Depósi o de in es igación de la Uni e sidad de Se illa
h ps://idus.us.es/
“This is an Accep ed Manusc ip o an a icle published by Else ie in: DNA
REPAIR on 2018, a ailable a : h ps://doi.o g/10.1016/j.dna ep.2018.04.003”
1
Mul iple oles o he splicing complex SF3B in DNA end
esec ion and homologous ecombina ion
Rosa io P ados-Ca ajal1,2, Ana López-Saa ed a1,2, C is ina Cepeda-Ga cía2, Sonia
Jimeno1,2 and Pablo Hue as1,2
1 Depa amen o de Gené ica, Uni e sidad de Se illa, Se illa, 41080, Spain
2 Cen o Andaluz de Biología Molecula y Medicina Regene a i a-CABIMER,
Uni e sidad de Se illa-CSIC-Uni e sidad Pablo de Ola ide, Se illa, 41092, Spain
Co espondence o P. Hue as ([email p o ec ed])
Tel: (+34) 954 467 667
Fax: (+34) 954 461 664
2
ABSTRACT
The app op ia e epai o DNA double s and b eaks is c i ical o genome main enance.
Thus, se e al cellula pa hways collabo a e o o ches a e a coo dina ed esponse. These
include he epai o he b eaks, which could be achie ed by di e en mechanisms. A
key p o ein in ol ed in he egula ion o he epai o b oken ch omosomes is C IP.
He e, we ha e ound new pa ne s o C IP in ol ed in he egula ion o DNA b eak
epai h ough a ec ing DNA end esec ion. We ocus on he splicing complex SF3B
and show ha i s deple ion impai s DNA end esec ion and hampe s homologous
ecombina ion. Func ionally, SF3B con ols C IP unc ion a , as leas , wo le els: by
a ec ing C IP mRNA le els and con olling C IP ec ui men o DNA b eaks, in a way
ha equi es ATM-media ed phospho yla ion o SF3B2 a se ine 289. Indeed,
o e exp ession o C IP escues he esec ion de ec caused by SF3B down egula ion.
S ikingly, o he SF3B deple ion pheno ypes, such as impai ed homologous
ecombina ion o cellula sensi i i y o DNA damaging agen s, a e independen o C IP
le els, sugges ing a mo e gene al ole o SF3B in con olling he esponse o
ch omosome b eaks.
3
INTRODUCTION
Li ing o ganisms a e exposed o mul iple physical and chemical h ea s ha migh
comp omise hei su i al. Especially ele an a e hose challenges ha jeopa dize he
in eg i y o he genome as hey will no only a ec he cu en gene a ion bu migh
endange he u u e p ogeny. Du ing e olu ion, a e y in ica e esponse has e ol ed o
sa egua d genomic in o ma ion [1, 2]. This in ol es he s imula ion o DNA epai
mechanisms, bu also he coo dina ion o all cellula e en s h ough he ac i a ion o he
DNA damage checkpoin s [1]. Pa icula ly challenging is he epai o DNA Double
S and B eaks (DSBs), due o he simul aneous ha m o bo h s ands [1]. Di e en o he
healing o any o he ype o lesion, DSBs canno be mended by using a complemen a y
s and. So, he epai o b oken ch omosomes is indeed a complica ed a ai . Two close
DNA agmen s migh be simply e-joined wi h li le o no p ocessing, a mechanism
named Non-Homologous End-Joining (NHEJ; [3]). Such p ocedu e is as , highly
e icien and ene ge ically cheap, hus is he me hod o choice o he majo i y o he
epai e en s in highe euka yo es. Howe e , he lack o a p oo eading ac i i y migh
esul in he e oneous joining o DNA segmen s ha o iginally we e no adjacen ,
con ibu ing o he appea ance o g oss ch omosomal ea angemen s [4]. As a
consequence, mo e complex DSB epai mechanisms coexis wi hin he cells. DNA
b eaks can be p ocessed, a s ep known as DNA end esec ion, which consis s on he
deg ada ion o one s and o he DNA in a 5’-3’ pola i y ha lea es a ail o p o uding
ssDNA [5]. ssDNA is immedia ely coa ed by he p o ec ing complex RPA [5]. This
esec ed DNA can be engaged in he pai ing wi h a homologous sequence elsewhe e in
he genome, p omp ing he epai mechanisms collec i ely known as Homologous
Recombina ion (HR; [6]). HR migh ensue in di e en ashions [6], bu all o hem
sha e he same ini ial s ep, he a o emen ioned DNA end esec ion. Thus, esec ed DNA
is an obliga o y subs a e in all HR pa hways and, a he same ime, e ec i ely blocks
NHEJ [6, 7]. Al hough adi ionally HR has been conside ed an e o - ee epai
pa hway, now i is clea ha unscheduled HR migh also inc ease he appea ance o
g oss ch omosomal ea angemen s [4]. Thus, he e is a igh egula ion o he choice
be ween DSB epai pa hways in esponse o cell s a us o minimize genomic ins abili y
upon he occu ence o b eaks on he DNA. A c i ical ac o o such egula ion is C IP.
This ac o ac s as a molecula swi ch ha ac i a es DNA end esec ion, hence
homologous ecombina ion, when he cellula en i onmen is suppo i e o his ype o
epai [8]. C IP, oge he wi h he MRN complex, ini ia es esec ion and con o ms he
4
minimal esec ion machine y [9, 10]. Al hough C IP i sel displays a nuclease ac i i y
[11, 12], i is s ill deba ed how much i con ibu es o he ac ual p ocess. In addi ion o
i s ole in DNA epai , C IP has been in ol ed in se e al p ocesses, including i s own
ansc ip ion [13]. To assess he gene al sui abili y o HR, C IP collec s cellula
in o ma ion h ough pos - ansla ional modi ica ions and p o ein-p o ein in e ac ions
[8]. Indeed, di e en pa ne s o C IP a e known o play p o- o an i- esec ion oles [8,
14-16].
Recen ly, a c oss alk be ween he DNA Damage Response (DDR) and he RNA
me abolism a di e en le els has become appa en . RNA is in ol ed in acili a ing he
ec ui men o checkpoin p o eins like 53BP1 o damaged ch oma in [17]. Mo eo e ,
highly ansc ibed genes a e epai ed di e en ly o o he ch oma in egions, and he
nascen RNA migh play a ole on his speci ici y [18]. Indeed, i has been ecen ly
shown ha RNA splicing changes globally upon challenging DNA wi h a DNA damage
sou ce, and such al e na i e splicing equi es he ac i a ion o he DDR o ake place
[19]. This DNA damage-dependen al e na i e splicing is con olled by BRCA1 [19], a
known pa ne o C IP in ol ed in DNA esec ion modula ion [13, 14]. This modula ion
implies ha BRCA1 in e ac s speci ically upon appea ance o DNA damage wi h
se e al p o eins such as SF3B1 [19], one ou o he se en subuni s o he co e SF3B
splicing complex [20]. This complex is c i ical o co ec RNA splicing, as con ac s
wi h he nascen mRNA a o nea he b anch si e [21]. Addi ionally, se e al subuni s o
he complex ha e been al eady ound in genome wide sc eens o ac o s in ol ed in
DNA epai , a ec ing homologous ecombina ion [22], con olling genome s abili y
[23] o as subs a es o he checkpoin kinases [24, 25].
He e we ha e isola ed addi ional pa ne s o C IP. Among hem, we ha e ound h ee
subuni s o he SF3B splicing complex. We ha e analysed he ole o his complex in
he epai o DSBs. Func ionally, SF3B is equi ed o p ope DNA end esec ion and
homologous ecombina ion. Indeed, SF3B egula es C IP mRNA le els bu also he
ec ui men o C IP o DSBs. S ikingly, SF3B ole on he epai o DSBs exceeds i s
egula ion o C IP, as cells deple ed o SF3B bu o e exp essing C IP a e p o icien o
DNA end esec ion bu hype sensi i e o DNA damage and de ec i e o homologous
ecombina ion.
