The role of sirtuin 1 on the induction of trained immunity.

Cellula Immunology 366 (2021) 104393 A ailable online 12 June 2021 0008-8749/© 2021 The Au ho s. Published by Else ie Inc. This is an open access a icle unde he CC BY license (h p://c ea i ecommons.o g/licenses/by/4.0/). Resea ch pape The ole o si uin 1 on he induc ion o ained immuni y Ve a P. Mou i s a , 1 , Leonie S. Helde a , 1 , Vasiliki Ma za aki a , b , Vale ie A.C.M. Koeken a , c , Laszlo G oh a , L. Cha lo e J. de B ee a , d , e , Simone J.C.F.M. Moo lag a , Cha lo e D.C. C. an de Heijden a , Samuel T. Kea ing a , , Jelme H. an Pu elen a , g , Ma in Jaege a , Leo A. B. Joos en a , h , * , 2 , Mihai G. Ne ea a , i , * , 2 a Depa men o In e nal Medicine, Radboud Cen e o In ec ious Diseases (RCI), Radboud Uni e si y Medical Cen e , Nijmegen, he Ne he lands b Depa men o Gene ics, Uni e si y o G oningen, Uni e si y Medical Cen e G oningen, G oningen, he Ne he lands c Depa men o Compu a ional Biology o Indi idualised In ec ion Medicine, Cen e o Indi idualised In ec ion Medicine (CiiM) & TWINCORE, Join Ven u es Be ween he Helmhol z-Cen e o In ec ion Resea ch (HZI) and he Hanno e Medical School (MHH), Hanno e , Ge many d Resea ch Cen e o Vi amins and Vaccines, Bandim Heal h P ojec , S a ens Se um Ins i u , Copenhagen, Denma k e Odense Pa ien Da a Explo a i e Ne wo k, Uni e si y o Sou he n Denma k/Odense Uni e si y Hospi al, Odense, Denma k Depa men o Biology, Uni e si y o Copenhagen, Copenhagen, Denma k g Depa men o Heal h E idence, Radboud Uni e si y Medical Cen e , Nijmegen, he Ne he lands h Depa men o Medical Gene ics, Iuliu Hațieganu Uni e si y o Medicine and Pha macy, Cluj-Napoca, Romania i Depa men o Genomics & Immuno egula ion, Li e and Medical Sciences Ins i u e (LIMES), Uni e si y o Bonn, Bonn, Ge many ARTICLE INFO Keywo ds: T ained immuni y Si uin 1 In lamma ion ABSTRACT Si uin 1 (SIRT1) has been desc ibed o modi y immune esponses by modula ion o gene ansc ip ion. As ansc ip ional ep og amming is he molecula subs a e o ained immuni y, a de ac o inna e immune memo y, we in es iga ed he ole o SIRT1 in he induc ion o ained immuni y. We iden i ied a ious SIRT1 gene ic single nucleo ide polymo phisms a ec ing inna e and adap i e cy okine p oduc ion o human pe iphe al blood mononuclea cells (PBMCs) in esponse o a ious s imuli on he one hand, and in i o induc ion o ained immuni y on he o he hand. Fu he mo e, inhibi ion o SIRT1 up egula ed p o-in lamma o y inna e cy okine p oduc ion upon s imula ion o PBMCs. Howe e , inhibi ion o SIRT1 in i o had no e ec on cy okine esponses upon induc ion o ained immuni y, while ac i a ion o SIRT1 mildly modi ied ained immuni y esponses. In conclusion, SIRT1 modi ies inna e cy okine p oduc ion by PBMCs in esponse o a ious mic obes, bu has only a seconda y ole o BCG and β-glucan-induced ained immuni y esponses. 1. In oduc ion Si uins a e a amily o highly conse ed nico inamide adenine dinucleo ide (NAD) + -dependen p o ein deace ylases. The mammalian si uin amily consis s o se en p o eins (SIRT1-7), which a e in ol ed in a a ie y o cellula p ocesses including cell di e en ia ion, me abolism, and s ess esponses [1,2]. Si uins deace yla e lysine esidues o bo h his one p o eins and nonhis one subs a es, including ansc ip ion ac o s [1]. An inc easing body o e idence demons a es ha SIRT1 modi ies immune esponses and in lamma ion [3]. On one hand, mos s udies show ha acu e in lamma ion dec eases he exp ession le el o SIRT1, which leads o a p o-in lamma o y esponse [4–7]. This can occu ia he deace yla ion o NF-κB subuni RelA/p65, o indi ec ly by inducing ep essi e ansc ip ional complexes [3,8]. On he o he hand, p olonged mic obial exposu e led o an inc ease in SIRT1 le els and caused immunosupp ession [9]. Addi ionally, SIRT1 has been desc ibed o suppo he swi ch om glycolysis o a y acid oxida ion in a THP-1 monocy e cell line du ing adap a ion o acu e in lamma ion, in conjunc ion wi h SIRT6, h ough an epigene ic-based mechanism [10]. SIRT1 is able o deace yla e H1 his ones a lysine (K) 26, as well as H3 his ones a lysine 9 (H3K9), lysine 14 (H3K14), and H4 his ones a lysine 16 (H4K16) [9,11,12], his esul s in pleio opic e ec s. * Co esponding au ho s a : Depa men o In e nal Medicine (463), Radboud Uni e si y Medical Cen e , Gee G oo eplein 8, 6525 GA Nijmegen, The Ne he lands. E-mail add esses: [email p o ec ed] (L.A.B. Joos en), [email p o ec ed] (M.G. Ne ea). 