scieee Science in your language
[en] (orig)

The role of sirtuin 1 on the induction of trained immunity.

Abstract

Sirtuin 1 (SIRT1) has been described to modify immune responses by modulation of gene transcription. As transcriptional reprogramming is the molecular substrate of trained immunity, a de facto innate immune memory, we investigated the role of SIRT1 in the induction of trained immunity. We identified various SIRT1 genetic single nucleotide polymorphisms affecting innate and adaptive cytokine production of human peripheral blood mononuclear cells (PBMCs) in response to various stimuli on the one hand, and in vitro induction of trained immunity on the other hand. Furthermore, inhibition of SIRT1 upregulated pro-inflammatory innate cytokine production upon stimulation of PBMCs. However, inhibition of SIRT1 in vitro had no effect on cytokine responses upon induction of trained immunity, while activation of SIRT1 mildly modified trained immunity responses. In conclusion, SIRT1 modifies innate cytokine production by PBMCs in response to various microbes, but has only a secondary role for BCG and β-glucan-induced trained immunity responses.

Read accessible full text

The role of sirtuin 1 on the induction of trained immunity.

Author: Mourits, Vera P,Helder, Leonie S,Matzaraki, Vasiliki,Koeken, Valerie A C M,Groh, Laszlo,de Bree, L Charlotte J,Moorlag, Simone J C F M,van der Heijden, Charlotte D C C,Keating, Samuel T,van Puffelen, Jelmer H,Jaeger, Martin,Joosten, Leo A B,Netea, Mihai
Publisher: Elsevier
Year: 2021
DOI: 10.1016/j.cellimm.2021.104393
Source: https://repository.helmholtz-hzi.de/bitstream/10033/623024/1/Mourits%20et%20al%20.pdf
Cellula Immunology 366 (2021) 104393
A ailable online 12 June 2021
0008-8749/© 2021 The Au ho s. Published by Else ie Inc. This is an open access a icle unde he CC BY license (h p://c ea i ecommons.o g/licenses/by/4.0/).
Resea ch pape
The ole o si uin 1 on he induc ion o ained immuni y
Ve a P. Mou i s
a
,
1
, Leonie S. Helde
a
,
1
, Vasiliki Ma za aki
a
,
b
, Vale ie A.C.M. Koeken
a
,
c
,
Laszlo G oh
a
, L. Cha lo e J. de B ee
a
,
d
,
e
, Simone J.C.F.M. Moo lag
a
, Cha lo e D.C.
C. an de Heijden
a
, Samuel T. Kea ing
a
,
, Jelme H. an Pu elen
a
,
g
, Ma in Jaege
a
, Leo A.
B. Joos en
a
,
h
,
*
,
2
, Mihai G. Ne ea
a
,
i
,
*
,
2
a
Depa men o In e nal Medicine, Radboud Cen e o In ec ious Diseases (RCI), Radboud Uni e si y Medical Cen e , Nijmegen, he Ne he lands
b
Depa men o Gene ics, Uni e si y o G oningen, Uni e si y Medical Cen e G oningen, G oningen, he Ne he lands
c
Depa men o Compu a ional Biology o Indi idualised In ec ion Medicine, Cen e o Indi idualised In ec ion Medicine (CiiM) & TWINCORE, Join Ven u es Be ween
he Helmhol z-Cen e o In ec ion Resea ch (HZI) and he Hanno e Medical School (MHH), Hanno e , Ge many
d
Resea ch Cen e o Vi amins and Vaccines, Bandim Heal h P ojec , S a ens Se um Ins i u , Copenhagen, Denma k
e
Odense Pa ien Da a Explo a i e Ne wo k, Uni e si y o Sou he n Denma k/Odense Uni e si y Hospi al, Odense, Denma k
Depa men o Biology, Uni e si y o Copenhagen, Copenhagen, Denma k
g
Depa men o Heal h E idence, Radboud Uni e si y Medical Cen e , Nijmegen, he Ne he lands
h
Depa men o Medical Gene ics, Iuliu Hațieganu Uni e si y o Medicine and Pha macy, Cluj-Napoca, Romania
i
Depa men o Genomics & Immuno egula ion, Li e and Medical Sciences Ins i u e (LIMES), Uni e si y o Bonn, Bonn, Ge many
ARTICLE INFO
Keywo ds:
T ained immuni y
Si uin 1
In lamma ion
ABSTRACT
Si uin 1 (SIRT1) has been desc ibed o modi y immune esponses by modula ion o gene ansc ip ion. As
ansc ip ional ep og amming is he molecula subs a e o ained immuni y, a de ac o inna e immune
memo y, we in es iga ed he ole o SIRT1 in he induc ion o ained immuni y. We iden i ied a ious SIRT1
gene ic single nucleo ide polymo phisms a ec ing inna e and adap i e cy okine p oduc ion o human pe iphe al
blood mononuclea cells (PBMCs) in esponse o a ious s imuli on he one hand, and in i o induc ion o ained
immuni y on he o he hand. Fu he mo e, inhibi ion o SIRT1 up egula ed p o-in lamma o y inna e cy okine
p oduc ion upon s imula ion o PBMCs. Howe e , inhibi ion o SIRT1 in i o had no e ec on cy okine esponses
upon induc ion o ained immuni y, while ac i a ion o SIRT1 mildly modi ied ained immuni y esponses. In
conclusion, SIRT1 modi ies inna e cy okine p oduc ion by PBMCs in esponse o a ious mic obes, bu has only a
seconda y ole o BCG and β-glucan-induced ained immuni y esponses.
1. In oduc ion
Si uins a e a amily o highly conse ed nico inamide adenine
dinucleo ide (NAD)
+
-dependen p o ein deace ylases. The mammalian
si uin amily consis s o se en p o eins (SIRT1-7), which a e in ol ed in
a a ie y o cellula p ocesses including cell di e en ia ion, me abolism,
and s ess esponses [1,2]. Si uins deace yla e lysine esidues o bo h
his one p o eins and nonhis one subs a es, including ansc ip ion
ac o s [1]. An inc easing body o e idence demons a es ha SIRT1
modi ies immune esponses and in lamma ion [3]. On one hand, mos
s udies show ha acu e in lamma ion dec eases he exp ession le el o
SIRT1, which leads o a p o-in lamma o y esponse [4–7]. This can
occu ia he deace yla ion o NF-κB subuni RelA/p65, o indi ec ly by
inducing ep essi e ansc ip ional complexes [3,8]. On he o he hand,
p olonged mic obial exposu e led o an inc ease in SIRT1 le els and
caused immunosupp ession [9]. Addi ionally, SIRT1 has been desc ibed
o suppo he swi ch om glycolysis o a y acid oxida ion in a THP-1
monocy e cell line du ing adap a ion o acu e in lamma ion, in
conjunc ion wi h SIRT6, h ough an epigene ic-based mechanism [10].
