High-Sensitivity PCR Detection of Parvovirus B19 Plasma

JOURNAL OF CLINICAL MICROBIOLOGY, June 2002, p. 1958–1962 Vol. 40, No. 6 0095-1137/02/$04.00⫹0 DOI: 10.1128/JCM.40.6.1958–1962.2002 Copy igh © 2002, Ame ican Socie y o Mic obiology. All Righ s Rese ed. High-Sensi i i y PCR De ec ion o Pa o i us B19 in Plasma P. Daly, 1 A. Co co an, 1 B. P. Mahon, 1,2 and S. Doyle 1 * Depa men o Biology 1 and Ins i u e o Immunology, 2 Na ional Uni e si y o I eland, Maynoo h, Coun y Kilda e, I eland Recei ed 27 No embe 2001/Re u ned o modi ica ion 22 Janua y 2002/Accep ed 1 Ma ch 2002 Pa o i us B19 (B19) is a human pa hogen ansmi ed o suscep ible indi iduals ia espi a o y sec e ions and con amina ed blood o blood p oduc s. B19 le els in pooled plasma o less han 10 4 genome equi alen s/ml may no be in ec ious, while hose g ea e han 10 7 /ml a e capable o ansmi ing in ec ion. A Wo ld Heal h O ganiza ion (WHO) B19 DNA in e na ional s anda d has been ecen ly in oduced. The pu pose o he p esen wo k was o de elop a PCR–enzyme-linked immunoso ben assay (PCR-ELISA) calib a ed agains he WHO B19 DNA in e - na ional s anda d which could easily and eliably de ec B19 DNA le els in plasma abo e 10 4 IU/ml (6.5 ⴛ10 3 genome equi alen s/ml). A B19 PCR-ELISA sys em was de eloped which uses a dini ophenyla ed oligonucleo ide p obe o de ec immobilized bio inyla ed amplicons ollowing single- ound PCR ampli ica ion. The le el o B19 DNA (in in e na ional uni s pe millili e ) in indi idual and pooled plasma specimens was e alua ed. P o einase K ea men o plasma was ound o be su icien o quan i a i ely elease B19 DNA. The B19 PCR-ELISA had a sensi i i y o de ec ion o 1.6 ⴛ10 3 IU/ml B19 DNA and a dynamic ange ex ending om 8 o 1,000 IU o B19 DNA (equi alen o 1.6 ⴛ10 3 o 2 ⴛ10 5 IU o B19 DNA/ml). Fu he mo e, he an ibody p o ile o pooled plasma p oduc s was de e mined in e ms o B19 immunoglobulin G (IgG) (in in e na ional uni s pe millili e ). The B19 IgG le el was ound o be 64.7 ⴞ17.5 IU/ml (mean ⴞs anda d de ia ion). The B19 PCR-ELISA, which is calib a ed agains he B19 DNA in e na ional s anda d, may ha e an applica ion o he apid sc eening o plasma minipools o B19 DNA, he eby leading o an imp o emen in blood p oduc sa e y. Pa o i us B19 (B19) is he causa i e agen o mul iple hu- man diseases, including ex ensi e e al loss and se e e disease o e en dea h in immunocomp omised indi iduals (20, 22). Indeed, i can be es ima ed ha upwa ds o 3,000 p egnancies pe annum may be los in he Eu opean Union and he Uni ed S a es due o B19 in ec ion, based on an in ec ion a e o 0.1% and a suscep ible coho o o e 3 million p egnancies in ol - ing se onega i e emales. In Eu ope, i has been p oposed ha 15% o immunocomp omised pa ien s may succumb o B19 in ec ion pe annum, leading o a esul an mo ali y a e o 7% in his pa ien coho (20). While i al in ec ion can occu hough ei he espi a o y sec e ions o con amina ed blood o blood p oduc s, he p e- cise i al load equi ed o ini ia e in ec ion is unknown. Con- sequen ly, B19 con amina ion o pooled blood p oduc s is o majo signi icance, p ima ily due o he high physicochemical ole ance o B19 o many o he ea men s used in plasma p ocessing allied o he ex emely high le els o i emia in acu ely in ec ed, and o en asymp oma ic, indi iduals (⬎10 12 genome equi alen s/ml) (15). These ac o s combine o p esen signi ican challenges o manu ac u e s in e ms o he p oduc ion o B19- ee ma e ial. Indeed, in he