RESULTS AND DISCUSSION
Isola ion o no el C IP biochemical in e ac o s
5
As men ioned, C IP is egula ed, among o he signals, by p o ein-p o ein in e ac ions
[8]. In o de o isola e new pa ne s o C IP, we pe o med andem a ini y pu i ica ion
om U2OS cells exp essing a GFP and iple FLAG- agged e sion o his p o ein.
Fi s , we used an an i-FLAG esin o immunop ecipi a e GFP-3XFLAG-C IP
complexes ha we e subsequen ly elu ed wi h an excess o 3XFLAG pep ide. Then, an
an i-GFP esin was used o u he pu i y he p o ein samples (Figu e 1A). The inal
p ecipi a ed we e esol ed in an SDS-PAGE (Figu e 1A). C IP sel -in e ac s [26], hus
endogenous C IP was used o ollow he quali y o he immunop ecipi a ion p o ocol.
P o eins immunop ecipi a ed exclusi ely om cells exp essing he usion p o ein and
absen on con ol cells we e de ec ed using Mass Spec ome y. We isola ed nine
p o eins p e iously unknown o be C IP in e ac ion pa ne s, including h ee subuni s o
he SF3B complex, and wo p e iously epo ed in e ac o s, a membe o he hnRNPU
amily and CCAR2 [15, 27] (Table 1). C IP has di e en unc ions wi hin he cell [8,
16]. To s udy he ele ance o hose new C IP in e ac ing p o eins in DNA end
esec ion, we analysed he o ma ion o ssDNA upon ea men wi h ionizing adia ion
(IR) on cells deple ed o all he no el in e ac ing p o eins. Ini ially, we chose SF3B3 as
a ep esen a i e example o he SF3B complex. The oles o p o eins o he hnRNPU
amily and CCAR2 on DNA end esec ion ha e been published elsewhe e [15, 27]. By
using RPA oci as a p oxy o DNA esec ion, we ound wo dis inc ca ego ies o C IP
in e ac ing p o eins in ela ionship wi h DNA damaged-induced end p ocessing (Figu e
1B): hose ha do no a ec i (RBM10, SFPQ) and hose ha , like C IP i sel , a e
equi ed o esec ion (SF3B3, PRMT5, DHX9, DHX15, KIF11). Deple ion e iciencies
a e shown in supplemen a y igu e S1A.
In e es ingly, PRMT5 has been e y ecen ly disco e ed o mobilize he an i- esec ion
ac o 53BP1 om damaged ch oma in and s imula e homologous ecombina ion [28],
in ag eemen wi h a ole p omo ing esec ion. I is no ewo hy ha om all 11 p o eins
we ha e de ec ed, 8 co espond o RNA- ela ed ac o s. In p inciple, a possibili y was
ha we pu i ied C IP-complexes mo e in ol ed in epai -independen C IP oles, such
as ansc ip ional egula ion [13, 29]. Howe e , deple ion o he majo i y o hem
hampe ed DNA esec ion, poin ing ou o a ole on modula ing DNA epai di ec ly o
indi ec ly. Mo eo e , e en SFPQ, which did no educe DNA esec ion when
down egula ed, is a known in e ac o o Rad51, Rad51 pa alogues and he Ku complex,
and has been shown o a ec di ec ly hei oles in DSB epai [30-33]. Such a high
incidence o RNA- ela ed p o eins in e ac ing wi h a known DNA epai ac o is no
6
su p ising. In ac , mRNA p ocessing ac o s a e commonly en iched in many genome-
wide sc eenings aimed o ind new ac o s in ol ed in he DDR and he main enance o
genomic in eg i y [15, 22, 23, 34] and many RNA- ela ed p o eins ha e been de ec ed
as a ge s o he DNA damage-induced pos - ansla ional modi ica ions [24, 25, 35, 36].
Thus, in ecen yea s, accumula ed g owing e idence e ealed he impo ance o RNA-
ela ed ac o s o he DDR and DNA epai [37, 38].
F om ha poin onwa ds, we decided o ocus on he ole o he SF3B complex in DNA
end esec ion and he esponse o DNA damage. No only we ound h ee dis inc
subuni s o he same complex in e ac ing wi h C IP, bu also all h ee ha e been
p e iously ound in global sc eenings o a ec homologous ecombina ion and epai
[22] and as di ec a ge s o he DNA Damage Response (DDR) [24, 25, 39, 40]. In
o de o alida e he ela ionship o C IP wi h his complex, we i s
immunop ecipi a ed p o eins wi h a GFP- ap using samples om cells bea ing a GFP-
C IP o GFP as a con ol and immunoblo ing o SF3B1 and SF3B2. Albei some
unspeci ic binding o hese p o eins, we con i med an en ichmen in bo h subuni s o
he SF3B complex in GFP-C IP cells (Figu e 1C). Then, we pe o med he ecip ocal
expe imen by using an i-SF3B1 and an i-SF3B2 an ibodies om immunop ecipi a ions
wi h samples om cells ha bou ing GFP-C IP o GFP cons uc s (Figu e 1D and 1E,
espec i ely). As seen in hose igu es, bo h SF3B1 and SF3B2 eadily
immunop ecipi a ed GFP-C IP and, o a lesse ex en , endogenous C IP. Bo h SF3B
complex and C IP a e ela ed wi h RNA me abolism, splicing and ansc ip ion,
espec i ely. Thus, we wonde ed i he in e ac ion be ween SF3B and C IP migh be
media ed o s abilized by RNA. None heless, ea men wi h RNase nei he abolished
no se e ely educed SF3B1-C IP co-immunop ecipi a ion (Figu e 1F). To de e mine
he subcellula localiza ion o his in e ac ion, we pe o med a p oximi y liga ion assay
(PLA). We obse ed ha C IP in e ac s wi h SF3B2 inside he nucleus (Figu e 1G).
Deple ion o ei he C IP o SF3B componen s abolished he PLA signal, suppo ing he
speci ici y o he assay (Figu e 1G). In ag eemen wi h ou da a, SF3B1 has been shown
o in e ac also wi h BRCA1 [19], a C IP well es ablished pa ne [8, 14, 16]. A s a k
di e ence be ween his s udy and ou s is he DNA damage dependency. Whe eas
SF3B1 and BRCA1 only in e ac upon he exposu e o he cul u es o DNA damage
[19], C IP and SF3B seem o in e ac e en in he absence o DNA damage in ou hands.
Howe e , an inc ease in C IP and SF3B in e ac ion could be obse ed upon DNA
damage (Figu e 1G). Mo eo e , such inc ease was abolished when he checkpoin was
7
inac i a ed by inhibi ion o ATM (Supplemen a y Figu e S1B). Su p isingly, he
majo i y o such in e ac ion did no occu a he si es o DSB, labelled wi h GFP-
MDC1, a p o ein ec ui ed ea ly o DSBs [41](Figu e 1H). These indings suppo ed a
cons i u i e in e ac ion o C IP and SF3B, which is s imula ed by he p esence o
damaged ch oma in bu mos ly akes place, and mos likely ha e a unc ional meaning,
ou side he ac ual damaged DNA.
