Leucine aminopeptidase of the human blood flukes, Schistosoma mansoni and Schistosoma japonicum

Leucine aminopep idase o he human blood lukes, Schis osoma mansoni and Schis osoma japonicum q Elaine McCa hy a,b , Colin S ack a,b , Sheila M. Donnelly a , Sean Doyle b , Vic o ia H. Mann c , Paul J. B indley c , Michael S ewa d , Tim A. Day e , Aa on G. Maule d , John P. Dal on a, , * a Molecula Pa asi ology Uni , School o Bio echnology, Dublin Ci y Uni e si y, Dublin 9, I eland b Depa men o Biology, Na ional Ins i u e o Cellula Bio echnology, Na ional Uni e si y o I eland, Maynoo h, Co. Kilda e, I eland c Depa men o T opical Medicine, Tulane Uni e si y Heal h Sciences Cen e , New O leans, LA 70112, USA d School o Biology and Biochemis y, Medical Biology Cen e , The Queen’s Uni e si y o Bel as , 97 Lisbu n Road,Bel as BT9 7BL, UK e Depa men o Biomedical Sciences, Iowa S a e Uni e si y,Ames, IA 50011, USA Ins i u e o he Bio echnology o In ec ious Diseases (IBID), Uni e si y o Technology Sydney, Wes bou ne S ee , Go e Hill, Sydney, Aus alia Recei ed 24 Oc obe 2003; ecei ed in e ised o m 28 Janua y 2004; accep ed 29 Janua y 2004 Abs ac An a ay o schis osome endop o eases in ol ed in he diges ion o hos hemoglobin o abso bable pep ides has been desc ibed, bu he exop o ease esponsible o ca abolising hese pep ides o amino acids has ye o be iden i ied. By sea ching he public da abases we ound ha Schis osoma mansoni and Schis osoma japonicum exp ess a gene encoding a membe o he M17 amily o leucine aminopep idases (LAPs). A unc ional ecombinan S. mansoni LAP p oduced in insec cells sha ed biochemical p ope ies, including pH op imum o ac i i y, subs a e speci ici y and eliance on me al ca ions o ac i i y, wi h he majo aminopep idase ac i i y in soluble ex ac s o adul wo ms. The pH ange in which he enzyme unc ions and he lack o a signal pep ide indica e ha he enzyme unc ions in acellula ly. Immunolocalisa ion s udies showed ha he S. mansoni LAP is syn hesised in he gas ode mal cells su ounding he gu lumen. Acco dingly, we p opose ha pep ides gene a ed in he lumen o he schis osome gu a e abso bed in o he gas ode mal cells and a e clea ed by LAP o ee amino acids be o e being dis ibu ed o he in e nal issues o he pa asi e. Since LAP was also localised o he su ace egumen i may play an addi ional ole in su ace memb ane e-modelling. q2004 Aus alian Socie y o Pa asi ology Inc. Published by Else ie L d. All igh s ese ed. Keywo ds: Aminopep idase; P o eases; Haemoglobin diges ion; Pa asi es; Helmin hs; T ema odes; Schis osomes 1. In oduc ion Schis osomiasis is a ch onic pa asi ic disease widesp ead in opical and sub- opical egions such as A ica, he Middle Eas , Sou h Ame ica and Sou h Eas Asia. In 1999, he Wo ld Heal h O ganisa ion es ima ed ha 652 million people we e a isk, wi h 193 million ac ually in ec ed and abou 20 million clinically ill om schis osomiasis (WHO, 1999). The disease is caused by blood lukes o he genus Schis osoma, o which i e species, Schis osoma mansoni, Schis osoma japonicum,Schis osoma haema obium,Schis- osoma in e cala um and Schis osoma mekongi, a e o medical impo ance o humans (Engels e al., 2002; Ross e al., 2002). Ou labo a o ies ha e been pa icula ly in e es ed in p o eases ha pa icipa e in p o eolysis o hos hemoglobin, an essen ial sou ce o nu ien o he schis osome pa asi e. Ma u ing and adul schis osomes li e in he blood essels o hei human hos s whe e hey eed on ed blood cells. The inges ed ed blood cells a e lysed by hemolysins wi hin he oesophagus o he pa asi es and hemoglobin ha is eleased lows in o caeca o he schis osome (Dal on e al., 2004). Se e al p o eoly ic enzymes pa icipa e in he p og essi e ca abolism o hemoglobin o amino acids ha a e subsequen ly u ilised in pa asi e me abolic p ocesses. A model o his ca abolic p ocess p oposes ha he ini ial clea ages o hemoglobin 0020-7519/$30.00 q2004 Aus alian Socie y o Pa asi ology Inc. Published by Else ie L d. All igh s ese ed. doi:10.1016/j.ijpa a.2004.01.008 In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 www.pa asi ology-online.com q The