Leucine aminopep idase o he human blood lukes, Schis osoma mansoni
and Schis osoma japonicum
q
Elaine McCa hy
a,b
, Colin S ack
a,b
, Sheila M. Donnelly
a
, Sean Doyle
b
, Vic o ia H. Mann
c
, Paul
J. B indley
c
, Michael S ewa
d
, Tim A. Day
e
, Aa on G. Maule
d
, John P. Dal on
a, ,
*
a
Molecula Pa asi ology Uni , School o Bio echnology, Dublin Ci y Uni e si y, Dublin 9, I eland
b
Depa men o Biology, Na ional Ins i u e o Cellula Bio echnology, Na ional Uni e si y o I eland, Maynoo h, Co. Kilda e, I eland
c
Depa men o T opical Medicine, Tulane Uni e si y Heal h Sciences Cen e , New O leans, LA 70112, USA
d
School o Biology and Biochemis y, Medical Biology Cen e , The Queen’s Uni e si y o Bel as , 97 Lisbu n Road,Bel as BT9 7BL, UK
e
Depa men o Biomedical Sciences, Iowa S a e Uni e si y,Ames, IA 50011, USA
Ins i u e o he Bio echnology o In ec ious Diseases (IBID), Uni e si y o Technology Sydney, Wes bou ne S ee , Go e Hill, Sydney, Aus alia
Recei ed 24 Oc obe 2003; ecei ed in e ised o m 28 Janua y 2004; accep ed 29 Janua y 2004
Abs ac
An a ay o schis osome endop o eases in ol ed in he diges ion o hos hemoglobin o abso bable pep ides has been desc ibed, bu he
exop o ease esponsible o ca abolising hese pep ides o amino acids has ye o be iden i ied. By sea ching he public da abases we ound
ha Schis osoma mansoni and Schis osoma japonicum exp ess a gene encoding a membe o he M17 amily o leucine aminopep idases
(LAPs). A unc ional ecombinan S. mansoni LAP p oduced in insec cells sha ed biochemical p ope ies, including pH op imum o
ac i i y, subs a e speci ici y and eliance on me al ca ions o ac i i y, wi h he majo aminopep idase ac i i y in soluble ex ac s o adul
wo ms. The pH ange in which he enzyme unc ions and he lack o a signal pep ide indica e ha he enzyme unc ions in acellula ly.
Immunolocalisa ion s udies showed ha he S. mansoni LAP is syn hesised in he gas ode mal cells su ounding he gu lumen. Acco dingly,
we p opose ha pep ides gene a ed in he lumen o he schis osome gu a e abso bed in o he gas ode mal cells and a e clea ed by LAP o
ee amino acids be o e being dis ibu ed o he in e nal issues o he pa asi e. Since LAP was also localised o he su ace egumen i may
play an addi ional ole in su ace memb ane e-modelling.
q2004 Aus alian Socie y o Pa asi ology Inc. Published by Else ie L d. All igh s ese ed.
Keywo ds: Aminopep idase; P o eases; Haemoglobin diges ion; Pa asi es; Helmin hs; T ema odes; Schis osomes
1. In oduc ion
Schis osomiasis is a ch onic pa asi ic disease widesp ead
in opical and sub- opical egions such as A ica, he
Middle Eas , Sou h Ame ica and Sou h Eas Asia. In 1999,
he Wo ld Heal h O ganisa ion es ima ed ha 652 million
people we e a isk, wi h 193 million ac ually in ec ed and
abou 20 million clinically ill om schis osomiasis (WHO,
1999). The disease is caused by blood lukes o he genus
Schis osoma, o which i e species, Schis osoma mansoni,
Schis osoma japonicum,Schis osoma haema obium,Schis-
osoma in e cala um and Schis osoma mekongi, a e o
medical impo ance o humans (Engels e al., 2002; Ross
e al., 2002). Ou labo a o ies ha e been pa icula ly
in e es ed in p o eases ha pa icipa e in p o eolysis o
hos hemoglobin, an essen ial sou ce o nu ien o he
schis osome pa asi e. Ma u ing and adul schis osomes li e
in he blood essels o hei human hos s whe e hey eed on
ed blood cells. The inges ed ed blood cells a e lysed by
hemolysins wi hin he oesophagus o he pa asi es and
hemoglobin ha is eleased lows in o caeca o he
schis osome (Dal on e al., 2004). Se e al p o eoly ic
enzymes pa icipa e in he p og essi e ca abolism o
hemoglobin o amino acids ha a e subsequen ly u ilised
in pa asi e me abolic p ocesses. A model o his ca abolic
p ocess p oposes ha he ini ial clea ages o hemoglobin
0020-7519/$30.00 q2004 Aus alian Socie y o Pa asi ology Inc. Published by Else ie L d. All igh s ese ed.
doi:10.1016/j.ijpa a.2004.01.008
In e na ional Jou nal o Pa asi ology 34 (2004) 703–714
www.pa asi ology-online.com
q
The Genbank accession numbe o he Schis oma Mansoni exp ession
cons uc desc ibed in his manusc ip is AY523600.