1 Sha ed i s au ho ship. 2 Sha ed senio au ho ship. Con en s lis s a ailable a ScienceDi ec Cellula Immunology jou nal homepage: www.else ie .com/loca e/ycimm h ps://doi.o g/10.1016/j.cellimm.2021.104393 Recei ed 26 No embe 2020; Recei ed in e ised o m 31 May 2021; Accep ed 5 June 2021 Cellula Immunology 366 (2021) 104393 2 The e m ained immuni y desc ibes he p ocess by which inna e immune cells unde go unc ional ep og amming a e ce ain s imula- ions/in ec ions, o moun a de ac o immune memo y ha suppo s long- e m al e ed immune esponses o seconda y non-speci ic s imu- la ion [13,14]. Bo h β-glucan, a cell wall componen o many ungal species, and he bacillus Calme e-Gu´ e in (BCG) accine, which is cu en ly used o p e en ion o ube culosis, ha e been ex ensi ely s udied he las yea s o hei abili y o induce ained immuni y [13]. This non-speci ic inna e immune memo y is cha ac e ized by epigene ic and me abolic ewi ing and esul s in enhanced p o-in lamma o y cy okine p oduc ion. β-glucan-induced ained immuni y is media ed by binding o he Dec in-1 ecep o , subsequen ac i a ion o mTOR/ HIF-1 α [15], and up egula ion o bo h glycolysis and oxida i e phos- pho yla ion [16]. Fu he mo e, H3K4me3 and H3K27ac en ichmen a p omo e s o p o-in lamma o y genes is associa ed wi h ch oma in accessibili y in ained cells, esul ing in inc eased ansc ip ion o p o- in lamma o y genes [17]. In con as , lipopolysaccha ide (LPS) om g am-nega i e bac e ia can induce a ole an mac ophage pheno ype, which is e ac o y o immune s imula ion and cha ac e ized by dec eased p o-in lamma o y cy okine p oduc ion [18]. SIRT1 has been shown o play a ole du ing endo oxin ole ance [9], as i s inhibi ion signi ican ly imp o ed su i al o sepsis in oden s [3,19]. A low SIRT1 ac i i y is obse ed in ch onic in lamma o y diseases, he e o e inc easing SIRT1 ac i i y would be bene icial in his s a e [3]. In e es ingly, SIRT1 exp ession was ound o be dec eased upon β-glucan-induced ained immuni y in monocy es [15]. T ained immuni y is pi o al o he bene icial he e ologous e ec s o some accines, bu also in media ing dele e ious e ec s in in lamma o y diseases in which i is inapp op ia ely ac i a ed [13,20]. I is hus essen ial o iden i y he mechanisms ha egula e ained immuni y esponses [13,21] in o de o design no el immunomodula o y s a e- gies. Gi en ha SIRT1 a ec s he immune esponse by me abolic and epigene ic mechanisms, we sough o in es iga e he ole o SIRT1 in inna e immune memo y using gene ic and pha macological app oaches. 2. Resul s 2.1. SIRT1 gene ic polymo phisms a e associa ed wi h cy okine esponses upon PBMC s imula ion To explo e he in ol emen o SIRT1 in immune esponses, we i s assessed he e ec o SIRT1 single nucleo ide polymo phisms (SNPs) on cy okine esponses o heal hy indi iduals in esponse o di e en mi- c obial s imuli. This was in es iga ed in a coho o 534 heal hy in- di iduals (500FG s udy), in which isola ed pe iphe al blood mononuclea cells (PBMCs) we e s imula ed ex i o wi h a ious mi- c oo ganisms o (non-)mic obial p oduc s, and cy okine p oduc ion was subsequen ly measu ed [22,23]. Bo h inna e (IL-6, TNF- α , IL-1β a e s imula ion o 24 h) and adap i e (IL-22, IL-17, IFN-γ a e s imula ion o 7 days) cy okine esponses we e in luenced by SNPs in he SIRT1 gene known as exp ession quan i a i e ai loci (eQTLs), in esponse o bac e ia (Bac e oides ( agilis), Bo elia (bu gdo e i), Coxiella bu ne i, Esche ichia coli, Mycobac e ium ube culosis, S aphylococcus au eus), ungi (Aspe gillus umiga us conidia), yeas s (C yp ococcus, Candida albicans and hyphae), TLR ligands (CpG oligodeoxynucleo ides, LPS, Pam3Cys) and non-mic obial s imuli (monosodium u a e c ys als (MSU) +pal- mi ic acid (C16.0)) (Table 1). Fo a mino i y o he s imuli (hea -killed C. albicans, in luenza i us, MSU alone, phy ohemagglu inin, o poly I: C), no e ec s o SIRT1 gene ic a ian s we e obse ed. 2.2. SIRT1 inhibi ion inc eases inna e p o-in lamma o y cy okine p oduc ion in PBMCs This p omp ed us o in es iga e whe he inhibi ion o SIRT1 a ec s in lamma o y cy okine p oduc ion in PBMCs isola ed om heal hy indi iduals in i o. PBMCs we e exposed o he syn he ic SIRT1 inhib- i o EX-527 a a ious concen a ions (1–100 µM), and s imula ed o 24 h wi h TLR4 ligand LPS o TLR1/2 ligand Pam3Cys. These concen a- ions o EX-527 we e no oxic o he cells (Supplemen a y Fig. 1). T ansc ip ion o IL6, TNFA, and IL1B was inc eased upon SIRT1 inhi- bi ion, al hough his was no s a is ically signi ican (Fig. 1A). Acco d- ingly, PBMC s imula ion wi h LPS oge he wi h inhibi ion o SIRT1 esul ed in a 1.2–1.4 old inc eased p oduc ion o p o-in lamma o y cy okines IL-1β, IL-6, and TNF- α (Fig. 1B). A simila , hough less p o- nounced, signi ican inc ease in IL-6 and IL-1β p oduc ion was obse ed in esponse o SIRT1 inhibi ion and Pam3Cys s imula ion (Fig. 1B). In con as , SIRT1 inhibi ion in Candida albicans-s imula ed PBMCs did no a ec p oduc ion o adap i e cy okines IFN-γ, IL-22, and IL-17 a e 7 days (Fig. 2). Addi ionally, inhibi ion o SIRT1 di ec ly a ec ed su ace exp ession o human monocy e ma ke s CD14, CD11b, and HLA-DR. Ou da a indica e inc eased CD14 exp ession a e 24 h exposu e o 10 µM EX-527. Simila ly, a mino bu signi ican inc ease in CD11b exp ession on CD14 +monocy es was obse ed in 100 µM EX-527 ea ed cells. Though no signi ican , we obse ed a end owa ds dec eased exp ession o HLA-DR on CD14 +monocy es (Supplemen a y Fig. 2). 