Multiple Roles of the Splicing Complex SF3B in DNA end Resection and Homologous Recombination

Depósito de investigación de la Universidad de Sevilla https://idus.us.es/ “This is an Accepted Manuscript of an article published by Elsevier in: DNA REPAIR on 2018, available at: https://doi.org/10.1016/j.dnarep.2018.04.003” 1 Multiple roles of the splicing complex SF3B in DNA end resection and homologous recombination Rosario Prados-Carvajal1,2, Ana López-Saavedra1,2, Cristina Cepeda-García2, Sonia Jimeno1,2 and Pablo Huertas1,2 1 Departamento de Genética, Universidad de Sevilla, Sevilla, 41080, Spain 2 Centro Andaluz de Biología Molecular y Medicina Regenerativa-CABIMER, Universidad de Sevilla-CSIC-Universidad Pablo de Olavide, Sevilla, 41092, Spain Correspondence to P. Huertas ([email protected]) Tel: (+34) 954 467 667 Fax: (+34) 954 461 664 2 ABSTRACT The appropriate repair of DNA double strand breaks is critical for genome maintenance. Thus, several cellular pathways collaborate to orchestrate a coordinated response. These include the repair of the breaks, which could be achieved by different mechanisms. A key protein involved in the regulation of the repair of broken chromosomes is CtIP. Here, we have found new partners of CtIP involved in the regulation of DNA break repair through affecting DNA end resection. We focus on the splicing complex SF3B and show that its depletion impairs DNA end resection and hampers homologous recombination. Functionally, SF3B controls CtIP function at, as least, two levels: by affecting CtIP mRNA levels and controlling CtIP recruitment to DNA breaks, in a way that requires ATM-mediated phosphorylation of SF3B2 at serine 289. Indeed, overexpression of CtIP rescues the resection defect caused by SF3B downregulation. Strikingly, other SF3B depletion phenotypes, such as impaired homologous recombination or cellular sensitivity to DNA damaging agents, are independent of CtIP levels, suggesting a more general role of SF3B in controlling the response to chromosome breaks. 3 INTRODUCTION Living organisms are exposed to multiple physical and chemical threats that might compromise their survival. Especially relevant are those challenges that jeopardize the integrity of the genome as they will not only affect the current generation but might endanger the future progeny. During evolution, a very intricate response has evolved to safeguard genomic information [1, 2]. This involves the stimulation of DNA repair mechanisms, but also the coordination of all cellular events through the activation of the DNA damage checkpoints [1]. Particularly challenging is the repair of DNA Double Strand Breaks (DSBs), due to the simultaneous harm to both strands [1]. Different to the healing of any other type of lesion, DSBs cannot be mended by using a complementary strand. So, the repair of broken chromosomes is indeed a complicated affair. Two close DNA fragments might be simply re-joined with little or no processing, a mechanism named Non-Homologous End-Joining (NHEJ; [3]). Such procedure is fast, highly efficient and energetically cheap, thus is the method of choice for the majority of the repair events in higher eukaryotes. However, the lack of a proofreading activity might result in the erroneous joining of DNA segments that originally were not adjacent, contributing to the appearance of gross chromosomal rearrangements [4]. As a consequence, more complex DSB repair mechanisms coexist within the cells. DNA breaks can be processed, a step known as DNA end resection, which consists on the degradation of one strand of the DNA in a 5’-3’ polarity that leaves a tail of protruding ssDNA [5]. ssDNA is immediately coated by the protecting complex RPA [5]. This resected DNA can be engaged in the pairing with a homologous sequence elsewhere in the genome, prompting the repair mechanisms collectively known as Homologous Recombination (HR; [6]). HR might ensue in different fashions [6], but all of them share the same initial step, the aforementioned DNA end resection. Thus, resected DNA is an obligatory substrate in all HR pathways and, at the same time, effectively blocks NHEJ [6, 7]. Although traditionally HR has been considered an error-free repair pathway, now it is clear that unscheduled HR might also increase the appearance of gross chromosomal rearrangements [4]. Thus, there is a tight regulation of the choice between DSB repair pathways in response to cell status to minimize genomic instability upon the occurrence of breaks on the DNA. A critical factor for such regulation is CtIP. This factor acts as a molecular switch that activates DNA end resection, hence homologous recombination, when the cellular environment is supportive of this type of repair [8]. CtIP, together with the MRN complex, initiates resection and conforms the 4 minimal resection machinery [9, 10]. Although CtIP itself displays a nuclease activity [11, 12], it is still debated how much it contributes to the actual process. In addition to its role in DNA repair, CtIP has been involved in several processes, including its own transcription [13]. To assess the general suitability for HR, CtIP collects cellular information through post-translational modifications and protein-protein interactions [8]. Indeed, different partners of CtIP are known to play pro- or antiresection roles [8, 14-16]. Recently, a crosstalk between the DNA Damage Response (DDR) and the RNA metabolism at different levels has become apparent. RNA is involved in facilitating the recruitment of checkpoint proteins like 53BP1 to damaged chromatin [17]. Moreover, highly transcribed genes are repaired differently to other chromatin regions, and the nascent RNA might play a role on this specificity [18]. Indeed, it has been recently shown that RNA splicing changes globally upon challenging DNA with a DNA damage source, and such alternative splicing requires the activation of the DDR to take place [19]. This DNA damage-dependent alternative splicing