*Co esponding au ho . Add ess: Ins i u e o he Bio echnology o
In ec ious Diseases (IBID), Uni e si y o Technology Sydney, Wes bou ne
S ee , Go e Hill, Sydney, Aus alia. Tel.: þ61-2-9514-4142; ax: þ61-2-
9514-4201.
E-mail add ess: [email p o ec ed].au (J.P. Dal on).
a e pe o med by endopep idases, including ca hepsins B, L
and D, libe a ing sho pep ides ha a e subsequen ly
hyd olysed by exopep idases in o abso bable dipep ides and
amino acids (B indley e al., 1997; To e al., 1999; Sajid
and McKe ow, 2002). Whe eas we and o he s ha e
cha ac e ised he exopep idase dipep idyl pep idase I,
(¼ca hepsin C), which is sec e ed om he pa asi e
gas ode mis in o he gu and mos likely is he enzyme
ha clea es dipep ides om agmen s o hos hemoglobin
(Hola-Jam iska e al., 1998, 1999, 2000), li le is known o
he pu a i e aminopep idase ha is c ucial o he inal s age
o libe a ing ee amino acids.
Aminopep idase ac i i y has been demons a ed in
soluble ex ac s o a ious s ages o he S. mansoni li e
cycle (Au iaul e al., 1982; Damonne ille e al., 1982; Xu
and D esden, 1986; Xu e al., 1988, 1990). Since he enzyme
displayed enhanced ac i i y agains syn he ic subs a es
con aining an N- e minal leucine i has been e med leucine
aminopep idase (LAP) (Au iaul e al., 1982). The LAP
ac i i y de ec ed in schis osomula and adul ex ac s was
shown o be immunogenic du ing in ec ions since he
enzyme was eac i e wi h an ibodies in he se um o
in ec ed a s and humans (Au iaul e al., 1982; Damonne-
ille e al., 1982; Doenho e al., 1988). LAP ac i i y is also
exp essed by schis osome eggs and has been implica ed in
he eme gence o he schis osome mi acidium since
ha ching can be blocked by bes a in, a gene al inhibi o o
aminopep idases (Xu and D esden, 1986; Xu e al., 1988,
1990).
In his s udy, we isola ed a cDNA encoding an S. mansoni
aminopep idase ha is a membe o he me allop o ease
M17 amily o LAPs (S a e and Lipscomb, 1998). Ou
cha ac e isa ion o he ecombinan and na i e LAP shows
ha i is p edominan ly exp essed in he gas ode mis o he
adul wo ms, and indica es ha we ha e iden i ied he
schis osome enzyme esponsible o he inal s age in
he ca abolism o hos hemoglobin. We discuss hese
indings in he con ex o ou model o hemoglobin
p o eolysis in hese blood- eeding pa asi es, and o p e ious
epo s o aminopep idase ac i i y in schis osomes.
2. Ma e ials and me hods
2.1. Pa asi e ex ac s, p o ein p epa a ions and in ec ion
se a
Soluble ex ac s o S. mansoni ce ca iae and adul wo ms
and S. japonicum adul wo ms we e p epa ed in phospha e
bu e ed saline (PBS, pH 7.3) a e h ee eeze haw cycles
and sonica ion cycles on ice as desc ibed p e iously (Dal on
e al., 1996). Insec cell-exp essed S. mansoni aspa aginyl
endopep idase (Sm32) (B indley e al., 1997; To e al.,
1999) was pu i ied in ou labo a o y (S ack, Dal on and
Doyle, unpublished). Pig kidney LAP was ob ained om
Sigma Chemical Co (Do se , Poole).
2.2. Fluo ogenic subs a e assay and luo og aphic gel
analysis o he de ec ion o aminopep idase ac i i y
Aminopep idase ac i i y o S. mansoni o S. japonicum
soluble ex ac s, po cine kidney LAP o ecombinan
S. mansoni LAP was measu ed using he luo ogenic pep i-
dyl subs a es L-leucine (Leu)-7-amido-4-me hylcouma in
hyd oxide (NHMec), L-alanyl (alanine)-NHMec, L- y osyl
( y osine)-NHMec and L-p olyl (p oline)-NHMec (Sigma).
The assays we e ca ied ou by incuba ing samples in a
eac ion mix o 10 mM luo ogenic pep idyl subs a e,
0.5 mM MgCl
2
and 0.1 M T is–HCl (pH 8.5) in a inal
olume o 1 ml a 37 8C o 30 min as desc ibed be o e
(Ga igan e al., 2001). A s anda d cu e was p epa ed using
0–10 mM NHMec and enzyme uni s p esen ed nmol
NHMec eleased/min/ml.
Fo he ac i a ion/inhibi ion s udies, he enzyme was
incuba ed wi h he di alen ca ions MgCl
2
, MnCl
2
and
ZnCl
2
, he me al chela ing eagen s 1,10-phenan h oline,
and N,N-e hylenediamine e aace ic acid (EDTA) o he
speci ic aminopep idase inhibi o bes a in a 37 8C o
10 min p io o addi ion o he luo ogenic pep idyl subs a e
o he assay mix and incuba ion o 30 min. The pH p o ile
was de e mined by incuba ing enzyme in 0.1 M T is–HCl
bu e s anging om pH 6.75 o 9.4.