Genbank accession numbe o he Schis oma Mansoni exp ession cons uc desc ibed in his manusc ip is AY523600. *Co esponding au ho . Add ess: Ins i u e o he Bio echnology o In ec ious Diseases (IBID), Uni e si y o Technology Sydney, Wes bou ne S ee , Go e Hill, Sydney, Aus alia. Tel.: þ61-2-9514-4142; ax: þ61-2- 9514-4201. E-mail add ess: [email p o ec ed].au (J.P. Dal on). a e pe o med by endopep idases, including ca hepsins B, L and D, libe a ing sho pep ides ha a e subsequen ly hyd olysed by exopep idases in o abso bable dipep ides and amino acids (B indley e al., 1997; To e al., 1999; Sajid and McKe ow, 2002). Whe eas we and o he s ha e cha ac e ised he exopep idase dipep idyl pep idase I, (¼ca hepsin C), which is sec e ed om he pa asi e gas ode mis in o he gu and mos likely is he enzyme ha clea es dipep ides om agmen s o hos hemoglobin (Hola-Jam iska e al., 1998, 1999, 2000), li le is known o he pu a i e aminopep idase ha is c ucial o he inal s age o libe a ing ee amino acids. Aminopep idase ac i i y has been demons a ed in soluble ex ac s o a ious s ages o he S. mansoni li e cycle (Au iaul e al., 1982; Damonne ille e al., 1982; Xu and D esden, 1986; Xu e al., 1988, 1990). Since he enzyme displayed enhanced ac i i y agains syn he ic subs a es con aining an N- e minal leucine i has been e med leucine aminopep idase (LAP) (Au iaul e al., 1982). The LAP ac i i y de ec ed in schis osomula and adul ex ac s was shown o be immunogenic du ing in ec ions since he enzyme was eac i e wi h an ibodies in he se um o in ec ed a s and humans (Au iaul e al., 1982; Damonne- ille e al., 1982; Doenho e al., 1988). LAP ac i i y is also exp essed by schis osome eggs and has been implica ed in he eme gence o he schis osome mi acidium since ha ching can be blocked by bes a in, a gene al inhibi o o aminopep idases (Xu and D esden, 1986; Xu e al., 1988, 1990). In his s udy, we isola ed a cDNA encoding an S. mansoni aminopep idase ha is a membe o he me allop o ease M17 amily o LAPs (S a e and Lipscomb, 1998). Ou cha ac e isa ion o he ecombinan and na i e LAP shows ha i is p edominan ly exp essed in he gas ode mis o he adul wo ms, and indica es ha we ha e iden i ied he schis osome enzyme esponsible o he inal s age in he ca abolism o hos hemoglobin. We discuss hese indings in he con ex o ou model o hemoglobin p o eolysis in hese blood- eeding pa asi es, and o p e ious epo s o aminopep idase ac i i y in schis osomes. 2. Ma e ials and me hods 2.1. Pa asi e ex ac s, p o ein p epa a ions and in ec ion se a Soluble ex ac s o S. mansoni ce ca iae and adul wo ms and S. japonicum adul wo ms we e p epa ed in phospha e bu e ed saline (PBS, pH 7.3) a e h ee eeze haw cycles and sonica ion cycles on ice as desc ibed p e iously (Dal on e al., 1996). Insec cell-exp essed S. mansoni aspa aginyl endopep idase (Sm32) (B indley e al., 1997; To e al., 1999) was pu i ied in ou labo a o y (S ack, Dal on and Doyle, unpublished). Pig kidney LAP was ob ained om Sigma Chemical Co (Do se , Poole). 2.2. Fluo ogenic subs a e assay and luo og aphic gel analysis o he de ec ion o aminopep idase ac i i y Aminopep idase ac i i y o S. mansoni o S. japonicum soluble ex ac s, po cine kidney LAP o ecombinan S. mansoni LAP was measu ed using he luo ogenic pep i- dyl subs a es L-leucine (Leu)-7-amido-4-me hylcouma in hyd oxide (NHMec), L-alanyl (alanine)-NHMec, L- y osyl ( y osine)-NHMec and L-p olyl (p oline)-NHMec (Sigma). The assays we e ca ied ou by incuba ing samples in a eac ion mix o 10 mM luo ogenic pep idyl subs a e, 0.5 mM MgCl 2 and 0.1 M T is–HCl (pH 8.5) in a inal olume o 1 ml a 37 8C o 30 min as desc ibed be o e (Ga igan e al., 2001). A s anda d cu e was p epa ed using 0–10 mM NHMec and enzyme uni s p esen ed nmol NHMec eleased/min/ml. Fo he ac i a ion/inhibi ion s udies, he enzyme was incuba ed wi h he di alen ca ions MgCl 2 , MnCl 2 and ZnCl 2 , he me al chela ing eagen s 1,10-phenan h oline, and N,N-e hylenediamine e aace ic acid (EDTA) o he speci ic aminopep idase inhibi o bes a in a 37 8C o 10 min p io o addi ion o he luo ogenic pep idyl subs a e o he