3573)
was hea -killed a 95 ◦C o 30 min.
4.2. Blood samples
Pe iphe al blood mononuclea cells (PBMCs) we e isola ed om
EX-527
0
1
2
3
4
5
6
7
RPMI -glucanBCG LPS
Fold change IL-6
EX-527
0
1
2
3
4
5
6
7
8
9
RPMI -glucanBCG LPS
Con ol
1 M EX-527
10 M EX-527
Fold change TNF-
SRT1720
0.0
0.5
1.0
1.5
2.0
2.5
RPMI -glucan BCG
**
Fold change IL-6
n.s.
SRT1720
0
1
2
3
4
RPMI
1 M SRT1720
5 M SRT1720
n.s. *
*
RPMI -glucan BCG
Fold change TNF-
EX-527 D6
RPMI -glucan BCG
0
1000
2000
3000
4000
*
*
*
Lac a e ( M)
EX-527 D6+LPS
RPMI -glucan BCG
0
500
1000
1500
2000Con ol
10 M EX-527
100 M EX-527
*
*
Lac a e ( M)
Fig. 4. E ec o SIRT1 modi ica ion on in i o ained immuni y. Monocy es de i ed om heal hy indi iduals we e s imula ed in i o wi h β-glucan (2 µg/mL), BCG
(5 µg/mL), LPS (1 ng/mL), o non-s imula ed (RPMI con ol), o 24 h, in combina ion wi h (A, C) EX-527, and (B) SRT1720, subsequen ly washed, es ed o 5 days,
and a day 6 es imula ed o 24 h wi h LPS. IL-6 and TNF-
α
cy okine p oduc ion and lac a e concen a ions we e measu ed in supe na an . Mean ±SEM, *P <0.05,
Wilcoxon signed ank es .
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
6
bu y coa s o heal hy blood dono s (Sanquin, Nijmegen, The
Ne he lands). Inclusion o olun ee s and expe imen s we e conduc ed
acco ding o he p inciples exp essed in he Decla a ion o Helsinki. All
olun ee s ga e w i en in o med consen be o e any ma e ial was
aken.
4.3. Popula ion coho s
QTL mapping using geno ype da a and cy okine p oduc ion upon
s imula ion and induc ion o ained immuni y was pe o med in a
coho o app oxima ely 500 and 300 heal hy indi iduals o Wes e n
Eu opean ances y, espec i ely om he Human Func ional Genomics
P ojec (500FG and 300BCG, see www.human unc ionalgenomics.o g).
The 500FG coho comp ises 534 adul s om Nijmegen, he Ne he lands
(44% males and 56% emales, age ange 18–75 yea s). PBMCs we e
isola ed and s imula ed in i o wi h a ious s imuli, and cy okines upon
s imula ion we e measu ed, as p e iously desc ibed [34]. The 300BCG
coho consis s o 325 adul s om he Ne he lands (43% males and 57%
emales, age ange 18–71 yea s). PBMCs we e isola ed and seed in 96-
wells pla es (Co ning, USA). A e washing away he non-adhe en
cells wi h PBS he adhe en cells we e subsequen ly s imula ed in i o
wi h BCG o β-glucan, and es imula ed a e 6 days wi h LPS, and
cy okine p oduc ion was subsequen ly measu ed. Fu he mo e, in-
di iduals om he 300BCG coho we e accina ed wi h 0.1 mL o BCG
(BCG accine s ain Bulga ia; In e Vax, Canada), and PBMCs we e iso-
la ed, and s imula ed ex i o wi h 5 ×10
6
CFU/mL hea -killed S. au eus
be o e accina ion, and 2 weeks and 3 mon hs a e accina ion. IL-1β,
IL-6, and TNF
α
p oduc ion was measu ed a e 24 h in supe na an s. The
500FG and 300BCG s udy we e app o ed by he e hical commi ee o he
Radboud Uni e si y and Radboudumc Nijmegen (no. 42561.091.12 and
NL58553.091.16).
4.4. PBMC isola ion and s imula ion
Cells we e isola ed by densi y cen i uga ion on Ficoll-Paque (GE
Heal hca e, UK), washed h ee imes in PBS and esuspended in cul u e
medium. A e isola ion, 5 ×10
5
PBMCs we e added o a ound bo om
96-wells pla e (G eine , Aus ia). Pam3Cys (10
μ
g/mL) o LPS (10 ng/
mL) we e added o 24 h a 37 ◦C and 5% CO
2
, Candida albicans was
added o 7 days (1 ×10
6
cells/mL), wi h o wi hou addi ion o EX-527
(1–100
μ
M).