SIRT1 is able o deace yla e H1 his ones a lysine (K) 26, as well as H3
his ones a lysine 9 (H3K9), lysine 14 (H3K14), and H4 his ones a lysine
16 (H4K16) [9,11,12], his esul s in pleio opic e ec s.
* Co esponding au ho s a : Depa men o In e nal Medicine (463), Radboud Uni e si y Medical Cen e , Gee G oo eplein 8, 6525 GA Nijmegen, The
Ne he lands.
E-mail add esses: [email p o ec ed] (L.A.B. Joos en), [email p o ec ed] (M.G. Ne ea).
1
Sha ed i s au ho ship.
2
Sha ed senio au ho ship.
Con en s lis s a ailable a ScienceDi ec
Cellula Immunology
jou nal homepage: www.else ie .com/loca e/ycimm
h ps://doi.o g/10.1016/j.cellimm.2021.104393
Recei ed 26 No embe 2020; Recei ed in e ised o m 31 May 2021; Accep ed 5 June 2021
Cellula Immunology 366 (2021) 104393
2
The e m ained immuni y desc ibes he p ocess by which inna e
immune cells unde go unc ional ep og amming a e ce ain s imula-
ions/in ec ions, o moun a de ac o immune memo y ha suppo s
long- e m al e ed immune esponses o seconda y non-speci ic s imu-
la ion [13,14]. Bo h β-glucan, a cell wall componen o many ungal
species, and he bacillus Calme e-Gu´
e in (BCG) accine, which is
cu en ly used o p e en ion o ube culosis, ha e been ex ensi ely
s udied he las yea s o hei abili y o induce ained immuni y [13].
This non-speci ic inna e immune memo y is cha ac e ized by epigene ic
and me abolic ewi ing and esul s in enhanced p o-in lamma o y
cy okine p oduc ion. β-glucan-induced ained immuni y is media ed
by binding o he Dec in-1 ecep o , subsequen ac i a ion o mTOR/
HIF-1
α
[15], and up egula ion o bo h glycolysis and oxida i e phos-
pho yla ion [16]. Fu he mo e, H3K4me3 and H3K27ac en ichmen a
p omo e s o p o-in lamma o y genes is associa ed wi h ch oma in
accessibili y in ained cells, esul ing in inc eased ansc ip ion o p o-
in lamma o y genes [17].
In con as , lipopolysaccha ide (LPS) om g am-nega i e bac e ia
can induce a ole an mac ophage pheno ype, which is e ac o y o
immune s imula ion and cha ac e ized by dec eased p o-in lamma o y
cy okine p oduc ion [18]. SIRT1 has been shown o play a ole du ing
endo oxin ole ance [9], as i s inhibi ion signi ican ly imp o ed su i al
o sepsis in oden s [3,19]. A low SIRT1 ac i i y is obse ed in ch onic
in lamma o y diseases, he e o e inc easing SIRT1 ac i i y would be
bene icial in his s a e [3]. In e es ingly, SIRT1 exp ession was ound o
be dec eased upon β-glucan-induced ained immuni y in monocy es
[15].
T ained immuni y is pi o al o he bene icial he e ologous e ec s o
some accines, bu also in media ing dele e ious e ec s in in lamma o y
diseases in which i is inapp op ia ely ac i a ed [13,20]. I is hus
essen ial o iden i y he mechanisms ha egula e ained immuni y
esponses [13,21] in o de o design no el immunomodula o y s a e-
gies. Gi en ha SIRT1 a ec s he immune esponse by me abolic and
epigene ic mechanisms, we sough o in es iga e he ole o SIRT1 in
inna e immune memo y using gene ic and pha macological app oaches.
2. Resul s
2.1. SIRT1 gene ic polymo phisms a e associa ed wi h cy okine esponses
upon PBMC s imula ion
To explo e he in ol emen o SIRT1 in immune esponses, we i s
assessed he e ec o SIRT1 single nucleo ide polymo phisms (SNPs) on
cy okine esponses o heal hy indi iduals in esponse o di e en mi-
c obial s imuli. This was in es iga ed in a coho o 534 heal hy in-
di iduals (500FG s udy), in which isola ed pe iphe al blood
mononuclea cells (PBMCs) we e s imula ed ex i o wi h a ious mi-
c oo ganisms o (non-)mic obial p oduc s, and cy okine p oduc ion was
subsequen ly measu ed [22,23]. Bo h inna e (IL-6, TNF-
α
, IL-1β a e
s imula ion o 24 h) and adap i e (IL-22, IL-17, IFN-γ a e s imula ion
o 7 days) cy okine esponses we e in luenced by SNPs in he SIRT1
gene known as exp ession quan i a i e ai loci (eQTLs), in esponse o
bac e ia (Bac e oides ( agilis), Bo elia (bu gdo e i), Coxiella bu ne i,
Esche ichia coli, Mycobac e ium ube culosis, S aphylococcus au eus), ungi
(Aspe gillus umiga us conidia), yeas s (C yp ococcus, Candida albicans
and hyphae), TLR ligands (CpG oligodeoxynucleo ides, LPS, Pam3Cys)
and non-mic obial s imuli (monosodium u a e c ys als (MSU) +pal-
mi ic acid (C16.0)) (Table 1). Fo a mino i y o he s imuli (hea -killed
C. albicans, in luenza i us, MSU alone, phy ohemagglu inin, o poly I:
C), no e ec s o SIRT1 gene ic a ian s we e obse ed.
2.2. SIRT1 inhibi ion inc eases inna e p o-in lamma o y cy okine
p oduc ion in PBMCs
This p omp ed us o in es iga e whe he inhibi ion o SIRT1 a ec s
in lamma o y cy okine p oduc ion in PBMCs isola ed om heal hy
indi iduals in i o. PBMCs we e exposed o he syn he ic SIRT1 inhib-
i o EX-527 a a ious concen a ions (1–100 µM), and s imula ed o 24
h wi h TLR4 ligand LPS o TLR1/2 ligand Pam3Cys. These concen a-
ions o EX-527 we e no oxic o he cells (Supplemen a y Fig. 1).