absence o o icial egula ions o con ol he sa e y o blood o blood p oduc s wi h espec o B19 p esence, indi idual manu ac u - e s ha e es ablished minipool sc eening p o ocols o minimize B19 con amina ion (1). While se ological diagnosis o i al in ec ion is now well s anda dized and widely a ailable (6, 12), only a limi ed num- be o me hods o he ex ac ion and de ec ion o B19 nucleic acid in single o pooled blood p oduc s ha e, as ye , been desc ibed (1, 3, 11, 19, 24). These assays p ima ily u ilize ei he digoxigenin (DIG)-labeled UTP inco po a ion in o newly syn- hesized amplicons du ing PCR o acili a e de ec ion o quan- i a i e PCR echnology such as Taqman chemis y (1, 24). Despi e nume ous ad an ages, applica ion o hese sys ems o B19 DNA de ec ion in ei he indi idual o pooled plasma uni s may be limi ed by i ep oducibili y o DIG-UTP inco po a ion, low sensi i i y, and cos ac o s. None heless, he a ailabili y o hese me hods—combined wi h eliable me hods o an ibody de ec ion and he in oduc- ion o in e na ional-s anda d p epa a ions o he quan i a- ion o B19 immunoglobulin G (IgG) and, mo e ecen ly, B19 DNA—is leading o u he imp o emen s in he si ua ion in which manu ac u e s had depended on he p esence o high le els o B19 IgG alone, in pooled plasma p oduc s, as an indica o o p oduc sa e y (9, 13, 15, 17). Fu he mo e, a ecen epo has shown ha 1 IU o B19 DNA equals 0.65 genome equi alen (1). Despi e hese ad ances, a ecen s udy has highligh ed p oblems wi h bo h specimen p epa a ion and lack o es sys em s anda diza ion o he de ec ion o B19 DNA (17). Mo eo e , i has been shown ha B19 can pe sis , a low le els, in immunocompe en indi iduals o up o 6 o 40 mon hs pos in ec ion (2, 14), implying ha ul asensi i e B19 DNA de ec ion is no be sui able o plasma sc eening due o de ec ion o i emic, hough nonin ec ious, plasma uni s. Fu - he mo e, he ecen obse a ion ha p epa a ions o a pooled plasma p oduc (Sol en /De e gen T ea ed Viplas/SD), con- aining less han 10 4 genome equi alen s/ml, did no lead o se ocon e sion in heal hy, B19-se onega i e olun ee s while unde e alua ion in a phase IV clinical ial has led o he consensus ha his le el o B19 con amina ion may be a sa e * Co esponding au ho . Mailing add ess: Depa men o Biology, Na ional Uni e si y o I eland, Maynoo h, Coun y Kilda e, I eland. Phone: 353-1-7083858. Fax: 353-1-7083845. E-mail: sean.doyle@may .ie. 1958 i al load which is incapable o ansmi ing B19 in ec ion o blood p oduc ecipien s (4). He e, we epo he de elopmen o a obus and eliable mic opla e de ec ion sys em o he de ec ion o bio inyla ed PCR p oduc using dini ophenyl (DNP)-labeled p obes, in combina ion wi h an ibody-enzyme conjuga e, o he de ec- ion o B19 DNA in se um o plasma a a sensi i i y o 1.6 ⫻ 10 3 IU/ml, which may ha e a u ili y in plasma sc eening. MATERIALS AND METHODS Specimens. Aliquo s o Sol en /De e gen T ea ed Viplas/SD plasma uni s (PS1 o -32), each comp ising 5,000 indi idual dona ions, we e ob ained om A is ides Lazo (VI Technologies, Bos on, Mass.) while indi idual uni s o pa - o i us B19-con aining plasma (IDS1 o -7) we e kind gi s om bo h Alb ech G oene and Thomas Weime (A en is Beh ing, Ma bu g, Ge many). The Wo ld Heal h O ganiza ion (WHO) B19 DNA in e na ional s anda d (99/800) o nucleic acid es ing was ob ained om he Na ional Ins i u e o Biological S anda ds and Con ol, Po e s Ba , He o dshi e, Uni ed Kingdom (18a). This ma e ial, which con