assay mix and incuba ion o 30 min. The pH p o ile was de e mined by incuba ing enzyme in 0.1 M T is–HCl bu e s anging om pH 6.75 o 9.4. To cha ac e ise aminopep idase ac i i y in gels soluble ex ac s o adul S. mansoni and S. japonicum, ecombinan S. mansoni LAP and pig kidney LAP we e sepa a ed on 10% na i e polyac ylamide gels, which we e hen washed in 0.1 M T is–HCl (pH 8.5) con aining 0.5 mM MgCl 2 and incuba ed o 10 min in he same bu e con aining 50 mM L-leucine-NHMec as desc ibed (Cu ley e al., 1994; Acos a e al., 1998). Fluo escen bands ep esen ing enzymes wi h LAP ac i i y we e isualised unde UV ligh and pho og aphed. 2.3. Iden i ica ion and analysis o he cDNA encoding schis osome leucine aminopep idase A cDNA encoding an S. mansoni aminopep idase (GenBank U83906) was disco e ed by sea ching he public da abases wi h he pep ide sequence NTDAEGRL ha ep esen s he conse ed ac i e si e egion o aminopep i- dases (Kim and Lipscomb, 1993; S a e and Lipscomb, 1998). Analysis o he S. mansoni aminopep idase sequence was pe o med using sequence e ie al sys em (SRS), Blas ools, and MEROPS a h p://me ops.sange .ac.uk. The Bos au us LAP (bo ine lens LAP, BlLAP) sequence and s uc u al da a we e employed o loca e ca aly ic domains and c i ical ac i e si e esidues (Kim and Lipscomb, 1993; Taylo , 1993). The phylogene ic ela ionship be ween selec ed LAPs o he M17 amily o aminopep idases was examined using selec ed C- e minal domains only. Sequence simila i ies wi hin he ca aly ic domains we e de e mined using he BLAST algo i hm and he selec ed sequences we e hen aligned using he Clus alX 1.81 E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714704 p og am (Thompson e al., 1997). The PHYLIP ee was calcula ed using he boo s apping me hod, wi h he numbe o boo s apping ials se a 1000 as ecommended. The p og am also co ec ed o mul iple subs i u ions. 2.4. Cons uc ion o cDNA exp ession ec o P ime s we e designed o ampli y he ull-leng h cDNA encoding S. mansoni LAP using he DNA sequence in o ma ion deposi ed in GenBank (accession no. U83906) as ollows: Fo wa d (50-GCGGCCTCGAGATGAGC GTTGTCACTCCCGTGTTCCCG-30)andRe e se(5 0- GCCGCTCTAGATTAGTGGTGGTGGTGGTGGTGGG GCCCCTTGAAACTTAATCG-30). The o wa d and e e se p ime s inco po a ed he es ic ion si es Xho I and Xba I (unde lined), espec i ely. The o wa d p ime inco po a ed a s a codon (bold) which was no p esen in he published sequence (see Sec ion 3) and he e e se p ime con ained a sequence encoding a His 6 ag (double unde lined) and a s op codon (also bold). Ampli ica ion o he LAP cDNA om an S. mansoni cDNA lib a y was pe o med unde he ollowing condi ions: ini ial dena u a- ion (94 8C, 5 min), ollowed by 30 cycles o dena u a ion (94 8C, 1.5 min), annealing (55 8C, 1.5 min) and p ime ex ension (72 8C, 1.5 min), ollowed by a inal ex ension s ep (72 8C, 7 min). PCR p oduc s we e cloned in o pGem-T ec o (P omega, USA), and he LAP gene subsequen ly excised om he plasmid using es ic ion endonucleases Xho I and Xba I and cloned in o he baculo i us exp ession ans e ec o pBlueBac4.5 (In i ogen). The inse o he pBlueBac4.5 cons uc was sequenced o con i m o ien- a ion and iden i y o he LAP cDNA. 2.5. P oduc ion and pu i ica ion o ecombinan S. mansoni LAP in baculo i us exp ession ec o sys em Spodop e a ugipe da (S 9 ) insec cells (In i ogen) we e ans o med wi h pBlueBac4.5 plasmid cons uc inco po a ing he S. mansoni LAP cDNA as p e iously desc ibed (Ennis e al., 2001). Cell suspensions we e lysed in he p esence o 0.05% ( / ) Tween w 20 (Sigma) de e gen in 50 mM NaH 2 PO 4 , 300 mM NaCl, and 10 mM imidazole (pH 8.0, lysis bu e ), and hen incuba ed on ice o 30 min. The cell lysa e was cen i uged a 14,000 £g o 30 min and he supe na an s passed o e a 1 ml Ni-NTA esin column, and he column washed wi h i e olumes o 50 mM NaH 2 PO 4 , 300 mM NaCl, and 20 mM imidazole (pH 8.0). Bound p o ein was elu ed using 250 mM imidazole in 50 mM NaH 2 PO 4 and 300 mM NaCl (pH 8.0). The p oduc ion and pu i ica ion o ecombinan S. mansoni LAP was moni o ed by Coomassie Blue-s ained SDS-PAGE (Dal on e al., 1996). P