T ansc ip ion o IL6, TNFA, and IL1B was inc eased upon SIRT1 inhi-
bi ion, al hough his was no s a is ically signi ican (Fig. 1A). Acco d-
ingly, PBMC s imula ion wi h LPS oge he wi h inhibi ion o SIRT1
esul ed in a 1.2–1.4 old inc eased p oduc ion o p o-in lamma o y
cy okines IL-1β, IL-6, and TNF-
α
(Fig. 1B). A simila , hough less p o-
nounced, signi ican inc ease in IL-6 and IL-1β p oduc ion was obse ed
in esponse o SIRT1 inhibi ion and Pam3Cys s imula ion (Fig. 1B). In
con as , SIRT1 inhibi ion in Candida albicans-s imula ed PBMCs did no
a ec p oduc ion o adap i e cy okines IFN-γ, IL-22, and IL-17 a e 7
days (Fig. 2). Addi ionally, inhibi ion o SIRT1 di ec ly a ec ed su ace
exp ession o human monocy e ma ke s CD14, CD11b, and HLA-DR.
Ou da a indica e inc eased CD14 exp ession a e 24 h exposu e o
10 µM EX-527. Simila ly, a mino bu signi ican inc ease in CD11b
exp ession on CD14 +monocy es was obse ed in 100 µM EX-527
ea ed cells. Though no signi ican , we obse ed a end owa ds
dec eased exp ession o HLA-DR on CD14 +monocy es (Supplemen a y
Fig. 2).
2.3. SIRT1 gene ic polymo phisms a e associa ed wi h ained immuni y
in i o
A e con i ming he impo ance o SIRT1 o modula ing di ec
cy okine p oduc ion, we sough o in es iga e whe he gene ic a ia ion
in he SIRT1 gene in luences ained immuni y. The e ec o SIRT1 SNPs
on cy okine p oduc ion upon induc ion o ained immuni y in i o was
in es iga ed in PBMCs isola ed om 267 heal hy indi iduals o he
300BCG coho [24]. Monocy es we e s imula ed wi h β-glucan, BCG, o
RPMI medium as con ol, o 24 h. The ea e , cells we e washed, es ed
o 5 days, and on day 6 es imula ed wi h he non-speci ic s imulus LPS
o 24 h. Subsequen ly, cy okine p oduc ion (IL-6 and TNF-
α
) was
measu ed in he supe na an o assess ained immuni y esponses. The
impac o SIRT1 gene polymo phisms on ained immuni y was assessed
by co ela ing indi idual SNPs wi h he magni ude o ained immuni y
esponses, measu ed by cy okine p oduc ion in ained cells compa ed
o un ained cells (RPMI con ol). As shown in Fig. 3, a gene ic a ian
( s10740283 a ch omosome 10) in close p oximi y o he SIRT1 gene
(desc ibed as SIRT1 eQTL in whole blood [25]), in luenced IL-6 p o-
duc ion in cells ained wi h BCG (P =0.004 and P =0.01). SNP
s2485679 (also known as SIRT1 eQTL in whole blood [25]), in luenced
he old change o TNF-
α
p oduc ion upon β-glucan aining (bo de line
signi icance o P =0.05 and P =0.07). Nex , we in es iga ed he impac
o SIRT1 polymo phisms on in i o ained immuni y esponses. This was
assessed by QTL mapping o SNP geno ypes and S. au eus-induced
cy okine esponses ex i o o BCG- accina ed heal hy indi iduals om
he 300BCG coho . Howe e , no signi ican impac o SIRT1 poly-
mo phisms on in i o induc ion o ained immuni y was obse ed (P >
Table 1
SIRT1 gene ic polymo phisms a e associa ed wi h cy okine e-
sponses upon PBMC s imula ion. QTL mapping o SIRT1 gene ic
a ian s om heal hy indi iduals o he 500FG coho and cy okine
p oduc ion o PBMCs in esponse o s imula ion in i o wi h a ious
s imuli (see Me hods). The s onges signi ican ly associa ed gene ic
a ian s o a speci ic cy okine-s imuli combina ion a e shown.
18S FW GATGGGCGGCGGAAAATAG
18s RV GCGTGGATTCTGCATAATGGT
TNFA FW AACGGAGCTGAACAATAGGC
TNFA RV TCTCGCCACTGAATAGTAGGG
IL1B FW ATCACTGAACTGCACGCTCC
IL1B RV TGGAGAACACCACTTGTTGC
IL6 FW AGCCCACCGGGAACGA
IL6 RV GGACCGAAGGCGCTTGT
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
3
0.05).
2.4. The e ec o SIRT1 on induc ion o ained immuni y
In a ollowing se o expe imen s, we assessed he e ec s o pha -
macological inhibi ion o SIRT1 by EX-527 on ained immuni y induced
by β-glucan o BCG, o ole ance induced by LPS. The addi ion o EX-527
did no a ec ei he ained immuni y o ole ance in e ms o IL-6 and
TNF-
α
p oduc ion a e es imula ion wi h LPS (Fig. 4A). To alida e
hese esul s, we in es iga ed he e ec o SIRT1 ac i a o SRT1720
[26]. Cells ained wi h BCG in he p esence o SRT1720 exhibi ed
ele a ed p oduc ion o IL-6 and TNF-
α
. On he o he hand, cells ained
wi h β-glucan in he p esence o SRT1720 did no p oduce mo e TNF-
α
han cells ained wi h β-glucan unde no mal condi ions, bu induced a
small, ye signi ican dec ease in IL-6 p oduc ion (Fig. 4B). In addi ion o
cy okine p oduc ion, he e ec s o EX-527 on me abolic changes
induced by ained immuni y we e in es iga ed by means o lac a e
measu emen p io o and a e es imula ion wi h LPS. Lowe le els o
lac a e we e measu ed in he supe na an s o β-glucan ained cells in he
p esence o 100 µM EX-527, indica ing lowe glycoly ic ac i i y in hese
cells (Fig. 4C).
3. Discussion
In he p esen s udy, we show ha gene ic a ia ion in SIRT1 in-
luences he induc ion o in lamma ion as e lec ed by cy okine p o-
duc ion upon s imula ion o PBMCs, as well as he induc ion o ained
immuni y in an in i o expe imen al model. In con as , SIRT1 poly-
mo phisms did no a ec he in i o induc ion o ained immuni y by
BCG accina ion. Pha macological inhibi ion o SIRT1 in luenced acu e
p o-in lamma o y inna e cy okine p oduc ion, whe eas i did no
modula e he induc ion o ained immuni y by BCG o β-glucan. On he
o he hand, pha macological SIRT1 ac i a ion a ec ed ained immu-
ni y esponses in i o.