2.3. SIRT1 gene ic polymo phisms a e associa ed wi h ained immuni y in i o A e con i ming he impo ance o SIRT1 o modula ing di ec cy okine p oduc ion, we sough o in es iga e whe he gene ic a ia ion in he SIRT1 gene in luences ained immuni y. The e ec o SIRT1 SNPs on cy okine p oduc ion upon induc ion o ained immuni y in i o was in es iga ed in PBMCs isola ed om 267 heal hy indi iduals o he 300BCG coho [24]. Monocy es we e s imula ed wi h β-glucan, BCG, o RPMI medium as con ol, o 24 h. The ea e , cells we e washed, es ed o 5 days, and on day 6 es imula ed wi h he non-speci ic s imulus LPS o 24 h. Subsequen ly, cy okine p oduc ion (IL-6 and TNF- α ) was measu ed in he supe na an o assess ained immuni y esponses. The impac o SIRT1 gene polymo phisms on ained immuni y was assessed by co ela ing indi idual SNPs wi h he magni ude o ained immuni y esponses, measu ed by cy okine p oduc ion in ained cells compa ed o un ained cells (RPMI con ol). As shown in Fig. 3, a gene ic a ian ( s10740283 a ch omosome 10) in close p oximi y o he SIRT1 gene (desc ibed as SIRT1 eQTL in whole blood [25]), in luenced IL-6 p o- duc ion in cells ained wi h BCG (P =0.004 and P =0.01). SNP s2485679 (also known as SIRT1 eQTL in whole blood [25]), in luenced he old change o TNF- α p oduc ion upon β-glucan aining (bo de line signi icance o P =0.05 and P =0.07). Nex , we in es iga ed he impac o SIRT1 polymo phisms on in i o ained immuni y esponses. This was assessed by QTL mapping o SNP geno ypes and S. au eus-induced cy okine esponses ex i o o BCG- accina ed heal hy indi iduals om he 300BCG coho . Howe e , no signi ican impac o SIRT1 poly- mo phisms on in i o induc ion o ained immuni y was obse ed (P > Table 1 SIRT1 gene ic polymo phisms a e associa ed wi h cy okine e- sponses upon PBMC s imula ion. QTL mapping o SIRT1 gene ic a ian s om heal hy indi iduals o he 500FG coho and cy okine p oduc ion o PBMCs in esponse o s imula ion in i o wi h a ious s imuli (see Me hods). The s onges signi ican ly associa ed gene ic a ian s o a speci ic cy okine-s imuli combina ion a e shown. 18S FW GATGGGCGGCGGAAAATAG 18s RV GCGTGGATTCTGCATAATGGT TNFA FW AACGGAGCTGAACAATAGGC TNFA RV TCTCGCCACTGAATAGTAGGG IL1B FW ATCACTGAACTGCACGCTCC IL1B RV TGGAGAACACCACTTGTTGC IL6 FW AGCCCACCGGGAACGA IL6 RV GGACCGAAGGCGCTTGT V.P. Mou i s e al. Cellula Immunology 366 (2021) 104393 3 0.05). 2.4. The e ec o SIRT1 on induc ion o ained immuni y In a ollowing se o expe imen s, we assessed he e ec s o pha - macological inhibi ion o SIRT1 by EX-527 on ained immuni y induced by β-glucan o BCG, o ole ance induced by LPS. The addi ion o EX-527 did no a ec ei he ained immuni y o ole ance in e ms o IL-6 and TNF- α p oduc ion a e es imula ion wi h LPS (Fig. 4A). To alida e hese esul s, we in es iga ed he e ec o SIRT1 ac i a o SRT1720 [26]. Cells ained wi h BCG in he p esence o SRT1720 exhibi ed ele a ed p oduc ion o IL-6 and TNF- α . On he o he hand, cells ained wi h β-glucan in he p esence o SRT1720 did no p oduce mo e TNF- α han cells ained wi h β-glucan unde no mal condi ions, bu induced a small, ye signi ican dec ease in IL-6 p oduc ion (Fig. 4B). In addi ion o cy okine p oduc ion, he e ec s o EX-527 on me abolic changes induced by ained immuni y we e in es iga ed by means o lac a e measu emen p io o and a e es imula ion wi h LPS. Lowe le els o lac a e we e measu ed in he supe na an s o β-glucan ained cells in he p esence o 100 µM EX-527, indica ing lowe glycoly ic ac i i y in hese cells (Fig. 4C). 3. Discussion In he p esen s udy, we show ha gene ic a ia ion in SIRT1 in- luences he induc ion o in lamma ion as e lec ed by cy okine p o- duc ion upon s imula ion o PBMCs, as well as he induc ion o ained immuni y in an in i o expe imen al model. In con as , SIRT1 poly- mo phisms did no a ec he in i o induc ion o ained immuni y by BCG accina ion. Pha macological inhibi ion o SIRT1 in luenced acu e p o-in lamma o y inna e cy okine p oduc ion, whe eas i did no modula e he induc ion o ained immuni y by BCG o β-glucan. On he o he hand, pha macological SIRT1 ac i a ion a ec ed ained immu- ni y esponses in i o. SIRT1 has p e iously been desc ibed o modula e in lamma ion, wi h ei he inhibi o y [3,27,28] o s imula o y e ec s [29], depending on he expe imen al model. Fo example, SIRT1 o e exp ession in a h i is pa ien s is associa ed wi h inc eased p o-in lamma o y cy okine p o- duc ion [30,31], whe eas SIRT1 ac i a ion did no a ec PBMCs de i ed om heal hy indi iduals in he same s udy [30]. In he cu en s udy, we IL1B 0 100 200 300 400 500 600 700Con ol 1uM EX-527 10 uM EX-527 100 uM EX-527 RPMI LPS P3C Fold