The SF3B complex is in ol ed in DNA end esec ion and ecombina ion
C IP is a mul i unc ional p o ein wi h oles in ansc ip ion, eplica ion, DNA epai , e c
[8, 16]. In o de o in es iga e i he SF3B complex migh be a ec ing DNA
ecombina ion, and speci ically, DNA end esec ion, we deple ed SF3B1 and SF3B2
subuni s o he complex using siRNA a ge ed agains hem (see Supplemen a y Figu e
S1C and S1D o deple ion e iciency). To be su e ha he obse ed pheno ypes we e
no caused by o - a ge e ec s, we also complemen ed SF3B2 deple ion wi h a siRNA-
esis an FLAG-SF3B2 cons uc (Supplemen a y Figu e S1D). Following he o ma ion
o RPA-coa ed ssDNA as a eadou , we obse ed ha upon challenging he cells wi h
ionizing adia ion (IR), and no ma e he subuni a ge ed, a educ ion o he le els o
SF3B complex leaded o an impai men o DNA end esec ion (Figu e 2A and 2B). As
expec ed, ec opic exp ession o siRNA- esis an wild ype FLAG- agged SF3B2 was
able o ully complemen his esec ion impai men (Figu e 2B). As men ioned, he
subuni s o he SF3B complex su e DNA damage-dependen pos - ansla ional
modi ica ions, including an ATM-dependen phospho yla ion o SF3B2 a se ine 289
[25]. Thus, we wonde ed i such modi ica ion migh a ec DNA end esec ion. Indeed,
exp ession o siRNA esis an FLAG-SF3B2-S289A mu an did no comple ely escue
he esec ion de ec obse ed upon deple ion o endogenous SF3B2 (Figu e 2B),
a guing he impo ance o such se ine in he p ocess. The e o e, i sugges s a double
con ibu ion o SF3B2 o he p ocess, one media ed by his phospho yla ion an ano he
independen o i .
No su p isingly, based on his de ec on DNA end esec ion, DSB epai pa hways we e
a ec ed upon deple ion o SF3B subuni s. In ag eemen wi h a esec ion impai men
when siRNAs agains SF3B1 o SF3B2 we e used, ecombina ion was s ongly educed
(Figu es 2C and 2D). NHEJ was no signi ican ly changed upon SF3B1 down egula ion
(Figu e 2E) bu mildly inc eased upon SF3B2 deple ion (Figu e 2F), sugges ing he
main e ec o he complex was h ough HR. Ec opic exp ession o siRNA esis an wild
8
ype FLAG-SF3B2 escued he e ec o SF3B2 deple ion (Figu es 2D and 2F). On he
con a y, he S289A mu an o SF3B2 was s ill comp omised o homologous
ecombina ion (Figu e 2D). These e ec s on DNA esec ion and HR we e no caused by
an accumula ion o cells in G1 phase (Supplemen a y Figu es S2A and S2B).
Thus, we conclude ha he SF3B complex plays a ole on DNA esec ion and in he
epai o DSBs, mainly in HR.
SF3B con ols he abundance o C IP
RNA binding p o eins ha e been shown o a ec he esponse o DNA damage a
se e al le els: hey can ha e RNA-independen unc ion and di ec oles in DNA epai
[30-33, 38], o hey can a ec he RNA me abolism, including mRNA s abili y, splicing
o ansla ion [22, 37, 38]. In ac , i has been es ablished ha mRNA splicing con ols
he abundance o speci ic epai p o eins [19, 37, 42]. As he in e ac ion be ween SF3B
and C IP seems o occu mainly ou side he ac ual si es o damaged DNA (Figu e 1H),
we wonde ed i he pheno ypes obse ed upon SF3B deple ion migh be pa ially o
o ally ela ed o changes on he abundance o speci ic epai ac o s. Conside ing he
e ec on DNA end esec ion, he in e ac ion wi h C IP and he ac ha C IP con ols i s
own exp ession [29] we analysed he abundance o C IP mRNA in he absence o
SF3B2. Indeed, deple ion o SF3B2, educed he amoun o C IP mRNA, and such
e ec was escued by he exp ession o a siRNA esis an e sion o he gene (Figu e
3A). S ikingly, cells exp essing he S289A mu an we e p o icien in C IP exp ession
(Figu e 3A), despi e being de ec i e in DNA end esec ion and HR (Figu e 2B and 2D).
Mo eo e , o e exp ession o SF3B2 ele a es he abundance o C IP ansc ip ,
measu ed by quan i a i e PCR (Figu e 3A). This lowe abundance o C IP mRNA
caused a educ ion in he abundance o he p o ein, ha was complemen ed by ec opic
exp ession o FLAG-SF3B2 (Figu e 3B and 3C). In p inciple, such dec ease could be a
di ec consequence o low mRNA o due o he p oduc ion o an al e na i e-spliced
a ian o he p o ein wi h inc eased u no e . In his case, lowe C IP p o ein le els
we e no due o a dec ease in he p o ein s abili y, analysed by a cycloheximide chase
(Figu e 3C), sugges ing ha SF3B complex con ols C IP abundance a he le el o
mRNA. Mo eo e , he S289A mu an , in conco dance wi h he mRNA esul s, showed
no mal accumula ion o C IP p o ein. Thus, his mu an in an ATM- a ge si e beha es
as a sepa a ion o unc ion mu an , de ec i e in DNA end esec ion and HR bu wi hou
a ec ing C IP exp ession. In ag eemen , ou da a sugges ha he educ ion o C IP
15
analysed wi h a BD FACSA ia wi h he BD FACSDi a So wa e 5.0.3. Fou di e en
pa ame e s we e conside ed: side sca e (SSC), o wa d sca e (FSC), blue
luo escence (407 nm iole lase BP, Fil e 450/40) and g een luo escence (488 nm
blue lase BP Fil e 530/30). Finally, he numbe o g een cells om a leas 10,000
e en s posi i es o blue luo escence (in ec ed wi h he I-SceI–BFP cons uc ) was
sco ed. The a e age o bo h duplica es was calcula ed o each sample o e e y
expe imen . To acili a e he compa ison be ween expe imen s, his a io was
no malized wi h shRNA o siRNA con ol. A leas ou comple ely independen
expe imen s we e ca ied ou o each condi ion and he a e age and s anda d de ia ion
o all ou ep esen ed.
MTT cell iabili y assay
Cell iabili y was e alua ed using a comme cially a ailable MTT cell g ow h assay ki
(Millipo e), acco ding o he manu ac u e 's ins uc ions. B ie ly, U2OS cells exp essing
GFP o GFP-C IP plasmid we e ans ec ed wi h he indica ed siRNAs. 24h a e , 7,000
cells we e seeded in o a 96-well pla e, ea ed wi h 0.5 µM e oposide o DMSO. 42h
la e , he samples we e incuba ed o 4h a a 37º C a e addi ion o MTT solu ion.
A e emo ing he medium and MTT solu ion, o mazan was solubilized in 100 μl HCl
in isop opanol 0.4 N. Cell iabili y was calcula ed measu ing abso bance a 570 nm and
630 nm as desc ibed in he manu ac u e p o ocol and no malized wi h con ol.
Expe imen s we e epea ed independen ly h ee imes.
RT-qPCR
RNA was ex ac ed using he RNeasy Mini Ki (Quiagen) ollowing he manu ac u e ’s
ins uc ions om cells 48 h a e ans ec ion wi h siRNA o in ec ion wi h he indica ed
shRNA (Supplemen a y Tables S1 and S2). Then, RNA was quan i ied and i s quali y
was checked by esol ing 10% o he sample in a 1% aga ose gel. Re o ansc ip ion
was ca ied ou using Quan iTec Re e se T ansc ip ion Ki (Quiagen) acco ding o he
manu ac u e ’s p o ocol. RT-qPCR eac ions we e pe o med mixing 10 µl o SYBR
G een (BIO-RAD) wi h 100 ng cDNA and 10 µl o p ime mix (Supplemen a y Table
S3). RT-qPCR expe imen s we e ca ied ou using iplica e echnical eplicas in an ABI
7500FAST. The e iciency o each p ime pai eac ion was p e iously calcula ed using
genomic DNA. The C o each sample was no malized o β-Ac in and ela i ized o
con ol. Expe imen s we e epea ed ou imes.