is controlled by BRCA1 [19], a known partner of CtIP involved in DNA resection modulation [13, 14]. This modulation implies that BRCA1 interacts specifically upon appearance of DNA damage with several proteins such as SF3B1 [19], one out of the seven subunits of the core SF3B splicing complex [20]. This complex is critical for correct RNA splicing, as contacts with the nascent mRNA at or near the branch site [21]. Additionally, several subunits of the complex have been already found in genome wide screens for factors involved in DNA repair, affecting homologous recombination [22], controlling genome stability [23] or as substrates of the checkpoint kinases [24, 25]. Here we have isolated additional partners of CtIP. Among them, we have found three subunits of the SF3B splicing complex. We have analysed the role of this complex in the repair of DSBs. Functionally, SF3B is required for proper DNA end resection and homologous recombination. Indeed, SF3B regulates CtIP mRNA levels but also the recruitment of CtIP to DSBs. Strikingly, SF3B role on the repair of DSBs exceeds its regulation of CtIP, as cells depleted for SF3B but overexpressing CtIP are proficient for DNA end resection but hypersensitive to DNA damage and defective for homologous recombination. RESULTS AND DISCUSSION Isolation of novel CtIP biochemical interactors 5 As mentioned, CtIP is regulated, among other signals, by protein-protein interactions [8]. In order to isolate new partners of CtIP, we performed tandem affinity purification from U2OS cells expressing a GFP and triple FLAG-tagged version of this protein. First, we used an anti-FLAG resin to immunoprecipitate GFP-3XFLAG-CtIP complexes that were subsequently eluted with an excess of 3XFLAG peptide. Then, an anti-GFP resin was used to further purify the protein samples (Figure 1A). The final precipitated were resolved in an SDS-PAGE (Figure 1A). CtIP self-interacts [26], thus endogenous CtIP was used to follow the quality of the immunoprecipitation protocol. Proteins immunoprecipitated exclusively from cells expressing the fusion protein and absent on control cells were detected using Mass Spectrometry. We isolated nine proteins previously unknown to be CtIP interaction partners, including three subunits of the SF3B complex, and two previously reported interactors, a member of the hnRNPU family and CCAR2 [15, 27] (Table 1). CtIP has different functions within the cell [8, 16]. To study the relevance of those new CtIP interacting proteins in DNA end resection, we analysed the formation of ssDNA upon treatment with ionizing radiation (IR) on cells depleted for all the novel interacting proteins. Initially, we chose SF3B3 as a representative example of the SF3B complex. The roles of proteins of the hnRNPU family and CCAR2 on DNA end resection have been published elsewhere [15, 27]. By using RPA foci as a proxy for DNA resection, we found two distinct categories of CtIP interacting proteins in relationship with DNA damaged-induced end processing (Figure 1B): those that do not affect it (RBM10, SFPQ) and those that, like CtIP itself, are required for resection (SF3B3, PRMT5, DHX9, DHX15, KIF11). Depletion efficiencies are shown in supplementary figure S1A. Interestingly, PRMT5 has been very recently discovered to mobilize the anti-resection factor 53BP1 from damaged chromatin and stimulate homologous recombination [28], in agreement with a role promoting resection. It is noteworthy that from all 11 proteins we have detected, 8 correspond to RNA-related factors. In principle, a possibility was that we purified CtIP-complexes more involved in repair-independent CtIP roles, such as transcriptional regulation [13, 29]. However, depletion of the majority of them hampered DNA resection, pointing out to a role on modulating DNA repair directly or indirectly. Moreover, even SFPQ, which did not reduce DNA resection when downregulated, is a known interactor of Rad51, Rad51 paralogues and the Ku complex, and has been shown to affect directly their roles in DSB repair [30-33]. Such a high incidence of RNA-related proteins interacting with a known DNA repair factor is not 6 surprising. In fact, mRNA processing factors are commonly enriched in many genomewide screenings aimed to find new factors involved in the DDR and the maintenance of genomic integrity [15, 22, 23, 34] and many RNA-related proteins have been detected as targets of the DNA damage-induced post-translational modifications [24, 25, 35, 36]. Thus, in recent years, accumulated growing evidence revealed the importance of RNA- related factors for the DDR and DNA repair [37, 38]. From that point onwards, we decided to focus on the role of the SF3B complex in DNA end resection and the response to DNA damage. Not only we found three distinct subunits of the same complex interacting with CtIP, but also all three have been previously found in global screenings to affect homologous recombination and repair [22] and as direct targets of the DNA Damage Response (DDR) [24, 25, 39, 40]. In order to validate the relationship of CtIP with this complex, we first immunoprecipitated proteins with a GFP-trap using samples from cells bearing a GFP- CtIP or GFP as a control and immunoblotting for SF3B1 and SF3B2. Albeit some unspecific binding of these proteins, we confirmed an enrichment in both subunits of the SF3B complex in GFP-CtIP cells (Figure 1C). Then, we performed the reciprocal experiment by using anti-SF3B1 and anti-SF3B2 antibodies from immunoprecipitations with samples from cells harbouring GFP-CtIP or GFP constructs (Figure 1D and 1E, respectively). As seen in those figures, both SF3B1 and SF3B2 readily immunoprecipitated GFP-CtIP and, to a lesser extent, endogenous CtIP. Both SF3B complex and CtIP are related with RNA metabolism, splicing and transcription, respectively. Thus, we wondered if the interaction between SF3B and CtIP might be mediated or stabilized by RNA. Nonetheless, treatment with RNase neither