change TNFA 0 20 40 60 80 RPMI LPS P3C Fold change IL6 0 50 100 150 200 250 300 350 RPMI LPS P3C Fold change IL-1 0 2000 4000 6000 8000 RPMI LPS P3C ***** p=0.05 Con ol 1 M EX-527 10 M EX-527 100 M EX-527 pg/ml IL-6 0 5000 10000 15000 20000**** ** RPMI LPSP3C pg/ml TNF 0 200 400 600* RPMI LPS P3C pg/ml Fig. 1. SIRT1 inhibi ion inc eases inna e cy okine p oduc ion o PBMCs. (A) RT-qPCR esul s o IL1B and TNFA (n =7), IL6 (n =5), and (B) cy okine p oduc ion o IL-1β, IL-6, TNF- α in supe na an (n ≥10), o PBMCs isola ed om heal hy indi iduals we e s imula ed wi h LPS (10 ng/mL) o Pam3Cys (10 µg/mL), o non- s imula ed (RPMI con ol), o 24 h in combina ion wi h EX-527 (1–100 µM). Mean ±SEM, *P <0.05, **P <0.01, ***P <0.001, Wilcoxon signed- ank es . V.P. Mou i s e al. Cellula Immunology 366 (2021) 104393 4 alida ed he ole o SIRT1 in he modula ion o he in lamma o y esponse by iden i ying SIRT1 SNPs ha impac cy okine esponses upon s imula ion wi h a ious mic oo ganisms, TLR ligands, and non- mic obial s imuli. Some o hese SNPs we e mos s ongly associa ed wi h cy okine p oduc ion induced by up o ou dis inc s imuli ( s12360310 and s7083505), whe eas o he SNPs mos signi ican ly a ec ed cy okines only a e speci ic s imula ions. We con i med he an i-in lamma o y ole o SIRT1 in acu e s imu- la ion o human PBMCs by pha macological inhibi ion. In e es ingly, SIRT1 seems o be speci ically in ol ed in he modula ion o he cy o- kines ha a e mainly p oduced by inna e immune cells, bu much less in he egula ion o cy okines p oduced mainly by he adap i e immune cells (IFN-γ, IL-17, IL-22). Mo e s udies a e needed o un a el he mechanisms by which SIRT1 a ec s cy okine esponses o di e en s imuli, and in speci ic cell ypes. Because EX-527 inhibi s SIRT1 en- zymes by exploi ing hei NAD + -dependen deace yla ion mechanism [32], his e ec may include modi ied deace yla ion o NF-κB subuni RelA/p65, which mainly egula es he exp ession o in lamma o y genes by myeloid cells [5,6]. To iden i y possible mechanisms egula ing ained immuni y e- sponses, we in e oga ed he ole o SIRT1 in he induc ion o ained immuni y using gene ic and pha macological app oaches. Fi s , we showed ha SIRT1 SNP s10740283 in luences BCG-induced ained immuni y esponses in PBMCs o heal hy indi iduals in i o. This SNP has p e iously been shown o a ec SIRT1 exp ession in human whole blood [25]. SIRT1 SNP s2485679, which is also a SIRT1 eQTL in human whole blood, in luenced β-glucan-induced ained immuni y bo de line signi ican . To iden i y whe he SIRT1 also plays a ole in induc ion o ained immuni y in i o, we assessed he e ec o hese polymo phisms on ained immuni y esponses induced by BCG accina ion in heal hy indi iduals. Howe e , we did no obse e signi ican associa ions be- ween SIRT1 SNPs and BCG-induced ained immuni y esponse, sug- ges ing ha SIRT1 has a limi ed con ibu ion o he p ocess o ained immuni y in i o. The sample size o he 300BCG coho migh con ibu e o he ac ha SIRT1 gene ic a ian s do no show a signi - ican e ec on cy okine esponses upon induc ion o ained immuni y. To u he assess he e ec o SIRT1 on ained immuni y, we used pha macological modula o s o SIRT1. We did no obse e an e ec o SIRT1 inhibi o EX-527 on ained immuni y esponses, and we obse ed only limi ed al e a ions in ained immuni y esponses by using he SIRT1 ac i a o SRT1720. Unexpec edly, a small bu signi i- can dec ease in IL-6 p oduc ion (bu no TNF- α ) was obse ed upon β-glucan-induced ained immuni y in combina ion wi h SRT1720. In con as , BCG-induced ained immuni y in combina ion wi h SRT1720 inc eased IL-6 and TNF- α p oduc ion. Because SRT1720 ac i a es SIRT1 by an unknown mechanism [33], i is impossible o specula e on he cause o he disc epancy compa ed o he esul s using SIRT1 inhibi o EX-527. Liu e al. iden i ied SIRT1 o play a ole in gene a ing endo oxin ole ance [9]. He e, we could no ecapi ula e he in luence o SIRT1 on ole ance in human monocy es. This appa en inconsis ency may be due o he di e en model and cells used: in con as o he s udy o Liu e al. which assessed he e ec on SIRT1 sho ly a e LPS s imula ion (up o 4 h) in THP-1 cells, we s udied he e ec o SIRT1 upon non-speci ic IFN-y 0 100 200 300 400 500 RPMI Candida Con ol 1 M EX-527 10 M EX-527 100 M EX-527 pg/ml IFNy IL-17 0 1000 2000 3000 RPMI Candida pg/ml IL-17 IL-22 0 1000 2000 3000 4000 5000 RPMI Candida pg/ml IL-22 Fig. 2. SIRT1 inhibi ion does no a ec adap i e cy okine p oduc ion o PBMCs. Cy okine assessmen in supe na an o PBMCs isola ed om heal hy indi iduals which we e s imula ed wi h C. albicans (1 ×10 6 cells/mL), o non- s imula ed (RPMI con ol), o 7 days in combina ion wi h EX-527 (1–100 µM). Mean ±SEM, n =n ≥3, n.s., Wilcoxon signed- ank es . -glucan GG TG TT -2 -1 0 1n=201 n=64 n=4 p=0.05 p=0.07 TNF- BCG AA AC CC -1.5 -1.0 -0.5 0.0 0.5 1.0 n=42 n=127 