ains in ac B19 i ions, consis s o lyophilized, pooled plasma con aining a known copy numbe o 5 ⫻10 5 IU o B19 DNA/ ial. All o he specimens which we e used o con i m PCR–enzyme-linked immunoso ben assay (PCR-ELISA) speci ici y (n⫽200) we e ob ained om he I ish Blood T ans usion Se ice (Dublin, I eland). A con ol plasmid (pB19NS1) con aining he en i e B19 NS1 coding egion was used as posi i e con ol o all PCRs and was p epa ed as p e iously desc ibed (8). DNA concen a ion o pB19NS1 was compu ed om A 260 measu emen s and was used in pa allel wi h he B19 DNA in e na ional s anda d in he es ablishmen o es sensi i i y. No e: B19 le els a e exp essed in a ious ways h oughou his epo , which e lec s how le els we e epo ed in he o iginal publica ions ci ed. Specimen p epa a ion and B19 DNA ampli ica ion. Undilu ed o dilu ed (10 ⫺4 o 10 ⫺10 in phospha e-bu e ed saline) specimens (100 ␮l) we e diges ed wi h 2 ␮l o p o einase K (20 mg/ml) a 56°C o 1 h, and his was ollowed by boiling and cen i uga ion (13,000 ⫻g o 30 min a 4°C) o emo e p ecipi a ed p o ein. Specimens we e also ex ac ed wi h he QiAmp Blood ki (QIAGEN, Hilden, Ge many) as desc ibed by he manu ac u e (whe e indica ed). DNA ex ac ion was pe o med in a labo a o y sepa a e om ha in which PCR eagen p epa a ion and nucleic acid ampli ica ion we e ca ied ou . Templa e DNA p esen in he supe na an (5 ␮l) was added o he ollowing mix u e: 10 mM T is-HCl (pH 9.0), 50 mM KCl, 0.1%( ol/ ol) T i on X-100, 2.0 mM MgCl 2 , a 200 ␮M concen a ion o each deoxynucleoside iphospha e (P omega, Mad- ison, Wis.), 1 M be aine (which enhanced he PCR) (Sigma, Poole, Uni ed Kingdom) (da a no shown), a 1.0 ␮M concen a ion o each oligonucleo ide p ime (Table 1) (5, 7) speci ic o egions wi hin he NS1 coding egion o he B19 genome, and 1.25 U o Taq polyme ase (P omega) in a o al olume o 50 ␮l. Ampli ica ion was as ollows: 95°C o 6 min ollowed by 35 cycles o 95°C o 1 min, 55°C o 1 min, and 72°C o 2 min, e mina ing in 72°C o 5 min. Ten mic oli e s o each PCR p oduc was subjec ed o 1% (w / ol) aga ose gel elec opho esis wi h e hidium b omide (0.5 ␮g/ml; Sigma) o 30 min a 100 V. Amplicon isualiza ion was pe o med using an Eagle-Eye II gel documen a ion sys em (S a agene, La Jolla, Cali .). Mic opla e p epa a ion and immunoassay o ma . Mic owells (Nunc, Ros- kilde, Denma k) we e coa ed wi h s ep a idin (2.5 ␮g/ml) and s abilized o 4°C s o age by he addi ion o 1% (w / ol) bo ine se um albumin in 50 mM sodium ca bona e bu e , pH 9.4. Bio inyla ed PCR p oduc s we e dilu ed 1/20 in 6⫻ SSC (1⫻SSC is 0.15 M NaCl plus 0.015 M sodium ci a e) o gi e a inal olume o 100 ␮l, added o mic owells coa ed wi h s ep a idin, and incuba ed a 37°C o 30 min. A e wo washes wi h phospha e-bu e ed saline–0.05% ( ol/ ol) Tween 20 (PBST), 100 ␮l o 125 mM NaOH–100 mM NaCl was added o he mic owells o dissocia e DNA duplex, incuba ed a oom empe a u e o 10 min, and washed ou imes wi h PBST. Then, 100 ␮l o DNP-labeled oligonucleo ide (Table 1) (100 ng/ml in 6⫻SSC–0.1% [w / ol] SDS) was added o he mic owells and incuba ed o 1ha 60°C ollowed by ou washes wi h PBST. Mic owells we e hen blocked wi h 2.5% (w / ol) milk powde in PBST o 1ha 20°C. Following emo al o he blocking solu ion, IgG (an i-DNP)-ho se adish pe ox- idase conjuga e was added, and he mix u e was incuba ed a oom empe a u e o 30 min and washed ou imes wi h PBST. Subs a e (100 ␮l o e ame hyl- benzidine) was hen added, and he mix u