abolished nor severely reduced SF3B1-CtIP co-immunoprecipitation (Figure 1F). To determine the subcellular localization of this interaction, we performed a proximity ligation assay (PLA). We observed that CtIP interacts with SF3B2 inside the nucleus (Figure 1G). Depletion of either CtIP or SF3B components abolished the PLA signal, supporting the specificity of the assay (Figure 1G). In agreement with our data, SF3B1 has been shown to interact also with BRCA1 [19], a CtIP well established partner [8, 14, 16]. A stark difference between this study and ours is the DNA damage dependency. Whereas SF3B1 and BRCA1 only interact upon the exposure of the cultures to DNA damage [19], CtIP and SF3B seem to interact even in the absence of DNA damage in our hands. However, an increase in CtIP and SF3B interaction could be observed upon DNA damage (Figure 1G). Moreover, such increase was abolished when the checkpoint was 7 inactivated by inhibition of ATM (Supplementary Figure S1B). Surprisingly, the majority of such interaction did not occur at the sites of DSB, labelled with GFPMDC1, a protein recruited early to DSBs [41](Figure 1H). These findings supported a constitutive interaction of CtIP and SF3B, which is stimulated by the presence of damaged chromatin but mostly takes place, and most likely have a functional meaning, outside the actual damaged DNA. The SF3B complex is involved in DNA end resection and recombination CtIP is a multifunctional protein with roles in transcription, replication, DNA repair, etc [8, 16]. In order to investigate if the SF3B complex might be affecting DNA recombination, and specifically, DNA end resection, we depleted SF3B1 and SF3B2 subunits of the complex using siRNA targeted against them (see Supplementary Figure S1C and S1D for depletion efficiency). To be sure that the observed phenotypes were not caused by off-target effects, we also complemented SF3B2 depletion with a siRNA- resistant FLAG-SF3B2 construct (Supplementary Figure S1D). Following the formation of RPA-coated ssDNA as a readout, we observed that upon challenging the cells with ionizing radiation (IR), and no matter the subunit targeted, a reduction of the levels of SF3B complex leaded to an impairment of DNA end resection (Figure 2A and 2B). As expected, ectopic expression of siRNA-resistant wild type FLAG-tagged SF3B2 was able to fully complement this resection impairment (Figure 2B). As mentioned, the subunits of the SF3B complex suffer DNA damage-dependent post-translational modifications, including an ATM-dependent phosphorylation of SF3B2 at serine 289 [25]. Thus, we wondered if such modification might affect DNA end resection. Indeed, expression of siRNA resistant FLAG-SF3B2-S289A mutant did not completely rescue the resection defect observed upon depletion of endogenous SF3B2 (Figure 2B), arguing the importance of such serine in the process. Therefore, it suggests a double contribution of SF3B2 to the process, one mediated by this phosphorylation an another independent of it. Not surprisingly, based on this defect on DNA end resection, DSB repair pathways were affected upon depletion of SF3B subunits. In agreement with a resection impairment when siRNAs against SF3B1 or SF3B2 were used, recombination was strongly reduced (Figures 2C and 2D). NHEJ was not significantly changed upon SF3B1 downregulation (Figure 2E) but mildly increased upon SF3B2 depletion (Figure 2F), suggesting the main effect of the complex was through HR. Ectopic expression of siRNA resistant wild 8 type FLAG-SF3B2 rescued the effect of SF3B2 depletion (Figures 2D and 2F). On the contrary, the S289A mutant of SF3B2 was still compromised for homologous recombination (Figure 2D). These effects on DNA resection and HR were not caused by an accumulation of cells in G1 phase (Supplementary Figures S2A and S2B). Thus, we conclude that the SF3B complex plays a role on DNA resection and in the repair of DSBs, mainly in HR. SF3B controls the abundance of CtIP RNA binding proteins have been shown to affect the response to DNA damage at several levels: they can have RNA-independent function and direct roles in DNA repair [30-33, 38], or they can affect the RNA metabolism, including mRNA stability, splicing or translation [22, 37, 38]. In fact, it has been established that mRNA splicing controls the abundance of specific repair proteins [19, 37, 42]. As the interaction between SF3B and CtIP seems to occur mainly outside the actual sites of damaged DNA (Figure 1H), we wondered if the phenotypes observed upon SF3B depletion might be partially or totally related to changes on the abundance of specific repair factors. Considering the effect on DNA end resection, the interaction with CtIP and the fact that CtIP controls its own expression [29] we analysed the abundance of CtIP mRNA in the absence of SF3B2. Indeed, depletion of SF3B2, reduced the amount of CtIP mRNA, and such effect was rescued by the expression of a siRNA resistant version of the gene (Figure 3A). Strikingly, cells expressing the S289A mutant were proficient in CtIP expression (Figure 3A), despite being defective in DNA end resection and HR (Figure 2B and 2D). Moreover, overexpression of SF3B2 elevates the abundance of CtIP transcript, measured by quantitative PCR (Figure 3A). This lower abundance of CtIP mRNA caused a reduction in the abundance of the protein, that was complemented by ectopic expression of FLAG-SF3B2 (Figure 3B and 3C). In principle, such decrease could be a direct consequence of low mRNA or due to the production of an alternative-spliced variant of the protein with increased turnover. In this case, lower CtIP protein levels were not due to a decrease in the protein stability, analysed by a cycloheximide chase (Figure 3C), suggesting that SF3B complex controls CtIP abundance at the level of mRNA. Moreover, the S289A mutant, in concordance with the mRNA results, showed normal accumulation of CtIP protein. Thus, this mutant in an ATM-target site behaves