JOURNAL OF CLINICAL MICROBIOLOGY, June 2002, p. 1958–1962 Vol. 40, No. 6
0095-1137/02/$04.00⫹0 DOI: 10.1128/JCM.40.6.1958–1962.2002
Copy igh © 2002, Ame ican Socie y o Mic obiology. All Righ s Rese ed.
High-Sensi i i y PCR De ec ion o Pa o i us B19 in Plasma
P. Daly,
1
A. Co co an,
1
B. P. Mahon,
1,2
and S. Doyle
1
*
Depa men o Biology
1
and Ins i u e o Immunology,
2
Na ional Uni e si y o I eland,
Maynoo h, Coun y Kilda e, I eland
Recei ed 27 No embe 2001/Re u ned o modi ica ion 22 Janua y 2002/Accep ed 1 Ma ch 2002
Pa o i us B19 (B19) is a human pa hogen ansmi ed o suscep ible indi iduals ia espi a o y sec e ions and
con amina ed blood o blood p oduc s. B19 le els in pooled plasma o less han 10
4
genome equi alen s/ml may no
be in ec ious, while hose g ea e han 10
7
/ml a e capable o ansmi ing in ec ion. A Wo ld Heal h O ganiza ion
(WHO) B19 DNA in e na ional s anda d has been ecen ly in oduced. The pu pose o he p esen wo k was o
de elop a PCR–enzyme-linked immunoso ben assay (PCR-ELISA) calib a ed agains he WHO B19 DNA in e -
na ional s anda d which could easily and eliably de ec B19 DNA le els in plasma abo e 10
4
IU/ml (6.5 ⴛ10
3
genome equi alen s/ml). A B19 PCR-ELISA sys em was de eloped which uses a dini ophenyla ed oligonucleo ide
p obe o de ec immobilized bio inyla ed amplicons ollowing single- ound PCR ampli ica ion. The le el o B19 DNA
(in in e na ional uni s pe millili e ) in indi idual and pooled plasma specimens was e alua ed. P o einase K
ea men o plasma was ound o be su icien o quan i a i ely elease B19 DNA. The B19 PCR-ELISA had a
sensi i i y o de ec ion o 1.6 ⴛ10
3
IU/ml B19 DNA and a dynamic ange ex ending om 8 o 1,000 IU o B19 DNA
(equi alen o 1.6 ⴛ10
3
o 2 ⴛ10
5
IU o B19 DNA/ml). Fu he mo e, he an ibody p o ile o pooled plasma p oduc s
was de e mined in e ms o B19 immunoglobulin G (IgG) (in in e na ional uni s pe millili e ). The B19 IgG le el
was ound o be 64.7 ⴞ17.5 IU/ml (mean ⴞs anda d de ia ion). The B19 PCR-ELISA, which is calib a ed agains
he B19 DNA in e na ional s anda d, may ha e an applica ion o he apid sc eening o plasma minipools o B19
DNA, he eby leading o an imp o emen in blood p oduc sa e y.
Pa o i us B19 (B19) is he causa i e agen o mul iple hu-
man diseases, including ex ensi e e al loss and se e e disease
o e en dea h in immunocomp omised indi iduals (20, 22).
Indeed, i can be es ima ed ha upwa ds o 3,000 p egnancies
pe annum may be los in he Eu opean Union and he Uni ed
S a es due o B19 in ec ion, based on an in ec ion a e o 0.1%
and a suscep ible coho o o e 3 million p egnancies in ol -
ing se onega i e emales. In Eu ope, i has been p oposed ha
15% o immunocomp omised pa ien s may succumb o B19
in ec ion pe annum, leading o a esul an mo ali y a e o
7% in his pa ien coho (20).
While i al in ec ion can occu hough ei he espi a o y
sec e ions o con amina ed blood o blood p oduc s, he p e-
cise i al load equi ed o ini ia e in ec ion is unknown. Con-
sequen ly, B19 con amina ion o pooled blood p oduc s is o
majo signi icance, p ima ily due o he high physicochemical
ole ance o B19 o many o he ea men s used in plasma
p ocessing allied o he ex emely high le els o i emia in
acu ely in ec ed, and o en asymp oma ic, indi iduals (⬎10
12
genome equi alen s/ml) (15). These ac o s combine o
p esen signi ican challenges o manu ac u e s in e ms o he
p oduc ion o B19- ee ma e ial. Indeed, in he absence o
o icial egula ions o con ol he sa e y o blood o blood
p oduc s wi h espec o B19 p esence, indi idual manu ac u -
e s ha e es ablished minipool sc eening p o ocols o minimize
B19 con amina ion (1).