e was incuba ed o 15 min a oom empe a u e. The eac ion was e mina ed by he addi ion o 1 N sul u ic acid and measu ed spec opho ome ically a 450 and 630 nm (Dyna ech MRX). Se ology. B19 IgG and IgM immunoassays we e ob ained om Bio in (Dublin, I eland) and we e used as p e iously desc ibed (12) and in acco dance wi h manu- ac u e s’ins uc ions. B ie ly, all immunoassays u ilized con o ma ionally in ac B19 capsid an igens (VP1 and VP2) o an ibody cap u e, excep he Wes e n blo immunoassay o B19 IgG, which con ains dena u ed B19 capsid p o eins (12). RESULTS Assay sensi i i y. PCR-ELISA sensi i i y o de ec ion was e alua ed using dilu ions o bo h he WHO B19 DNA in e - na ional s anda d (99/800) and pu i ied con ol plasmid (pB19NS1) con aining he en i e NS1 gene. ELISA analysis o he B19 DNA in e na ional s anda d, ollowing p o einase K ex ac ion and PCR ampli ica ion using p ime s F1 and R1, acili a ed de ec ion o 8 IU o B19 DNA/5 ␮l (1.6 ⫻10 3 IU/ml) (Fig. 1). ELISA e alua ion, ollowing ex ac ion using he Qiagen spin column, esul ed in he de ec ion o 40 IU (8 ⫻10 3 IU/ml) o he B19 DNA in e na ional s anda d (Fig. 1). These esul s indica ed ha p o einase K diges ion o he in- e na ional s anda d esul ed in supe io de ec ion ela i e o ha o he spin column-ex ac ed ma e ial, and p o einase K diges ion was hus used in subsequen expe imen s. Figu e 1 illus a es a calib a ion cu e, ex ending o e 3 o de s o mag- ni ude, gene a ed ollowing PCR ampli ica ion o hal -log di- lu ions o he B19 DNA in e na ional s anda d which was subsequen ly used o compu e B19 DNA le els (in in e na- ional uni s pe millili e ) in indi idual and pooled plasma specimens. Fu he mo e, he imp o emen in PCR-ELISA sensi i i y (8 IU; 1.6 ⫻10 3 IU/ml) o e ha ob ained wi h e hidium b omide s aining (200 IU; 4 ⫻10 4 IU/ml) ollowing aga ose gel elec opho esis is also e iden (Fig. 1). A sensi i i y o de ec ion o 50 copies o he con ol plasmid (in 5 ␮l) was de e mined, which equa es o 10 4 copies/ml. Simila ly o he WHO in e na ional s anda d, he sensi i i y o de ec ion by aga ose gel elec opho esis was obse ed o be 10 imes lowe (500 copies o con ol plasmid [10 5 copies/ml]). Thus, he ELISA o ma con e s a leas a 10- old inc ease in sensi i i y o e e hidium b omide isualiza ion o amplicons. TABLE 1. Nucleo ide sequences o oligonucleo ide p ime s and hei ela i e posi ions in he B19 genome a P ime o p obe Gene Posi ion Sequence (5⬘33⬘) P ime s F1 NS1 1399–1422 Bio in-AATACACTGTGGTTTTATGGGCCG R1 NS1 1600–1576 CTAAAATGGCTTTTGCAGCTTCTAC P obe (DNP-Oligo) NS1 1536–1566 (DNP) 3 -CTTAATAATACCTTCATCCCAGACCACCAA a The oligonucleo ide p ime s we e selec ed based on p e ious obse a ions (5, 7). The ela i e nucleo ide posi ions o he B19 p ime s a e numbe ed acco ding o e e ence 21. P ime F1 was bio inyla ed a he 5⬘end o acili a e binding o amplicons o s ep a idin-coa ed mic o i e wells. The de ec ion p obe was labeled wi h h ee DNP g oups a he 5⬘end o acili a e IgG (an i-DNP)-ho se adish pe oxidase conjuga e binding. VOL. 40, 2002 B19 PCR-ELISA 1959 Specimen e alua ion. PCR-ELISA analysis o pooled plasma specimens (PS1 o -30) de ec ed high le els o i emia in specimens PS1 o -5 (Fig. 2). All o he pooled plasma spec- imens es ed con ained ei he low le els o B19 DNA o le els which we e below he sensi i i y o he es sys em. Subse- quen ly, he le els o B19 DNA p esen in specimens PS1 o -5 we e quan i ied and ound o con ain be ween 8.0 ⫻10 7 