To cha ac e ise aminopep idase ac i i y in gels soluble
ex ac s o adul S. mansoni and S. japonicum, ecombinan
S. mansoni LAP and pig kidney LAP we e sepa a ed on 10%
na i e polyac ylamide gels, which we e hen washed in
0.1 M T is–HCl (pH 8.5) con aining 0.5 mM MgCl
2
and
incuba ed o 10 min in he same bu e con aining 50 mM
L-leucine-NHMec as desc ibed (Cu ley e al., 1994; Acos a
e al., 1998). Fluo escen bands ep esen ing enzymes wi h
LAP ac i i y we e isualised unde UV ligh and
pho og aphed.
2.3. Iden i ica ion and analysis o he cDNA encoding
schis osome leucine aminopep idase
A cDNA encoding an S. mansoni aminopep idase
(GenBank U83906) was disco e ed by sea ching he public
da abases wi h he pep ide sequence NTDAEGRL ha
ep esen s he conse ed ac i e si e egion o aminopep i-
dases (Kim and Lipscomb, 1993; S a e and Lipscomb,
1998). Analysis o he S. mansoni aminopep idase sequence
was pe o med using sequence e ie al sys em (SRS), Blas
ools, and MEROPS a h p://me ops.sange .ac.uk. The Bos
au us LAP (bo ine lens LAP, BlLAP) sequence and
s uc u al da a we e employed o loca e ca aly ic domains
and c i ical ac i e si e esidues (Kim and Lipscomb, 1993;
Taylo , 1993). The phylogene ic ela ionship be ween
selec ed LAPs o he M17 amily o aminopep idases was
examined using selec ed C- e minal domains only.
Sequence simila i ies wi hin he ca aly ic domains we e
de e mined using he BLAST algo i hm and he selec ed
sequences we e hen aligned using he Clus alX 1.81
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714704
p og am (Thompson e al., 1997). The PHYLIP ee was
calcula ed using he boo s apping me hod, wi h he numbe
o boo s apping ials se a 1000 as ecommended. The
p og am also co ec ed o mul iple subs i u ions.
2.4. Cons uc ion o cDNA exp ession ec o
P ime s we e designed o ampli y he ull-leng h cDNA
encoding S. mansoni LAP using he DNA sequence
in o ma ion deposi ed in GenBank (accession no. U83906)
as ollows: Fo wa d (50-GCGGCCTCGAGATGAGC
GTTGTCACTCCCGTGTTCCCG-30)andRe e se(5
0-
GCCGCTCTAGATTAGTGGTGGTGGTGGTGGTGGG
GCCCCTTGAAACTTAATCG-30). The o wa d and
e e se p ime s inco po a ed he es ic ion si es Xho I and
Xba I (unde lined), espec i ely. The o wa d p ime
inco po a ed a s a codon (bold) which was no p esen in
he published sequence (see Sec ion 3) and he e e se
p ime con ained a sequence encoding a His
6
ag (double
unde lined) and a s op codon (also bold). Ampli ica ion o
he LAP cDNA om an S. mansoni cDNA lib a y was
pe o med unde he ollowing condi ions: ini ial dena u a-
ion (94 8C, 5 min), ollowed by 30 cycles o dena u a ion
(94 8C, 1.5 min), annealing (55 8C, 1.5 min) and p ime
ex ension (72 8C, 1.5 min), ollowed by a inal ex ension
s ep (72 8C, 7 min). PCR p oduc s we e cloned in o pGem-T
ec o (P omega, USA), and he LAP gene subsequen ly
excised om he plasmid using es ic ion endonucleases
Xho I and Xba I and cloned in o he baculo i us exp ession
ans e ec o pBlueBac4.5 (In i ogen). The inse o he
pBlueBac4.5 cons uc was sequenced o con i m o ien-
a ion and iden i y o he LAP cDNA.
2.5. P oduc ion and pu i ica ion o ecombinan S. mansoni
LAP in baculo i us exp ession ec o sys em
Spodop e a ugipe da (S
9
) insec cells (In i ogen)
we e ans o med wi h pBlueBac4.5 plasmid cons uc
inco po a ing he S. mansoni LAP cDNA as p e iously
desc ibed (Ennis e al., 2001). Cell suspensions we e lysed
in he p esence o 0.05% ( / ) Tween
w
20 (Sigma)
de e gen in 50 mM NaH
2
PO
4
, 300 mM NaCl, and 10 mM
imidazole (pH 8.0, lysis bu e ), and hen incuba ed on ice
o 30 min. The cell lysa e was cen i uged a 14,000 £g o
30 min and he supe na an s passed o e a 1 ml Ni-NTA
esin column, and he column washed wi h i e olumes o
50 mM NaH
2
PO
4
, 300 mM NaCl, and 20 mM imidazole
(pH 8.0). Bound p o ein was elu ed using 250 mM
imidazole in 50 mM NaH
2
PO
4
and 300 mM NaCl (pH
8.0). The p oduc ion and pu i ica ion o ecombinan
S. mansoni LAP was moni o ed by Coomassie Blue-s ained
SDS-PAGE (Dal on e al., 1996). P o ein concen a ions
we e de e mined using a bicinchoninic p o ein assay ki
(Pie ce, Rock o d, IL) wi h bo ine se um albumin
(0–2 mg ml
21
) as p o ein s anda d.