4.5. Monocy e isola ion and s imula ion
Pe coll monocy es we e isola ed by laye ing hype -osmo ic Pe coll
solu ion (48,5% Pe coll (Sigma-Ald ich), 41,5% s e ile H
2
O, 0.16 M
il e -s e ilized NaCl) on PBMCs. A e 15 min cen i uga ion a 580 ×g,
he in e phase laye was isola ed, cells we e washed wi h PBS, and
esuspended in cul u e medium. To inc ease he pu i y o Pe coll-
isola ed monocy es, he monocy es we e adhe ed o polys y ene la
bo om pla es (Co ning, USA) o Pe i dishes (Falcon, Me ck) o 1 h a
37 ◦C ollowed by washing wi h wa m PBS. Nex , cells we e p e-
incuba ed wi h cul u e medium supplemen ed wi h 10% human
pooled se um as con ol, o oge he wi h EX-527 (1–10
μ
M) o SRT1720
(1–5
μ
M). Nex , cul u e medium supplemen ed wi h 10% human pooled
se um was added as a con ol, o oge he wi h ei he 2
μ
g/mL β-glucan,
5
μ
g/mL BCG In e Vax, o LPS (1 ng/mL). A e 24 h, cells we e washed
wi h wa m PBS and cul u e medium was added. Cul u e medium was
e eshed a e 3 days o incuba ion. On day 6, cells we e es imula ed
wi h RPMI, LPS (10 ng/mL), o Pam3Cys (10
μ
g/mL). A e 24 h, su-
pe na an s we e collec ed and s o ed a −20 ◦C un il u he use.
4.6. Cy okine and lac a e measu emen s
Cy okine concen a ions we e measu ed in supe na an s using com-
me cial sandwich ELISA ki s o human IL-6, TNF-
α
, IL-1β, IL-17, IL-22
(R&D sys ems) and IFN-γ (Sanquin Resea ch) in acco dance wi h he
manu ac u e ’s ins uc ions. Lac a e concen a ion was measu ed in
supe na an s o mac ophages using an enzyma ic assay as desc ibed
p e iously [35]. In b ie , supe na an s con aining se um (day 6) we e
p e- ea ed wi h pe chlo ic acid and NaOH o p e en po en ial p o ein
in e e ence wi h he assay. Lac a e concen a ion was de e mined by
enzyma ic eac ion wi h lac a e oxidase (Sigma-Ald ich), Amplex Red
eagen (Li e Technologies) and ho se adish pe oxidase (Sigma-
Ald ich). A e 20 min incuba ion, luo escence o eso u in (570/585
nm) was measu ed.
4.7. Quan i a i e RT-PCR
A baseline, a e 4 h, 24 h, and 6 days, RNA was isola ed om
ained monocy es by using TRIzol eagen acco ding o manu ac u e ’s
ins uc ions. Fi s -s and cDNA syn hesis was pe o med using Supe -
Sc ip III, ollowed by syn hesis o he second cDNA s and (The mo
Fishe Scien i ic) acco ding o he manu ac u e ’s p o ocol. Quan i a i e
PCR was pe o med using S epOne PLUS machine (Applied Biosciences)
using SYBR G een (In i ogen). The alues a e exp essed as log2 old
inc ease in mRNA le els ela i e o hose in non- ained cells. 18S was
used as a housekeeping gene. The p ime sequences a e lis ed below:
4.8. Viabili y assay
Cy o oxici y was analyzed by de ec ing lac a e dehyd ogenase (LDH)
di ec ly in esh supe na an using he Cy oTox 96® Non-Radioac i e
Cy o oxici y Assay (P omega, he Ne he lands), in acco dance wi h he
manu ac u e ’s ins uc ions.