While se ological diagnosis o i al in ec ion is now well
s anda dized and widely a ailable (6, 12), only a limi ed num-
be o me hods o he ex ac ion and de ec ion o B19 nucleic
acid in single o pooled blood p oduc s ha e, as ye , been
desc ibed (1, 3, 11, 19, 24). These assays p ima ily u ilize ei he
digoxigenin (DIG)-labeled UTP inco po a ion in o newly syn-
hesized amplicons du ing PCR o acili a e de ec ion o quan-
i a i e PCR echnology such as Taqman chemis y (1, 24).
Despi e nume ous ad an ages, applica ion o hese sys ems o
B19 DNA de ec ion in ei he indi idual o pooled plasma uni s
may be limi ed by i ep oducibili y o DIG-UTP inco po a ion,
low sensi i i y, and cos ac o s.
None heless, he a ailabili y o hese me hods—combined
wi h eliable me hods o an ibody de ec ion and he in oduc-
ion o in e na ional-s anda d p epa a ions o he quan i a-
ion o B19 immunoglobulin G (IgG) and, mo e ecen ly, B19
DNA—is leading o u he imp o emen s in he si ua ion in
which manu ac u e s had depended on he p esence o high
le els o B19 IgG alone, in pooled plasma p oduc s, as an
indica o o p oduc sa e y (9, 13, 15, 17). Fu he mo e, a
ecen epo has shown ha 1 IU o B19 DNA equals 0.65
genome equi alen (1). Despi e hese ad ances, a ecen s udy
has highligh ed p oblems wi h bo h specimen p epa a ion and
lack o es sys em s anda diza ion o he de ec ion o B19
DNA (17). Mo eo e , i has been shown ha B19 can pe sis ,
a low le els, in immunocompe en indi iduals o up o 6 o 40
mon hs pos in ec ion (2, 14), implying ha ul asensi i e B19
DNA de ec ion is no be sui able o plasma sc eening due o
de ec ion o i emic, hough nonin ec ious, plasma uni s. Fu -
he mo e, he ecen obse a ion ha p epa a ions o a pooled
plasma p oduc (Sol en /De e gen T ea ed Viplas/SD), con-
aining less han 10
4
genome equi alen s/ml, did no lead o
se ocon e sion in heal hy, B19-se onega i e olun ee s while
unde e alua ion in a phase IV clinical ial has led o he
consensus ha his le el o B19 con amina ion may be a sa e
* Co esponding au ho . Mailing add ess: Depa men o Biology,
Na ional Uni e si y o I eland, Maynoo h, Coun y Kilda e, I eland.
Phone: 353-1-7083858. Fax: 353-1-7083845. E-mail: sean.doyle@may
.ie.
1958
i al load which is incapable o ansmi ing B19 in ec ion o
blood p oduc ecipien s (4).
He e, we epo he de elopmen o a obus and eliable
mic opla e de ec ion sys em o he de ec ion o bio inyla ed
PCR p oduc using dini ophenyl (DNP)-labeled p obes, in
combina ion wi h an ibody-enzyme conjuga e, o he de ec-
ion o B19 DNA in se um o plasma a a sensi i i y o 1.6 ⫻
10
3
IU/ml, which may ha e a u ili y in plasma sc eening.
MATERIALS AND METHODS
Specimens. Aliquo s o Sol en /De e gen T ea ed Viplas/SD plasma uni s
(PS1 o -32), each comp ising 5,000 indi idual dona ions, we e ob ained om
A is ides Lazo (VI Technologies, Bos on, Mass.) while indi idual uni s o pa -
o i us B19-con aining plasma (IDS1 o -7) we e kind gi s om bo h Alb ech
G oene and Thomas Weime (A en is Beh ing, Ma bu g, Ge many). The
Wo ld Heal h O ganiza ion (WHO) B19 DNA in e na ional s anda d (99/800)
o nucleic acid es ing was ob ained om he Na ional Ins i u e o Biological
S anda ds and Con ol, Po e s Ba , He o dshi e, Uni ed Kingdom (18a). This
ma e ial, which con ains in ac B19 i ions, consis s o lyophilized, pooled plasma
con aining a known copy numbe o 5 ⫻10
5
IU o B19 DNA/ ial. All o he
specimens which we e used o con i m PCR–enzyme-linked immunoso ben
assay (PCR-ELISA) speci ici y (n⫽200) we e ob ained om he I ish Blood
T ans usion Se ice (Dublin, I eland). A con ol plasmid (pB19NS1) con aining
he en i e B19 NS1 coding egion was used as posi i e con ol o all PCRs and
was p epa ed as p e iously desc ibed (8). DNA concen a ion o pB19NS1 was
compu ed om A
260
measu emen s and was used in pa allel wi h he B19 DNA
in e na ional s anda d in he es ablishmen o es sensi i i y. No e: B19 le els
a e exp essed in a ious ways h oughou his epo , which e lec s how le els
we e epo ed in he o iginal publica ions ci ed.