o ein concen a ions we e de e mined using a bicinchoninic p o ein assay ki (Pie ce, Rock o d, IL) wi h bo ine se um albumin (0–2 mg ml 21 ) as p o ein s anda d. 2.6. P epa a ion o polyclonal an ise um o S. mansoni LAP (an i-SmLAP) Polyclonal an ise um o S. mansoni LAP was ob ained by immunising a abbi ou imes a 3-week in e als, sub- cu aneously, wi h pu i ied ecombinan p o ein (50 mg) o mula ed in F eunds Comple e o Incomple e adju an . Se um was ob ained 10 days a e he inal immunisa ion. 2.7. Immunoblo ing Soluble S. mansoni and S. japonicum ex ac s (10 mg) and pu i ied ecombinan LAP (2.0 mg) we e esol ed on 12% educing SDS-PAGE gels and hen ans e ed o ni ocellulose memb ane. The memb anes we e blocked in 5% (w/ ) milk powde /PBS plus 0.05% ( / ) Tween w 20 (PBST) o 1 h and hen p obed wi h abbi an i-S. mansoni LAP se um (1:6000) o p e-immunisa ion se um (con ol) o 1 h a oom empe a u e. Bound an ibody was isualised using pe oxidase-conjuga ed goa an i- abbi IgG (1:1000) and diaminobenzidine/H 2 O 2 (Sigma, Do se , UK) as he ch omogenic subs a e (B ady e al., 1999a,b). 2.8. Con ocal scanning lase mic oscopy Adul S. mansoni we e la - ixed in 4% pa a o malde- hyde (PFA) in PBS (pH 7.2) o 1 h and hen ee- ixed o a u he 3 h a 4 8C. They we e washed in an ibody diluen (AbD: PBS wi h 0.1% bo ine se um albumin, 0.3% T i on X-100 and 0.1% sodium azide) o 24 h be o e being incuba ed o 72 h a 4 8C in an i-SmLAP se um (dilu ed 1:500) and subsequen ly washed in AbD (24 h, 4 8C). Specimens we e incuba ed o 48 h in an i- abbi IgG (1:100) conjuga ed o e ame hyl hodamine iso hiocyana e (TRITC) o isualisa ion o binding si es. Specimens we e washed again in AbD, incuba ed o 24 h in phalloidin- luo escein iso hiocyana e (FITC) (as a coun e s ain ha binds F-ac in) and, a e a inal wash in AbD, we e moun ed in PBS/glyce ol (1:9) con aining 2.5% 2,4-diazabicylco 2.2.2 oc ane o con ocal mic oscopic examina ion (Leica TCS-NT; Leica Mic osys ems, Mil on Keynes, UK). Immunocy ochemical con ols included omission o p i- ma y an ise um and eplacemen o he p ima y an ise um wi h p e-immune se um. 3. Resul s 3.1. Classi ica ion o he schis osome aminopep idase based on p ima y sequence s uc u e By sea ching he public da abases wi h he pep ide sequence NTDAEGRL ha ep esen s he conse ed ac i e si e egion o aminopep idases (Kim and Lipscomb, 1993; S a e and Lipscomb, 1998), we loca ed a cDNA ha encodes an S. mansoni aminopep idase (GenBank U83906). E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 705 Sequence alignmen and phylogene ic analyses using he amino acid sequence deduced om his cDNA e ealed ha he enzyme is a membe o he M17 amily o LAPs (S a e and Lipscomb, 1998). The S. mansoni LAP sequence is mos closely ela ed o an S. japonicum exp essed sequence ag (EST) sequence (accession no. AF300423); he wo p o eins sha e 85% amino acid iden i y sugges ing ha hey a e o hologous enzymes (i.e. hey pe o m he same unc ion in hese wo disc e e, schis osome species). The ecen appea ance in GenBank o .40,000 cDNAs, which may include he comple e ansc ip ome o he adul s age o S. japonicum (Hu e al., 2003), enabled us o e-in e oga e he public da abases wi h accession nos. U83906 and AF300423. Al hough his analysis loca ed o e 80 addi ional en ies encoding pa ial S. japonicum LAPs (no shown), each o hese showed comple e iden i y o he o iginal EST sequence. This in u n suppo ed he no ion ha a single copy gene encodes he LAP cha ac e ised he e. The ela ionship be ween he S. mansoni and S. japonicum LAPs and o he membe s o he M17 amily was in es iga ed by compa ing he sequence simila i ies in he conse ed C- e minal domain (see below). The schis o- some LAPs a e mos simila o an uncha ac e ised insec LAPs o Aedes gambiae (accession no. XP_311765) and D osophila melanogas e (accession no. NP_650318). Rema kably, only one helmin h LAP sequence wi h close simila i y o he schis osome LAP was de ec ed in he da abases; his sequence is one o wo LAP genes exp essed by he nema ode Caeno habdi is elegans (accession no. Q27245; 41 and 39% amino acid iden i y o he