Cell cycle analysis by low cy ome y
16
Cells we e ha es ed, washed wi h PBS and esuspended in ice-cold PBS. E OH (70%)
was added d opwise while o exing a low speed, and cells we e hen ixed a 4ºC
o e nigh . Cells we e washed wi h PBS and ea ed wi h 250 µg/ml RNase A (Sigma)
and 10 µg/ml p opidium iodide dilu ed in PBS (Fluka). Cells we e incuba ed a 37ºC o
20 min and analyzed using a FACSCALIBUR (BD Biosciences).
Immuno luo escence mic oscopy
U2OS cells we e in ec ed wi h len i i us ha bou ing he indica ed shRNA o ans ec ed
wi h he men ioned siRNAs. A e 48 h, cells we e i adia ed (10 Gy) o mock ea ed,
incuba ed 1 h o oci o ma ion and collec ed. Fo RPA oci s udies, co e slips we e
ea ed o 5 min on ice wi h p e-ex ac ion bu e (25 mM T is.HCl, pH 7.5, 50 mM
NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM suc ose and 0.2% T i on X-100). Then,
cells we e ixed wi h 4% pa a o maldehyde (w/ ) in PBS o 15 min. A e ixa ion,
cells we e washed h ee imes wi h PBS and blocked o a leas 1 h wi h 5% FBS
dilu ed in PBS. Cells we e incuba ed wi h he adequa e p ima y an ibodies
(Supplemen a y Table S4) dilu ed in 5% FBS in PBS o 2 h a oom empe a u e,
washed h ice wi h PBS, and hen incuba ed wi h seconda y an ibodies (Supplemen a y
Table S5) dilu ed in 5% FBS in PBS o 1 h a oom empe a u e. Cells we e hen
washed wice wi h PBS, and co e slips we e moun ed wi h Vec ashield moun ing
medium (Vec o Labo a o ies) con aining 4,6-diamidino-2-phenylindole (DAPI) and
analysed using a LEICA mic oscope. A leas 200 cells we e sco ed pe sample.
Expe imen s we e epea ed independen ly a leas ou imes.
Immuno-FISH
Fo immuno-FISH, U2OS19p igh 13 cells we e ixed in 4% pa a o maldehyde o 15
min, pe meabilized in 0.5% i on o 15 min, blocked in 3% BSA in PBS 0.1% ween
and incuba ed wi h p ima y and seconda y an ibodies (Supplemen a y Tables S4 and
S5) o 1 h each. Cells we e hen pos - ixed in 4% o maldehyde o 20 min, and he
FISH p o ocol was ca ied ou as p e iously desc ibed [46]. Immuno-FISH samples
we e analysed using a con ocal mic oscopy. A leas 100 cells we e sco ed pe sample.
Expe imen s we e epea ed independen ly h ee imes.
Immunoblo ing
Ex ac s we e p epa ed in Laemmli bu e (4% SDS, 20% glyce ol and 125 mM T is-
HCl, pH 6.8), and p o eins we e esol ed by SDS-PAGE and ans e ed o PVDF
memb anes (Millipo e), ollowed by immunoblo ing. Wes e n blo analysis was ca ied
17
ou using he an ibodies lis ed in supplemen a y ables S4 and S5. Resul s we e
isualized using an Odyssey In a ed Imaging Sys em (Li-Co ).
Cycloheximide chase
Cells we e exposed o esh medium con aining 150 μg/ml o cycloheximide (Sigma-
Ald ich) 48 h pos ans ec ion o in ec ion o inhibi u he p o ein syn hesis. Cells
we e collec ed immedia ely (0h), 4 h o 8 h a e he cycloheximide addi ion and p o ein
samples we e p epa ed as desc ibed in he immunoblo ing sec ion.
S a is ical analysis
S a is ical signi icance was de e mined wi h a pai ed -s uden o ANOVA es s, as
indica ed in he igu e legends, using he PRISM so wa e (G aphpad So wa e Inc).
S a is ically signi ican di e ences we e labelled wi h one, wo o h ee as e isks i p
<0.05, p <0.01 o p <0.001, espec i ely.
ACKNOWLEDGEMENTS
This wo k was unded by a R+D+I g an om he Spanish Minis y o Economy and
Compe i i i y (SAF2013-43255-P) and an ERC S a ing G an (DSBRECA). AL-S is
he ecipien o a FPI ellowship om he Spanish Minis y o Economy and
Compe i i i y, and RP-C is unded wi h an FPU ellowship om he Spanish Minis y
o Educa ion. CABIMER is suppo ed by he egional go e nmen o Andalucia (Jun a
de Andalucía).
REFERENCES
[1] A. Ciccia, S.J. Elledge, The DNA damage esponse: making i sa e o play wi h
kni es, Molecula cell, 40 (2010) 179-204.
[2] S.P. Jackson, J. Ba ek, The DNA-damage esponse in human biology and disease,
Na u e, 461 (2009) 1071-1078.
[3] A.J. Da is, D.J. Chen, DNA double s and b eak epai ia non-homologous end-
joining, T ansl Cance Res, 2 (2013) 130-143.
[4] A. So, T. Le Guen, B.S. Lopez, J. Gui ouilh-Ba ba , Genomic ea angemen s
induced by unscheduled DNA double s and b eaks in soma ic mammalian cells, FEBS
J, 284 (2017) 2324-2344.
[5] P. Hue as, DNA esec ion in euka yo es: deciding how o ix he b eak, Na S uc
Mol Biol, 17 (2010) 11-16.
18
[6] M. Jasin, R. Ro hs ein, Repai o s and b eaks by homologous ecombina ion, Cold
Sp ing Ha b Pe spec Biol, 5 (2013) a012740.
[7] L.S. Syming on, End esec ion a double-s and b eaks: mechanism and egula ion,
Cold Sp ing Ha b Pe spec Biol, 6 (2014).
[8] N. Makha ash ili, T.T. Paull, C IP: A DNA damage esponse p o ein a he
in e sec ion o DNA me abolism, DNA Repai (Ams ), 32 (2015) 75-81.
[9] R. Anand, L. Ranjha, E. Canna o, P. Cejka, Phospho yla ed C IP Func ions as a Co-
ac o o he MRE11-RAD50-NBS1 Endonuclease in DNA End Resec ion, Molecula
cell, 64 (2016) 940-950.
[10] A.A. Sa o i, C. Lukas, J. Coa es, M. Mis ik, S. Fu, J. Ba ek, R. Bae , J. Lukas,
S.P. Jackson, Human C IP p omo es DNA end esec ion, Na u e, 450 (2007) 509-514.
[11] N. Makha ash ili, A.T. Tubbs, S.H. Yang, H. Wang, O. Ba on, Y. Zhou, R.A.
Deshpande, J.H. Lee, M. Lob ich, B.P. Sleckman, X. Wu, T.T. Paull, Ca aly ic and
nonca aly ic oles o he C IP endonuclease in double-s and b eak end esec ion,
Molecula cell, 54 (2014) 1022-1033.
[12] H. Wang, Y. Li, L.N. T uong, L.Z. Shi, P.Y. Hwang, J. He, J. Do, M.J. Cho, H. Li,
A. Neg e e, J. Shiloach, M.W. Be ns, B. Shen, L. Chen, X. Wu, C IP main ains s abili y
a common agile si es and in e ed epea s by end esec ion-independen endonuclease
ac i i y, Molecula cell, 54 (2014) 1012-1021.
[13] X. Yu, L.C. Wu, A.M. Bowcock, A. A onheim, R. Bae , The C- e minal (BRCT)
domains o BRCA1 in e ac in i o wi h C IP, a p o ein implica ed in he C BP
pa hway o ansc ip ional ep ession, J Biol Chem, 273 (1998) 25388-25392.
[14] A. C uz-Ga cia, A. Lopez-Saa ed a, P. Hue as, BRCA1 Accele a es C IP-
Media ed DNA-End Resec ion, Cell epo s, (2014).