2.6. P epa a ion o polyclonal an ise um o S. mansoni LAP
(an i-SmLAP)
Polyclonal an ise um o S. mansoni LAP was ob ained by
immunising a abbi ou imes a 3-week in e als, sub-
cu aneously, wi h pu i ied ecombinan p o ein (50 mg)
o mula ed in F eunds Comple e o Incomple e adju an .
Se um was ob ained 10 days a e he inal immunisa ion.
2.7. Immunoblo ing
Soluble S. mansoni and S. japonicum ex ac s (10 mg)
and pu i ied ecombinan LAP (2.0 mg) we e esol ed on
12% educing SDS-PAGE gels and hen ans e ed o
ni ocellulose memb ane. The memb anes we e blocked in
5% (w/ ) milk powde /PBS plus 0.05% ( / ) Tween
w
20
(PBST) o 1 h and hen p obed wi h abbi an i-S. mansoni
LAP se um (1:6000) o p e-immunisa ion se um (con ol)
o 1 h a oom empe a u e. Bound an ibody was isualised
using pe oxidase-conjuga ed goa an i- abbi IgG (1:1000)
and diaminobenzidine/H
2
O
2
(Sigma, Do se , UK) as he
ch omogenic subs a e (B ady e al., 1999a,b).
2.8. Con ocal scanning lase mic oscopy
Adul S. mansoni we e la - ixed in 4% pa a o malde-
hyde (PFA) in PBS (pH 7.2) o 1 h and hen ee- ixed o a
u he 3 h a 4 8C. They we e washed in an ibody diluen
(AbD: PBS wi h 0.1% bo ine se um albumin, 0.3% T i on
X-100 and 0.1% sodium azide) o 24 h be o e being
incuba ed o 72 h a 4 8C in an i-SmLAP se um (dilu ed
1:500) and subsequen ly washed in AbD (24 h, 4 8C).
Specimens we e incuba ed o 48 h in an i- abbi IgG
(1:100) conjuga ed o e ame hyl hodamine iso hiocyana e
(TRITC) o isualisa ion o binding si es. Specimens we e
washed again in AbD, incuba ed o 24 h in phalloidin-
luo escein iso hiocyana e (FITC) (as a coun e s ain ha
binds F-ac in) and, a e a inal wash in AbD, we e moun ed
in PBS/glyce ol (1:9) con aining 2.5% 2,4-diazabicylco
2.2.2 oc ane o con ocal mic oscopic examina ion (Leica
TCS-NT; Leica Mic osys ems, Mil on Keynes, UK).
Immunocy ochemical con ols included omission o p i-
ma y an ise um and eplacemen o he p ima y an ise um
wi h p e-immune se um.
3. Resul s
3.1. Classi ica ion o he schis osome aminopep idase based
on p ima y sequence s uc u e
By sea ching he public da abases wi h he pep ide
sequence NTDAEGRL ha ep esen s he conse ed ac i e
si e egion o aminopep idases (Kim and Lipscomb, 1993;
S a e and Lipscomb, 1998), we loca ed a cDNA ha
encodes an S. mansoni aminopep idase (GenBank U83906).
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 705
Sequence alignmen and phylogene ic analyses using he
amino acid sequence deduced om his cDNA e ealed ha
he enzyme is a membe o he M17 amily o LAPs (S a e
and Lipscomb, 1998). The S. mansoni LAP sequence is
mos closely ela ed o an S. japonicum exp essed sequence
ag (EST) sequence (accession no. AF300423); he wo
p o eins sha e 85% amino acid iden i y sugges ing ha hey
a e o hologous enzymes (i.e. hey pe o m he same
unc ion in hese wo disc e e, schis osome species). The
ecen appea ance in GenBank o .40,000 cDNAs, which
may include he comple e ansc ip ome o he adul s age o
S. japonicum (Hu e al., 2003), enabled us o e-in e oga e
he public da abases wi h accession nos. U83906 and
AF300423. Al hough his analysis loca ed o e 80
addi ional en ies encoding pa ial S. japonicum LAPs (no
shown), each o hese showed comple e iden i y o he
o iginal EST sequence. This in u n suppo ed he no ion
ha a single copy gene encodes he LAP cha ac e ised he e.
The ela ionship be ween he S. mansoni and S.
japonicum LAPs and o he membe s o he M17 amily
was in es iga ed by compa ing he sequence simila i ies in
he conse ed C- e minal domain (see below). The schis o-
some LAPs a e mos simila o an uncha ac e ised insec
LAPs o Aedes gambiae (accession no. XP_311765) and
D osophila melanogas e (accession no. NP_650318).
Rema kably, only one helmin h LAP sequence wi h close
simila i y o he schis osome LAP was de ec ed in he
da abases; his sequence is one o wo LAP genes exp essed
by he nema ode Caeno habdi is elegans (accession no.