SIRT1 has p e iously been desc ibed o modula e in lamma ion, wi h
ei he inhibi o y [3,27,28] o s imula o y e ec s [29], depending on he
expe imen al model. Fo example, SIRT1 o e exp ession in a h i is
pa ien s is associa ed wi h inc eased p o-in lamma o y cy okine p o-
duc ion [30,31], whe eas SIRT1 ac i a ion did no a ec PBMCs de i ed
om heal hy indi iduals in he same s udy [30]. In he cu en s udy, we
IL1B
0
100
200
300
400
500
600
700Con ol
1uM EX-527
10 uM EX-527
100 uM EX-527
RPMI LPS P3C
Fold change
TNFA
0
20
40
60
80
RPMI LPS P3C
Fold change
IL6
0
50
100
150
200
250
300
350
RPMI LPS P3C
Fold change
IL-1
0
2000
4000
6000
8000
RPMI LPS P3C
*****
p=0.05 Con ol
1 M EX-527
10 M EX-527
100 M EX-527
pg/ml
IL-6
0
5000
10000
15000
20000****
**
RPMI LPSP3C
pg/ml
TNF
0
200
400
600*
RPMI LPS P3C
pg/ml
Fig. 1. SIRT1 inhibi ion inc eases inna e cy okine p oduc ion o PBMCs. (A) RT-qPCR esul s o IL1B and TNFA (n =7), IL6 (n =5), and (B) cy okine p oduc ion o
IL-1β, IL-6, TNF-
α
in supe na an (n ≥10), o PBMCs isola ed om heal hy indi iduals we e s imula ed wi h LPS (10 ng/mL) o Pam3Cys (10 µg/mL), o non-
s imula ed (RPMI con ol), o 24 h in combina ion wi h EX-527 (1–100 µM). Mean ±SEM, *P <0.05, **P <0.01, ***P <0.001, Wilcoxon signed- ank es .
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
4
alida ed he ole o SIRT1 in he modula ion o he in lamma o y
esponse by iden i ying SIRT1 SNPs ha impac cy okine esponses upon
s imula ion wi h a ious mic oo ganisms, TLR ligands, and non-
mic obial s imuli. Some o hese SNPs we e mos s ongly associa ed
wi h cy okine p oduc ion induced by up o ou dis inc s imuli
( s12360310 and s7083505), whe eas o he SNPs mos signi ican ly
a ec ed cy okines only a e speci ic s imula ions.
We con i med he an i-in lamma o y ole o SIRT1 in acu e s imu-
la ion o human PBMCs by pha macological inhibi ion. In e es ingly,
SIRT1 seems o be speci ically in ol ed in he modula ion o he cy o-
kines ha a e mainly p oduced by inna e immune cells, bu much less in
he egula ion o cy okines p oduced mainly by he adap i e immune
cells (IFN-γ, IL-17, IL-22). Mo e s udies a e needed o un a el he
mechanisms by which SIRT1 a ec s cy okine esponses o di e en
s imuli, and in speci ic cell ypes. Because EX-527 inhibi s SIRT1 en-
zymes by exploi ing hei NAD
+
-dependen deace yla ion mechanism
[32], his e ec may include modi ied deace yla ion o NF-κB subuni
RelA/p65, which mainly egula es he exp ession o in lamma o y genes
by myeloid cells [5,6].
To iden i y possible mechanisms egula ing ained immuni y e-
sponses, we in e oga ed he ole o SIRT1 in he induc ion o ained
immuni y using gene ic and pha macological app oaches. Fi s , we
showed ha SIRT1 SNP s10740283 in luences BCG-induced ained
immuni y esponses in PBMCs o heal hy indi iduals in i o. This SNP
has p e iously been shown o a ec SIRT1 exp ession in human whole
blood [25]. SIRT1 SNP s2485679, which is also a SIRT1 eQTL in human
whole blood, in luenced β-glucan-induced ained immuni y bo de line
signi ican . To iden i y whe he SIRT1 also plays a ole in induc ion o
ained immuni y in i o, we assessed he e ec o hese polymo phisms
on ained immuni y esponses induced by BCG accina ion in heal hy
indi iduals. Howe e , we did no obse e signi ican associa ions be-
ween SIRT1 SNPs and BCG-induced ained immuni y esponse, sug-
ges ing ha SIRT1 has a limi ed con ibu ion o he p ocess o ained
immuni y in i o. The sample size o he 300BCG coho migh
con ibu e o he ac ha SIRT1 gene ic a ian s do no show a signi -
ican e ec on cy okine esponses upon induc ion o ained immuni y.
To u he assess he e ec o SIRT1 on ained immuni y, we used
pha macological modula o s o SIRT1. We did no obse e an e ec o
SIRT1 inhibi o EX-527 on ained immuni y esponses, and we
obse ed only limi ed al e a ions in ained immuni y esponses by
using he SIRT1 ac i a o SRT1720. Unexpec edly, a small bu signi i-
can dec ease in IL-6 p oduc ion (bu no TNF-
α
) was obse ed upon
β-glucan-induced ained immuni y in combina ion wi h SRT1720. In
con as , BCG-induced ained immuni y in combina ion wi h SRT1720
inc eased IL-6 and TNF-
α
p oduc ion. Because SRT1720 ac i a es SIRT1
by an unknown mechanism [33], i is impossible o specula e on he
cause o he disc epancy compa ed o he esul s using SIRT1 inhibi o
EX-527. Liu e al. iden i ied SIRT1 o play a ole in gene a ing endo oxin
ole ance [9]. He e, we could no ecapi ula e he in luence o SIRT1 on
ole ance in human monocy es. This appa en inconsis ency may be due
o he di e en model and cells used: in con as o he s udy o Liu e al.
which assessed he e ec on SIRT1 sho ly a e LPS s imula ion (up o 4
h) in THP-1 cells, we s udied he e ec o SIRT1 upon non-speci ic
IFN-y
0
100
200
300
400
500
RPMI Candida
Con ol
1 M EX-527
10 M EX-527
100 M EX-527
pg/ml IFNy
IL-17
0
1000
2000
3000
RPMI Candida
pg/ml IL-17
IL-22
0
1000
2000
3000
4000
5000
RPMI Candida
pg/ml IL-22
Fig. 2. SIRT1 inhibi ion does no a ec adap i e cy okine p oduc ion o
PBMCs. Cy okine assessmen in supe na an o PBMCs isola ed om heal hy
indi iduals which we e s imula ed wi h C. albicans (1 ×10
6
cells/mL), o non-
s imula ed (RPMI con ol), o 7 days in combina ion wi h EX-527 (1–100 µM).