[15] A. Lopez-Saa ed a, D. Gomez-Cabello, M.S. Dominguez-Sanchez, F. Mejias-
Na a o, M.J. Fe nandez-A ila, C. Dinan , M.I. Ma inez-Macias, J. Ba ek, P. Hue as,
A genome-wide sc eening unco e s he ole o CCAR2 as an an agonis o DNA end
esec ion, Na Commun, 7 (2016) 12364.
[16] Z. You, J.M. Bailis, DNA damage and decisions: C IP coo dina es DNA epai and
cell cycle checkpoin s, T ends Cell Biol, 20 (2010) 402-409.
[17] F. P yde, S. Khalili, K. Robe son, J. Sel idge, A.M. Ri chie, D.W. Mel on, D.
Jullien, Y. Adachi, 53BP1 exchanges slowly a he si es o DNA damage and appea s o
equi e RNA o i s associa ion wi h ch oma in, J Cell Sci, 118 (2005) 2043-2055.
19
[18] F. Ayma d, B. Bugle , C.K. Schmid , E. Guillou, P. Ca on, S. B iois, J.S. Iaco oni,
V. Dabu on, K.M. Mille , S.P. Jackson, G. Legube, T ansc ip ionally ac i e ch oma in
ec ui s homologous ecombina ion a DNA double-s and b eaks, Na S uc Mol Biol,
21 (2014) 366-374.
[19] K.I. Sa age, J.J. Go ski, E.M. Ba os, G.W. I win, L. Man i, A.J. Powell, A.
Pellaga i, N. Lukashchuk, D.J. McCance, W.G. McCluggage, G. Sche ino, M. Sal o-
Tellez, J. Boul wood, D.J. Richa d, S.S. McDade, D.P. Ha kin, Iden i ica ion o a
BRCA1-mRNA splicing complex equi ed o e icien DNA epai and main enance o
genomic s abili y, Molecula cell, 54 (2014) 445-459.
[20] C. C e u, J. Schmi zo a, A. Ponce-Sal a ie a, O. Dybko , E.I. De Lau en iis, K.
Sha ma, C.L. Will, H. U laub, R. Luh mann, V. Pena, Molecula A chi ec u e o SF3b
and S uc u al Consequences o I s Cance -Rela ed Mu a ions, Molecula cell, 64
(2016) 307-319.
[21] O. Gozani, R. Feld, R. Reed, E idence ha sequence-independen binding o
highly conse ed U2 snRNP p o eins ups eam o he b anch si e is equi ed o
assembly o spliceosomal complex A, Genes De , 10 (1996) 233-243.
[22] B. Adamson, A. Smogo zewska, F.D. Sigoillo , R.W. King, S.J. Elledge, A
genome-wide homologous ecombina ion sc een iden i ies he RNA-binding p o ein
RBMX as a componen o he DNA-damage esponse, Na Cell Biol, 14 (2012) 318-
328.
[23] R.D. Paulsen, D.V. Soni, R. Wollman, A.T. Hahn, M.C. Yee, A. Guan, J.A.
Hesley, S.C. Mille , E.F. C omwell, D.E. Solow-Co de o, T. Meye , K.A. Cimp ich, A
genome-wide siRNA sc een e eals di e se cellula p ocesses and pa hways ha
media e genome s abili y, Molecula cell, 35 (2009) 228-239.
[24] P. Beli, N. Lukashchuk, S.A. Wagne , B.T. Weine , J.V. Olsen, L. Baskcomb, M.
Mann, S.P. Jackson, C. Choudha y, P o eomic in es iga ions e eal a ole o RNA
p ocessing ac o THRAP3 in he DNA damage esponse, Molecula cell, 46 (2012)
212-225.
[25] S. Ma suoka, B.A. Balli , A. Smogo zewska, E.R. McDonald, 3 d, K.E. Hu o , J.
Luo, C.E. Bakala ski, Z. Zhao, N. Solimini, Y. Le en hal, Y. Shiloh, S.P. Gygi, S.J.
Elledge, ATM and ATR subs a e analysis e eals ex ensi e p o ein ne wo ks
esponsi e o DNA damage, Science, 316 (2007) 1160-1166.
[26] O.R. Da ies, J.V. Fo men , M. Sun, R. Belo se ko skaya, J. Coa es, Y. Galan y,
M. Demi , C.R. Mo on, N.J. Rzecho zek, S.P. Jackson, L. Pelleg ini, C IP e ame
20
assembly is equi ed o DNA-end esec ion and epai , Na S uc Mol Biol, 22 (2015)
150-157.
[27] S.E. Polo, A.N. Black o d, J.R. Chapman, L. Baskcomb, S. G a el, A. Rusch, A.
Thomas, R. Blund ed, P. Smi h, J. Kzhyshkowska, T. Dobne , A.M. Taylo , A.S.
Tu nell, G.S. S ewa , R.J. G and, S.P. Jackson, Regula ion o DNA-end esec ion by
hnRNPU-like p o eins p omo es DNA double-s and b eak signaling and epai ,
Molecula cell, 45 (2012) 505-516.
[28] T.L. Cla ke, M.P. Sanchez-Bailon, K. Chiang, J.J. Reynolds, J. He e o-Ruiz, T.M.
Bandei as, P.M. Ma ias, S.L. Maslen, J.M. Skehel, G.S. S ewa , C.C. Da ies, PRMT5-
Dependen Me hyla ion o he TIP60 Coac i a o RUVBL1 Is a Key Regula o o
Homologous Recombina ion, Molecula cell, 65 (2017) 900-916 e907.
[29] F. Liu, W.H. Lee, C IP ac i a es i s own and cyclin D1 p omo e s ia he E2F/RB
pa hway du ing G1/S p og ession, Molecula and cellula biology, 26 (2006) 3124-
3134.
[30] C.L. Bladen, D. Udayakuma , Y. Takeda, W.S. Dynan, Iden i ica ion o he
polypy imidine ac binding p o ein-associa ed splicing ac o .p54(n b) complex as a
candida e DNA double-s and b eak ejoining ac o , J Biol Chem, 280 (2005) 5205-
5210.
[31] Y. Mo ozumi, Y. Takizawa, M. Takaku, H. Ku umizaka, Human PSF binds o
RAD51 and modula es i s homologous-pai ing and s and-exchange ac i i ies, Nucleic
Acids Res, 37 (2009) 4296-4307.
[32] C. Rajesh, D.K. Bake , A.J. Pie ce, D.L. Pi man, The splicing- ac o ela ed
p o ein SFPQ/PSF in e ac s wi h RAD51D and is necessa y o homology-di ec ed
epai and sis e ch oma id cohesion, Nucleic Acids Res, 39 (2011) 132-145.
[33] C. Rajesh, A.M. G u e , V. Bas u , D.L. Pi man, The in e ac ion p o ile o
homologous ecombina ion epai p o eins RAD51C, RAD51D and XRCC2 as
de e mined by p o eomic analysis, P o eomics, 9 (2009) 4071-4086.
[34] K.E. Hu o , C. Co a-Ramusino, S.J. Elledge, A gene ic sc een iden i ies he T iple
T complex equi ed o DNA damage signaling and ATM and ATR s abili y, Genes
De , 24 (2010) 1939-1950.
[35] S. Jungmichel, M. Blasius, Rapid and ansien p o ein ace yla ion changes in
esponse o DNA damage, Cell Cycle, 12 (2013) 1993.
21
[36] M.B. Smolka, C.P. Albuque que, S.H. Chen, H. Zhou, P o eome-wide
iden i ica ion o in i o a ge s o DNA damage checkpoin kinases, P oc Na l Acad Sci
U S A, 104 (2007) 10364-10369.
[37] J. Boucas, A. Riabinska, M. Jokic, G.S. He e -Sp ie, S. Chen, K. Hopke , H.C.