as a separation of function mutant, defective in DNA end resection and HR but without affecting CtIP expression. In agreement, our data suggest that the reduction of CtIP 15 analysed with a BD FACSAria with the BD FACSDiva Software v5.0.3. Four different parameters were considered: side scatter (SSC), forward scatter (FSC), blue fluorescence (407 nm violet laser BP, Filter 450/40) and green fluorescence (488 nm blue laser BP Filter 530/30). Finally, the number of green cells from at least 10,000 events positives for blue fluorescence (infected with the I-SceI–BFP construct) was scored. The average of both duplicates was calculated for each sample of every experiment. To facilitate the comparison between experiments, this ratio was normalized with shRNA or siRNA control. At least four completely independent experiments were carried out for each condition and the average and standard deviation of all four represented. MTT cell viability assay Cell viability was evaluated using a commercially available MTT cell growth assay kit (Millipore), according to the manufacturer's instructions. Briefly, U2OS cells expressing GFP or GFP-CtIP plasmid were transfected with the indicated siRNAs. 24h after, 7,000 cells were seeded into a 96-well plate, treated with 0.5 µM etoposide or DMSO. 42h later, the samples were incubated for 4h at at 37º C after addition of MTT solution. After removing the medium and MTT solution, formazan was solubilized in 100 μl HCl in isopropanol 0.4 N. Cell viability was calculated measuring absorbance at 570 nm and 630 nm as described in the manufacturer protocol and normalized with control. Experiments were repeated independently three times. RT-qPCR RNA was extracted using the RNeasy Mini Kit (Quiagen) following the manufacturer’s instructions from cells 48 h after transfection with siRNA or infection with the indicated shRNA (Supplementary Tables S1 and S2). Then, RNA was quantified and its quality was checked by resolving 10% of the sample in a 1% agarose gel. Retrotranscription was carried out using QuantiTect Reverse Transcription Kit (Quiagen) according to the manufacturer’s protocol. RT-qPCR reactions were performed mixing 10 µl of SYBR Green (BIO-RAD) with 100 ng cDNA and 10 µl of primer mix (Supplementary Table S3). RT-qPCR experiments were carried out using triplicate technical replicas in an ABI 7500FAST. The efficiency of each primer pair reaction was previously calculated using genomic DNA. The Ct of each sample was normalized to β-Actin and relativized to control. Experiments were repeated four times. Cell cycle analysis by flow cytometry 16 Cells were harvested, washed with PBS and resuspended in ice-cold PBS. EtOH (70%) was added dropwise while vortexing at low speed, and cells were then fixed at 4ºC overnight. Cells were washed with PBS and treated with 250 µg/ml RNase A (Sigma) and 10 µg/ml propidium iodide diluted in PBS (Fluka). Cells were incubated at 37ºC for 20 min and analyzed using a FACSCALIBUR (BD Biosciences). Immunofluorescence microscopy U2OS cells were infected with lentivirus harbouring the indicated shRNA or transfected with the mentioned siRNAs. After 48 h, cells were irradiated (10 Gy) or mock treated, incubated 1 h for foci formation and collected. For RPA foci studies, coverslips were treated for 5 min on ice with pre-extraction buffer (25 mM Tris.HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose and 0.2% Triton X-100). Then, cells were fixed with 4% paraformaldehyde (w/v) in PBS for 15 min. After fixation, cells were washed three times with PBS and blocked for at least 1 h with 5% FBS diluted in PBS. Cells were incubated with the adequate primary antibodies (Supplementary Table S4) diluted in 5% FBS in PBS for 2 h at room temperature, washed thrice with PBS, and then incubated with secondary antibodies (Supplementary Table S5) diluted in 5% FBS in PBS for 1 h at room temperature. Cells were then washed twice with PBS, and coverslips were mounted with Vectashield mounting medium (Vector Laboratories) containing 4,6-diamidino-2-phenylindole (DAPI) and analysed using a LEICA microscope. At least 200 cells were scored per sample. Experiments were repeated independently at least four times. Immuno-FISH For immuno-FISH, U2OS19ptight13 cells were fixed in 4% paraformaldehyde for 15 min, permeabilized in 0.5% triton for 15 min, blocked in 3% BSA in PBS 0.1% tween and incubated with primary and secondary antibodies (Supplementary Tables S4 and S5) for 1 h each. Cells were then post-fixed in 4% formaldehyde for 20 min, and the FISH protocol was carried out as previously described [46]. Immuno-FISH samples were analysed using a confocal microscopy. At least 100 cells were scored per sample. Experiments were repeated independently three times. Immunoblotting Extracts were prepared in Laemmli buffer (4% SDS, 20% glycerol and 125 mM Tris- HCl, pH 6.8), and proteins were resolved by SDS-PAGE and transferred to PVDF membranes (Millipore), followed by immunoblotting. Western blot analysis was carried 17 out using the antibodies listed in supplementary tables S4 and S5. Results were visualized using an Odyssey Infrared Imaging System (Li-Cor). Cycloheximide chase Cells were exposed to fresh medium containing 150 μg/ml of cycloheximide (Sigma- Aldrich) 48 h post transfection or infection to inhibit further protein synthesis. Cells were collected immediately (0h), 4 h or 8 h after the cycloheximide addition and protein samples were prepared as described in the immunoblotting section. Statistical analysis Statistical significance was determined with a paired t-student or ANOVA tests, as indicated in the figure legends, using the PRISM software (Graphpad Software Inc). Statistically significant differences were labelled with one, two or three asterisks if p <0.05, p <0.01 or p <0.001, respectively. ACKNOWLEDGEMENTS This work was funded by a R+D+I grant from the Spanish Ministry of Economy and Competitivity (SAF2013-43255-P) and an ERC Starting