and 5.0 ⫻10 8 IU o B19 DNA/ml, in addi ion o B19 IgG le els o 59.5 o 86.5 IU/ml, which we e signi ican ly highe han he immunoassay cu o (3 IU/ml) (Table 2). No B19 IgM was de ec able in hese pools (Table 2) o any o he pooled plasma specimen. All specimens es ed we e posi i e o B19 IgG in all comme cial immunoassay sys ems, including mic opla e en- zyme immunoassay and immuno luo escen , Wes e n, and im- munoblo assays. No specimen eac i i y was obse ed agains dena u ed VP2 when es ed by Wes e n blo ing; howe e , all specimens we e VP1 posi i e by his me hod. The B19 IgG le el (mean ⫾s anda d de ia ion) in all plasma pools es ed was ound o be 64.7 ⫾17.5 IU/ml (n⫽30). Highe le els o B19 DNA (1.2 ⫻10 9 o 8.0 ⫻10 11 IU/ml) we e ound ollowing e alua ion o indi idual plasma dona- ions (IDS1 o -7). Signi ican ly, all o hese specimens we e B19 IgG nega i e, and only one con ained de ec able B19 IgM, sugges ing ha all indi iduals we e ecen ly in ec ed wi h B19 (Table 2). Finally, a pool o 200 se um specimens also es ed nega i e by he PCR-ELISA, u he con i ming assay speci- ici y (specimen/cu o abso bance a io, ⬍1.0). DISCUSSION A obus mic owell de ec ion sys em o he high-sensi i i y de ec ion o bio inyla ed amplicons ollowing ex ac ion and single- ound PCR ampli ica ion o pa o i us B19 DNA has been de eloped. The o e all ampli ica ion and de ec ion sys- em uses colo ime ic de ec ion o specimen isualiza ion, ex- hibi s a sensi i i y o de ec ion o 1.6 ⫻10 3 IU o B19 DNA/ml, is compa ible o use wi h ei he indi idual o pooled speci- mens, and is capable o being au oma ed. Signi ican ly, he equi emen o PCR-dependen inco po a ion o a de ec ion moie y (e.g., DIG) is ob ia ed. Al hough he use o comme cial ex ac ion ki s is hough o educe he p esence o PCR inhibi o s, especially o he de- e mina ion o i al load in plasma pools (18), he da a p e- sen ed he e demons a e ha p o einase K diges ion alone is su icien o quan i a i ely elease B19 DNA om pooled and indi idual plasma specimens ea ed wi h ci a e. Ex ac ion o specimen DNA is o pa amoun impo ance o ensu e quan i- a i e elease o a ge DNA, and a numbe o me hods o DNA ex ac ion based on e iciency, con enience, ep oduc- ibili y, and he p esence o inhibi o s ha e been in es iga ed (25). These au ho s ound ha ea men o se um specimens by apid hea ing ul illed he c i e ia o ou ine diagnosis while o he ex ac ion me hods, such as lysis ea men and comme - cial DNA ex ac ion ki s, ailed o yield highe le els o ex- ac ed DNA based on quan i a i e PCR esul s. Ou obse a- FIG. 1. PCR-ELISA quan i a ion using he WHO B19 DNA in e na ional s anda d. Hal -log dilu ions we e ex ac ed by p o einase K (solid line) o spin column (dashed line) me hodologies, subjec ed o PCR using p ime s F1 and R1, and analyzed by ELISA. Abso bance a 450 and 630 nm is plo ed e sus he log amoun o B19 DNA. The PCR-ELISA cu o (0.159) is indica ed by he ho izon al black line and was calcula ed as he mean plus 2 s anda d de ia ions [0.107 ⫹2(0.026)] ollowing eplica e analysis o 20 B19-DNA-nega i e specimens. A le el o 8 IU o B19 DNA was eliably de ec able ollowing p o einase K ex ac ion. Amplicon de ec ion by aga ose gel elec opho esis de ec ion is also shown (inse ). I can be seen ha a minimum o 200 IU o B19 DNA only can be de ec ed by his app oach. PD, p ime dime . 