Reinha d , Pos ansc ip ional egula ion o gene exp ession-adding ano he laye o
complexi y o he DNA damage esponse, F on Gene , 3 (2012) 159.
[38] C. Na o, P. Bielli, V. Paglia ini, C. Se e, The in e play be ween DNA damage
esponse and RNA p ocessing: he unexpec ed ole o splicing ac o s as ga ekeepe s o
genome s abili y, F on Gene , 6 (2015) 142.
[39] M.V. Benne zen, D.H. La sen, J. Bunkenbo g, J. Ba ek, J. Lukas, J.S. Ande sen,
Si e-speci ic phospho yla ion dynamics o he nuclea p o eome du ing he DNA
damage esponse, Mol Cell P o eomics, 9 (2010) 1314-1323.
[40] A.E. Elia, A.P. Boa dman, D.C. Wang, E.L. Hu lin, R.A. E e ley, N. Dephou e,
C. Zhou, I. Ko en, S.P. Gygi, S.J. Elledge, Quan i a i e P o eomic A las o
Ubiqui ina ion and Ace yla ion in he DNA Damage Response, Molecula cell, 59
(2015) 867-881.
[41] G.S. S ewa , B. Wang, C.R. Bignell, A.M. Taylo , S.J. Elledge, MDC1 is a
media o o he mammalian DNA damage checkpoin , Na u e, 421 (2003) 961-966.
[42] H.C. Reinha d , I.G. Cannell, S. Mo andell, M.B. Ya e, Is pos - ansc ip ional
s abiliza ion, splicing and ansla ion o selec i e mRNAs a key o he DNA damage
esponse?, Cell Cycle, 10 (2011) 23-27.
[43] J. Ba bie , M. Du e e, D. Bi encou , G. Sanchez, L. G a adou, P. de la G ange,
D. Auboeu , Regula ion o H- as splice a ian exp ession by c oss alk be ween he p53
and nonsense-media ed mRNA decay pa hways, Molecula and cellula biology, 27
(2007) 7315-7333.
[44] J.Y. Ip, D. Schmid , Q. Pan, A.K. Ramani, A.G. F ase , D.T. Odom, B.J.
Blencowe, Global impac o RNA polyme ase II elonga ion inhibi ion on al e na i e
splicing egula ion, Genome Res, 21 (2011) 390-401.
[45] K. Ma sushi a, T. Kajiwa a, M. Tamu a, M. Sa oh, N. Tanaka, T. Tomonaga, H.
Ma suba a, H. Shimada, R. Yoshimo o, A. I o, S. Kubo, T. Na sume, D. Le ens, M.
Yoshida, F. Nomu a, SAP155-media ed splicing o FUSE-binding p o ein-in e ac ing
ep esso se es as a molecula swi ch o c-myc gene exp ession, Mol Cance Res, 10
(2012) 787-799.
22
[46] C. Lemai e, A. G aba z, K. Tsou oula, L. And ono , A. Fu s , T. Panko ai, V.
Heye , M. Rogie , K.M. A wood, P. Kessle , G. Dellai e, B. Klaholz, B. Reina-San-
Ma in, E. Sou oglou, Nuclea posi ion dic a es DNA epai pa hway choice, Genes
De , 28 (2014) 2450-2463.
[47] R.W. Anan ha, A.L. Alci a , J. Ma, H. Cai, S. Simhad i, J. Ule, J. Konig, B. Xia,
Requi emen o he e ogeneous nuclea ibonucleop o ein C o BRCA gene exp ession
and homologous ecombina ion, PloS one, 8 (2013) e61368.
[48] M. B and, J.G. Moggs, M. Oulad-Abdelghani, F. Lejeune, F.J. Dilwo h, J.
S e enin, G. Almouzni, L. To a, UV-damaged DNA-binding p o ein in he TFTC
complex links DNA damage ecogni ion o nucleosome ace yla ion, EMBO J, 20 (2001)
3187-3196.
[49] D. Gomez-Cabello, S. Jimeno, M.J. Fe nandez-A ila, P. Hue as, New ools o
s udy DNA double-s and b eak epai pa hway choice, PloS one, 8 (2013) e77206.
[50] A.J. Pie ce, R.D. Johnson, L.H. Thompson, M. Jasin, XRCC3 p omo es homology-
di ec ed epai o DNA damage in mammalian cells, Genes De , 13 (1999) 2633-2638.
[51] N. Benna do, A. Cheng, N. Huang, J.M. S a k, Al e na i e-NHEJ is a
mechanis ically dis inc pa hway o mammalian ch omosome b eak epai , PLoS
gene ics, 4 (2008) e1000110.
[52] P. Hue as, S.P. Jackson, Human C IP media es cell cycle con ol o DNA end
esec ion and double s and b eak epai , J Biol Chem, 284 (2009) 9558-9565.
TABLES
Table 1: Mass spec ome y da a o C IP complexes
P o ein
Aliases
Gene
Molecula
Weigh
Unique
pep ides
C IP
RBBP8, RIM, SCKL2, JWDS
RBBP8
101.942
37
SF3B1
SAP155, MDS, Hsh155, PRPF10, PRP10
SF3B1
145.830
34
RBM10
DXS8237E, KIAA0122, GPATCH9, GPATC9, TARPS,
ZRANB5
RBM10
103.533
31
SF3B3
SF3b130, SAP130, STAF130, KIAA0017, RSE1
SF3B3
135.577
27
SF3B2
SF3B145, SAP145, Cus1
SF3B2
100.228
26
PRMT5
HRMT15L, SKB1Hs, INP72, JBP1
PRMT5
72.684
25
DHX15
DDX15, DBP1, HRH2, PRPF43, PRP43
DHX15
90.933
24
SFPQ
PSF, PPP1R140, POMP100
SFPQ
76.149
23
DHX9
DDX9, NDHII, NDH2, LKP, RHA
DHX9
140.958
22
23
CCAR2
KIAA1967, DBC1, P30DBC, NET35
CCAR2
102.902
18
KIF11
KNSL1, TRIP5, MCLMR, EG5, HKSP
KIF11
119.159
15
hnRNPU
SAF-A, P120
HNRNPU
90.584
14
In bold, p e iously desc ibed C IP in e ac o s
FIGURES LEGENDS
Figu e 1. Disco e y o he SF3B complex as a physical and unc ional in e ac o o
C IP
A, P o ein samples om cells ha bou ing GFP-3XFLAG-C IP o con ol cells we e
subjec ed o wo-s ep a ini y pu i ica ion. Fi s , complexes we e isola ed wi h an i-
FLAG beads and elu ed using 3XFLAG pep ide. Then, a second pu i ica ion was
pe o med wi h an i-GFP esin. A wes e n blo displaying he endogenous (whi e
iangle) and GFP-3XFLAG-C IP (solid iangle) bands a each s ep o pu i ica ion is
shown. B, DNA esec ion p o iciency, measu ed as he pe cen age o RPA oci-posi i e
cells upon 10 Gy o ionizing adia ion, in cells down egula ed o he indica ed genes.
The a e age and s anda d de ia ion o a leas h ee independen expe imen s is shown.