Grant (DSBRECA). AL-S is the recipient of a FPI fellowship from the Spanish Ministry of Economy and Competitivity, and RP-C is funded with an FPU fellowship from the Spanish Ministry of Education. CABIMER is supported by the regional government of Andalucia (Junta de Andalucía). REFERENCES [1] A. Ciccia, S.J. Elledge, The DNA damage response: making it safe to play with knives, Molecular cell, 40 (2010) 179-204. [2] S.P. Jackson, J. Bartek, The DNA-damage response in human biology and disease, Nature, 461 (2009) 1071-1078. [3] A.J. Davis, D.J. Chen, DNA double strand break repair via non-homologous endjoining, Transl Cancer Res, 2 (2013) 130-143. [4] A. So, T. Le Guen, B.S. Lopez, J. Guirouilh-Barbat, Genomic rearrangements induced by unscheduled DNA double strand breaks in somatic mammalian cells, FEBS J, 284 (2017) 2324-2344. [5] P. Huertas, DNA resection in eukaryotes: deciding how to fix the break, Nat Struct Mol Biol, 17 (2010) 11-16. 18 [6] M. Jasin, R. Rothstein, Repair of strand breaks by homologous recombination, Cold Spring Harb Perspect Biol, 5 (2013) a012740. [7] L.S. Symington, End resection at double-strand breaks: mechanism and regulation, Cold Spring Harb Perspect Biol, 6 (2014). [8] N. Makharashvili, T.T. Paull, CtIP: A DNA damage response protein at the intersection of DNA metabolism, DNA Repair (Amst), 32 (2015) 75-81. [9] R. Anand, L. Ranjha, E. Cannavo, P. Cejka, Phosphorylated CtIP Functions as a Cofactor of the MRE11-RAD50-NBS1 Endonuclease in DNA End Resection, Molecular cell, 64 (2016) 940-950. [10] A.A. Sartori, C. Lukas, J. Coates, M. Mistrik, S. Fu, J. Bartek, R. Baer, J. Lukas, S.P. Jackson, Human CtIP promotes DNA end resection, Nature, 450 (2007) 509-514. [11] N. Makharashvili, A.T. Tubbs, S.H. Yang, H. Wang, O. Barton, Y. Zhou, R.A. Deshpande, J.H. Lee, M. Lobrich, B.P. Sleckman, X. Wu, T.T. Paull, Catalytic and noncatalytic roles of the CtIP endonuclease in double-strand break end resection, Molecular cell, 54 (2014) 1022-1033. [12] H. Wang, Y. Li, L.N. Truong, L.Z. Shi, P.Y. Hwang, J. He, J. Do, M.J. Cho, H. Li, A. Negrete, J. Shiloach, M.W. Berns, B. Shen, L. Chen, X. Wu, CtIP maintains stability at common fragile sites and inverted repeats by end resection-independent endonuclease activity, Molecular cell, 54 (2014) 1012-1021. [13] X. Yu, L.C. Wu, A.M. Bowcock, A. Aronheim, R. Baer, The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of transcriptional repression, J Biol Chem, 273 (1998) 25388-25392. [14] A. Cruz-Garcia, A. Lopez-Saavedra, P. Huertas, BRCA1 Accelerates CtIP- Mediated DNA-End Resection, Cell reports, (2014). [15] A. Lopez-Saavedra, D. Gomez-Cabello, M.S. Dominguez-Sanchez, F. Mejias- Navarro, M.J. Fernandez-Avila, C. Dinant, M.I. Martinez-Macias, J. Bartek, P. Huertas, A genome-wide screening uncovers the role of CCAR2 as an antagonist of DNA end resection, Nat Commun, 7 (2016) 12364. [16] Z. You, J.M. Bailis, DNA damage and decisions: CtIP coordinates DNA repair and cell cycle checkpoints, Trends Cell Biol, 20 (2010) 402-409. [17] F. Pryde, S. Khalili, K. Robertson, J. Selfridge, A.M. Ritchie, D.W. Melton, D. Jullien, Y. Adachi, 53BP1 exchanges slowly at the sites of DNA damage and appears to require RNA for its association with chromatin, J Cell Sci, 118 (2005) 2043-2055. 19 [18] F. Aymard, B. Bugler, C.K. Schmidt, E. Guillou, P. Caron, S. Briois, J.S. Iacovoni, V. Daburon, K.M. Miller, S.P. Jackson, G. Legube, Transcriptionally active chromatin recruits homologous recombination at DNA double-strand breaks, Nat Struct Mol Biol, 21 (2014) 366-374. [19] K.I. Savage, J.J. Gorski, E.M. Barros, G.W. Irwin, L. Manti, A.J. Powell, A. Pellagatti, N. Lukashchuk, D.J. McCance, W.G. McCluggage, G. Schettino, M. Salto- Tellez, J. Boultwood, D.J. Richard, S.S. McDade, D.P. Harkin, Identification of a BRCA1-mRNA splicing complex required for efficient DNA repair and maintenance of genomic stability, Molecular cell, 54 (2014) 445-459. [20] C. Cretu, J. Schmitzova, A. Ponce-Salvatierra, O. Dybkov, E.I. De Laurentiis, K. Sharma, C.L. Will, H. Urlaub, R. Luhrmann, V. Pena, Molecular Architecture of SF3b and Structural Consequences of Its Cancer-Related Mutations, Molecular cell, 64 (2016) 307-319. [21] O. Gozani, R. Feld, R. Reed, Evidence that sequence-independent binding of highly conserved U2 snRNP proteins upstream of the branch site is required for assembly of spliceosomal complex A, Genes Dev, 10 (1996) 233-243. [22] B. Adamson, A. Smogorzewska, F.D. Sigoillot, R.W. King, S.J. Elledge, A genome-wide homologous recombination screen identifies the RNA-binding protein RBMX as a component of the DNA-damage response, Nat Cell Biol, 14 (2012) 318- 328. [23] R.D. Paulsen, D.V. Soni, R. Wollman, A.T. Hahn, M.C. Yee, A. Guan, J.A. Hesley, S.C. Miller, E.F. Cromwell, D.E. Solow-Cordero, T. Meyer, K.A. Cimprich, A genome-wide siRNA screen reveals diverse cellular processes and pathways that mediate genome stability, Molecular cell, 35 (2009) 228-239. [24] P. Beli, N. Lukashchuk, S.A. Wagner, B.T. Weinert, J.V. Olsen, L. Baskcomb, M. Mann, S.P. Jackson, C. Choudhary, Proteomic investigations reveal a role for RNA processing factor THRAP3 in the DNA damage response, Molecular cell, 46 (2012) 212-225. [25] S. Matsuoka, B.A. Ballif, A. Smogorzewska, E.R. McDonald, 3rd, K.E. Hurov, J. Luo, C.E. Bakalarski, Z. Zhao, N. Solimini, Y. Lerenthal, Y. Shiloh, S.P. Gygi, S.J. Elledge, ATM and ATR substrate analysis reveals extensive protein networks responsive to DNA damage, Science, 316 (2007) 1160-1166. [26] O.R. Davies, J.V. Forment, M. Sun, R. Belotserkovskaya, J. Coates, Y. Galanty, M. Demir, C.R. Morton, N.J. Rzechorzek, S.P. Jackson, L. Pellegrini, CtIP tetramer 20 assembly is required for DNA-end resection and repair, Nat Struct Mol Biol, 22 (2015) 150-157. [27] S.E. Polo, A.N. Blackford, J.R. Chapman, L. Baskcomb, S. Gravel, A. Rusch, A. Thomas, R. Blundred, P. Smith, J. Kzhyshkowska, T. Dobner, A.M. Taylor, A.S. Turnell, G.S. Stewart, R.J. Grand, S.P. Jackson, Regulation