n=100 p=0.01 p=0.004 IL-6 Fig. 3. SIRT1 gene ic polymo phisms a e associa ed wi h in i o ained immuni y esponses. Adhe en cells o he PBMC ac ion de i ed om heal hy indi iduals o he 300BCG coho we e s imula ed in i o wi h BCG (5 µg/mL) and β-glucan (2 µg/mL) o 24 h, subsequen ly washed, es ed o 5 days, and a day 6 es imula ed o 24 h wi h 10 ng/mL LPS. IL-6 and TNF- α cy okine p oduc ion was measu ed in supe na an by ELISA (Mean, Mann Whi ney U es ). V.P. Mou i s e al. Cellula Immunology 366 (2021) 104393 5 es imula ion in human mac ophages 6 days a e 24 h EX-527 ea men . To conclude, gene ic a ia ion in SIRT1 is associa ed wi h cy okine esponses o PBMCs o s imula ion wi h a ious mic obial and non- mic obial s imuli, whe e SIRT1 inhibi ion esul s in inc eased inna e p o-in lamma o y cy okine p oduc ion o PBMCs in i o. Al hough SIRT1 gene ic a ian s had a mode a e e ec on in i o BCG- and β-glucan-induced ained immuni y, his e ec was no alida ed in in i o models o BCG accina ion. Inhibi ion o SIRT1 unc ion did no in luence he induc ion o ained immuni y in monocy es, whe eas ac i a ion o SIRT1 only mildly modi ied ained immuni y esponses in i o. The impac o SIRT1 inhibi ion o ac i a ion on he unc ion o o he immune cells is emains o be in es iga ed. Taken oge he , despi e i s egula o y ole in he acu e induc ion o in lamma ion, SIRT1 does no play an impo an ole in BCG- and β-glucan-induced ained immuni y. 4. Me hods 4.1. Reagen s RPMI 1640 (Du ch modi ied; Gibco, Li e Technologies, MA) was used as cul u e medium supplemen ed wi h 5 µg/ml gen amicin (Cen a a m B.V., he Ne he lands), 2 mM L-glu amine (Gibco), and 1 mM py u a e (Gibco). Syn he ic Pam3Cys (Pam3Cys) was pu chased om EMC Mic ocollec ions (Ge many), Esche ichia coli lipopolysaccha ide (LPS; se o ype 055:B5, Sigma-Ald ich), β-glucan (β −1,3-(D)-glucan) was kindly p o ided by P o esso Da id Williams (Eas Tennessee S a e Uni e si y, TN), and bacillus Calme e Gu´ e in (BCG) accine was pu - chased om In e Vax (Ma kham, ON, Canada). SIRT1 inhibi o EX-527 was pu chased om Sigma-Ald ich, SIRT1 ac i a o SRT1720 was pu - chased om Selleckchem. Candida albicans UC820 (ATCC MYA-3573) was hea -killed a 95 ◦C o 30 min. 4.2. Blood samples Pe iphe al blood mononuclea cells (PBMCs) we e isola ed om EX-527 0 1 2 3 4 5 6 7 RPMI -glucanBCG LPS Fold change IL-6 EX-527 0 1 2 3 4 5 6 7 8 9 RPMI -glucanBCG LPS Con ol 1 M EX-527 10 M EX-527 Fold change TNF- SRT1720 0.0 0.5 1.0 1.5 2.0 2.5 RPMI -glucan BCG ** Fold change IL-6 n.s. SRT1720 0 1 2 3 4 RPMI 1 M SRT1720 5 M SRT1720 n.s. * * RPMI -glucan BCG Fold change TNF- EX-527 D6 RPMI -glucan BCG 0 1000 2000 3000 4000 * * * Lac a e ( M) EX-527 D6+LPS RPMI -glucan BCG 0 500 1000 1500 2000Con ol 10 M EX-527 100 M EX-527 * * Lac a e ( M) Fig. 4. E ec o SIRT1 modi ica ion on in i o ained immuni y. Monocy es de i ed om heal hy indi iduals we e s imula ed in i o wi h β-glucan (2 µg/mL), BCG (5 µg/mL), LPS (1 ng/mL), o non-s imula ed (RPMI con ol), o 24 h, in combina ion wi h (A, C) EX-527, and (B) SRT1720, subsequen ly washed, es ed o 5 days, and a day 6 es imula ed o 24 h wi h LPS. IL-6 and TNF- α cy okine p oduc ion and lac a e concen a ions we e measu ed in supe na an . Mean ±SEM, *P <0.05, Wilcoxon signed ank es . V.P. Mou i s e al. Cellula Immunology 366 (2021) 104393 6 bu y coa s o heal hy blood dono s (Sanquin, Nijmegen, The Ne he lands). Inclusion o olun ee s and expe imen s we e conduc ed acco ding o he p inciples exp essed in he Decla a ion o Helsinki. All olun ee s ga e w i en in o med consen be o e any ma e ial was aken. 4.3. Popula ion coho s QTL mapping using geno ype da a and cy okine p oduc ion upon s imula ion and induc ion o ained immuni y was pe o med in a coho o app oxima ely 500 and 300 heal hy indi iduals o Wes e n Eu opean ances y, espec i ely om he Human Func ional Genomics P ojec (500FG and 300BCG, see www.human unc ionalgenomics.o g). The 500FG coho comp ises 534 adul s om Nijmegen, he Ne he lands (44% males and 56% emales, age ange 18–75 yea s). PBMCs we e isola ed and s imula ed in i o wi h a ious s imuli, and cy okines upon s imula ion we e measu ed, as p e iously desc ibed [34]. The 300BCG coho consis s o 325 adul s om he Ne he lands (43% males and 57% emales, age ange 18–71 yea s). PBMCs we e isola ed and seed in 96- wells pla es (Co ning, USA). A e washing away he non-adhe en cells wi h PBS he adhe en cells we e subsequen ly s imula ed in i o wi h BCG o β-glucan, and es imula ed a e 6 days wi h LPS, and cy okine p oduc ion was subsequen ly measu ed. Fu he mo e, in- di iduals om he 300BCG coho we e accina ed wi h 0.1 mL o BCG (BCG accine s ain Bulga ia; In e Vax, Canada), and PBMCs we e iso- la ed, and s imula ed ex i o wi h 5 ×10 6 CFU/mL hea -killed S. au eus be o e accina ion, and 2 weeks and 3 mon hs a e accina ion. IL-1β, IL-6, and TNF α p oduc ion was measu ed a e 24 h in supe na an s. The 500FG and 300BCG s udy we e app o ed by he e hical commi ee o he Radboud Uni e si y and Radboudumc Nijmegen (no. 42561.091.12 and NL58553.091.16). 