A S uden - es compa ing wi h con ol shNT (Non-Ta ge shRNA) was pe o med and
one, wo o h ee as e isk(s) deno es s a is ical signi icance a p<0.05, p<0.01 o
p<0.001, espec i ely. C, Cells bea ing a GFP-C IP usion o GFP as a con ol we e
used o immunop ecipi a ion using a GFP- ap. Immunop ecipi a ed samples (IP) and
p o ein inpu s (Inpu ) we e esol ed in SDS-PAGE and blo ed wi h an ibodies agains
he indica ed p o eins. D, P o ein samples om U2OS cells ha bou ing GFP-C IP we e
used o immunop ecipi a ion wi h an an ibody agains SF3B1 (B1) o a con ol IgG
(C), esol ed in SDS-PAGE and blo ed wi h he indica ed an ibodies. E, Same as D,
bu in cells bea ing GFP o GFP-C IP cons uc s and wi h an an ibody agains SF3B2
(IP-SF3B2). F, Same as D, bu du ing immunop ecipi a ion, RNase A was added o no
as designa ed in he igu e. G, P oximi y Liga ion Assay be ween C IP and SF3B2. PLA
signal was sco ed using an ibodies agains C IP and he SF3B2 subuni in unpe u bed
cells (undamaged) o cells exposed o 10 Gy o ionizing adia ion and le o eco e o
1 h (IR). To es ablish he speci ici y o he signal, he expe imen was epea ed wi h
deple ion o ei he C IP o SF3B2. shNT deno es an shRNA wi h no a ge in he human
genome. The quan i ica ion ( igh ) and depic i e images (le ) o one ep esen a i e
expe imen , ou o ou wi h simila esul s, is shown. Median PLA oci is ep esen ed
24
wi h a ed line. H, PLA expe imen using SF3B2 and C IP an ibodies in i adia ed cells
(10 Gy) ha bou ing a GFP-MDC1 cons uc o isualize DNA b eaks.
Figu e 2. Deple ion o SF3B subuni s hampe s DNA end esec ion
A, Cells ans ec ed wi h siRNA agains SF3B1 (siSF3B1) o a con ol sequence (siNT)
we e exposed o 10 Gy o ionizing adia ion (IR). An hou la e , cells we e collec ed
and RPA was de ec ed by immuno luo escence. Images o a ep esen a i e expe imen
and a plo o he a e age and s anda d de ia ion o h ee independen expe imen s a e
shown. O he de ails as in igu e 1B. B, Same as A, bu cells ans ec ed wi h a siRNA
agains SF3B2 (siSF3B2) o con ol (siNT) bea ing a siRNA- esis an FLAG-SF3B2,
FLAG-SF3B2-S289A o FLAG plasmid, as indica ed. S a is ical signi icance was
measu ed wi h an ANOVA es . C, Classical ecombina ion assay using he DR-GFP
epo e in cells deple ed o SF3B1. A scheme o he epo e is shown on he le .
Induc ion o a DSB using I-SceI meganuclease will ende GFP posi i e cells when
gene con e sion occu s using he dono epea (iGFP). Such e en could happen
in amolecula ly (as shown) o wi h a dono sequence loca ed in he sis e ch oma id
(no shown). The e iciency o classical ecombina ion was calcula ed as he pe cen age
o GFP posi i e cells in esponse o I-SceI exp ession upon down egula ion o he
indica ed genes, no malized wi h he con ol. S a is ical signi icance was es ed using a
-S uden es as desc ibed in me hods. D, Same as C, bu in cells s ably exp essing
FLAG, siRNA- esis an FLAG-SF3B2 o FLAG-SF3B2-S289A and ans ec ed wi h a
siRNA agains SF3B2 o a con ol sequence. S a is ical signi icance was de e mined
wi h a 2-way ANOVA es . E, Same as C, bu using he NHEJ epo e EJ5-GFP. In his
case, wo I-SceI-induced DSBs could be epai ed by conse a i e (le ) o mu agenic
( igh ) NHEJ g an ing he accumula ion o unc ional GFP. F, Same as D bu in cells
bea ing he NHEJ epo e EJ5-GFP.
Figu e 3. The SF3B complex con ols C IP exp ession
A, The amoun o C IP mRNA was calcula ed by RT-qPCR in cells s ably exp essing a
agged e sion o siRNA- esis an wild ype SF3B2 (FLAG-SF3B2), SF3B2 mu an
(FLAG-SF3B2-S289A) o he emp y ec o (FLAG) and ans ec ed wi h a siRNA
agains SF3B2 (siSF3B2) o a con ol sequence (siNT). The ba s ep esen he a e age
and s anda d de ia ion o h ee independen expe imen s. S a is ical analysis as in igu e
1B. C, P o ein abundance and s abili y we e de e mined ea ing he cells wi h
FLAG-SF3B2
- Dox + Dox
P ados-Ca ajal e al Figu e 5
A
C IPFISHDAPI
- Dox + Dox
FLAG
B
0
20
40
60
80
Cells wi h C IP oci a he a ay (%)
FLAG FLAG-SF3B2 FLAG-SF3B2-S289A
***
***
***
***
***
siSF3B2
-Dox
+Dox
FLAG-SF3B2-S289A
- Dox + Dox
P ados-Ca ajal e al Figu e 6
A
shNT
shSF3B2
shC IP
shNT
shSF3B2
shC IP
0
20
40
60
80
*
***
*
*
***
GFP
% RPA oci-posi i e cells
GFP-C IP
0
20
40
60
80
*
** **
% RPA oci-posi i e cells
shNT
shSF3B2
shNT
shSF3B2
shC IP
shNT
RPADAPI
shSF3B2shNT
shNT
shNT
shC IP
shSF3B2
BRPA DAPI
shC IP shSF3B2 shNT
GFP GFP-C IP
RPA DAPI
C
HR e ficiency
no malized o con ol
siNT
siSF3B2
siC IP
0.0
0.5
1.0
1.5
FLAG
FLAG-C IP
**
**
**
*** ** D
siNT
siSF3B2
0
50
100
150
Su i al (%)
GFP
GFP-C IP
**
*
*
1
Supplemen a y Figu e legends:
Supplemen a y Figu e S1. Down egula ion e iciency o a ge ed genes
A, U2OS cells we e ansduced wi h he indica ed shRNAs and cul u ed o 48 h. Then,
p o eins we e ex ac ed using Laemmli bu e , esol ed in SDS-PAGE and ans e ed
o PVDF memb anes. Rep esen a i e blo s upon incuba ion wi h an ibodies agains he
speci ied p o eins a e shown. shNT deno es a non- a ge shRNA con ol. B, PLA signal
using SF3B2 and C IP an ibody as indica ed in igu e 1G, bu in cells p e ea ed o 1
hou be o e i adia ion wi h ATM inhibi o (ATMi) o DMSO. C, same as A bu in cells
deple ed o SF3B1 using siRNA. D, P o ein samples om cells bea ing he siRNA
esis an wild ype FLAG-SF3B2, he FLAG-SF3B2-S289A mu an o FLAG emp y
ec o and ans ec ed wi h siRNA agains he endogenous o m SF3B2 (siSF3B2) o a
non- a ge ed con ol (siNT) we e p epa ed, esol ed by SDS-PAGE and blo ed o he
indica ed an ibodies
Supplemen a y Figu e S2. Cell cycle e ec o SF3B1 and SF3B2 deple ion
A, Cell cycle dis ibu ion upon ans ec ion wi h he indica ed siRNAs. The a e age and
s anda d de ia ion o h ee independen expe imen a e plo ed. B, Same as A bu cells
s ably exp essing FLAG, siRNA- esis an wild ype FLAG-SF3B2 o FLAG-SF3B2-
S289A mu an and ans ec ed wi h he indica ed siRNAs.
Supplemen a y Figu e S3. S289 phospho yla ion does no a ec C IP-SF3B2
in e ac ion
PLA was pe o med as desc ibed in Figu e 1G in cells down egula ed o endogenous
SF3B2 and bea ing a siRNA- esis an e sion o wild ype SF3B2, an S289A mu an o
he emp y FLAG ec o as a con ol. S a is ical di e ences we e calcula ed using an
ANOVA es .
Supplemen a y Figu e S4. FLAG-C IP o e exp ession
Cells exp essing FLAG-C IP o he emp y FLAG ec o , as indica ed, we e ans ec ed
wi h siRNAs agains C IP, SF3B2 o a con ol sequence. Then, p o ein samples we e
ob ained as desc ibed in me hods, esol ed in SDS-PAGE and blo ed wi h he indica ed
an ibodies.