Specimen p epa a ion and B19 DNA ampli ica ion. Undilu ed o dilu ed
(10
⫺4
o 10
⫺10
in phospha e-bu e ed saline) specimens (100 l) we e diges ed
wi h 2 l o p o einase K (20 mg/ml) a 56°C o 1 h, and his was ollowed by
boiling and cen i uga ion (13,000 ⫻g o 30 min a 4°C) o emo e p ecipi a ed
p o ein. Specimens we e also ex ac ed wi h he QiAmp Blood ki (QIAGEN,
Hilden, Ge many) as desc ibed by he manu ac u e (whe e indica ed). DNA
ex ac ion was pe o med in a labo a o y sepa a e om ha in which PCR
eagen p epa a ion and nucleic acid ampli ica ion we e ca ied ou . Templa e
DNA p esen in he supe na an (5 l) was added o he ollowing mix u e: 10
mM T is-HCl (pH 9.0), 50 mM KCl, 0.1%( ol/ ol) T i on X-100, 2.0 mM MgCl
2
,
a 200 M concen a ion o each deoxynucleoside iphospha e (P omega, Mad-
ison, Wis.), 1 M be aine (which enhanced he PCR) (Sigma, Poole, Uni ed
Kingdom) (da a no shown), a 1.0 M concen a ion o each oligonucleo ide
p ime (Table 1) (5, 7) speci ic o egions wi hin he NS1 coding egion o he
B19 genome, and 1.25 U o Taq polyme ase (P omega) in a o al olume o 50
l. Ampli ica ion was as ollows: 95°C o 6 min ollowed by 35 cycles o 95°C o
1 min, 55°C o 1 min, and 72°C o 2 min, e mina ing in 72°C o 5 min. Ten
mic oli e s o each PCR p oduc was subjec ed o 1% (w / ol) aga ose gel
elec opho esis wi h e hidium b omide (0.5 g/ml; Sigma) o 30 min a 100 V.
Amplicon isualiza ion was pe o med using an Eagle-Eye II gel documen a ion
sys em (S a agene, La Jolla, Cali .).
Mic opla e p epa a ion and immunoassay o ma . Mic owells (Nunc, Ros-
kilde, Denma k) we e coa ed wi h s ep a idin (2.5 g/ml) and s abilized o 4°C
s o age by he addi ion o 1% (w / ol) bo ine se um albumin in 50 mM sodium
ca bona e bu e , pH 9.4. Bio inyla ed PCR p oduc s we e dilu ed 1/20 in 6⫻
SSC (1⫻SSC is 0.15 M NaCl plus 0.015 M sodium ci a e) o gi e a inal olume
o 100 l, added o mic owells coa ed wi h s ep a idin, and incuba ed a 37°C
o 30 min. A e wo washes wi h phospha e-bu e ed saline–0.05% ( ol/ ol)
Tween 20 (PBST), 100 l o 125 mM NaOH–100 mM NaCl was added o he
mic owells o dissocia e DNA duplex, incuba ed a oom empe a u e o 10 min,
and washed ou imes wi h PBST. Then, 100 l o DNP-labeled oligonucleo ide
(Table 1) (100 ng/ml in 6⫻SSC–0.1% [w / ol] SDS) was added o he mic owells
and incuba ed o 1ha 60°C ollowed by ou washes wi h PBST. Mic owells
we e hen blocked wi h 2.5% (w / ol) milk powde in PBST o 1ha 20°C.
Following emo al o he blocking solu ion, IgG (an i-DNP)-ho se adish pe ox-
idase conjuga e was added, and he mix u e was incuba ed a oom empe a u e
o 30 min and washed ou imes wi h PBST. Subs a e (100 l o e ame hyl-
benzidine) was hen added, and he mix u e was incuba ed o 15 min a oom
empe a u e. The eac ion was e mina ed by he addi ion o 1 N sul u ic acid
and measu ed spec opho ome ically a 450 and 630 nm (Dyna ech MRX).
Se ology. B19 IgG and IgM immunoassays we e ob ained om Bio in (Dublin,
I eland) and we e used as p e iously desc ibed (12) and in acco dance wi h manu-
ac u e s’ins uc ions. B ie ly, all immunoassays u ilized con o ma ionally in ac B19
capsid an igens (VP1 and VP2) o an ibody cap u e, excep he Wes e n blo
immunoassay o B19 IgG, which con ains dena u ed B19 capsid p o eins (12).