of DNA-end resection by hnRNPU-like proteins promotes DNA double-strand break signaling and repair, Molecular cell, 45 (2012) 505-516. [28] T.L. Clarke, M.P. Sanchez-Bailon, K. Chiang, J.J. Reynolds, J. Herrero-Ruiz, T.M. Bandeiras, P.M. Matias, S.L. Maslen, J.M. Skehel, G.S. Stewart, C.C. Davies, PRMT5- Dependent Methylation of the TIP60 Coactivator RUVBL1 Is a Key Regulator of Homologous Recombination, Molecular cell, 65 (2017) 900-916 e907. [29] F. Liu, W.H. Lee, CtIP activates its own and cyclin D1 promoters via the E2F/RB pathway during G1/S progression, Molecular and cellular biology, 26 (2006) 3124- 3134. [30] C.L. Bladen, D. Udayakumar, Y. Takeda, W.S. Dynan, Identification of the polypyrimidine tract binding protein-associated splicing factor.p54(nrb) complex as a candidate DNA double-strand break rejoining factor, J Biol Chem, 280 (2005) 5205- 5210. [31] Y. Morozumi, Y. Takizawa, M. Takaku, H. Kurumizaka, Human PSF binds to RAD51 and modulates its homologous-pairing and strand-exchange activities, Nucleic Acids Res, 37 (2009) 4296-4307. [32] C. Rajesh, D.K. Baker, A.J. Pierce, D.L. Pittman, The splicing-factor related protein SFPQ/PSF interacts with RAD51D and is necessary for homology-directed repair and sister chromatid cohesion, Nucleic Acids Res, 39 (2011) 132-145. [33] C. Rajesh, A.M. Gruver, V. Basrur, D.L. Pittman, The interaction profile of homologous recombination repair proteins RAD51C, RAD51D and XRCC2 as determined by proteomic analysis, Proteomics, 9 (2009) 4071-4086. [34] K.E. Hurov, C. Cotta-Ramusino, S.J. Elledge, A genetic screen identifies the Triple T complex required for DNA damage signaling and ATM and ATR stability, Genes Dev, 24 (2010) 1939-1950. [35] S. Jungmichel, M. Blasius, Rapid and transient protein acetylation changes in response to DNA damage, Cell Cycle, 12 (2013) 1993. 21 [36] M.B. Smolka, C.P. Albuquerque, S.H. Chen, H. Zhou, Proteome-wide identification of in vivo targets of DNA damage checkpoint kinases, Proc Natl Acad Sci U S A, 104 (2007) 10364-10369. [37] J. Boucas, A. Riabinska, M. Jokic, G.S. Herter-Sprie, S. Chen, K. Hopker, H.C. Reinhardt, Posttranscriptional regulation of gene expression-adding another layer of complexity to the DNA damage response, Front Genet, 3 (2012) 159. [38] C. Naro, P. Bielli, V. Pagliarini, C. Sette, The interplay between DNA damage response and RNA processing: the unexpected role of splicing factors as gatekeepers of genome stability, Front Genet, 6 (2015) 142. [39] M.V. Bennetzen, D.H. Larsen, J. Bunkenborg, J. Bartek, J. Lukas, J.S. Andersen, Site-specific phosphorylation dynamics of the nuclear proteome during the DNA damage response, Mol Cell Proteomics, 9 (2010) 1314-1323. [40] A.E. Elia, A.P. Boardman, D.C. Wang, E.L. Huttlin, R.A. Everley, N. Dephoure, C. Zhou, I. Koren, S.P. Gygi, S.J. Elledge, Quantitative Proteomic Atlas of Ubiquitination and Acetylation in the DNA Damage Response, Molecular cell, 59 (2015) 867-881. [41] G.S. Stewart, B. Wang, C.R. Bignell, A.M. Taylor, S.J. Elledge, MDC1 is a mediator of the mammalian DNA damage checkpoint, Nature, 421 (2003) 961-966. [42] H.C. Reinhardt, I.G. Cannell, S. Morandell, M.B. Yaffe, Is post-transcriptional stabilization, splicing and translation of selective mRNAs a key to the DNA damage response?, Cell Cycle, 10 (2011) 23-27. [43] J. Barbier, M. Dutertre, D. Bittencourt, G. Sanchez, L. Gratadou, P. de la Grange, D. Auboeuf, Regulation of H-ras splice variant expression by cross talk between the p53 and nonsense-mediated mRNA decay pathways, Molecular and cellular biology, 27 (2007) 7315-7333. [44] J.Y. Ip, D. Schmidt, Q. Pan, A.K. Ramani, A.G. Fraser, D.T. Odom, B.J. Blencowe, Global impact of RNA polymerase II elongation inhibition on alternative splicing regulation, Genome Res, 21 (2011) 390-401. [45] K. Matsushita, T. Kajiwara, M. Tamura, M. Satoh, N. Tanaka, T. Tomonaga, H. Matsubara, H. Shimada, R. Yoshimoto, A. Ito, S. Kubo, T. Natsume, D. Levens, M. Yoshida, F. Nomura, SAP155-mediated splicing of FUSE-binding protein-interacting repressor serves as a molecular switch for c-myc gene expression, Mol Cancer Res, 10 (2012) 787-799. 22 [46] C. Lemaitre, A. Grabarz, K. Tsouroula, L. Andronov, A. Furst, T. Pankotai, V. Heyer, M. Rogier, K.M. Attwood, P. Kessler, G. Dellaire, B. Klaholz, B. Reina-San- Martin, E. Soutoglou, Nuclear position dictates DNA repair pathway choice, Genes Dev, 28 (2014) 2450-2463. [47] R.W. Anantha, A.L. Alcivar, J. Ma, H. Cai, S. Simhadri, J. Ule, J. Konig, B. Xia, Requirement of heterogeneous nuclear ribonucleoprotein C for BRCA gene expression and homologous recombination, PloS one, 8 (2013) e61368. [48] M. Brand, J.G. Moggs, M. Oulad-Abdelghani, F. Lejeune, F.J. Dilworth, J. Stevenin, G. Almouzni, L. Tora, UV-damaged DNA-binding protein in the TFTC complex links DNA damage recognition to nucleosome acetylation, EMBO J, 20 (2001) 3187-3196. [49] D. Gomez-Cabello, S. Jimeno, M.J. Fernandez-Avila, P. Huertas, New tools to study DNA double-strand break repair pathway choice, PloS one, 8 (2013) e77206. [50] A.J. Pierce, R.D. Johnson, L.H. Thompson, M. Jasin, XRCC3 promotes homologydirected repair of DNA damage in mammalian cells, Genes Dev, 13 (1999) 2633-2638. [51] N. Bennardo, A. Cheng, N. Huang, J.M. Stark, Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair, PLoS genetics, 4 (2008) e1000110. [52] P. Huertas, S.P. Jackson, Human CtIP mediates cell cycle control of DNA end resection and double strand break repair, J Biol Chem, 284 (2009) 9558-9565. TABLES Table 1: Mass spectrometry data of CtIP complexes Protein Aliases Gene Molecular Weight Unique peptides CtIP RBBP8, RIM, SCKL2, JWDS RBBP8 101.942 37 SF3B1 SAP155, MDS, Hsh155, PRPF10, PRP10 SF3B1 145.830 34 RBM10 DXS8237E, KIAA0122, GPATCH9, GPATC9, TARPS, ZRANB5 RBM10 103.533 31 SF3B3 SF3b130, SAP130, STAF130, KIAA0017, RSE1 SF3B3 135.577 27 SF3B2 SF3B145, SAP145, Cus1 SF3B2 100.228 26 PRMT5 HRMT15L, SKB1Hs, INP72, JBP1 PRMT5 72.684 