Q27245; 41 and 39% amino acid iden i y o he S. mansoni
and S. japonicum LAPs, espec i ely). The mo e di e ged
C. elegans LAP (accession no. P34629; 12 and 11% amino
acid iden i y, espec i ely, does no seem o ha e an
o hologue in he schis osome genome, bu esides in he
clade ha includes LAPs om se e al species o Leishma-
nia. LAP membe s o he M17 amily om he lowe ing
plan s A abidopsis haliana,Lycope sicon esculen um and
Solanum ube osum o m a disc e e and mo e dis an clade
om he schis osome LAPs (Fig. 1).
An alignmen o he p ima y sequence o S. mansoni and
S. japonicum LAPs wi h he A. gambiae,D. melanogas e
and C. elegans sequences is p esen ed in Fig. 2. The amino
acids o he i e sequences we e 22.18% iden ical, 18.11%
s ongly simila and 11.65% weakly simila ( o al o e all
simila i y 52%). LAPs consis o a wo-domain s uc u e, a
less conse ed N- e minal domain and a mo e conse ed C-
e minal domain ha con ains he ca aly ic esidues. As
expec ed, he schis osome and o he sequences show g ea e
conse a ion in his ca aly ic C- e minal domain (Fig. 2).
LAP a e me allo-p o eases and equi e he binding o wo
zinc ions ha a e pen ahed ally coo dina ed wi hin each
ac i e si e. These me al ions ac as nucleophiles and a e
essen ial o enzyma ic ac i i y. Acco dingly, he esidues
ha bind hese zinc ions a e highly conse ed be ween all
membe s o he M17 amily o LAP enzymes including he
schis osome LAPs. Residues Asp 289, Asp 367 and Glu 369
bind zinc 1, while Asp 289, Lys 284, Asp 307 and Glu 369
bind zinc 2. The esidues Lys 296 and A g 371 a e also
in ol ed in he ca aly ic mechanism by ac ing as an
elec ophile and p o on dono , espec i ely, and a e hus
also conse ed in all LAPs.
3.2. Func ional exp ession o ecombinan S. mansoni
LAP in insec cells
The cDNA sequences encoding he S. mansoni (U83906)
and S. japonicum (AF300423) LAPs bo h lack s a codons
and a e he e o e incomple e. Howe e , by analysing he
mo e ecen S. japonicum sequence en ies (Hu e al., 2003),
we comple ed he 50end o he LAP gene o his species and
iden i ied he s a me hionine. The p o ein sequence o he
S. japonicum LAP (AF300423) was missing 26 NH
2
-
e minal amino acids (see accession no. BU795916 o 50
end o S. japonicum cDNA a h p://schis osoma.chgc.sh.
cn). By compa ison, we ound ha he o hologue in
S. mansoni LAP (U83906) was appa en ly missing only one
amino acid, he s a me hionine. Acco dingly, o exp ess
enzyma ically ac i e S. mansoni LAP in insec cells, we
in oduced a s a codon (ATG) a he 50end o he S. manoni
cDNA by inco po a ing i in o he o wa d p ime used in
he ampli ica ion o he gene om he cDNA lib a y.
(Howe e , sc eening o he S. mansoni EST da a ecen ly
published by Ve jo ski-Almeida e al. (2003) e ealed ha
he S. mansoni sequence was missing h ee NH
2
- e minal
amino acids—see accession nos. MS1-0068T and MS1-
0128T).
S. mansoni LAP was pu i ied om ecombinan baculo-
i us-in ec ed insec cell ex ac s by single-s ep a ini y
ch oma og aphy on Ni-NTA aga ose and was esol ed as a
57.5 kDa band ollowing SDS-PAGE. The p edic ed
molecula weigh o he p o ein is 56,551.3 Da; he
addi ional molecula weigh o he ecombinan p o ein is
con ibu ed by addi ional amino acids associa ed wi h he
ec o and he His
6
ag (Fig. 3A). Pu i ied ecombinan
S. mansoni LAP exhibi ed a speci ic ac i i y o
1302 U mg
21
p o ein agains he diagnos ic LAP subs a e,
L-Leu-NHMec. In con as , he speci ic ac i i y o he LAP
in he soluble ex ac s o adul S. mansoni and S. japonicum,
was 1.4 U mg
21
p o ein and 1.45 U mg
21
p o ein,
espec i ely.
Recombinan S. mansoni LAP was esol ed by na i e
polyac ylamide gels alongside samples o soluble
S. mansoni ex ac , soluble S. japonicum ex ac and po cine
kidney LAP (Fig. 3B). The gels we e incuba ed in he
subs a e L-leu-NHMec o 10 min o de ec LAP ac i i y. A
single band ep esen ing LAP ac i i y was isualised unde
UV ligh in he ecombinan LAP sample and his co-
mig a ed wi h a single band o ac i i y de ec ed in he
S. mansoni and S. japonicum ex ac s. The posi i e con ol,
po cine kidney LAP, was also isualised as a single band
al hough his enzyme mig a ed u he in o he gel.