1960 DALY ET AL. J. CLIN.MICROBIOL. ions o ci a e- ea ed plasma a e in ag eemen wi h hose ound by Ze bini e al. (25), who ound ha specimen ea - men wi h p o einase K was mo e e icien o B19 DNA iso- la ion han comme cial ki s. This obse a ion should be o signi ican u ili y in he la ge-scale sc eening o plasma by blood p oduc manu ac u e s. A sensi i i y limi o 350 o 3,500 copies o B19 DNA has been epo ed (7) when single- ound PCR wi h op imized p ime pai s and e hidium b omide de ec ion has been used ollowing aga ose gel elec opho esis. Using hese p ime s, in combina ion wi h a modi ied PCR p ocedu e and ELISA- based amplicon e ela ion, a minimum o 8 IU o B19 DNA was de ec able in he p esen s udy, which ep esen s a signi - ican imp o emen o e his p e ious wo k. Al hough Du igon e al. (7) showed ha nes ed PCR imp o ed sensi i i y by up o 100- old, his op ion is no en i ely sui able o la ge-scale plasma sc eening, due o con amina ion isks. In he las decade a numbe o quan i a i e PCR assays ha e been de eloped o de ec B19 DNA in indi idual se um and plasma specimens; howe e , ew ha e di ec ly add essed ei he he issue o plasma pool con amina ion o assay compa ibili y wi h he ecen ly in oduced WHO B19 DNA in e na ional s anda d. Fu he mo e, hese assays may exhibi inapp op ia e sensi i i y o pooled plasma sc eening. Fo ins ance, Ze bini e al. (24) epo ed eliable de ec ion o 60 B19 genome equi - alen s (1.2 ⫻10 4 /ml) using DIG-labeled PCR p oduc de ec- ion, which is abo e he B19 le el (10 4 genome equi alen s/ml) hough o ep esen a nonin ec ious dose. Con e sely, o he au ho s ha e epo ed assay sensi i i ies o 168 and 100 B19 copies/ml, espec i ely, he use o which may lead o disca ding i emic, hough nonin ec ious, plasma uni s (10, 19). Al hough do blo hyb idiza ion assays using colo ime ic subs a es (En- Vison) ha e been de eloped (26) which can de ec 3 ⫻10 3 copies (10 g) o B19 DNA (while he addi ion o chemilumi- nescen subs a es inc eased he sensi i i y o 6 ⫻10 2 genome copies [2 g]), hese es o ma s may no be eadily au oma ed o la ge-scale specimen p ocessing. Whole- i us de ec ion using ecep o -media ed hemagglu i- FIG. 2. Quali a i e de ec ion o B19 DNA in 30 pooled plasma specimens by PCR-ELISA. Fi e pools (PS1 o PS5) we e ound o ha e high le els o B19 DNA, he le els o which we e subsequen ly quan i ied in e ms o B19 DNA (in in e na ional uni s pe millili e ) (see ex ). Ele en pools (PS6 o PS15) appea ed o con ain low le els o B19 DNA. In 14 pools (PS17 o PS30), any B19 DNA p esen was below he PCR-ELISA cu o o 1.6 ⫻10 3 IU/ml. TABLE 2. B19 i ological and se ological s a us o pooled plasma and indi idual specimens Specimen a Le el in plasma B19 DNA (IU/ml) B19 IgG (IU/ml) B19 IgM (index b ) PS1 2.2 ⫻10 8 59.5 0.19 PS2 5.0 ⫻10 8 74.0 0.22 PS3 1.6 ⫻10 8 72.0 0.23 PS4 1.2 ⫻10 8 86.5 0.23 PS5 8.0 ⫻10 7 84.0 0.21 IDS1 8.0 ⫻10 11 0.0 0.13 IDS2 7.0 ⫻10 11 0.0 0.08 IDS3 2.0 ⫻10 11 0.0 0.08 IDS4 1.4 ⫻10 11 0.0 0.26 IDS5 1.2 ⫻10 9 0.0 2.02 IDS6 1.1 ⫻10 11 0.0 0.24 IDS7 3.2 ⫻10 11 0.0 0.60 a PS1 o ⫺5, pooled plasma specimens; IDS1 o ⫺7, indi idual specimens. b B19 IgM alues a e exp essed as index alues ( a io o specimen op ical densi y o cu o alue op ical densi y). An index o ⬎1.1 implies B19 IgM posi i i y. VOL. 40, 2002 B19 PCR-ELISA 1961 na ion has been p oposed as a s a egy o he de ec ion o B19 in plasma (16, 23). Howe e , due o documen ed alse nega- i i y in he p esence o B19 IgG and IgM and he absence o p ecise sensi i i y o de ec ion in e ms o genome equi alen s pe millili e (23), his me hod does no