RESULTS
Assay sensi i i y. PCR-ELISA sensi i i y o de ec ion was
e alua ed using dilu ions o bo h he WHO B19 DNA in e -
na ional s anda d (99/800) and pu i ied con ol plasmid
(pB19NS1) con aining he en i e NS1 gene. ELISA analysis o
he B19 DNA in e na ional s anda d, ollowing p o einase K
ex ac ion and PCR ampli ica ion using p ime s F1 and R1,
acili a ed de ec ion o 8 IU o B19 DNA/5 l (1.6 ⫻10
3
IU/ml) (Fig. 1). ELISA e alua ion, ollowing ex ac ion using
he Qiagen spin column, esul ed in he de ec ion o 40 IU (8
⫻10
3
IU/ml) o he B19 DNA in e na ional s anda d (Fig. 1).
These esul s indica ed ha p o einase K diges ion o he in-
e na ional s anda d esul ed in supe io de ec ion ela i e o
ha o he spin column-ex ac ed ma e ial, and p o einase K
diges ion was hus used in subsequen expe imen s. Figu e 1
illus a es a calib a ion cu e, ex ending o e 3 o de s o mag-
ni ude, gene a ed ollowing PCR ampli ica ion o hal -log di-
lu ions o he B19 DNA in e na ional s anda d which was
subsequen ly used o compu e B19 DNA le els (in in e na-
ional uni s pe millili e ) in indi idual and pooled plasma
specimens. Fu he mo e, he imp o emen in PCR-ELISA
sensi i i y (8 IU; 1.6 ⫻10
3
IU/ml) o e ha ob ained wi h
e hidium b omide s aining (200 IU; 4 ⫻10
4
IU/ml) ollowing
aga ose gel elec opho esis is also e iden (Fig. 1).
A sensi i i y o de ec ion o 50 copies o he con ol plasmid
(in 5 l) was de e mined, which equa es o 10
4
copies/ml.
Simila ly o he WHO in e na ional s anda d, he sensi i i y o
de ec ion by aga ose gel elec opho esis was obse ed o be 10
imes lowe (500 copies o con ol plasmid [10
5
copies/ml]).
Thus, he ELISA o ma con e s a leas a 10- old inc ease in
sensi i i y o e e hidium b omide isualiza ion o amplicons.
TABLE 1. Nucleo ide sequences o oligonucleo ide p ime s and hei ela i e posi ions in he B19 genome
a
P ime o p obe Gene Posi ion Sequence (5⬘33⬘)
P ime s
F1 NS1 1399–1422 Bio in-AATACACTGTGGTTTTATGGGCCG
R1 NS1 1600–1576 CTAAAATGGCTTTTGCAGCTTCTAC
P obe (DNP-Oligo) NS1 1536–1566 (DNP)
3
-CTTAATAATACCTTCATCCCAGACCACCAA
a
The oligonucleo ide p ime s we e selec ed based on p e ious obse a ions (5, 7). The ela i e nucleo ide posi ions o he B19 p ime s a e numbe ed acco ding o
e e ence 21. P ime F1 was bio inyla ed a he 5⬘end o acili a e binding o amplicons o s ep a idin-coa ed mic o i e wells. The de ec ion p obe was labeled wi h
h ee DNP g oups a he 5⬘end o acili a e IgG (an i-DNP)-ho se adish pe oxidase conjuga e binding.
VOL. 40, 2002 B19 PCR-ELISA 1959
Specimen e alua ion. PCR-ELISA analysis o pooled
plasma specimens (PS1 o -30) de ec ed high le els o i emia
in specimens PS1 o -5 (Fig. 2). All o he pooled plasma spec-
imens es ed con ained ei he low le els o B19 DNA o le els
which we e below he sensi i i y o he es sys em. Subse-
quen ly, he le els o B19 DNA p esen in specimens PS1 o -5
we e quan i ied and ound o con ain be ween 8.0 ⫻10
7
and
5.0 ⫻10
8
IU o B19 DNA/ml, in addi ion o B19 IgG le els o
59.5 o 86.5 IU/ml, which we e signi ican ly highe han he
immunoassay cu o (3 IU/ml) (Table 2). No B19 IgM was
de ec able in hese pools (Table 2) o any o he pooled plasma
specimen. All specimens es ed we e posi i e o B19 IgG in all
comme cial immunoassay sys ems, including mic opla e en-
zyme immunoassay and immuno luo escen , Wes e n, and im-
munoblo assays. No specimen eac i i y was obse ed agains
dena u ed VP2 when es ed by Wes e n blo ing; howe e , all
specimens we e VP1 posi i e by his me hod. The B19 IgG
le el (mean ⫾s anda d de ia ion) in all plasma pools es ed
was ound o be 64.7 ⫾17.5 IU/ml (n⫽30).