25 DHX15 DDX15, DBP1, HRH2, PRPF43, PRP43 DHX15 90.933 24 SFPQ PSF, PPP1R140, POMP100 SFPQ 76.149 23 DHX9 DDX9, NDHII, NDH2, LKP, RHA DHX9 140.958 22 23 CCAR2 KIAA1967, DBC1, P30DBC, NET35 CCAR2 102.902 18 KIF11 KNSL1, TRIP5, MCLMR, EG5, HKSP KIF11 119.159 15 hnRNPU SAF-A, P120 HNRNPU 90.584 14 In bold, previously described CtIP interactors FIGURES LEGENDS Figure 1. Discovery of the SF3B complex as a physical and functional interactor of CtIP A, Protein samples from cells harbouring GFP-3XFLAG-CtIP or control cells were subjected to two-step affinity purification. First, complexes were isolated with anti- FLAG beads and eluted using 3XFLAG peptide. Then, a second purification was performed with anti-GFP resin. A western blot displaying the endogenous (white triangle) and GFP-3XFLAG-CtIP (solid triangle) bands at each step of purification is shown. B, DNA resection proficiency, measured as the percentage of RPA foci-positive cells upon 10 Gy of ionizing radiation, in cells downregulated for the indicated genes. The average and standard deviation of at least three independent experiments is shown. A Student t-test comparing with control shNT (Non-Target shRNA) was performed and one, two or three asterisk(s) denotes statistical significance at p<0.05, p<0.01 or p<0.001, respectively. C, Cells bearing a GFP-CtIP fusion or GFP as a control were used for immunoprecipitation using a GFP-trap. Immunoprecipitated samples (IP) and protein inputs (Input) were resolved in SDS-PAGE and blotted with antibodies against the indicated proteins. D, Protein samples from U2OS cells harbouring GFP-CtIP were used for immunoprecipitation with an antibody against SF3B1 (B1) or a control IgG (C), resolved in SDS-PAGE and blotted with the indicated antibodies. E, Same as D, but in cells bearing GFP or GFP-CtIP constructs and with an antibody against SF3B2 (IP-SF3B2). F, Same as D, but during immunoprecipitation, RNase A was added or not as designated in the figure. G, Proximity Ligation Assay between CtIP and SF3B2. PLA signal was scored using antibodies against CtIP and the SF3B2 subunit in unperturbed cells (undamaged) or cells exposed to 10 Gy of ionizing radiation and left to recover for 1 h (IR). To establish the specificity of the signal, the experiment was repeated with depletion of either CtIP or SF3B2. shNT denotes an shRNA with no target in the human genome. The quantification (right) and depictive images (left) of one representative experiment, out of four with similar results, is shown. Median PLA foci is represented 24 with a red line. H, PLA experiment using SF3B2 and CtIP antibodies in irradiated cells (10 Gy) harbouring a GFP-MDC1 construct to visualize DNA breaks. Figure 2. Depletion of SF3B subunits hampers DNA end resection A, Cells transfected with siRNA against SF3B1 (siSF3B1) or a control sequence (siNT) were exposed to 10 Gy of ionizing radiation (IR). An hour later, cells were collected and RPA was detected by immunofluorescence. Images of a representative experiment and a plot of the average and standard deviation of three independent experiments are shown. Other details as in figure 1B. B, Same as A, but cells transfected with a siRNA against SF3B2 (siSF3B2) or control (siNT) bearing a siRNA-resistant FLAG-SF3B2, FLAG-SF3B2-S289A or FLAG plasmid, as indicated. Statistical significance was measured with an ANOVA test. C, Classical recombination assay using the DR-GFP reporter in cells depleted for SF3B1. A scheme of the reporter is shown on the left. Induction of a DSB using I-SceI meganuclease will render GFP positive cells when gene conversion occurs using the donor repeat (iGFP). Such event could happen intramolecularly (as shown) or with a donor sequence located in the sister chromatid (not shown). The efficiency of classical recombination was calculated as the percentage of GFP positive cells in response to I-SceI expression upon downregulation of the indicated genes, normalized with the control. Statistical significance was tested using a t-Student test as described in methods. D, Same as C, but in cells stably expressing FLAG, siRNA-resistant FLAG-SF3B2 or FLAG-SF3B2-S289A and transfected with a siRNA against SF3B2 or a control sequence. Statistical significance was determined with a 2-way ANOVA test. E, Same as C, but using the NHEJ reporter EJ5-GFP. In this case, two I-SceI-induced DSBs could be repaired by conservative (left) or mutagenic (right) NHEJ granting the accumulation of functional GFP. F, Same as D but in cells bearing the NHEJ reporter EJ5-GFP. Figure 3. The SF3B complex controls CtIP expression A, The amount of CtIP mRNA was calculated by RT-qPCR in cells stably expressing a tagged version of siRNA-resistant wild type SF3B2 (FLAG-SF3B2), SF3B2 mutant (FLAG-SF3B2-S289A) or the empty vector (FLAG) and transfected with a siRNA against SF3B2 (siSF3B2) or a control sequence (siNT). The bars represent the average and standard deviation of three independent experiments. Statistical analysis as in figure 1B. C, Protein abundance and stability were determined treating the cells with FLAG-SF3B2 - Dox + Dox Prados-Carvajal et al Figure 5 A CtIPFISHDAPI - Dox + Dox FLAG B 0 20 40 60 80 Cells with CtIP foci at the array (%) FLAG FLAG-SF3B2 FLAG-SF3B2-S289A *** *** *** *** *** siSF3B2 -Dox +Dox FLAG-SF3B2-S289A - Dox + Dox Prados-Carvajal et al Figure 6 A shNT shSF3B2 shCtIP shNT shSF3B2 shCtIP 0 20 40 60 80 * *** * * *** GFP % RPA foci-positive cells GFP-CtIP 0 20 40 60 80 * ** ** % RPA foci-positive cells shNT shSF3B2 shNT shSF3B2 shCtIP shNT RPADAPI shSF3B2shNT shNT shNT shCtIP shSF3B2 BRPA DAPI shCtIP shSF3B2 shNT GFP GFP-CtIP RPA DAPI C HR efficiency normalized to contol siNT siSF3B2 siCtIP 0.0 0.5 1.0 1.5 FLAG FLAG-CtIP ** ** ** *** ** D siNT siSF3B2 0 50 100 150 Survival (%) GFP GFP-CtIP ** * * 1 Supplementary Figure legends: Supplementary Figure S1. Downregulation efficiency of targeted genes A, U2OS cells were transduced with the indicated shRNAs and cultured