S. mansoni and S. japonicum LAPs, espec i ely). The mo e di e ged C. elegans LAP (accession no. P34629; 12 and 11% amino acid iden i y, espec i ely, does no seem o ha e an o hologue in he schis osome genome, bu esides in he clade ha includes LAPs om se e al species o Leishma- nia. LAP membe s o he M17 amily om he lowe ing plan s A abidopsis haliana,Lycope sicon esculen um and Solanum ube osum o m a disc e e and mo e dis an clade om he schis osome LAPs (Fig. 1). An alignmen o he p ima y sequence o S. mansoni and S. japonicum LAPs wi h he A. gambiae,D. melanogas e and C. elegans sequences is p esen ed in Fig. 2. The amino acids o he i e sequences we e 22.18% iden ical, 18.11% s ongly simila and 11.65% weakly simila ( o al o e all simila i y 52%). LAPs consis o a wo-domain s uc u e, a less conse ed N- e minal domain and a mo e conse ed C- e minal domain ha con ains he ca aly ic esidues. As expec ed, he schis osome and o he sequences show g ea e conse a ion in his ca aly ic C- e minal domain (Fig. 2). LAP a e me allo-p o eases and equi e he binding o wo zinc ions ha a e pen ahed ally coo dina ed wi hin each ac i e si e. These me al ions ac as nucleophiles and a e essen ial o enzyma ic ac i i y. Acco dingly, he esidues ha bind hese zinc ions a e highly conse ed be ween all membe s o he M17 amily o LAP enzymes including he schis osome LAPs. Residues Asp 289, Asp 367 and Glu 369 bind zinc 1, while Asp 289, Lys 284, Asp 307 and Glu 369 bind zinc 2. The esidues Lys 296 and A g 371 a e also in ol ed in he ca aly ic mechanism by ac ing as an elec ophile and p o on dono , espec i ely, and a e hus also conse ed in all LAPs. 3.2. Func ional exp ession o ecombinan S. mansoni LAP in insec cells The cDNA sequences encoding he S. mansoni (U83906) and S. japonicum (AF300423) LAPs bo h lack s a codons and a e he e o e incomple e. Howe e , by analysing he mo e ecen S. japonicum sequence en ies (Hu e al., 2003), we comple ed he 50end o he LAP gene o his species and iden i ied he s a me hionine. The p o ein sequence o he S. japonicum LAP (AF300423) was missing 26 NH 2 - e minal amino acids (see accession no. BU795916 o 50 end o S. japonicum cDNA a h p://schis osoma.chgc.sh. cn). By compa ison, we ound ha he o hologue in S. mansoni LAP (U83906) was appa en ly missing only one amino acid, he s a me hionine. Acco dingly, o exp ess enzyma ically ac i e S. mansoni LAP in insec cells, we in oduced a s a codon (ATG) a he 50end o he S. manoni cDNA by inco po a ing i in o he o wa d p ime used in he ampli ica ion o he gene om he cDNA lib a y. (Howe e , sc eening o he S. mansoni EST da a ecen ly published by Ve jo ski-Almeida e al. (2003) e ealed ha he S. mansoni sequence was missing h ee NH 2 - e minal amino acids—see accession nos. MS1-0068T and MS1- 0128T). S. mansoni LAP was pu i ied om ecombinan baculo- i us-in ec ed insec cell ex ac s by single-s ep a ini y ch oma og aphy on Ni-NTA aga ose and was esol ed as a 57.5 kDa band ollowing SDS-PAGE. The p edic ed molecula weigh o he p o ein is 56,551.3 Da; he addi ional molecula weigh o he ecombinan p o ein is con ibu ed by addi ional amino acids associa ed wi h he ec o and he His 6 ag (Fig. 3A). Pu i ied ecombinan S. mansoni LAP exhibi ed a speci ic ac i i y o 1302 U mg 21 p o ein agains he diagnos ic LAP subs a e, L-Leu-NHMec. In con as , he speci ic ac i i y o he LAP in he soluble ex ac s o adul S. mansoni and S. japonicum, was 1.4 U mg 21 p o ein and 1.45 U mg 21 p o ein, espec i ely. Recombinan S. mansoni LAP was esol ed by na i e polyac ylamide gels alongside samples o soluble S. mansoni ex ac , soluble S. japonicum ex ac and po cine kidney LAP (Fig. 3B). The gels we e incuba ed in he subs a e L-leu-NHMec o 10 min o de ec LAP ac i i y. A single band ep esen ing LAP ac i i y was isualised unde UV ligh in he ecombinan LAP sample and his co- mig a ed wi h a single band o ac i i y de ec ed in he S. mansoni and S. japonicum ex ac s. The posi i e con ol, po cine kidney LAP, was also isualised as a single band al hough his enzyme mig a ed u he in o he gel. E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714706 3.3. Immunological de ec ion o S. mansoni LAP in pa asi e ex ac s Rabbi an ise um p epa ed agains ecombinan S. mansoni LAP de ec ed a single polypep ide in S. mansoni ex ac s ha co-mig a ed a ,57.5 kDa wi h he ecombi- nan SmLAP (Fig. 4A). A single p o ein was also de ec ed in S. japonicum ex ac s bu his mig a ed as e , a app oxi- ma ely 52 kDa. LAP is also exp essed in S. mansoni ce ca iae and i mig a ed as a simila sized p o ein o he adul o m (Fig. 4B). 