Highe le els o B19 DNA (1.2 ⫻10
9
o 8.0 ⫻10
11
IU/ml)
we e ound ollowing e alua ion o indi idual plasma dona-
ions (IDS1 o -7). Signi ican ly, all o hese specimens we e
B19 IgG nega i e, and only one con ained de ec able B19 IgM,
sugges ing ha all indi iduals we e ecen ly in ec ed wi h B19
(Table 2). Finally, a pool o 200 se um specimens also es ed
nega i e by he PCR-ELISA, u he con i ming assay speci-
ici y (specimen/cu o abso bance a io, ⬍1.0).
DISCUSSION
A obus mic owell de ec ion sys em o he high-sensi i i y
de ec ion o bio inyla ed amplicons ollowing ex ac ion and
single- ound PCR ampli ica ion o pa o i us B19 DNA has
been de eloped. The o e all ampli ica ion and de ec ion sys-
em uses colo ime ic de ec ion o specimen isualiza ion, ex-
hibi s a sensi i i y o de ec ion o 1.6 ⫻10
3
IU o B19 DNA/ml,
is compa ible o use wi h ei he indi idual o pooled speci-
mens, and is capable o being au oma ed. Signi ican ly, he
equi emen o PCR-dependen inco po a ion o a de ec ion
moie y (e.g., DIG) is ob ia ed.
Al hough he use o comme cial ex ac ion ki s is hough o
educe he p esence o PCR inhibi o s, especially o he de-
e mina ion o i al load in plasma pools (18), he da a p e-
sen ed he e demons a e ha p o einase K diges ion alone is
su icien o quan i a i ely elease B19 DNA om pooled and
indi idual plasma specimens ea ed wi h ci a e. Ex ac ion o
specimen DNA is o pa amoun impo ance o ensu e quan i-
a i e elease o a ge DNA, and a numbe o me hods o
DNA ex ac ion based on e iciency, con enience, ep oduc-
ibili y, and he p esence o inhibi o s ha e been in es iga ed
(25). These au ho s ound ha ea men o se um specimens
by apid hea ing ul illed he c i e ia o ou ine diagnosis while
o he ex ac ion me hods, such as lysis ea men and comme -
cial DNA ex ac ion ki s, ailed o yield highe le els o ex-
ac ed DNA based on quan i a i e PCR esul s. Ou obse a-
FIG. 1. PCR-ELISA quan i a ion using he WHO B19 DNA in e na ional s anda d. Hal -log dilu ions we e ex ac ed by p o einase K (solid
line) o spin column (dashed line) me hodologies, subjec ed o PCR using p ime s F1 and R1, and analyzed by ELISA. Abso bance a 450 and
630 nm is plo ed e sus he log amoun o B19 DNA. The PCR-ELISA cu o (0.159) is indica ed by he ho izon al black line and was calcula ed
as he mean plus 2 s anda d de ia ions [0.107 ⫹2(0.026)] ollowing eplica e analysis o 20 B19-DNA-nega i e specimens. A le el o 8 IU o B19
DNA was eliably de ec able ollowing p o einase K ex ac ion. Amplicon de ec ion by aga ose gel elec opho esis de ec ion is also shown (inse ).
I can be seen ha a minimum o 200 IU o B19 DNA only can be de ec ed by his app oach. PD, p ime dime .
1960 DALY ET AL. J. CLIN.MICROBIOL.
ions o ci a e- ea ed plasma a e in ag eemen wi h hose
ound by Ze bini e al. (25), who ound ha specimen ea -
men wi h p o einase K was mo e e icien o B19 DNA iso-
la ion han comme cial ki s. This obse a ion should be o
signi ican u ili y in he la ge-scale sc eening o plasma by
blood p oduc manu ac u e s.
A sensi i i y limi o 350 o 3,500 copies o B19 DNA has
been epo ed (7) when single- ound PCR wi h op imized
p ime pai s and e hidium b omide de ec ion has been used
ollowing aga ose gel elec opho esis. Using hese p ime s, in
combina ion wi h a modi ied PCR p ocedu e and ELISA-
based amplicon e ela ion, a minimum o 8 IU o B19 DNA
was de ec able in he p esen s udy, which ep esen s a signi -
ican imp o emen o e his p e ious wo k. Al hough Du igon
e al. (7) showed ha nes ed PCR imp o ed sensi i i y by up o
100- old, his op ion is no en i ely sui able o la ge-scale
plasma sc eening, due o con amina ion isks.