for 48 h. Then, proteins were extracted using Laemmli buffer, resolved in SDS-PAGE and transferred to PVDF membranes. Representative blots upon incubation with antibodies against the specified proteins are shown. shNT denotes a non-target shRNA control. B, PLA signal using SF3B2 and CtIP antibody as indicated in figure 1G, but in cells pretreated for 1 hour before irradiation with ATM inhibitor (ATMi) or DMSO. C, same as A but in cells depleted for SF3B1 using siRNA. D, Protein samples from cells bearing the siRNA resistant wild type FLAG-SF3B2, the FLAG-SF3B2-S289A mutant or FLAG empty vector and transfected with siRNA against the endogenous form SF3B2 (siSF3B2) or a non-targeted control (siNT) were prepared, resolved by SDS-PAGE and blotted for the indicated antibodies Supplementary Figure S2. Cell cycle effect of SF3B1 and SF3B2 depletion A, Cell cycle distribution upon transfection with the indicated siRNAs. The average and standard deviation of three independent experiment are plotted. B, Same as A but cells stably expressing FLAG, siRNA-resistant wild type FLAG-SF3B2 or FLAG-SF3B2- S289A mutant and transfected with the indicated siRNAs. Supplementary Figure S3. S289 phosphorylation does not affect CtIP-SF3B2 interaction PLA was performed as described in Figure 1G in cells downregulated for endogenous SF3B2 and bearing a siRNA-resistant version of wildtype SF3B2, an S289A mutant or the empty FLAG vector as a control. Statistical differences were calculated using an ANOVA test. Supplementary Figure S4. FLAG-CtIP overexpression Cells expressing FLAG-CtIP or the empty FLAG vector, as indicated, were transfected with siRNAs against CtIP, SF3B2 or a control sequence. Then, protein samples were obtained as described in methods, resolved in SDS-PAGE and blotted with the indicated antibodies. Supplementary tables 2 Supplementary Table S1: shRNAs used in this study. Target gene TCR Number ID Sequence (5’-3’) Non Target SHC016V 01031212MN - CCGGCAACAAGATGAAGA GCACCAACTC GAGTTGGTGCTCTTCATCT TGTTGTTTTT CtIP TRCN0000318738 NM_002894. 2-3041s21c1 CCGGCAGAAGGATGAAGG ACAGTTTCTC GAGAAACTGTCCTTCATC CTTCTGTTTTTG SF3B2 TRCN0000314606 NM_006842. 2-1133s21c1 CCGGGCTGATGTTGAGAT TGAGTATCTCG AGATACTCAATCTCAACA TCAGCTTTTTG SF3B3 TRCN0000000069 NM_012426. x-3898s1c1 CCGGAGGAGGGTGACTGG ATAATTACTC GAGTAATTATCCAGTCAC CCTCCTTTTTTG RBM10 TRCN0000233276 NM_005676. 3-491s21c1 CCGGGACATGGACTACCG TTCATATCTCGAGATATG AACGGTAGTCCATGTCTTT TTG 3 SFPQ TRCN0000001084 NM_005066. x-1855s1c1 CCGGGCGCCAAAGAGAGG AAAGTTACTCGAGTAACT TTCCTCTCTTTGGCGCTTT TT DHX9 TRCN0000001210 NM_001357. x-515s1c1 CCGGGAAGGATTACTACT CAAGAAACTCGAGTTTCT TGAGTAGTAATCCTTCTTT TT DHX15 TRCN0000000006 NM_001358. x-2632s1c1 CCGGGTTGGTTCGATAAT GGCCTTTCTCGAGAAAGG CCATTATCGAACCAACTTT TT KIF11 TRCN0000116497 NM_004523. 2-3927s1c1 CCGGGCTTGAGCTTAACA TAGGTAACTCGAGTTACC TATGTTAAGCTCAAGCTTT TTG PRMT5 TRCN0000107086 NM_006109. 2-1577s1c1 CCGGGCCCAGTTTGAGAT GCCTTATCTCGAGATAAG GCATCTCAAACTGGGCTT TTTG Supplementary Table S2: siRNAs used in this study. Target Reference Supplier Sequence (5’-3’) 4 gene Non Target D-001810-10-20 Dharmacon UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA and UGGUUUACAUGUUUUCCUA (mix) CtIP Huertas and Jackson 2009 Sigma GCUAAAACAGGAACGAAUC SF3B1 D-020061-07- 0005 Dharmacon CGAGUUUGCUUGGUCAGAA SF3B2 HSC.RNAI.N00 6843.12.6 IDT GGACUUGUCAUUUCAUGUUCUUATT Supplementary Table S3: Primers used in this study. Primers Application Sequence (5’-3’) Fw ActB qPCR ACGAGGCCCAGAGCAAGA Rv ActB qPCR GACGATGCCGTGCTCGAT Fw CtIP qPCR AGAAATTGGCTTCCTGCTCAAG Rv CtIP qPCR GAAAACCAACTTCCCAAAAATTCTC SF3B2 UP SF3B2 cloning AAGCTCAAGCTTATGGATGACCC SF3B2 LOW SF3B2 cloning TTCGCGGCCGCCTAAACTTGAAC Fw G418 SF3B2 cloning GTCAGTGATATCCCCTGATAAATGCTTCAA Rv G418 SF3B2 cloning GTCCAGTGATATCCGAAATCTCGTGATGG Supplementary Table S4: Primary Antibodies used in this study. 5 IF, immunofluorescence. IF-FISH, Immuno-FISH. WB, Western blotting. PLA, Proximity ligation assay. IP, Immunoprecipitation. Target protein Application Supplier Reference -Tubulin WB Sigma T9026 -Actin WB Abcam ab8227 γ-H2AX IF, IF-FISH Cell Signaling 2577L γ-H2AX IF Millipore 05-636 BRCA1 WB Santa Cruz sc-6954 CtIP WB, PLA, IF-FISH R. Baer 14.1 DHX9 WB Bethyl Laboratories A300-855A-1 DHX15 WB Bethyl Laboratories A300-118A-1 FLAG WB, IF-FISH Sigma F3165-0.2MG GFP WB Santa Cruz Sc-8334 GFP IF Roche 11 814 460 001 KIF11 WB Novus NB100-78467 PRMT5 WB Abcam ab31751 RBM10 WB Bethyl Laboratories A301-006A RPA32 WB, IF Abcam ab2175 SF3B1 WB, IP MBL D221-3 SF3B2 WB, PLA, IP Proteintech 10919-1-AP SF3B3 WB Abcam ab3608 SFPQ WB Abcam ab38148 Supplementary Table S5: Secondary antibodies used in this study. IF, immunofluorescence. IF-FISH, Immuno-FISH. WB, Western blotting. Antibody Application Supplier Reference 6 Alexa Fluor 594 goat anti-mouse IF Invitrogen A11032 Alexa Fluor 488 goat anti-rabbit IF Invitrogen A11034 Alexa Fluor 568 goat anti-rabbit IF-FISH Invitrogen A11011 Alexa Fluor 647 goat anti-mouse IF-FISH Invitrogen A21235 Alexa Fluor 568 donkey anti-mouse IF-FISH Molecular probes A10037 Fluorescein anti-Biotin IF-FISH Vector SP-3040 IRDye 800 CW Donkey anti-goat IgG (H+L) WB Li-Cor 926-32214 IRDye 680RD goat anti-mouse IgG (H+L) WB Li-Cor 926-68070 IRDye 800CW goat anti-rabbit IgG (H+L) WB Li-Cor 926-32211 Prados-Carvajal et al Supplementary Figure S1 A shNT shRBM10 RBM10 α-Tubulin shNT shSFPQ SFPQ shNT shDHX9 DHX9 shNT shDHX15 DHX15 shNT shKIF11 KIF11 shNT shPRMT5 PRMT5 α-Tubulinα-Tubulin α-Tubulin α-Tubulin α-Tubulin shNT shSF3B3 SF3B3 α-Tubulin shNT shCtIP CtIP α-Tubulin FLAG-SF3B2 Endogenous SF3B2 α-Tubulin C D SF3B1 β-Actin siNT siSF3B1 siCtIP siNT siSF3B2 FLAG FLAG-SF3B2 FLAG-SF3B2-S289A FLAG FLAG-SF3B2 FLAG-SF3B2-S289A B 0 50 100 150 200 PLA signal relative to control No damage IR *** ** ** *** * DMSO ATMi Prados-Carvajal et al Supplementary Figure S2 AB siNT siSF3B1 0 50 100G1 S G2/M % Cells siNT siSF3B2 siNT siSF3B2 siNT siSF3B2 0 50 100G1 S G2 FLAG % Cells FLAG-SF3B2 FLAG-SF3B2- S289A