Mean ±SEM, n =n ≥3, n.s., Wilcoxon signed- ank es .
-glucan
GG TG TT
-2
-1
0
1n=201
n=64
n=4
p=0.05
p=0.07
TNF-
BCG
AA AC CC
-1.5
-1.0
-0.5
0.0
0.5
1.0 n=42
n=127
n=100
p=0.01
p=0.004
IL-6
Fig. 3. SIRT1 gene ic polymo phisms a e associa ed wi h in i o ained immuni y esponses. Adhe en cells o he PBMC ac ion de i ed om heal hy indi iduals o
he 300BCG coho we e s imula ed in i o wi h BCG (5 µg/mL) and β-glucan (2 µg/mL) o 24 h, subsequen ly washed, es ed o 5 days, and a day 6 es imula ed
o 24 h wi h 10 ng/mL LPS. IL-6 and TNF-
α
cy okine p oduc ion was measu ed in supe na an by ELISA (Mean, Mann Whi ney U es ).
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
5
es imula ion in human mac ophages 6 days a e 24 h EX-527
ea men .
To conclude, gene ic a ia ion in SIRT1 is associa ed wi h cy okine
esponses o PBMCs o s imula ion wi h a ious mic obial and non-
mic obial s imuli, whe e SIRT1 inhibi ion esul s in inc eased inna e
p o-in lamma o y cy okine p oduc ion o PBMCs in i o. Al hough
SIRT1 gene ic a ian s had a mode a e e ec on in i o BCG- and
β-glucan-induced ained immuni y, his e ec was no alida ed in in
i o models o BCG accina ion. Inhibi ion o SIRT1 unc ion did no
in luence he induc ion o ained immuni y in monocy es, whe eas
ac i a ion o SIRT1 only mildly modi ied ained immuni y esponses in
i o. The impac o SIRT1 inhibi ion o ac i a ion on he unc ion o
o he immune cells is emains o be in es iga ed. Taken oge he ,
despi e i s egula o y ole in he acu e induc ion o in lamma ion, SIRT1
does no play an impo an ole in BCG- and β-glucan-induced ained
immuni y.
4. Me hods
4.1. Reagen s
RPMI 1640 (Du ch modi ied; Gibco, Li e Technologies, MA) was used
as cul u e medium supplemen ed wi h 5 µg/ml gen amicin (Cen a a m
B.V., he Ne he lands), 2 mM L-glu amine (Gibco), and 1 mM py u a e
(Gibco). Syn he ic Pam3Cys (Pam3Cys) was pu chased om EMC
Mic ocollec ions (Ge many), Esche ichia coli lipopolysaccha ide (LPS;
se o ype 055:B5, Sigma-Ald ich), β-glucan (β −1,3-(D)-glucan) was
kindly p o ided by P o esso Da id Williams (Eas Tennessee S a e
Uni e si y, TN), and bacillus Calme e Gu´
e in (BCG) accine was pu -
chased om In e Vax (Ma kham, ON, Canada). SIRT1 inhibi o EX-527
was pu chased om Sigma-Ald ich, SIRT1 ac i a o SRT1720 was pu -
chased om Selleckchem. Candida albicans UC820 (ATCC MYA-3573)
was hea -killed a 95 ◦C o 30 min.
4.2. Blood samples
Pe iphe al blood mononuclea cells (PBMCs) we e isola ed om
EX-527
0
1
2
3
4
5
6
7
RPMI -glucanBCG LPS
Fold change IL-6
EX-527
0
1
2
3
4
5
6
7
8
9
RPMI -glucanBCG LPS
Con ol
1 M EX-527
10 M EX-527
Fold change TNF-
SRT1720
0.0
0.5
1.0
1.5
2.0
2.5
RPMI -glucan BCG
**
Fold change IL-6
n.s.
SRT1720
0
1
2
3
4
RPMI
1 M SRT1720
5 M SRT1720
n.s. *
*
RPMI -glucan BCG
Fold change TNF-
EX-527 D6
RPMI -glucan BCG
0
1000
2000
3000
4000
*
*
*
Lac a e ( M)
EX-527 D6+LPS
RPMI -glucan BCG
0
500
1000
1500
2000Con ol
10 M EX-527
100 M EX-527
*
*
Lac a e ( M)
Fig. 4. E ec o SIRT1 modi ica ion on in i o ained immuni y. Monocy es de i ed om heal hy indi iduals we e s imula ed in i o wi h β-glucan (2 µg/mL), BCG
(5 µg/mL), LPS (1 ng/mL), o non-s imula ed (RPMI con ol), o 24 h, in combina ion wi h (A, C) EX-527, and (B) SRT1720, subsequen ly washed, es ed o 5 days,
and a day 6 es imula ed o 24 h wi h LPS. IL-6 and TNF-
α
cy okine p oduc ion and lac a e concen a ions we e measu ed in supe na an . Mean ±SEM, *P <0.05,
Wilcoxon signed ank es .
V.P. Mou i s e al.

Cellula Immunology 366 (2021) 104393
6
bu y coa s o heal hy blood dono s (Sanquin, Nijmegen, The
Ne he lands). Inclusion o olun ee s and expe imen s we e conduc ed
acco ding o he p inciples exp essed in he Decla a ion o Helsinki. All
olun ee s ga e w i en in o med consen be o e any ma e ial was
aken.
4.3. Popula ion coho s
QTL mapping using geno ype da a and cy okine p oduc ion upon
s imula ion and induc ion o ained immuni y was pe o med in a
coho o app oxima ely 500 and 300 heal hy indi iduals o Wes e n
Eu opean ances y, espec i ely om he Human Func ional Genomics
P ojec (500FG and 300BCG, see www.human unc ionalgenomics.o g).