4.9. Gene ic analysis
Isola ed DNA o he 500FG indi iduals was geno yped using he
comme cially a ailable SNP chip, Illumina HumanOmniExp essExome-
8 1.0. Cy okine QTL mapping was conduc ed using he geno ypes and
cy okine measu emen s upon in i o s imula ion o isola ed PBMCs, as
p e iously desc ibed [23]. The mos signi ican ly associa ed SNP o a
pa icula cy okine-s imuli combina ion is shown in Table 1. DNA
samples om indi iduals o he 300BCG coho we e geno yped using
he comme cially a ailable SNP chip, In inium Global Sc eening A ay
MD 1.0 om Illumina. Op icall 0.7.0 wi h de aul se ings was used o
geno ype calling [36]. Samples wi h a call a e ≤0.99 we e excluded, as
we e a ian s wi h a Ha dy-Weinbe g equilib ium (HWE) ≤0.0001, and
mino allele equency (MAF) ≤0.1. S ands o a ian s we e aligned
and iden i ied agains he 1000 Genome e e ence panel using Geno ype
Ha monize [37]. We hen impu ed he samples on he Michigan
impu a ion se e using he human e e ence conso ium (HRC 1.1
2016) as a e e ence panel [38], and we il e ed ou gene ic a ian s
wi h an R
2
<0.3 o impu a ion quali y. We iden i ied and excluded 17
gene ic ou lie s, and selec ed 4,296,841 SNPs wi h MAF 5% o ollow-
up QTL mapping. Bo h geno ype and cy okine da a on in i o ained
immuni y esponses induced by BCG o β-glucan in monocy es was ob-
ained o a o al o 267 indi iduals. Raw cy okine le els we e log-
ans o med and he old change o cy okine p oduc ion be ween
ained and non- ained cells was aken as a measu emen o he
magni ude o he in i o ained immuni y esponse. The cy okine
changes we e mapped o geno ype da a using a linea eg ession model
wi h age and sex as co a ia es o co ec he dis ibu ions o old change
o cy okine p oduc ion. Simila app oach was ollowed o iden i y QTLs
using he ex i o cy okine p oduc ion om PBMCs a e BCG accina-
ion in heal hy olun ee s. Bo h geno ype and cy okine da a on ex i o
ained immuni y esponses we e ob ained o a o al o 296 indi iduals.
The old change in cy okine p oduc ion (a e accina ion compa ed o
baseline) was used as a measu emen o he magni ude o he ained
immuni y esponse. The old change o cy okine p oduc ion was log-
ans o med, and we e mapped o geno ype da a using a linea
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
7
eg ession model wi h age and sex as co a ia es. R-package Ma ix-eQTL
was used o QTL mapping.
4.10. Flow cy ome y
Isola ed Pe coll monocy es we e exposed o EX-527 o ehicle con-
ol o 24 h. Fo cell su ace ma ke analysis, cells we e washed in PBS
con aining 1% BSA and s ained wi h an i-CD14 APC (M5E2 clone), an i-
HLA-DR PE-Cy5 (L243 clone), and an i-CD11b BV785 (ICRF44 clone; all
Biolegend). Flow cy ome y expe imen s we e pe o med using he
Beckman Coul e Cy oFLEX. CD14 MFI was de e mined a e exclusion
o double s. Du ing analysis o HLA-DR and CD11b MFI, cells we e ga ed
on he CD14 +ga e o elimina e deb is and lymphocy e popula ions.
4.11. S a is ics
Da a was analyzed using a Wilcoxon signed- ank es o pai ed
samples, o a Mann-Whi ney U es o unpai ed samples, using G aph-
Pad P ism so wa e (G aphPad Inc. e sion 8). Da a a e exp essed as
mean ±SEM, and alues o *P <0.05, **P <0.01 and ***P <0.001
we e conside ed s a is ically signi ican .
CRediT au ho ship con ibu ion s a emen
Ve a P. Mou i s: P ojec adminis a ion, Concep ualiza ion, Me h-
odology, Fo mal analysis, W i ing - o iginal d a , Valida ion, Visuali-
za ion. Leonie S. Helde : Concep ualiza ion, In es iga ion, Fo mal
analysis, W i ing - o iginal d a , Visualiza ion. Vasiliki Ma za aki:
Da a cu a ion, Fo mal analysis, In es iga ion. Vale ie A.C.M. Koeken:
Da a cu a ion, Fo mal analysis, In es iga ion. Laszlo G oh: Da a cu a-
ion, In es iga ion. L. Cha lo e J. de B ee: Da a cu a ion, In es iga-
ion. Simone J.C.F.M. Moo lag: Da a cu a ion, In es iga ion.
Cha lo e D.C.C. an de Heijden: In es iga ion. Samuel T. Kea ing:
In es iga ion. Jelme H. an Pu elen: In es iga ion. Ma in Jaege :
Resou ces, Supe ision. Leo A.B. Joos en: Concep ualiza ion, Funding
acquisi ion, Supe ision, W i ing - e iew & edi ing. Mihai G. Ne ea:
Concep ualiza ion, Funding acquisi ion, Supe ision, W i ing - e iew &
edi ing.
Decla a ion o Compe ing In e es
The au ho s decla e ha hey ha e no known compe ing inancial
in e es s o pe sonal ela ionships ha could ha e appea ed o in luence
he wo k epo ed in his pape .