su icien ly gua an ee blood p oduc sa e y, in e ms o he absence B19 con amina- ion. The mean plasma B19 IgG le el o 75.2 IU/ml obse ed in pooled plasma specimens PS1 o -5 s ongly sugges s ha an ibody p esence in plasma does no in e e e wi h B19 DNA ex ac ion o , con e sely, ha B19 p esence in plasma pools does no in e e e wi h B19 an ibody de ec ion in se ological assays. Since he indi idual dona ions sc eened we e all B19 IgG nega i e, i is no possible o p edic i ee i us in e e es wi h an ibody de ec ion in specimens ob ained om indi idual dono s. Howe e , i should be no ed ha specimen IDS5, which was also B19 IgM posi i e, con ained 100 imes less B19 DNA han all o he indi idual specimens es ed. This obse - a ion may e lec i us diminu ion as he humo al esponse is moun ed. The p esence and absence o IgG eac i i y agains linea epi opes o VP1 and VP2, espec i ely, a e consis en wi h esul s ob ained ollowing he se ological e alua ion o indi idual se um samples by Wes e n blo analysis (12). These esul s sugges ha he po en ial p o ec i e na u e o B19 IgG p esen in plasma pools p ima ily comp ises an ibody eac i i y di ec ed agains bo h con o ma ional and VP1-unique egion epi opes on B19 an igens. The in oduc ion o a WHO B19 DNA in e na ional s anda d ep esen s a signi ican ad ance in he imp o emen o blood p oduc sa e y and will se e o diminish ambigui y be ween e- sul s om di e en o ganiza ions cu en ly using ei he a ious assay o ma s o quan i a i e e minology o exp ess B19 DNA le els (i.e., genome equi alen s pe millili e , copies pe millili e , and PCR-de ec able uni s pe millili e [17]). Al hough he e is no de ini i e in o ma ion ega ding he p ecise B19 i al load in plasma which can ansmi in ec ion o ecipien s, i has been epo ed ha le els g ea e han 10 7 genome equi alen s/ml, in h ee indi idual lo s o pooled plasma (Sol en /De e gen T ea ed Viplas/SD), esul ed in B19 se ocon e sion in 19 ecipi- en s (4). Consequen ly, he e is now an impe us o iden i y and emo e indi idual high- i e B19 plasma dona ions om plasma pools, and a numbe o companies ha e in oduced minipool sc eening o add ess his p oblem. In conclusion, he cu en ly ecommended maximum le el o 10 4 genome equi alen s/ml o B19 DNA in plasma pools as a sa e i al load sugges s ha he B19 PCR-ELISA p esen ed he e, which is calib a ed agains he in e na ional s anda d and has a cu o o 8 IU o B19 DNA (1.6 ⫻10 3 IU o B19 DNA/ml), has an applica ion o he apid sc eening o plasma dona ions o minipools o pa o i us B19 DNA, he eby lead- ing o an imp o emen in blood p oduc sa e y. ACKNOWLEDGMENTS This wo k was suppo ed by En e p ise I eland and he I ish Heal h Resea ch Boa d. REFERENCES 1. Abe ham, C., C. Pendl, P. G oss, G. Ze lau h, and M. A. Gessne . 2001. Quan i a i e, in e nally con olled eal- ime PCR assay o he de ec ion o pa o i us B19 DNA. J. Vi ol. Me hods 92:183–191. 2. Cassino i, P., and G. Siegl. 2000. Quan i a i e e idence o pe sis ence o human pa o i us B19 DNA in an immunocompe en indi idual. Eu . J. Clin. Mic obiol. In ec . Dis. 19:886–887. 3. Cubie, H. A., P. J. Molyneaux, M. J. Shea man, J. G yzbowski, and T. B own. 1995. Do -blo hyb idisa ion assay o de ec ion o pa o i us B19 in ec ions using syn he ic oligonucleo ides. Mol. Cell. P obes 9:59–65. 4. Da enpo , R., G. Geohas, S. Cohen, K. Beach, A. Lazo, K. Lucchesi, and J. Peh a. 2000. Phase IV s udy o Plas⫹[ eg]SD: hepa i is A (HAV) and pa - o i us B19 (B19) sa e y esul s. Blood 96:1942. 