Supplemen a y ables
2
Supplemen a y Table S1: shRNAs used in his s udy.
Ta ge
gene
TCR Numbe
ID
Sequence (5’-3’)
Non Ta ge
SHC016V
01031212MN
-
CCGGCAACAAGATGAAGA
GCACCAACTC
GAGTTGGTGCTCTTCATCT
TGTTGTTTTT
C IP
TRCN0000318738
NM_002894.
2-3041s21c1
CCGGCAGAAGGATGAAGG
ACAGTTTCTC
GAGAAACTGTCCTTCATC
CTTCTGTTTTTG
SF3B2
TRCN0000314606
NM_006842.
2-1133s21c1
CCGGGCTGATGTTGAGAT
TGAGTATCTCG
AGATACTCAATCTCAACA
TCAGCTTTTTG
SF3B3
TRCN0000000069
NM_012426.
x-3898s1c1
CCGGAGGAGGGTGACTGG
ATAATTACTC
GAGTAATTATCCAGTCAC
CCTCCTTTTTTG
RBM10
TRCN0000233276
NM_005676.
3-491s21c1
CCGGGACATGGACTACCG
TTCATATCTCGAGATATG
AACGGTAGTCCATGTCTTT
TTG
3
SFPQ
TRCN0000001084
NM_005066.
x-1855s1c1
CCGGGCGCCAAAGAGAGG
AAAGTTACTCGAGTAACT
TTCCTCTCTTTGGCGCTTT
TT
DHX9
TRCN0000001210
NM_001357.
x-515s1c1
CCGGGAAGGATTACTACT
CAAGAAACTCGAGTTTCT
TGAGTAGTAATCCTTCTTT
TT
DHX15
TRCN0000000006
NM_001358.
x-2632s1c1
CCGGGTTGGTTCGATAAT
GGCCTTTCTCGAGAAAGG
CCATTATCGAACCAACTTT
TT
KIF11
TRCN0000116497
NM_004523.
2-3927s1c1
CCGGGCTTGAGCTTAACA
TAGGTAACTCGAGTTACC
TATGTTAAGCTCAAGCTTT
TTG
PRMT5
TRCN0000107086
NM_006109.
2-1577s1c1
CCGGGCCCAGTTTGAGAT
GCCTTATCTCGAGATAAG
GCATCTCAAACTGGGCTT
TTTG
Supplemen a y Table S2: siRNAs used in his s udy.
Ta ge
Re e ence
Supplie
Sequence (5’-3’)
4
gene
Non
Ta ge
D-001810-10-20
Dha macon
UGGUUUACAUGUCGACUAA,
UGGUUUACAUGUUGUGUGA,
UGGUUUACAUGUUUUCUGA and
UGGUUUACAUGUUUUCCUA (mix)
C IP
Hue as and
Jackson 2009
Sigma
GCUAAAACAGGAACGAAUC
SF3B1
D-020061-07-
0005
Dha macon
CGAGUUUGCUUGGUCAGAA
SF3B2
HSC.RNAI.N00
6843.12.6
IDT
GGACUUGUCAUUUCAUGUUCUUATT
Supplemen a y Table S3: P ime s used in his s udy.
P ime s
Applica ion
Sequence (5’-3’)
Fw Ac B
qPCR
ACGAGGCCCAGAGCAAGA
R Ac B
qPCR
GACGATGCCGTGCTCGAT
Fw C IP
qPCR
AGAAATTGGCTTCCTGCTCAAG
R C IP
qPCR
GAAAACCAACTTCCCAAAAATTCTC
SF3B2 UP
SF3B2
cloning
AAGCTCAAGCTTATGGATGACCC
SF3B2 LOW
SF3B2
cloning
TTCGCGGCCGCCTAAACTTGAAC
Fw G418
SF3B2
cloning
GTCAGTGATATCCCCTGATAAATGCTTCAA
R G418
SF3B2
cloning
GTCCAGTGATATCCGAAATCTCGTGATGG
Supplemen a y Table S4: P ima y An ibodies used in his s udy.
5
IF, immuno luo escence. IF-FISH, Immuno-FISH. WB, Wes e n blo ing. PLA,
P oximi y liga ion assay. IP, Immunop ecipi a ion.
Ta ge p o ein
Applica ion
Supplie
Re e ence
-Tubulin
WB
Sigma
T9026
-Ac in
WB
Abcam
ab8227
γ-H2AX
IF, IF-FISH
Cell
Signaling
2577L
γ-H2AX
IF
Millipo e
05-636
BRCA1
WB
San a C uz
sc-6954
C IP
WB, PLA,
IF-FISH
R. Bae
14.1
DHX9
WB
Be hyl
Labo a o ies
A300-855A-1
DHX15
WB
Be hyl
Labo a o ies
A300-118A-1
FLAG
WB, IF-FISH
Sigma
F3165-0.2MG
GFP
WB
San a C uz
Sc-8334
GFP
IF
Roche
11 814 460 001
KIF11
WB
No us
NB100-78467
PRMT5
WB
Abcam
ab31751
RBM10
WB
Be hyl
Labo a o ies
A301-006A
RPA32
WB, IF
Abcam
ab2175
SF3B1
WB, IP
MBL
D221-3
SF3B2
WB, PLA, IP
P o ein ech
10919-1-AP
SF3B3
WB
Abcam
ab3608
SFPQ
WB
Abcam
ab38148
Supplemen a y Table S5: Seconda y an ibodies used in his s udy.
IF, immuno luo escence. IF-FISH, Immuno-FISH. WB, Wes e n blo ing.
An ibody
Applica ion
Supplie
Re e ence
6
Alexa Fluo 594 goa an i-mouse
IF
In i ogen
A11032
Alexa Fluo 488 goa an i- abbi
IF
In i ogen
A11034
Alexa Fluo 568 goa an i- abbi
IF-FISH
In i ogen
A11011
Alexa Fluo 647 goa an i-mouse
IF-FISH
In i ogen
A21235
Alexa Fluo 568 donkey an i-mouse
IF-FISH
Molecula
p obes
A10037
Fluo escein an i-Bio in
IF-FISH
Vec o
SP-3040
IRDye 800 CW Donkey an i-goa IgG (H+L)
WB
Li-Co
926-32214
IRDye 680RD goa an i-mouse IgG (H+L)
WB
Li-Co
926-68070
IRDye 800CW goa an i- abbi IgG (H+L)
WB
Li-Co
926-32211
P ados-Ca ajal e al Supplemen a y Figu e S1
A
shNT
shRBM10
RBM10
α-Tubulin
shNT
shSFPQ
SFPQ
shNT
shDHX9
DHX9
shNT
shDHX15
DHX15
shNT
shKIF11
KIF11
shNT
shPRMT5
PRMT5
α-Tubulinα-Tubulin α-Tubulin
α-Tubulin α-Tubulin
shNT
shSF3B3
SF3B3
α-Tubulin
shNT
shC IP
C IP
α-Tubulin
FLAG-SF3B2
Endogenous SF3B2
α-Tubulin
C
D
SF3B1
β-Ac in
siNT
siSF3B1
siC IP
siNT siSF3B2
FLAG
FLAG-SF3B2
FLAG-SF3B2-S289A
FLAG
FLAG-SF3B2
FLAG-SF3B2-S289A
B
0
50
100
150
200
PLA signal ela i e o con ol
No damage IR
***
**
**
***
*
DMSO
ATMi
P ados-Ca ajal e al Supplemen a y Figu e S2
AB
siNT
siSF3B1
0
50
100G1
S
G2/M
% Cells
siNT
siSF3B2
siNT
siSF3B2
siNT
siSF3B2
0
50
100G1
S
G2
FLAG
% Cells
FLAG-SF3B2 FLAG-SF3B2-
S289A