The 500FG coho comp ises 534 adul s om Nijmegen, he Ne he lands
(44% males and 56% emales, age ange 18–75 yea s). PBMCs we e
isola ed and s imula ed in i o wi h a ious s imuli, and cy okines upon
s imula ion we e measu ed, as p e iously desc ibed [34]. The 300BCG
coho consis s o 325 adul s om he Ne he lands (43% males and 57%
emales, age ange 18–71 yea s). PBMCs we e isola ed and seed in 96-
wells pla es (Co ning, USA). A e washing away he non-adhe en
cells wi h PBS he adhe en cells we e subsequen ly s imula ed in i o
wi h BCG o β-glucan, and es imula ed a e 6 days wi h LPS, and
cy okine p oduc ion was subsequen ly measu ed. Fu he mo e, in-
di iduals om he 300BCG coho we e accina ed wi h 0.1 mL o BCG
(BCG accine s ain Bulga ia; In e Vax, Canada), and PBMCs we e iso-
la ed, and s imula ed ex i o wi h 5 ×10
6
CFU/mL hea -killed S. au eus
be o e accina ion, and 2 weeks and 3 mon hs a e accina ion. IL-1β,
IL-6, and TNF
α
p oduc ion was measu ed a e 24 h in supe na an s. The
500FG and 300BCG s udy we e app o ed by he e hical commi ee o he
Radboud Uni e si y and Radboudumc Nijmegen (no. 42561.091.12 and
NL58553.091.16).
4.4. PBMC isola ion and s imula ion
Cells we e isola ed by densi y cen i uga ion on Ficoll-Paque (GE
Heal hca e, UK), washed h ee imes in PBS and esuspended in cul u e
medium. A e isola ion, 5 ×10
5
PBMCs we e added o a ound bo om
96-wells pla e (G eine , Aus ia). Pam3Cys (10
μ
g/mL) o LPS (10 ng/
mL) we e added o 24 h a 37 ◦C and 5% CO
2
, Candida albicans was
added o 7 days (1 ×10
6
cells/mL), wi h o wi hou addi ion o EX-527
(1–100
μ
M).
4.5. Monocy e isola ion and s imula ion
Pe coll monocy es we e isola ed by laye ing hype -osmo ic Pe coll
solu ion (48,5% Pe coll (Sigma-Ald ich), 41,5% s e ile H
2
O, 0.16 M
il e -s e ilized NaCl) on PBMCs. A e 15 min cen i uga ion a 580 ×g,
he in e phase laye was isola ed, cells we e washed wi h PBS, and
esuspended in cul u e medium. To inc ease he pu i y o Pe coll-
isola ed monocy es, he monocy es we e adhe ed o polys y ene la
bo om pla es (Co ning, USA) o Pe i dishes (Falcon, Me ck) o 1 h a
37 ◦C ollowed by washing wi h wa m PBS. Nex , cells we e p e-
incuba ed wi h cul u e medium supplemen ed wi h 10% human
pooled se um as con ol, o oge he wi h EX-527 (1–10
μ
M) o SRT1720
(1–5
μ
M). Nex , cul u e medium supplemen ed wi h 10% human pooled
se um was added as a con ol, o oge he wi h ei he 2
μ
g/mL β-glucan,
5
μ
g/mL BCG In e Vax, o LPS (1 ng/mL). A e 24 h, cells we e washed
wi h wa m PBS and cul u e medium was added. Cul u e medium was
e eshed a e 3 days o incuba ion. On day 6, cells we e es imula ed
wi h RPMI, LPS (10 ng/mL), o Pam3Cys (10
μ
g/mL). A e 24 h, su-
pe na an s we e collec ed and s o ed a −20 ◦C un il u he use.
4.6. Cy okine and lac a e measu emen s
Cy okine concen a ions we e measu ed in supe na an s using com-
me cial sandwich ELISA ki s o human IL-6, TNF-
α
, IL-1β, IL-17, IL-22
(R&D sys ems) and IFN-γ (Sanquin Resea ch) in acco dance wi h he
manu ac u e ’s ins uc ions. Lac a e concen a ion was measu ed in
supe na an s o mac ophages using an enzyma ic assay as desc ibed
p e iously [35]. In b ie , supe na an s con aining se um (day 6) we e
p e- ea ed wi h pe chlo ic acid and NaOH o p e en po en ial p o ein
in e e ence wi h he assay. Lac a e concen a ion was de e mined by
enzyma ic eac ion wi h lac a e oxidase (Sigma-Ald ich), Amplex Red
eagen (Li e Technologies) and ho se adish pe oxidase (Sigma-
Ald ich). A e 20 min incuba ion, luo escence o eso u in (570/585
nm) was measu ed.
4.7. Quan i a i e RT-PCR
A baseline, a e 4 h, 24 h, and 6 days, RNA was isola ed om
ained monocy es by using TRIzol eagen acco ding o manu ac u e ’s
ins uc ions. Fi s -s and cDNA syn hesis was pe o med using Supe -
Sc ip III, ollowed by syn hesis o he second cDNA s and (The mo
Fishe Scien i ic) acco ding o he manu ac u e ’s p o ocol. Quan i a i e
PCR was pe o med using S epOne PLUS machine (Applied Biosciences)
using SYBR G een (In i ogen). The alues a e exp essed as log2 old
inc ease in mRNA le els ela i e o hose in non- ained cells. 18S was
used as a housekeeping gene. The p ime sequences a e lis ed below:
4.8. Viabili y assay
Cy o oxici y was analyzed by de ec ing lac a e dehyd ogenase (LDH)
di ec ly in esh supe na an using he Cy oTox 96® Non-Radioac i e
Cy o oxici y Assay (P omega, he Ne he lands), in acco dance wi h he
manu ac u e ’s ins uc ions.
4.9. Gene ic analysis
Isola ed DNA o he 500FG indi iduals was geno yped using he
comme cially a ailable SNP chip, Illumina HumanOmniExp essExome-
8 1.0. Cy okine QTL mapping was conduc ed using he geno ypes and
cy okine measu emen s upon in i o s imula ion o isola ed PBMCs, as
p e iously desc ibed [23]. The mos signi ican ly associa ed SNP o a
pa icula cy okine-s imuli combina ion is shown in Table 1. DNA
samples om indi iduals o he 300BCG coho we e geno yped using
he comme cially a ailable SNP chip, In inium Global Sc eening A ay
MD 1.0 om Illumina. Op icall 0.7.0 wi h de aul se ings was used o
geno ype calling [36]. Samples wi h a call a e ≤0.99 we e excluded, as
we e a ian s wi h a Ha dy-Weinbe g equilib ium (HWE) ≤0.0001, and
mino allele equency (MAF) ≤0.1. S ands o a ian s we e aligned
and iden i ied agains he 1000 Genome e e ence panel using Geno ype
Ha monize [37]. We hen impu ed he samples on he Michigan
impu a ion se e using he human e e ence conso ium (HRC 1.1
2016) as a e e ence panel [38], and we il e ed ou gene ic a ian s
wi h an R
2
<0.3 o impu a ion quali y. We iden i ied and excluded 17
gene ic ou lie s, and selec ed 4,296,841 SNPs wi h MAF 5% o ollow-
up QTL mapping. Bo h geno ype and cy okine da a on in i o ained
immuni y esponses induced by BCG o β-glucan in monocy es was ob-
ained o a o al o 267 indi iduals. Raw cy okine le els we e log-
ans o med and he old change o cy okine p oduc ion be ween
ained and non- ained cells was aken as a measu emen o he
magni ude o he in i o ained immuni y esponse. The cy okine
changes we e mapped o geno ype da a using a linea eg ession model
wi h age and sex as co a ia es o co ec he dis ibu ions o old change
o cy okine p oduc ion. Simila app oach was ollowed o iden i y QTLs
using he ex i o cy okine p oduc ion om PBMCs a e BCG accina-
ion in heal hy olun ee s. Bo h geno ype and cy okine da a on ex i o
ained immuni y esponses we e ob ained o a o al o 296 indi iduals.