Acknowledgemen s
We hank all he heal hy olun ee s o hei pa icipa ion. This s udy
was pa ly suppo ed by an EFRO g an (COILED). MGN was suppo ed
by an ERC Ad anced g an [833247] and a Spinoza g an o he
Ne he lands O ganiza ion o Scien i ic Resea ch.
Decla a ion o In e es
MGN and LABJ a e scien i ic ounde s o T ained The apeu ics
Disco e y.
Appendix A. Supplemen a y da a
Supplemen a y da a o his a icle can be ound online a h ps://doi.
o g/10.1016/j.cellimm.2021.104393.
Re e ences
[1] T. Zhang, W.L. K aus, SIRT1-dependen egula ion o ch oma in and ansc ip ion:
linking NAD(+) me abolism and signaling o he con ol o cellula unc ions,
Biochim. Biophys. Ac a 1804 (8) (2010) 1666–1675.
[2] S. Michan, D. Sinclai , Si uins in mammals: insigh s in o hei biological unc ion,
Biochem. J. 404 (1) (2007) 1–13.
[3] V.T. Vachha ajani, e al., Si uins link in lamma ion and me abolism, J. Immunol.
Res. 2016 (2016) 8167273.
[4] T.T. Schug, e al., Myeloid dele ion o SIRT1 induces in lamma o y signaling in
esponse o en i onmen al s ess, Mol. Cell. Biol. 30 (19) (2010) 4712–4721.
[5] L. Se ano-Ma co, e al., TNF-alpha inhibi s PPARbe a/del a ac i i y and SIRT1
exp ession h ough NF-kappaB in human adipocy es, Biochim. Biophys. Ac a 1821
(9) (2012) 1177–1185.
[6] F. Yeung, e al., Modula ion o NF-kappaB-dependen ansc ip ion and cell
su i al by he SIRT1 deace ylase, EMBO J. 23 (12) (2004) 2369–2380.
[7] Z. Shen, e al., Role o SIRT1 in egula ion o LPS- o wo e hanol me aboli es-
induced TNF-alpha p oduc ion in cul u ed mac ophage cell lines, Am. J. Physiol.
Gas oin es . Li e Physiol. 296 (5) (2009) G1047–G1053.
[8] M. Lei, e al., Res e a ol inhibi s in e leukin 1be a-media ed inducible ni ic oxide
syn hase exp ession in a icula chond ocy es by ac i a ing SIRT1 and he eby
supp essing nuclea ac o -kappaB ac i i y, Eu . J. Pha macol. 674 (2–3) (2012)
73–79.
[9] T.F. Liu, e al., NAD+-dependen SIRT1 deace ylase pa icipa es in epigene ic
ep og amming du ing endo oxin ole ance, J. Biol. Chem. 286 (11) (2011)
9856–9864.
[10] T.F. Liu, e al., NAD+-dependen si uin 1 and 6 p o eins coo dina e a swi ch om
glucose o a y acid oxida ion du ing he acu e in lamma o y esponse, J. Biol.
Chem. 287 (31) (2012) 25758–25769.
[11] A. Vaque o, e al., Human Si T1 in e ac s wi h his one H1 and p omo es o ma ion
o acul a i e he e och oma in, Mol. Cell 16 (1) (2004) 93–105.
[12] S. Imai, e al., T ansc ip ional silencing and longe i y p o ein Si 2 is an NAD-
dependen his one deace ylase, Na u e 403 (6771) (2000) 795–800.
[13] M.G. Ne ea, e al., De ining ained immuni y and i s ole in heal h and disease,
Na . Re . Immunol. (2020).
[14] M.G. Ne ea, J. Quin in, J.W. an de Mee , T ained immuni y: a memo y o inna e
hos de ense, Cell Hos Mic obe 9 (5) (2011) 355–361.
[15] S.C. Cheng, e al., mTOR- and HIF-1alpha-media ed ae obic glycolysis as me abolic
basis o ained immuni y, Science 345 (6204) (2014) 1250684.
[16] S.T. Kea ing, e al., The Se 7 lysine me hyl ans e ase egula es plas ici y in
oxida i e phospho yla ion necessa y o ained immuni y induced by β-glucan,
Cell Rep. 31 (3) (2020), 107548–107548.
[17] S. Saeed, e al., Epigene ic p og amming o monocy e- o-mac ophage
di e en ia ion and ained inna e immuni y, Science 345 (6204) (2014) 1251086.
[18] B. No ako ic, e al., Be a-glucan e e ses he epigene ic s a e o LPS-induced
immunological ole ance, Cell 167 (5) (2016) 1354–1368.