In he las decade a numbe o quan i a i e PCR assays ha e
been de eloped o de ec B19 DNA in indi idual se um and
plasma specimens; howe e , ew ha e di ec ly add essed ei he
he issue o plasma pool con amina ion o assay compa ibili y
wi h he ecen ly in oduced WHO B19 DNA in e na ional
s anda d. Fu he mo e, hese assays may exhibi inapp op ia e
sensi i i y o pooled plasma sc eening. Fo ins ance, Ze bini
e al. (24) epo ed eliable de ec ion o 60 B19 genome equi -
alen s (1.2 ⫻10
4
/ml) using DIG-labeled PCR p oduc de ec-
ion, which is abo e he B19 le el (10
4
genome equi alen s/ml)
hough o ep esen a nonin ec ious dose. Con e sely, o he
au ho s ha e epo ed assay sensi i i ies o 168 and 100 B19
copies/ml, espec i ely, he use o which may lead o disca ding
i emic, hough nonin ec ious, plasma uni s (10, 19). Al hough
do blo hyb idiza ion assays using colo ime ic subs a es (En-
Vison) ha e been de eloped (26) which can de ec 3 ⫻10
3
copies (10 g) o B19 DNA (while he addi ion o chemilumi-
nescen subs a es inc eased he sensi i i y o 6 ⫻10
2
genome
copies [2 g]), hese es o ma s may no be eadily au oma ed
o la ge-scale specimen p ocessing.
Whole- i us de ec ion using ecep o -media ed hemagglu i-
FIG. 2. Quali a i e de ec ion o B19 DNA in 30 pooled plasma specimens by PCR-ELISA. Fi e pools (PS1 o PS5) we e ound o ha e high
le els o B19 DNA, he le els o which we e subsequen ly quan i ied in e ms o B19 DNA (in in e na ional uni s pe millili e ) (see ex ). Ele en
pools (PS6 o PS15) appea ed o con ain low le els o B19 DNA. In 14 pools (PS17 o PS30), any B19 DNA p esen was below he PCR-ELISA
cu o o 1.6 ⫻10
3
IU/ml.
TABLE 2. B19 i ological and se ological s a us o pooled
plasma and indi idual specimens
Specimen
a
Le el in plasma
B19 DNA (IU/ml) B19 IgG (IU/ml) B19 IgM (index
b
)
PS1 2.2 ⫻10
8
59.5 0.19
PS2 5.0 ⫻10
8
74.0 0.22
PS3 1.6 ⫻10
8
72.0 0.23
PS4 1.2 ⫻10
8
86.5 0.23
PS5 8.0 ⫻10
7
84.0 0.21
IDS1 8.0 ⫻10
11
0.0 0.13
IDS2 7.0 ⫻10
11
0.0 0.08
IDS3 2.0 ⫻10
11
0.0 0.08
IDS4 1.4 ⫻10
11
0.0 0.26
IDS5 1.2 ⫻10
9
0.0 2.02
IDS6 1.1 ⫻10
11
0.0 0.24
IDS7 3.2 ⫻10
11
0.0 0.60
a
PS1 o ⫺5, pooled plasma specimens; IDS1 o ⫺7, indi idual specimens.
b
B19 IgM alues a e exp essed as index alues ( a io o specimen op ical
densi y o cu o alue op ical densi y). An index o ⬎1.1 implies B19 IgM
posi i i y.
VOL. 40, 2002 B19 PCR-ELISA 1961
na ion has been p oposed as a s a egy o he de ec ion o B19
in plasma (16, 23). Howe e , due o documen ed alse nega-
i i y in he p esence o B19 IgG and IgM and he absence o
p ecise sensi i i y o de ec ion in e ms o genome equi alen s
pe millili e (23), his me hod does no su icien ly gua an ee
blood p oduc sa e y, in e ms o he absence B19 con amina-
ion. The mean plasma B19 IgG le el o 75.2 IU/ml obse ed
in pooled plasma specimens PS1 o -5 s ongly sugges s ha
an ibody p esence in plasma does no in e e e wi h B19 DNA
ex ac ion o , con e sely, ha B19 p esence in plasma pools
does no in e e e wi h B19 an ibody de ec ion in se ological
assays. Since he indi idual dona ions sc eened we e all B19
IgG nega i e, i is no possible o p edic i ee i us in e e es
wi h an ibody de ec ion in specimens ob ained om indi idual
dono s. Howe e , i should be no ed ha specimen IDS5,
which was also B19 IgM posi i e, con ained 100 imes less B19
DNA han all o he indi idual specimens es ed. This obse -
a ion may e lec i us diminu ion as he humo al esponse is
moun ed. The p esence and absence o IgG eac i i y agains
linea epi opes o VP1 and VP2, espec i ely, a e consis en
wi h esul s ob ained ollowing he se ological e alua ion o
indi idual se um samples by Wes e n blo analysis (12). These
esul s sugges ha he po en ial p o ec i e na u e o B19 IgG
p esen in plasma pools p ima ily comp ises an ibody eac i i y
di ec ed agains bo h con o ma ional and VP1-unique egion
epi opes on B19 an igens.