The old change in cy okine p oduc ion (a e accina ion compa ed o
baseline) was used as a measu emen o he magni ude o he ained
immuni y esponse. The old change o cy okine p oduc ion was log-
ans o med, and we e mapped o geno ype da a using a linea
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
7
eg ession model wi h age and sex as co a ia es. R-package Ma ix-eQTL
was used o QTL mapping.
4.10. Flow cy ome y
Isola ed Pe coll monocy es we e exposed o EX-527 o ehicle con-
ol o 24 h. Fo cell su ace ma ke analysis, cells we e washed in PBS
con aining 1% BSA and s ained wi h an i-CD14 APC (M5E2 clone), an i-
HLA-DR PE-Cy5 (L243 clone), and an i-CD11b BV785 (ICRF44 clone; all
Biolegend). Flow cy ome y expe imen s we e pe o med using he
Beckman Coul e Cy oFLEX. CD14 MFI was de e mined a e exclusion
o double s. Du ing analysis o HLA-DR and CD11b MFI, cells we e ga ed
on he CD14 +ga e o elimina e deb is and lymphocy e popula ions.
4.11. S a is ics
Da a was analyzed using a Wilcoxon signed- ank es o pai ed
samples, o a Mann-Whi ney U es o unpai ed samples, using G aph-
Pad P ism so wa e (G aphPad Inc. e sion 8). Da a a e exp essed as
mean ±SEM, and alues o *P <0.05, **P <0.01 and ***P <0.001
we e conside ed s a is ically signi ican .
CRediT au ho ship con ibu ion s a emen
Ve a P. Mou i s: P ojec adminis a ion, Concep ualiza ion, Me h-
odology, Fo mal analysis, W i ing - o iginal d a , Valida ion, Visuali-
za ion. Leonie S. Helde : Concep ualiza ion, In es iga ion, Fo mal
analysis, W i ing - o iginal d a , Visualiza ion. Vasiliki Ma za aki:
Da a cu a ion, Fo mal analysis, In es iga ion. Vale ie A.C.M. Koeken:
Da a cu a ion, Fo mal analysis, In es iga ion. Laszlo G oh: Da a cu a-
ion, In es iga ion. L. Cha lo e J. de B ee: Da a cu a ion, In es iga-
ion. Simone J.C.F.M. Moo lag: Da a cu a ion, In es iga ion.
Cha lo e D.C.C. an de Heijden: In es iga ion. Samuel T. Kea ing:
In es iga ion. Jelme H. an Pu elen: In es iga ion. Ma in Jaege :
Resou ces, Supe ision. Leo A.B. Joos en: Concep ualiza ion, Funding
acquisi ion, Supe ision, W i ing - e iew & edi ing. Mihai G. Ne ea:
Concep ualiza ion, Funding acquisi ion, Supe ision, W i ing - e iew &
edi ing.
Decla a ion o Compe ing In e es
The au ho s decla e ha hey ha e no known compe ing inancial
in e es s o pe sonal ela ionships ha could ha e appea ed o in luence
he wo k epo ed in his pape .
Acknowledgemen s
We hank all he heal hy olun ee s o hei pa icipa ion. This s udy
was pa ly suppo ed by an EFRO g an (COILED). MGN was suppo ed
by an ERC Ad anced g an [833247] and a Spinoza g an o he
Ne he lands O ganiza ion o Scien i ic Resea ch.
Decla a ion o In e es
MGN and LABJ a e scien i ic ounde s o T ained The apeu ics
Disco e y.
Appendix A. Supplemen a y da a
Supplemen a y da a o his a icle can be ound online a h ps://doi.
o g/10.1016/j.cellimm.2021.104393.
Re e ences
[1] T. Zhang, W.L. K aus, SIRT1-dependen egula ion o ch oma in and ansc ip ion:
linking NAD(+) me abolism and signaling o he con ol o cellula unc ions,
Biochim. Biophys. Ac a 1804 (8) (2010) 1666–1675.
[2] S. Michan, D. Sinclai , Si uins in mammals: insigh s in o hei biological unc ion,
Biochem. J. 404 (1) (2007) 1–13.
[3] V.T. Vachha ajani, e al., Si uins link in lamma ion and me abolism, J. Immunol.
Res. 2016 (2016) 8167273.
[4] T.T. Schug, e al., Myeloid dele ion o SIRT1 induces in lamma o y signaling in
esponse o en i onmen al s ess, Mol. Cell. Biol. 30 (19) (2010) 4712–4721.
[5] L. Se ano-Ma co, e al., TNF-alpha inhibi s PPARbe a/del a ac i i y and SIRT1
exp ession h ough NF-kappaB in human adipocy es, Biochim. Biophys. Ac a 1821
(9) (2012) 1177–1185.
[6] F. Yeung, e al., Modula ion o NF-kappaB-dependen ansc ip ion and cell
su i al by he SIRT1 deace ylase, EMBO J. 23 (12) (2004) 2369–2380.
[7] Z. Shen, e al., Role o SIRT1 in egula ion o LPS- o wo e hanol me aboli es-
induced TNF-alpha p oduc ion in cul u ed mac ophage cell lines, Am. J. Physiol.
Gas oin es . Li e Physiol. 296 (5) (2009) G1047–G1053.
[8] M. Lei, e al., Res e a ol inhibi s in e leukin 1be a-media ed inducible ni ic oxide
syn hase exp ession in a icula chond ocy es by ac i a ing SIRT1 and he eby
supp essing nuclea ac o -kappaB ac i i y, Eu . J. Pha macol. 674 (2–3) (2012)
73–79.