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714706
3.3. Immunological de ec ion o S. mansoni LAP
in pa asi e ex ac s
Rabbi an ise um p epa ed agains ecombinan
S. mansoni LAP de ec ed a single polypep ide in S. mansoni
ex ac s ha co-mig a ed a ,57.5 kDa wi h he ecombi-
nan SmLAP (Fig. 4A). A single p o ein was also de ec ed in
S. japonicum ex ac s bu his mig a ed as e , a app oxi-
ma ely 52 kDa. LAP is also exp essed in S. mansoni
ce ca iae and i mig a ed as a simila sized p o ein o he
adul o m (Fig. 4B).
3.4. Physico-chemical p ope ies o ecombinan
S. mansoni LAP
Recombinan S. mansoni LAP ac i i y displayed a
p e e ence o a neu al/sligh ly alkaline (pH 6.5–9.4)
en i onmen . Enzyme ac i i y was op imal a pH 8.25 and
was no de ec able below pH 6.5 (Fig. 5A). This pH p o ile
co ela ed closely wi h he p o ile o LAP ac i i y in
soluble ex ac s o S. mansoni and S. japonicum ha also
exhibi ed op imal ac i i y a pH 8.25. LAP membe s o he
M17 amily a e me alloenzymes and hus equi e
Fig. 1. The phylogene ic ela ionship be ween S. mansoni and S. japonicum LAP and a ious o he membe s o he M17 amily. Schis osoma mansoni LAP is
mos closely ela ed o S. japonicum LAP. In u n he schis osome LAPs a e mos simila o he insec LAPs om he A. gambiae genome sequencing p ojec
(accession no. XP_311765) and D. melanogas e (accession no. NP_650318). O he wo LAP genes exp essed by C. elegans, he schis osome LAPs a e mos
simila o LAP-2 (accession no. Q27245). Caeno habdi is elegans LAP-1 esides in a clade ha includes he LAP genes o he p o ozoan pa asi ic Leishmania
species, Leishmania majo (accession no. AF424693), Leishmania dono ani (accession no. AF424692) and Leishmania mexicana amazonensis (accession no.
AF424691). Plan LAP membe s o he M17 amily A. haliana (accession no. P30184), Solanum ube osum (accession no. P31427), L. esculen um Ap-1
(accession no. Q10712) and L. esculen um Ap-2 (accession no. Q42876) o m a disc e e and mo e dis inc clade om he schis osome LAP genes.
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 707
Fig. 2.
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714708
he p esence o me al ca ions o main ain enzyme ac i i y
and s abili y (Kim and Lipscomb, 1993; Taylo , 1993;
S a e and Lipscomb, 1998). An analysis o he me al ion
equi emen o S. mansoni LAP showed ha manganese
and magnesium ions enhanced ecombinan LAP ac i i y
2–4 old. LAP ac i i y in soluble ex ac s o S. mansoni and
S. japonicum was likewise enhanced by he addi ion o hese
me al ions. In con as , zinc ca ions educed he ac i i y o
ecombinan LAP, S. mansoni and S. japonicum by as much
as 94, 84 and 31%, espec i ely. The me al chela o s EDTA
and 1,10-phenan h oline and he aminopep idase inhibi o
bes a in we e all inhibi o y o bo h ecombinan and na i e
schis osome LAP (Table 1).
Recombinan S. mansoni LAP exhibi ed a ma ked
p e e ence o Leu when compa ed o Ala, Ty and P o in
keeping wi h i s classi ica ion as a M17 LAP (Fig. 5B). The
LAP ac i i y in S. mansoni and S. japonicum soluble
ex ac s shows a simila subs a e p o ile. Po cine kidney
LAP also demons a ed a p e e ence o Leu bu i s ela i e
ac i i y agains Ala and Ty di e ed om he schis osome
enzyme. Cha ac e is ically, hese aminopep idases do no
clea e he bulky hyd ophobic esidue P o (Kim and
Lipscomb, 1993; Taylo , 1993; S a e and Lipscomb,
1998).
3.5. Immunolocalisa ion o S. mansoni LAP by con ocal
scanning lase mic oscopy
LAP-immuno eac i i y was p edomina ely associa ed
wi h he alimen a y ac . S ong immuno eac i i y su -
ounded he subapical mou h, wi h s aining localised below
he muscula u e o he o al sucke (Fig. 6A); no s aining was
associa ed wi h he en al sucke (Fig. 6B). Wi hin he
alimen a y ac i sel , he oesophagus was immunonega i e
while s ong s aining was obse ed immedia ely dis al o he
oesophageal opening o he pai ed gu caeca (Fig. 6B and
C). LAP-immuno eac i i y was associa ed wi h he synci ial
gas ode mis and illed he lumen o he an e io egions o
he pai ed gu caeca (Fig. 6B–D). S aining wi hin he lumen
and in he gas ode mis dec eased pos e io ly becoming
unde ec able in he dis al hi d o he wo m (Fig. 6E). LAP-
immuno eac i i y was conside ably s onge wi hin he gu
Fig. 2. Alignmen o LAP om S. mansoni (SmLAP) wi h S. japonicum LAP (SjLAP), Anopheles gambiae LAP (AgLAP, accession no. XP_311765), D.