3.4. Physico-chemical p ope ies o ecombinan S. mansoni LAP Recombinan S. mansoni LAP ac i i y displayed a p e e ence o a neu al/sligh ly alkaline (pH 6.5–9.4) en i onmen . Enzyme ac i i y was op imal a pH 8.25 and was no de ec able below pH 6.5 (Fig. 5A). This pH p o ile co ela ed closely wi h he p o ile o LAP ac i i y in soluble ex ac s o S. mansoni and S. japonicum ha also exhibi ed op imal ac i i y a pH 8.25. LAP membe s o he M17 amily a e me alloenzymes and hus equi e Fig. 1. The phylogene ic ela ionship be ween S. mansoni and S. japonicum LAP and a ious o he membe s o he M17 amily. Schis osoma mansoni LAP is mos closely ela ed o S. japonicum LAP. In u n he schis osome LAPs a e mos simila o he insec LAPs om he A. gambiae genome sequencing p ojec (accession no. XP_311765) and D. melanogas e (accession no. NP_650318). O he wo LAP genes exp essed by C. elegans, he schis osome LAPs a e mos simila o LAP-2 (accession no. Q27245). Caeno habdi is elegans LAP-1 esides in a clade ha includes he LAP genes o he p o ozoan pa asi ic Leishmania species, Leishmania majo (accession no. AF424693), Leishmania dono ani (accession no. AF424692) and Leishmania mexicana amazonensis (accession no. AF424691). Plan LAP membe s o he M17 amily A. haliana (accession no. P30184), Solanum ube osum (accession no. P31427), L. esculen um Ap-1 (accession no. Q10712) and L. esculen um Ap-2 (accession no. Q42876) o m a disc e e and mo e dis inc clade om he schis osome LAP genes. E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 707 Fig. 2. E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714708 he p esence o me al ca ions o main ain enzyme ac i i y and s abili y (Kim and Lipscomb, 1993; Taylo , 1993; S a e and Lipscomb, 1998). An analysis o he me al ion equi emen o S. mansoni LAP showed ha manganese and magnesium ions enhanced ecombinan LAP ac i i y 2–4 old. LAP ac i i y in soluble ex ac s o S. mansoni and S. japonicum was likewise enhanced by he addi ion o hese me al ions. In con as , zinc ca ions educed he ac i i y o ecombinan LAP, S. mansoni and S. japonicum by as much as 94, 84 and 31%, espec i ely. The me al chela o s EDTA and 1,10-phenan h oline and he aminopep idase inhibi o bes a in we e all inhibi o y o bo h ecombinan and na i e schis osome LAP (Table 1). Recombinan S. mansoni LAP exhibi ed a ma ked p e e ence o Leu when compa ed o Ala, Ty and P o in keeping wi h i s classi ica ion as a M17 LAP (Fig. 5B). The LAP ac i i y in S. mansoni and S. japonicum soluble ex ac s shows a simila subs a e p o ile. Po cine kidney LAP also demons a ed a p e e ence o Leu bu i s ela i e ac i i y agains Ala and Ty di e ed om he schis osome enzyme. Cha ac e is ically, hese aminopep idases do no clea e he bulky hyd ophobic esidue P o (Kim and Lipscomb, 1993; Taylo , 1993; S a e and Lipscomb, 1998). 3.5. Immunolocalisa ion o S. mansoni LAP by con ocal scanning lase mic oscopy LAP-immuno eac i i y was p edomina ely associa ed wi h he alimen a y ac . S ong immuno eac i i y su - ounded he subapical mou h, wi h s aining localised below he muscula u e o he o al sucke (Fig. 6A); no s aining was associa ed wi h he en al sucke (Fig. 6B). Wi hin he alimen a y ac i sel , he oesophagus was immunonega i e while s ong s aining was obse ed immedia ely dis al o he oesophageal opening o he pai ed gu caeca (Fig. 6B and C). LAP-immuno eac i i y was associa ed wi h he synci ial gas ode mis and illed he lumen o he an e io egions o he pai ed gu caeca (Fig. 6B–D). S aining wi hin he lumen and in he gas ode mis dec eased pos e io ly becoming unde ec able in he dis al hi d o he wo m (Fig. 