[9] T.F. Liu, e al., NAD+-dependen SIRT1 deace ylase pa icipa es in epigene ic
ep og amming du ing endo oxin ole ance, J. Biol. Chem. 286 (11) (2011)
9856–9864.
[10] T.F. Liu, e al., NAD+-dependen si uin 1 and 6 p o eins coo dina e a swi ch om
glucose o a y acid oxida ion du ing he acu e in lamma o y esponse, J. Biol.
Chem. 287 (31) (2012) 25758–25769.
[11] A. Vaque o, e al., Human Si T1 in e ac s wi h his one H1 and p omo es o ma ion
o acul a i e he e och oma in, Mol. Cell 16 (1) (2004) 93–105.
[12] S. Imai, e al., T ansc ip ional silencing and longe i y p o ein Si 2 is an NAD-
dependen his one deace ylase, Na u e 403 (6771) (2000) 795–800.
[13] M.G. Ne ea, e al., De ining ained immuni y and i s ole in heal h and disease,
Na . Re . Immunol. (2020).
[14] M.G. Ne ea, J. Quin in, J.W. an de Mee , T ained immuni y: a memo y o inna e
hos de ense, Cell Hos Mic obe 9 (5) (2011) 355–361.
[15] S.C. Cheng, e al., mTOR- and HIF-1alpha-media ed ae obic glycolysis as me abolic
basis o ained immuni y, Science 345 (6204) (2014) 1250684.
[16] S.T. Kea ing, e al., The Se 7 lysine me hyl ans e ase egula es plas ici y in
oxida i e phospho yla ion necessa y o ained immuni y induced by β-glucan,
Cell Rep. 31 (3) (2020), 107548–107548.
[17] S. Saeed, e al., Epigene ic p og amming o monocy e- o-mac ophage
di e en ia ion and ained inna e immuni y, Science 345 (6204) (2014) 1251086.
[18] B. No ako ic, e al., Be a-glucan e e ses he epigene ic s a e o LPS-induced
immunological ole ance, Cell 167 (5) (2016) 1354–1368.
[19] V.T. Vachha ajani, e al., SIRT1 inhibi ion du ing he hypoin lamma o y
pheno ype o sepsis enhances immuni y and imp o es ou come, J. Leukoc. Biol. 96
(5) (2014) 785–796.
[20] R.J.W. A s, L.A.B. Joos en, M.G. Ne ea, The po en ial ole o ained immuni y in
au oimmune and au oin lamma o y diso de s, F on . Immunol. 9 (2018) 298.
[21] V.P. Mou i s, e al., T ained immuni y as a no el he apeu ic s a egy, Cu . Opin.
Pha macol. 41 (2018) 52–58.
[22] M. Schi me , e al., Linking he human gu mic obiome o in lamma o y cy okine
p oduc ion capaci y, Cell 167 (4) (2016) 1125–1136 e8.
[23] Y. Li, e al., In e -indi idual a iabili y and gene ic in luences on cy okine
esponses o bac e ia and ungi, Na . Med. 22 (8) (2016) 952–960.
[24] V.P. Mou i s, e al., BCG-induced ained immuni y in heal hy indi iduals: he
e ec o plasma mu amyl dipep ide concen a ions, J. Immunol. Res. 2020 (2020)
5812743.
[25] G.T. Conso ium, Human genomics. The Geno ype-Tissue Exp ession (GTEx) pilo
analysis: mul i issue gene egula ion in humans, Science 348 (6235) (2015)
648–660.
[26] J.C. Milne, e al., Small molecule ac i a o s o SIRT1 as he apeu ics o he
ea men o ype 2 diabe es, Na u e 450 (7170) (2007) 712–716.
[27] L. Wang, e al., Si uin 1 inhibi s lipopolysaccha ide-induced in lamma ion in
ch onic myelogenous leukemia k562 cells h ough in e ac ing wi h he Toll-like
ecep o 4-nuclea ac o kappa B- eac i e oxygen species signaling axis, Cance
Cell In . 20 (2020) 73.
[28] T. Yoshizaki, e al., SIRT1 inhibi s in lamma o y pa hways in mac ophages and
modula es insulin sensi i i y, Am. J. Physiol. Endoc inol. Me ab. 298 (3) (2010)
E419–E428.
[29] C.A. Fe nandes, e al., Si uin inhibi ion a enua es he p oduc ion o in lamma o y
cy okines in lipopolysaccha ide-s imula ed mac ophages, Biochem. Biophys. Res.
Commun. 420 (4) (2012) 857–861.
[30] D. Wendling, e al., Res e a ol, a si uin 1 ac i a o , inc eases IL-6 p oduc ion by
pe iphe al blood mononuclea cells o pa ien s wi h knee os eoa h i is, Clin.
Epigene . 5 (1) (2013) 10.
[31] F. Niede e , e al., SIRT1 o e exp ession in he heuma oid a h i is syno ium
con ibu es o p oin lamma o y cy okine p oduc ion and apop osis esis ance, Ann.
Rheum. Dis. 70 (10) (2011) 1866–1873.
[32] M. Ge z, e al., Ex-527 inhibi s Si uins by exploi ing hei unique NAD+-
dependen deace yla ion mechanism, P oc. Na l. Acad. Sci. 110 (30) (2013)
E2772–E2781.
[33] R.H. Hou koope , E. Pi inen, J. Auwe x, Si uins as egula o s o me abolism and
heal hspan, Na . Re . Mol. Cell Biol. 13 (4) (2012) 225–238.
V.P. Mou i s e al.
Cellula Immunology 366 (2021) 104393
8
[34] Y. Li, e al., A unc ional genomics app oach o unde s and a ia ion in cy okine
p oduc ion in humans, Cell 167 (4) (2016) 1099–1110 e14.
[35] E. Lachmandas, e al., Mic obial s imula ion o di e en Toll-like ecep o
signalling pa hways induces di e se me abolic p og ammes in human monocy es,
Na . Mic obiol. 2 (2016) 16246.
[36] T.S. Shah, e al., op iCall: a obus geno ype-calling algo i hm o a e, low-
equency and common a ian s, Bioin o ma ics 28 (12) (2012) 1598–1603.
[37] P. Deelen, e al., Geno ype ha monize : au oma ic s and alignmen and o ma
con e sion o geno ype da a in eg a ion, BMC Res. No es 7 (2014) 901.
[38] S. McCa hy, e al., A e e ence panel o 64,976 haplo ypes o geno ype
impu a ion, Na . Gene . 48 (10) (2016) 1279–1283.
V.P. Mou i s e al.