[19] V.T. Vachha ajani, e al., SIRT1 inhibi ion du ing he hypoin lamma o y
pheno ype o sepsis enhances immuni y and imp o es ou come, J. Leukoc. Biol. 96
(5) (2014) 785–796.
[20] R.J.W. A s, L.A.B. Joos en, M.G. Ne ea, The po en ial ole o ained immuni y in
au oimmune and au oin lamma o y diso de s, F on . Immunol. 9 (2018) 298.
[21] V.P. Mou i s, e al., T ained immuni y as a no el he apeu ic s a egy, Cu . Opin.
Pha macol. 41 (2018) 52–58.
[22] M. Schi me , e al., Linking he human gu mic obiome o in lamma o y cy okine
p oduc ion capaci y, Cell 167 (4) (2016) 1125–1136 e8.
[23] Y. Li, e al., In e -indi idual a iabili y and gene ic in luences on cy okine
esponses o bac e ia and ungi, Na . Med. 22 (8) (2016) 952–960.
[24] V.P. Mou i s, e al., BCG-induced ained immuni y in heal hy indi iduals: he
e ec o plasma mu amyl dipep ide concen a ions, J. Immunol. Res. 2020 (2020)
5812743.
[25] G.T. Conso ium, Human genomics. The Geno ype-Tissue Exp ession (GTEx) pilo
analysis: mul i issue gene egula ion in humans, Science 348 (6235) (2015)
648–660.
[26] J.C. Milne, e al., Small molecule ac i a o s o SIRT1 as he apeu ics o he
ea men o ype 2 diabe es, Na u e 450 (7170) (2007) 712–716.
[27] L. Wang, e al., Si uin 1 inhibi s lipopolysaccha ide-induced in lamma ion in
ch onic myelogenous leukemia k562 cells h ough in e ac ing wi h he Toll-like
ecep o 4-nuclea ac o kappa B- eac i e oxygen species signaling axis, Cance
Cell In . 20 (2020) 73.
[28] T. Yoshizaki, e al., SIRT1 inhibi s in lamma o y pa hways in mac ophages and
modula es insulin sensi i i y, Am. J. Physiol. Endoc inol. Me ab. 298 (3) (2010)
E419–E428.
[29] C.A. Fe nandes, e al., Si uin inhibi ion a enua es he p oduc ion o in lamma o y
cy okines in lipopolysaccha ide-s imula ed mac ophages, Biochem. Biophys. Res.
Commun. 420 (4) (2012) 857–861.
[30] D. Wendling, e al., Res e a ol, a si uin 1 ac i a o , inc eases IL-6 p oduc ion by
pe iphe al blood mononuclea cells o pa ien s wi h knee os eoa h i is, Clin.
Epigene . 5 (1) (2013) 10.
[31] F. Niede e , e al., SIRT1 o e exp ession in he heuma oid a h i is syno ium
con ibu es o p oin lamma o y cy okine p oduc ion and apop osis esis ance, Ann.
Rheum. Dis. 70 (10) (2011) 1866–1873.
[32] M. Ge z, e al., Ex-527 inhibi s Si uins by exploi ing hei unique NAD+-
dependen deace yla ion mechanism, P oc. Na l. Acad. Sci. 110 (30) (2013)
E2772–E2781.
[33] R.H. Hou koope , E. Pi inen, J. Auwe x, Si uins as egula o s o me abolism and
heal hspan, Na . Re . Mol. Cell Biol. 13 (4) (2012) 225–238.
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
8
[34] Y. Li, e al., A unc ional genomics app oach o unde s and a ia ion in cy okine
p oduc ion in humans, Cell 167 (4) (2016) 1099–1110 e14.
[35] E. Lachmandas, e al., Mic obial s imula ion o di e en Toll-like ecep o
signalling pa hways induces di e se me abolic p og ammes in human monocy es,
Na . Mic obiol. 2 (2016) 16246.
[36] T.S. Shah, e al., op iCall: a obus geno ype-calling algo i hm o a e, low-
equency and common a ian s, Bioin o ma ics 28 (12) (2012) 1598–1603.
[37] P. Deelen, e al., Geno ype ha monize : au oma ic s and alignmen and o ma
con e sion o geno ype da a in eg a ion, BMC Res. No es 7 (2014) 901.
[38] S. McCa hy, e al., A e e ence panel o 64,976 haplo ypes o geno ype
impu a ion, Na . Gene . 48 (10) (2016) 1279–1283.
V.P. Mou i s e al.