4.4. PBMC isola ion and s imula ion Cells we e isola ed by densi y cen i uga ion on Ficoll-Paque (GE Heal hca e, UK), washed h ee imes in PBS and esuspended in cul u e medium. A e isola ion, 5 ×10 5 PBMCs we e added o a ound bo om 96-wells pla e (G eine , Aus ia). Pam3Cys (10 μ g/mL) o LPS (10 ng/ mL) we e added o 24 h a 37 ◦C and 5% CO 2 , Candida albicans was added o 7 days (1 ×10 6 cells/mL), wi h o wi hou addi ion o EX-527 (1–100 μ M). 4.5. Monocy e isola ion and s imula ion Pe coll monocy es we e isola ed by laye ing hype -osmo ic Pe coll solu ion (48,5% Pe coll (Sigma-Ald ich), 41,5% s e ile H 2 O, 0.16 M il e -s e ilized NaCl) on PBMCs. A e 15 min cen i uga ion a 580 ×g, he in e phase laye was isola ed, cells we e washed wi h PBS, and esuspended in cul u e medium. To inc ease he pu i y o Pe coll- isola ed monocy es, he monocy es we e adhe ed o polys y ene la bo om pla es (Co ning, USA) o Pe i dishes (Falcon, Me ck) o 1 h a 37 ◦C ollowed by washing wi h wa m PBS. Nex , cells we e p e- incuba ed wi h cul u e medium supplemen ed wi h 10% human pooled se um as con ol, o oge he wi h EX-527 (1–10 μ M) o SRT1720 (1–5 μ M). Nex , cul u e medium supplemen ed wi h 10% human pooled se um was added as a con ol, o oge he wi h ei he 2 μ g/mL β-glucan, 5 μ g/mL BCG In e Vax, o LPS (1 ng/mL). A e 24 h, cells we e washed wi h wa m PBS and cul u e medium was added. Cul u e medium was e eshed a e 3 days o incuba ion. On day 6, cells we e es imula ed wi h RPMI, LPS (10 ng/mL), o Pam3Cys (10 μ g/mL). A e 24 h, su- pe na an s we e collec ed and s o ed a −20 ◦C un il u he use. 4.6. Cy okine and lac a e measu emen s Cy okine concen a ions we e measu ed in supe na an s using com- me cial sandwich ELISA ki s o human IL-6, TNF- α , IL-1β, IL-17, IL-22 (R&D sys ems) and IFN-γ (Sanquin Resea ch) in acco dance wi h he manu ac u e ’s ins uc ions. Lac a e concen a ion was measu ed in supe na an s o mac ophages using an enzyma ic assay as desc ibed p e iously [35]. In b ie , supe na an s con aining se um (day 6) we e p e- ea ed wi h pe chlo ic acid and NaOH o p e en po en ial p o ein in e e ence wi h he assay. Lac a e concen a ion was de e mined by enzyma ic eac ion wi h lac a e oxidase (Sigma-Ald ich), Amplex Red eagen (Li e Technologies) and ho se adish pe oxidase (Sigma- Ald ich). A e 20 min incuba ion, luo escence o eso u in (570/585 nm) was measu ed. 4.7. Quan i a i e RT-PCR A baseline, a e 4 h, 24 h, and 6 days, RNA was isola ed om ained monocy es by using TRIzol eagen acco ding o manu ac u e ’s ins uc ions. Fi s -s and cDNA syn hesis was pe o med using Supe - Sc ip III, ollowed by syn hesis o he second cDNA s and (The mo Fishe Scien i ic) acco ding o he manu ac u e ’s p o ocol. Quan i a i e PCR was pe o med using S epOne PLUS machine (Applied Biosciences) using SYBR G een (In i ogen). The alues a e exp essed as log2 old inc ease in mRNA le els ela i e o hose in non- ained cells. 18S was used as a housekeeping gene. The p ime sequences a e lis ed below: 4.8. Viabili y assay Cy o oxici y was analyzed by de ec ing lac a e dehyd ogenase (LDH) di ec ly in esh supe na an using he Cy oTox 96® Non-Radioac i e Cy o oxici y Assay (P omega, he Ne he lands), in acco dance wi h he manu ac u e ’s ins uc ions. 4.9. Gene ic analysis Isola ed DNA o he 500FG indi iduals was geno yped using he comme cially a ailable SNP chip, Illumina HumanOmniExp essExome- 8 1.0. Cy okine QTL mapping was conduc ed using he geno ypes and cy okine measu emen s upon in i o s imula ion o isola ed PBMCs, as p e iously desc ibed [23]. The mos signi ican ly associa ed SNP o a pa icula cy okine-s imuli combina ion is shown in Table 1. DNA samples om indi iduals o he 300BCG coho we e geno yped using he comme cially a ailable SNP chip, In inium Global Sc eening A ay MD 1.0 om Illumina. Op icall 0.7.0 wi h de aul se ings was used o geno ype calling [36]. Samples wi h a call a e ≤0.99 we e excluded, as we e a ian s wi h a Ha dy-Weinbe g equilib ium (HWE) ≤0.0001, and mino allele equency (MAF) ≤0.1. S ands o a ian s we e aligned and iden i ied agains he 1000 Genome e e ence panel using Geno ype Ha monize [37]. We hen impu ed he samples on he Michigan impu a ion se e using he human e e ence conso ium (HRC 1.1 2016) as a e e ence panel [38], and we il e ed ou gene ic a ian s wi h an R 2 <0.3 o impu a ion quali y. We iden i ied and excluded 17 gene ic ou lie s, and selec ed 4,296,841 SNPs wi h MAF 5% o ollow- up QTL mapping. Bo h geno ype and cy okine da a on in i o ained immuni y esponses induced by BCG o β-glucan in monocy es was ob- ained o a o al o 267 indi iduals. Raw cy okine le els we