The in oduc ion o a WHO B19 DNA in e na ional s anda d
ep esen s a signi ican ad ance in he imp o emen o blood
p oduc sa e y and will se e o diminish ambigui y be ween e-
sul s om di e en o ganiza ions cu en ly using ei he a ious
assay o ma s o quan i a i e e minology o exp ess B19 DNA
le els (i.e., genome equi alen s pe millili e , copies pe millili e ,
and PCR-de ec able uni s pe millili e [17]). Al hough he e is no
de ini i e in o ma ion ega ding he p ecise B19 i al load in
plasma which can ansmi in ec ion o ecipien s, i has been
epo ed ha le els g ea e han 10
7
genome equi alen s/ml, in
h ee indi idual lo s o pooled plasma (Sol en /De e gen
T ea ed Viplas/SD), esul ed in B19 se ocon e sion in 19 ecipi-
en s (4). Consequen ly, he e is now an impe us o iden i y and
emo e indi idual high- i e B19 plasma dona ions om plasma
pools, and a numbe o companies ha e in oduced minipool
sc eening o add ess his p oblem.
In conclusion, he cu en ly ecommended maximum le el
o 10
4
genome equi alen s/ml o B19 DNA in plasma pools as
a sa e i al load sugges s ha he B19 PCR-ELISA p esen ed
he e, which is calib a ed agains he in e na ional s anda d and
has a cu o o 8 IU o B19 DNA (1.6 ⫻10
3
IU o B19
DNA/ml), has an applica ion o he apid sc eening o plasma
dona ions o minipools o pa o i us B19 DNA, he eby lead-
ing o an imp o emen in blood p oduc sa e y.
ACKNOWLEDGMENTS
This wo k was suppo ed by En e p ise I eland and he I ish Heal h
Resea ch Boa d.
REFERENCES
1. Abe ham, C., C. Pendl, P. G oss, G. Ze lau h, and M. A. Gessne . 2001.
Quan i a i e, in e nally con olled eal- ime PCR assay o he de ec ion o
pa o i us B19 DNA. J. Vi ol. Me hods 92:183–191.
2. Cassino i, P., and G. Siegl. 2000. Quan i a i e e idence o pe sis ence o
human pa o i us B19 DNA in an immunocompe en indi idual. Eu .
J. Clin. Mic obiol. In ec . Dis. 19:886–887.
3. Cubie, H. A., P. J. Molyneaux, M. J. Shea man, J. G yzbowski, and T.
B own. 1995. Do -blo hyb idisa ion assay o de ec ion o pa o i us B19
in ec ions using syn he ic oligonucleo ides. Mol. Cell. P obes 9:59–65.
4. Da enpo , R., G. Geohas, S. Cohen, K. Beach, A. Lazo, K. Lucchesi, and J.
Peh a. 2000. Phase IV s udy o Plas⫹[ eg]SD: hepa i is A (HAV) and pa -
o i us B19 (B19) sa e y esul s. Blood 96:1942.
5. Dieck, D., R. L. Schild, M. Hansmann, and A. M. Eis-Hubinge . 1999. P ena al
diagnosis o congeni al pa o i us B19 in ec ion: alue o se ological and PCR
echniques in ma e nal and e al se um. P ena . Diagn. 19:1119–1123.
6. Doyle, S., S. Ke , G. O’Kee e, D. O’Ca oll, P. Daly, and C. Kil y. 2000.
De ec ion o pa o i us B19 IgM by an ibody cap u e enzyme immunoassay:
ecei e ope a ing cha ac e is ic analysis. J. Vi ol. Me hods 90:143–152.
7. Du igon, E. L., D. D. E dman, G. W. Ga y, M. A. Pallansch, T. J. To ok, and
L. J. Ande son. 1993. Mul iple p ime pai s o polyme ase chain eac ion
(PCR) ampli ica ion o human pa o i us B19 DNA. J. Vi ol. Me hods
44:155–165.
8. Ennis, O., A. Co co an, K. Ka anagh, B. P. Mahon, and S. Doyle. 2001.
Baculo i us exp ession o pa o i us B19 (B19V) NS1: u ili y in con i ming
ecen in ec ion. J. Clin. Vi ol. 22:55–60.
9. Fe guson, M., D. Walke , and B. Cohen. 1997. Repo o a collabo a i e
s udy o es ablish he in e na ional s anda d o pa o i us B19 se um IgG.
Biologicals 25:283–288.
10. G ube , F., F. G. Falkne , F. Do ne , and T. Hamme le. 1998. P ecise
quan i a ion o human pa o i us B19 DNA in biological samples by PCR.
Biologicals 26:213–216.
11. Jo dan, J., B. Taingo, J. Kiss, and W. Koch. 1998. Human pa o i us B19:
p e alence o i al DNA in olun ee blood dono s and clinical ou comes o
ans usion ecipien s. Vox Sang. 75:97–102.