6E). LAP- immuno eac i i y was conside ably s onge wi hin he gu Fig. 2. Alignmen o LAP om S. mansoni (SmLAP) wi h S. japonicum LAP (SjLAP), Anopheles gambiae LAP (AgLAP, accession no. XP_311765), D. melanogas e LAP (DmLAP, accession no. NP_650318) and LAP-2 om C. elegans (CeLAP-2, accession no. Q27245). This alignmen indica es he conse ed si es (*) among he i e sequences (22.18% iden ical). O he sequences, 18.11% a e s ongly simila (:) and 11.65% a e weakly simila (.). All i e sequences a e o simila leng h (SmLAP, 523 esidues; SjLAP, 521 esidues; AgLAP, 516 esidues; DmLAP, 508 esidues; CeLAP, 522 esidues), al hough i mus be no ed ha AgLAP is incomple e a he N- e minus. Each LAP subuni is a wo-domain s uc u e, consis ing o an N- e minal domain and a ca aly icC- e minal domain. The sequences a e mo e conse ed in he ca aly ic C- e minal domain o each subuni (highligh ed in bold). Ac i e LAP equi es he binding o wo zinc ions ha a e pen ahed ally coo dina ed wi hin each ac i e si e. Zinc 1 is bound by Asp 289, Asp 367 and Glu 369 (unde lined). Zinc 2 is bound by Asp 289, Lys 284, Asp 307 and Glu 369 (unde lined). These esidues a e highly conse ed be ween all membe s o he M17 amily o LAP enzymes. Lys 296 and A g 371 (double unde lined) a e also in ol ed in ca alysis ac ing as an elec ophile and p o on dono , espec i ely. E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 709 o emales han males. A dis inc laye o sub- egumen al immunos aining ha became p og essi ely mo e in ense pos e io ly was obse ed along he leng h o he body (Fig. 6E and F). In con as o LAP immunos aining in he gu , he sub- egumen al s aining was s onge in males han emales. No s aining was obse ed in he ep oduc i e sys em. All con ols ga e nega i e esul s (Fig. 6D, inse ). 4. Discussion Sequence alignmen s and phylogene ic analyses e ealed ha he schis osome aminopep idases encoded by he cDNAs desc ibed we e membe s o he clan MF ha con ains only one amily, M17, also known as he leucyl aminopep idases (LAPs) (S a e and Lipscomb, 1998). Whe eas LAPs ha e been iden i ied in many o ganisms, o da e no M17 aminopep idase has been cha ac e ised om a pa asi ic wo m. Aminopep idase ac i i y, howe e , has been de ec ed in pa asi e ex ac s om schis osomes (Au iaul e al., 1982; Damonne ille e al., 1982; Xu and D esden, 1986; Xu e al., 1988, 1990; Doenho e al., 1988), Fasciola hepa ica (Acos a e al., 1998; Piacenza e al., 1999) and Asca is suum (Rhoads and Fe e e , 1998). The well-cha ac e ised Haemonchus con o us aminopep idase, H11 (accession no. AJ249941) (New on, 1995), di e s om he aminopep idases in es iga ed he e in ha i is a memb ane bound, mic osomal enzyme o Clan MA(E), Family M1. The schis osome LAPs a e mos closely ela ed o LAPs o he mosqui o A. gambiae and he ui ly D. melanogas e , bu he unc ion o hese enzymes is unknown. Mo e in e es ingly, we ound only one helmin h sequence in he public da abases ha was ela ed o he schis osome LAP, namely one o he wo LAPs o he ee- li ing nema ode C. elegans, accession no. Q27245, bu his enzyme is also uncha ac e ised. Schis osomes appa en ly do Fig. 3. Pu i ica ion o unc ionally ac i e ecombinan S. mansoni LAP exp essed in insec cells. (A) Samples om he pu i ica ion we e analysed on 12% educing SDS-PAGE. Lane 1, p o ein molecula size ma ke s; Lane 2, soluble ex ac o insec cells in ec ed wi h ecombinan baculo i us encoding SmLAP; Lane 3, soluble ex ac o unin ec ed insec cells; Lane 4, Ni NTA-aga ose-pu i ied ecombinan SmLAP (0.7 mg). (B) Soluble ex ac s o adul schis osome and ecombinan SmLAP we e sepa a ed in 10% na i e PAGE and subjec ed o di ec luo ogenic subs a e analysis by p obing wi h L-leu-NHMec. Lane 1, soluble ex ac s o S. mansoni; Lane 2, soluble ex ac s o S. japonicum; Lane 3, pu i ied ecombinan SmLAP; Lane 4, po cine kidney LAP. Fig. 4. Immunoblo iden i ica ion o schis osome LAP in pa asi e ex ac s. Soma ic ex ac s om S. japonicum,S. mansoni and ecombinan LAP we e esol ed using 12% SDS-PAGE, blo ed o ni ocellulose memb ane and p obed wi h polyclonal an ibodies p epa ed agains S. mansoni ecombinan