e log- ans o med and he old change o cy okine p oduc ion be ween ained and non- ained cells was aken as a measu emen o he magni ude o he in i o ained immuni y esponse. The cy okine changes we e mapped o geno ype da a using a linea eg ession model wi h age and sex as co a ia es o co ec he dis ibu ions o old change o cy okine p oduc ion. Simila app oach was ollowed o iden i y QTLs using he ex i o cy okine p oduc ion om PBMCs a e BCG accina- ion in heal hy olun ee s. Bo h geno ype and cy okine da a on ex i o ained immuni y esponses we e ob ained o a o al o 296 indi iduals. The old change in cy okine p oduc ion (a e accina ion compa ed o baseline) was used as a measu emen o he magni ude o he ained immuni y esponse. The old change o cy okine p oduc ion was log- ans o med, and we e mapped o geno ype da a using a linea V.P. Mou i s e al. Cellula Immunology 366 (2021) 104393 7 eg ession model wi h age and sex as co a ia es. R-package Ma ix-eQTL was used o QTL mapping. 4.10. Flow cy ome y Isola ed Pe coll monocy es we e exposed o EX-527 o ehicle con- ol o 24 h. Fo cell su ace ma ke analysis, cells we e washed in PBS con aining 1% BSA and s ained wi h an i-CD14 APC (M5E2 clone), an i- HLA-DR PE-Cy5 (L243 clone), and an i-CD11b BV785 (ICRF44 clone; all Biolegend). Flow cy ome y expe imen s we e pe o med using he Beckman Coul e Cy oFLEX. CD14 MFI was de e mined a e exclusion o double s. Du ing analysis o HLA-DR and CD11b MFI, cells we e ga ed on he CD14 +ga e o elimina e deb is and lymphocy e popula ions. 4.11. S a is ics Da a was analyzed using a Wilcoxon signed- ank es o pai ed samples, o a Mann-Whi ney U es o unpai ed samples, using G aph- Pad P ism so wa e (G aphPad Inc. e sion 8). Da a a e exp essed as mean ±SEM, and alues o *P <0.05, **P <0.01 and ***P <0.001 we e conside ed s a is ically signi ican . CRediT au ho ship con ibu ion s a emen Ve a P. Mou i s: P ojec adminis a ion, Concep ualiza ion, Me h- odology, Fo mal analysis, W i ing - o iginal d a , Valida ion, Visuali- za ion. Leonie S. Helde : Concep ualiza ion, In es iga ion, Fo mal analysis, W i ing - o iginal d a , Visualiza ion. Vasiliki Ma za aki: Da a cu a ion, Fo mal analysis, In es iga ion. Vale ie A.C.M. Koeken: Da a cu a ion, Fo mal analysis, In es iga ion. Laszlo G oh: Da a cu a- ion, In es iga ion. L. Cha lo e J. de B ee: Da a cu a ion, In es iga- ion. Simone J.C.F.M. Moo lag: Da a cu a ion, In es iga ion. Cha lo e D.C.C. an de Heijden: In es iga ion. Samuel T. Kea ing: In es iga ion. Jelme H. an Pu elen: In es iga ion. Ma in Jaege : Resou ces, Supe ision. Leo A.B. Joos en: Concep ualiza ion, Funding acquisi ion, Supe ision, W i ing - e iew & edi ing. Mihai G. Ne ea: Concep ualiza ion, Funding acquisi ion, Supe ision, W i ing - e iew & edi ing. Decla a ion o Compe ing In e es The au ho s decla e ha hey ha e no known compe ing inancial in e es s o pe sonal ela ionships ha could ha e appea ed o in luence he wo k epo ed in his pape . Acknowledgemen s We hank all he heal hy olun ee s o hei pa icipa ion. This s udy was pa ly suppo ed by an EFRO g an (COILED). MGN was suppo ed by an ERC Ad anced g an [833247] and a Spinoza g an o he Ne he lands O ganiza ion o Scien i ic Resea ch. Decla a ion o In e es MGN and LABJ a e scien i ic ounde s o T ained The apeu ics Disco e y. Appendix A. Supplemen a y da a Supplemen a y da a o his a icle can be ound online a h ps://doi. o g/10.1016/j.cellimm.2021.104393. Re e ences [1] T. Zhang, W.L. K aus, SIRT1-dependen egula ion o ch oma in and ansc ip ion: linking NAD(+) me abolism and signaling o he con ol o cellula unc ions, Biochim. Biophys. Ac a 1804 (8) (2010) 1666–1675. [2] S. Michan, D. Sinclai , Si uins in mammals: insigh s in o hei biological unc ion, Biochem. J. 404 (1) (2007) 1–13. [3] V.T. Vachha ajani, e al., Si uins link in lamma ion and me abolism, J. Immunol. Res. 2016 (2016) 8167273. [4] T.T. Schug, e al., Myeloid dele ion o SIRT1 induces in lamma o y signaling in esponse o en i onmen al s ess, Mol. Cell. Biol. 30 (19) (2010) 4712–4721. [5] L. Se ano-Ma co, e al., TNF-alpha inhibi s PPARbe a/del a ac i i y and SIRT1 exp ession h ough NF-kappaB in human adipocy es, Biochim. Biophys. Ac a 1821 (9) (2012) 1177–1185. [6] F. Yeung, e al., Modula ion o NF-kappaB-dependen ansc ip ion and cell su i al by he SIRT1 deace ylase, EMBO J. 23 (12) (2004) 2369–2380. [7] Z. Shen, e al., Role o SIRT1 in egula ion o LPS- o wo e hanol me aboli es- induced TNF-alpha p oduc ion in cul u ed mac ophage cell lines, Am. J. Physiol. Gas oin es . Li e Physiol. 296 (5) (2009) G1047–G1053. [8] M. Lei, e al., Res e a ol inhibi s in e leukin 1be a-media ed inducible ni ic oxide syn hase exp ession in a icula chond ocy es by ac i a ing SIRT1 and he eby supp essing nuclea ac o -kappaB ac i i y, Eu . J. Pha macol. 