12. Ke , S., G. O’Kee e, C. Kil y, and S. Doyle. 1999. Undena u ed pa o i us
B19 an igens a e essen ial o he accu a e de ec ion o pa o i us B19 IgG.
J. Med. Vi ol. 57:179–185.
13. McOmish, F., P. L. Yap, A. Jo dan, H. Ha , B. J. Cohen, and P. Simmonds.
1993. De ec ion o pa o i us B19 in dona ed blood: a model sys em o
sc eening by polyme ase chain eac ion. J. Clin. Mic obiol. 31:323–328.
14. Musiani, M., M. Ze bini, G. Gen ilomi, M. Plazzi, G. Gallinella, and S.
Ven u oli. 1995. Pa o i us B19 clea ance om pe iphe al blood a e acu e
in ec ion. J. In ec . Dis. 172:1360–1363.
15. P owse, C., C. A. Ludlam, and P. L. Yap. 1997. Human pa o i us B19 and
blood p oduc s. Vox Sang. 72:1–10.
16. Saka a, H., H. Iha a, S. Sa o, T. Ka o, H. Ikeda, and S. Sekiguchi. 1999.
E iciency o dono sc eening o human pa o i us B19 by he ecep o -
media ed hemagglu ina ion assay me hod. Vox Sang. 77:197–203.
17. Saldanha, J. 2001. Valida ion and s anda disa ion o nucleic acid ampli ica-
ion echnology (NAT) assays o he de ec ion o i al con amina ion o
blood and blood p oduc s. J. Clin. Vi ol. 20:7–13.
18. Saldanha, J., P. Mino , e al. 1997. Collabo a i e s udy o assess he sui abili y
o a p oposed wo king eagen o human pa o i us B19 DNA de ec ion in
plasma pools by gene ampli ica ion echniques. Vox Sang. 73:207–211.
18a.Saldanha, J., N. Lelie, M. W. Yu, A. Hea h, and he B19 Collabo a i e S udy
G oup. 2002. Es ablishmen o he i s Wo ld Heal h O ganiza ion In e na-
ional S anda d o human pa o i us B19 DNA nucleic acid ampli ica ion
echniques. Vox Sang. 82:24–31.
19. Sa o, K., E. Ma suda, K. Kamisango, H. Iwasaki, S. Ma suba a, and Y.
Ma sunaga. 2000. De elopmen o a hype sensi i e de ec ion me hod o
human pa o i us B19 DNA. J. Clin. Mic obiol. 38:1241–1243.
20. Schleuning, M., G. Jage , E. Holle , W. Hill, C. Thomssen, C. Denzlinge , T.
Lo enz, G. Ledde ose, W. Wilmanns, and H.-J. Kolb. 1999. Human pa o-
i us B19-associa ed disease in bone ma ow ansplan a ion. In ec ion 27:
114–117.
21. Shade, R. O., M. C. Blundell, S. F. Co mo e, P. Ta e sall, and C. R. As ell.
1986. Nucleo ide sequence and genome o ganiza ion o human pa o i us
B19 isola ed om he se um o a child du ing aplas ic c isis. J. Vi ol. 58:
921–936.
22. an Elsacke -Niele, A. M. W., and A. C. M. K oes. 1999. Human pa o i us
B19: ele ance in in e nal medicine. Ne h. J. Med. 54:221–230.
23. Wakama su, C., F. Takaku a, E. Kojima, Y. Ki iyama, N. Go o, K. Ma su-
mo o, M. Oyama, H. Sa o, K. Okochi, and Y. Maeda. 1999. Sc eening o
blood dono s o human pa o i us B19 and cha ac e isa ion o he esul s.
Vox Sang. 76:14–21.
24. Ze bini, M., D. Gibellini, M. Musiani, S. Ven u oli, G. Gallinella, and G.
Gen ilomi. 1995. Au oma ed de ec ion o digoxigenin-labelled B19 pa o i-
us amplicons by a cap u e hyb idiza ion assay. J. Vi ol. Me hods 55:1–9.
25. Ze bini, M., G. Gallinella, E. Mana esi, M. Musiani, G. Gen ilomi, and S.
Ven u oli. 1999. S anda diza ion o a PCR-ELISA in se um samples: diag-
nosis o ac i e pa o i us B19 in ec ion. J. Med. Vi ol. 59:239–244.
26. Ze bini, M., G. Gen ilomi, M. C icca, E. Mana esi, F. Bon icini, and M. Mu-
siani. 2001. A sys em o enhance he sensi i i y o digoxigenin-labelled p obe:
de ec ion o B19 DNA in se um samples. J. Vi ol. Me hods 93:137–144.
1962 DALY ET AL. J. CLIN.MICROBIOL.