melanogas e LAP (DmLAP, accession no. NP_650318) and LAP-2 om C. elegans (CeLAP-2, accession no. Q27245). This alignmen indica es he
conse ed si es (*) among he i e sequences (22.18% iden ical). O he sequences, 18.11% a e s ongly simila (:) and 11.65% a e weakly simila (.). All i e
sequences a e o simila leng h (SmLAP, 523 esidues; SjLAP, 521 esidues; AgLAP, 516 esidues; DmLAP, 508 esidues; CeLAP, 522 esidues), al hough i
mus be no ed ha AgLAP is incomple e a he N- e minus. Each LAP subuni is a wo-domain s uc u e, consis ing o an N- e minal domain and a ca aly icC-
e minal domain. The sequences a e mo e conse ed in he ca aly ic C- e minal domain o each subuni (highligh ed in bold). Ac i e LAP equi es he binding
o wo zinc ions ha a e pen ahed ally coo dina ed wi hin each ac i e si e. Zinc 1 is bound by Asp 289, Asp 367 and Glu 369 (unde lined). Zinc 2 is bound by
Asp 289, Lys 284, Asp 307 and Glu 369 (unde lined). These esidues a e highly conse ed be ween all membe s o he M17 amily o LAP enzymes. Lys 296
and A g 371 (double unde lined) a e also in ol ed in ca alysis ac ing as an elec ophile and p o on dono , espec i ely.
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 709
o emales han males. A dis inc laye o sub- egumen al
immunos aining ha became p og essi ely mo e in ense
pos e io ly was obse ed along he leng h o he body
(Fig. 6E and F). In con as o LAP immunos aining in he
gu , he sub- egumen al s aining was s onge in males han
emales. No s aining was obse ed in he ep oduc i e
sys em. All con ols ga e nega i e esul s (Fig. 6D, inse ).
4. Discussion
Sequence alignmen s and phylogene ic analyses e ealed
ha he schis osome aminopep idases encoded by he
cDNAs desc ibed we e membe s o he clan MF ha
con ains only one amily, M17, also known as he leucyl
aminopep idases (LAPs) (S a e and Lipscomb, 1998).
Whe eas LAPs ha e been iden i ied in many o ganisms, o
da e no M17 aminopep idase has been cha ac e ised om a
pa asi ic wo m. Aminopep idase ac i i y, howe e , has
been de ec ed in pa asi e ex ac s om schis osomes
(Au iaul e al., 1982; Damonne ille e al., 1982; Xu and
D esden, 1986; Xu e al., 1988, 1990; Doenho e al., 1988),
Fasciola hepa ica (Acos a e al., 1998; Piacenza e al.,
1999) and Asca is suum (Rhoads and Fe e e , 1998). The
well-cha ac e ised Haemonchus con o us aminopep idase,
H11 (accession no. AJ249941) (New on, 1995), di e s om
he aminopep idases in es iga ed he e in ha i is a
memb ane bound, mic osomal enzyme o Clan MA(E),
Family M1. The schis osome LAPs a e mos closely ela ed
o LAPs o he mosqui o A. gambiae and he ui ly
D. melanogas e , bu he unc ion o hese enzymes is
unknown. Mo e in e es ingly, we ound only one helmin h
sequence in he public da abases ha was ela ed o he
schis osome LAP, namely one o he wo LAPs o he ee-
li ing nema ode C. elegans, accession no. Q27245, bu his
enzyme is also uncha ac e ised. Schis osomes appa en ly do
Fig. 3. Pu i ica ion o unc ionally ac i e ecombinan S. mansoni LAP
exp essed in insec cells. (A) Samples om he pu i ica ion we e analysed
on 12% educing SDS-PAGE. Lane 1, p o ein molecula size ma ke s;
Lane 2, soluble ex ac o insec cells in ec ed wi h ecombinan
baculo i us encoding SmLAP; Lane 3, soluble ex ac o unin ec ed insec
cells; Lane 4, Ni NTA-aga ose-pu i ied ecombinan SmLAP (0.7 mg). (B)
Soluble ex ac s o adul schis osome and ecombinan SmLAP we e
sepa a ed in 10% na i e PAGE and subjec ed o di ec luo ogenic subs a e
analysis by p obing wi h L-leu-NHMec. Lane 1, soluble ex ac s o S.
mansoni; Lane 2, soluble ex ac s o S. japonicum; Lane 3, pu i ied
ecombinan SmLAP; Lane 4, po cine kidney LAP.
Fig. 4. Immunoblo iden i ica ion o schis osome LAP in pa asi e ex ac s.
Soma ic ex ac s om S. japonicum,S. mansoni and ecombinan LAP we e
esol ed using 12% SDS-PAGE, blo ed o ni ocellulose memb ane and
p obed wi h polyclonal an ibodies p epa ed agains S. mansoni ecombinan
LAP. (A) Lane 1, molecula size ma ke s; Lane 2, soluble ex ac s o adul
S. mansoni; Lane 3, soluble ex ac s o adul S. japonicum; Lane 4, pu i ied
ecombinan SmLAP. (B) Lane 1, molecula size ma ke s; Lane 2, soluble
ex ac s o adul S. mansoni; Lane 3, soluble ex ac s o S. mansoni ce ca ia.