674 (2–3) (2012) 73–79. [9] T.F. Liu, e al., NAD+-dependen SIRT1 deace ylase pa icipa es in epigene ic ep og amming du ing endo oxin ole ance, J. Biol. Chem. 286 (11) (2011) 9856–9864. [10] T.F. Liu, e al., NAD+-dependen si uin 1 and 6 p o eins coo dina e a swi ch om glucose o a y acid oxida ion du ing he acu e in lamma o y esponse, J. Biol. Chem. 287 (31) (2012) 25758–25769. [11] A. Vaque o, e al., Human Si T1 in e ac s wi h his one H1 and p omo es o ma ion o acul a i e he e och oma in, Mol. Cell 16 (1) (2004) 93–105. [12] S. Imai, e al., T ansc ip ional silencing and longe i y p o ein Si 2 is an NAD- dependen his one deace ylase, Na u e 403 (6771) (2000) 795–800. [13] M.G. Ne ea, e al., De ining ained immuni y and i s ole in heal h and disease, Na . Re . Immunol. (2020). [14] M.G. Ne ea, J. Quin in, J.W. an de Mee , T ained immuni y: a memo y o inna e hos de ense, Cell Hos Mic obe 9 (5) (2011) 355–361. [15] S.C. Cheng, e al., mTOR- and HIF-1alpha-media ed ae obic glycolysis as me abolic basis o ained immuni y, Science 345 (6204) (2014) 1250684. [16] S.T. Kea ing, e al., The Se 7 lysine me hyl ans e ase egula es plas ici y in oxida i e phospho yla ion necessa y o ained immuni y induced by β-glucan, Cell Rep. 31 (3) (2020), 107548–107548. [17] S. Saeed, e al., Epigene ic p og amming o monocy e- o-mac ophage di e en ia ion and ained inna e immuni y, Science 345 (6204) (2014) 1251086. [18] B. No ako ic, e al., Be a-glucan e e ses he epigene ic s a e o LPS-induced immunological ole ance, Cell 167 (5) (2016) 1354–1368. [19] V.T. Vachha ajani, e al., SIRT1 inhibi ion du ing he hypoin lamma o y pheno ype o sepsis enhances immuni y and imp o es ou come, J. Leukoc. Biol. 96 (5) (2014) 785–796. [20] R.J.W. A s, L.A.B. Joos en, M.G. Ne ea, The po en ial ole o ained immuni y in au oimmune and au oin lamma o y diso de s, F on . Immunol. 9 (2018) 298. [21] V.P. Mou i s, e al., T ained immuni y as a no el he apeu ic s a egy, Cu . Opin. Pha macol. 41 (2018) 52–58. [22] M. Schi me , e al., Linking he human gu mic obiome o in lamma o y cy okine p oduc ion capaci y, Cell 167 (4) (2016) 1125–1136 e8. [23] Y. Li, e al., In e -indi idual a iabili y and gene ic in luences on cy okine esponses o bac e ia and ungi, Na . Med. 22 (8) (2016) 952–960. [24] V.P. Mou i s, e al., BCG-induced ained immuni y in heal hy indi iduals: he e ec o plasma mu amyl dipep ide concen a ions, J. Immunol. Res. 2020 (2020) 5812743. [25] G.T. Conso ium, Human genomics. The Geno ype-Tissue Exp ession (GTEx) pilo analysis: mul i issue gene egula ion in humans, Science 348 (6235) (2015) 648–660. [26] J.C. Milne, e al., Small molecule ac i a o s o SIRT1 as he apeu ics o he ea men o ype 2 diabe es, Na u e 450 (7170) (2007) 712–716. [27] L. Wang, e al., Si uin 1 inhibi s lipopolysaccha ide-induced in lamma ion in ch onic myelogenous leukemia k562 cells h ough in e ac ing wi h he Toll-like ecep o 4-nuclea ac o kappa B- eac i e oxygen species signaling axis, Cance Cell In . 20 (2020) 73. [28] T. Yoshizaki, e al., SIRT1 inhibi s in lamma o y pa hways in mac ophages and modula es insulin sensi i i y, Am. J. Physiol. Endoc inol. Me ab. 298 (3) (2010) E419–E428. [29] C.A. Fe nandes, e al., Si uin inhibi ion a enua es he p oduc ion o in lamma o y cy okines in lipopolysaccha ide-s imula ed mac ophages, Biochem. Biophys. Res. Commun. 420 (4) (2012) 857–861. [30] D. Wendling, e al., Res e a ol, a si uin 1 ac i a o , inc eases IL-6 p oduc ion by pe iphe al blood mononuclea cells o pa ien s wi h knee os eoa h i is, Clin. Epigene . 5 (1) (2013) 10. [31] F. Niede e , e al., SIRT1 o e exp ession in he heuma oid a h i is syno ium con ibu es o p oin lamma o y cy okine p oduc ion and apop osis esis ance, Ann. Rheum. Dis. 70 (10) (2011) 1866–1873. [32] M. Ge z, e al., Ex-527 inhibi s Si uins by exploi ing hei unique NAD+- dependen deace yla ion mechanism, P oc. Na l. Acad. Sci. 110 (30) (2013) E2772–E2781. [33] R.H. Hou koope , E. Pi inen, J. Auwe x, Si uins as egula o s o me abolism and heal hspan, Na . Re . Mol. Cell Biol. 13 (4) (2012) 225–238. V.P. Mou i s e al. Cellula Immunology 366 (2021) 104393 8 [34] Y. Li, e al., A unc ional genomics app oach o unde s and a ia ion in cy okine p oduc ion in humans, Cell 167 (4) (2016) 1099–1110 e14. [35] E. Lachmandas, e al., Mic obial s imula ion o di e en Toll-like ecep o signalling pa hways induces di e se me abolic p og ammes in human monocy es, Na . Mic obiol. 2 (2016) 16246. [36] T.S. Shah, e al., op iCall: a obus geno ype-calling algo i hm o a e, low- equency and common a ian s, Bioin o ma ics 28 (12) (2012) 1598–1603. [37] P. Deelen, e al., Geno ype ha monize : au oma ic s and alignmen and o ma con e sion o geno ype da a in eg a ion, BMC Res. No es 7 (2014) 901. [38] S. McCa hy, e al., A e e ence panel o 64,976 haplo ypes o geno ype impu a ion, Na . Gene . 48 (10) (2016) 1279–1283. V.P. Mou i s e al.