LAP. (A) Lane 1, molecula size ma ke s; Lane 2, soluble ex ac s o adul S. mansoni; Lane 3, soluble ex ac s o adul S. japonicum; Lane 4, pu i ied ecombinan SmLAP. (B) Lane 1, molecula size ma ke s; Lane 2, soluble ex ac s o adul S. mansoni; Lane 3, soluble ex ac s o S. mansoni ce ca ia. P e-immune abbi se a did no bind o any p o eins in pa asi e ex ac s (no shown). E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714710 no exp ess he o hologue o he second aminopep idase (P34629) o C. elegans. LAPs consis o wo s uc u ally un ela ed domains. The NH 2 - e minal domain is no conse ed amongs LAPs, a ies in leng h among membe s, and does no exhibi iden i y wi h o he p o eins. In con as , he COOH- e minal domain con ains he ca aly ic and he zinc-binding esidues and is s uc u ally ela ed o ca boxypep idases A and T (Clan MC) (Kim and Lipscomb, 1993; Taylo , 1993; S a e and Lipscomb, 1998). The subs a e and zinc binding si es a e well conse ed in he M17 amily and consequen ly i s membe s om p oka yo es, plan s and animals display simila ac i i y p o iles (S a e and Lipscomb, 1998). These si es a e conse ed in S. mansoni and S. japonicum LAPs, and ecombinan S. mansoni LAP displayed biochemical p ope ies consis en wi h hose o o he M17 amily pep idases. Speci ically, ecombinan S. mansoni LAP had a ma ked subs a e p e e ence o NH 2 - e minal leucine esidues, a equi emen o me al ions o ac i i y and a neu al o weakly alkaline pH op imum. By luo ogenic subs a e gel analysis, we de ec ed a single aminopep idase ac i i y in ex ac s o adul S. mansoni and S. japonicum sugges ing ha he enzyme is he majo aminopep idase ac i i y in hese p epa a ions. In suppo o his, ecombinan SmLAP exhibi ed a simila biochemical p o ile o he LAP ac i i y in he pa asi e ex ac s. Using an ibodies p epa ed agains he ecombinan SmLAP we iden i ied he enzyme as a single p o ein in soluble ex ac s o mixed adul S. mansoni a ,57.5 kDa, which is sligh ly highe han i s p edic ed molecula mass o 56,739.4 kDa om analysis o he p ima y sequence. The S. japonicum LAP also esol ed as a single p o ein, bu mig a ed a app oxima ely 52 kDa which is lowe han i s p edic ed mass o 56,210.68 kDa. The enzyme o each schis osome, howe e , co-mig a ed as single bands in na i e polyac yl- amide gels and hei speci ic ac i i ies in he soluble ex ac s we e simila (S. mansoni LAP 1.4 U mg 21 p o ein and S. japonicum LAP 1.45 U mg 21 p o ein). Dispa i ies in he p edic ed and appa en molecula sizes o he S. mansoni LAP may be due o pos - ansla ional glycosyla ion which would end o cause p o eins o mig a e slowe in gels bu his Fig. 5. Compa ison o he biochemical p ope ies o ecombinan SmLAP wi h he LAP ac i i y in soluble ex ac s o adul schis osomes. (A) The e ec o pH on LAP ac i i y o pu i ied ecombinan SmLAP (x) soluble ex ac s o adul S. mansoni (V) and soluble ex ac s o adul S. japonicum (B). (B) The ela i e ac i i y o ecombinan SmLAP, soluble ex ac s o adul S. mansoni, soluble ex ac s o adul S. japonicum and po cine kidney agains he luo ogenic subs a es L-leu-NHMec (ha ched ba ), L-ala- NHMec (black ba ), L- y -NHMec (whi e ba ) and L-p o-NHMec (no ac i i y). The hyd olysis o subs a es was measu ed as a pe cen age o he op imal subs a e L-leu-NHMec. Table 1 E ec o di alen me al ca ions, chela o s and inhibi o s on ecombinan S. mansoni leucine aminopep idase (LAP) and LAP ac i i ies in soluble ex ac s o S. mansoni and S. japonicum Recombinan S. mansoni LAP S. mansoni soluble ex ac S. japonicum soluble ex ac Con ol (no ea men ) 100 100 100 Di alen ca ions MnCl 2 (0.05 mM) 139.8 ^0.5 380.4 ^1.5 442.1 ^2.9 MnCl 2 (0.5 mM) 87.6 ^1.9 236.4 ^0.2 364.6 ^1.6 MgCl 2 (0.05 mM) 186.4 ^1.5 299.7 ^1.6 146.3 ^5.6 MgCl 2 (0.5 mM) 205.0 ^12.1 409.0 ^1.0 350.1 ^16.1 ZnCl 2 (0.05 mM) 24.7 ^0.3 29.1 ^0.1 88.9 ^4.9 ZnCl 2 (0.5 mM) 6.0 ^0.5 15.6 ^0.1 69.4 ^0.6 Me al chela o s EDTA (5 mM) 51.5 ^0.6 36.7 ^0.7 101.9 ^1.5 o-Phenan h oline (5 mM) 28.6 ^0.6 56.4 ^0.2 38.5 ^0.6 Inhibi o Bes a in (50 mM) ,0.05 ,0.05 30.2 ^0.1 E. McCa hy e al. / In e na ional Jou nal o Pa asi ology 34 (2004) 703–714 711