P e-immune abbi se a did no bind o any p o eins in pa asi e ex ac s (no
shown).
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714710
no exp ess he o hologue o he second aminopep idase
(P34629) o C. elegans.
LAPs consis o wo s uc u ally un ela ed domains. The
NH
2
- e minal domain is no conse ed amongs LAPs,
a ies in leng h among membe s, and does no exhibi
iden i y wi h o he p o eins. In con as , he COOH- e minal
domain con ains he ca aly ic and he zinc-binding esidues
and is s uc u ally ela ed o ca boxypep idases A and T
(Clan MC) (Kim and Lipscomb, 1993; Taylo , 1993; S a e
and Lipscomb, 1998). The subs a e and zinc binding si es
a e well conse ed in he M17 amily and consequen ly i s
membe s om p oka yo es, plan s and animals display
simila ac i i y p o iles (S a e and Lipscomb, 1998). These
si es a e conse ed in S. mansoni and S. japonicum LAPs,
and ecombinan S. mansoni LAP displayed biochemical
p ope ies consis en wi h hose o o he M17 amily
pep idases. Speci ically, ecombinan S. mansoni LAP had
a ma ked subs a e p e e ence o NH
2
- e minal leucine
esidues, a equi emen o me al ions o ac i i y and a
neu al o weakly alkaline pH op imum.
By luo ogenic subs a e gel analysis, we de ec ed a single
aminopep idase ac i i y in ex ac s o adul S. mansoni and
S. japonicum sugges ing ha he enzyme is he majo
aminopep idase ac i i y in hese p epa a ions. In suppo o
his, ecombinan SmLAP exhibi ed a simila biochemical
p o ile o he LAP ac i i y in he pa asi e ex ac s. Using
an ibodies p epa ed agains he ecombinan SmLAP we
iden i ied he enzyme as a single p o ein in soluble ex ac s o
mixed adul S. mansoni a ,57.5 kDa, which is sligh ly
highe han i s p edic ed molecula mass o 56,739.4 kDa
om analysis o he p ima y sequence. The S. japonicum
LAP also esol ed as a single p o ein, bu mig a ed a
app oxima ely 52 kDa which is lowe han i s p edic ed mass
o 56,210.68 kDa. The enzyme o each schis osome,
howe e , co-mig a ed as single bands in na i e polyac yl-
amide gels and hei speci ic ac i i ies in he soluble ex ac s
we e simila (S. mansoni LAP 1.4 U mg
21
p o ein and
S. japonicum LAP 1.45 U mg
21
p o ein). Dispa i ies in he
p edic ed and appa en molecula sizes o he S. mansoni
LAP may be due o pos - ansla ional glycosyla ion which
would end o cause p o eins o mig a e slowe in gels bu his
Fig. 5. Compa ison o he biochemical p ope ies o ecombinan SmLAP
wi h he LAP ac i i y in soluble ex ac s o adul schis osomes. (A) The
e ec o pH on LAP ac i i y o pu i ied ecombinan SmLAP (x) soluble
ex ac s o adul S. mansoni (V) and soluble ex ac s o adul S. japonicum
(B). (B) The ela i e ac i i y o ecombinan SmLAP, soluble ex ac s o
adul S. mansoni, soluble ex ac s o adul S. japonicum and po cine kidney
agains he luo ogenic subs a es L-leu-NHMec (ha ched ba ), L-ala-
NHMec (black ba ), L- y -NHMec (whi e ba ) and L-p o-NHMec (no
ac i i y). The hyd olysis o subs a es was measu ed as a pe cen age o he
op imal subs a e L-leu-NHMec.
Table 1
E ec o di alen me al ca ions, chela o s and inhibi o s on ecombinan S. mansoni leucine aminopep idase (LAP) and LAP ac i i ies in soluble ex ac s o
S. mansoni and S. japonicum
Recombinan S. mansoni LAP S. mansoni soluble ex ac S. japonicum soluble ex ac
Con ol (no ea men ) 100 100 100
Di alen ca ions
MnCl
2
(0.05 mM) 139.8 ^0.5 380.4 ^1.5 442.1 ^2.9
MnCl
2
(0.5 mM) 87.6 ^1.9 236.4 ^0.2 364.6 ^1.6
MgCl
2
(0.05 mM) 186.4 ^1.5 299.7 ^1.6 146.3 ^5.6
MgCl
2
(0.5 mM) 205.0 ^12.1 409.0 ^1.0 350.1 ^16.1
ZnCl
2
(0.05 mM) 24.7 ^0.3 29.1 ^0.1 88.9 ^4.9
ZnCl
2
(0.5 mM) 6.0 ^0.5 15.6 ^0.1 69.4 ^0.6
Me al chela o s
EDTA (5 mM) 51.5 ^0.6 36.7 ^0.7 101.9 ^1.5
o-Phenan h oline (5 mM) 28.6 ^0.6 56.4 ^0.2 38.5 ^0.6
Inhibi o
Bes a in (50 mM) ,0.05 ,0.05 30.2 ^0.1
E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 711