5. Dieck, D., R. L. Schild, M. Hansmann, and A. M. Eis-Hubinge . 1999. P ena al diagnosis o congeni al pa o i us B19 in ec ion: alue o se ological and PCR echniques in ma e nal and e al se um. P ena . Diagn. 19:1119–1123. 6. Doyle, S., S. Ke , G. O’Kee e, D. O’Ca oll, P. Daly, and C. Kil y. 2000. De ec ion o pa o i us B19 IgM by an ibody cap u e enzyme immunoassay: ecei e ope a ing cha ac e is ic analysis. J. Vi ol. Me hods 90:143–152. 7. Du igon, E. L., D. D. E dman, G. W. Ga y, M. A. Pallansch, T. J. To ok, and L. J. Ande son. 1993. Mul iple p ime pai s o polyme ase chain eac ion (PCR) ampli ica ion o human pa o i us B19 DNA. J. Vi ol. Me hods 44:155–165. 8. Ennis, O., A. Co co an, K. Ka anagh, B. P. Mahon, and S. Doyle. 2001. Baculo i us exp ession o pa o i us B19 (B19V) NS1: u ili y in con i ming ecen in ec ion. J. Clin. Vi ol. 22:55–60. 9. Fe guson, M., D. Walke , and B. Cohen. 1997. Repo o a collabo a i e s udy o es ablish he in e na ional s anda d o pa o i us B19 se um IgG. Biologicals 25:283–288. 10. G ube , F., F. G. Falkne , F. Do ne , and T. Hamme le. 1998. P ecise quan i a ion o human pa o i us B19 DNA in biological samples by PCR. Biologicals 26:213–216. 11. Jo dan, J., B. Taingo, J. Kiss, and W. Koch. 1998. Human pa o i us B19: p e alence o i al DNA in olun ee blood dono s and clinical ou comes o ans usion ecipien s. Vox Sang. 75:97–102. 12. Ke , S., G. O’Kee e, C. Kil y, and S. Doyle. 1999. Undena u ed pa o i us B19 an igens a e essen ial o he accu a e de ec ion o pa o i us B19 IgG. J. Med. Vi ol. 57:179–185. 13. McOmish, F., P. L. Yap, A. Jo dan, H. Ha , B. J. Cohen, and P. Simmonds. 1993. De ec ion o pa o i us B19 in dona ed blood: a model sys em o sc eening by polyme ase chain eac ion. J. Clin. Mic obiol. 31:323–328. 14. Musiani, M., M. Ze bini, G. Gen ilomi, M. Plazzi, G. Gallinella, and S. Ven u oli. 1995. Pa o i us B19 clea ance om pe iphe al blood a e acu e in ec ion. J. In ec . Dis. 172:1360–1363. 15. P owse, C., C. A. Ludlam, and P. L. Yap. 1997. Human pa o i us B19 and blood p oduc s. Vox Sang. 72:1–10. 16. Saka a, H., H. Iha a, S. Sa o, T. Ka o, H. Ikeda, and S. Sekiguchi. 1999. E iciency o dono sc eening o human pa o i us B19 by he ecep o - media ed hemagglu ina ion assay me hod. Vox Sang. 77:197–203. 17. Saldanha, J. 2001. Valida ion and s anda disa ion o nucleic acid ampli ica- ion echnology (NAT) assays o he de ec ion o i al con amina ion o blood and blood p oduc s. J. Clin. Vi ol. 20:7–13. 18. Saldanha, J., P. Mino , e al. 1997. Collabo a i e s udy o assess he sui abili y o a p oposed wo king eagen o human pa o i us B19 DNA de ec ion in plasma pools by gene ampli ica ion echniques. Vox Sang. 73:207–211. 18a.Saldanha, J., N. Lelie, M. W. Yu, A. Hea h, and he B19 Collabo a i e S udy G oup. 2002. Es ablishmen o he i s Wo ld Heal h O ganiza ion In e na- ional S anda d o human pa o i us B19 DNA nucleic acid ampli ica ion echniques. Vox Sang. 82:24–31. 19. Sa o, K., E. Ma suda, K. Kamisango, H. Iwasaki, S. Ma suba a, and Y. Ma sunaga. 2000. De elopmen o a hype sensi i e de ec ion me hod o human pa o i us B19 DNA. J. Clin. Mic obiol. 38:1241–1243. 20. Schleuning, M., G. Jage , E. Holle , W. Hill, C. Thomssen, C. Denzlinge , T. Lo enz, G. Ledde ose, W. Wilmanns, and H.-J. Kolb. 1999. Human pa o- i us B19-associa ed disease in bone ma ow ansplan a ion. In ec ion 27: 114–117. 21. Shade, R. O., M. C. Blundell, S. F. Co mo e, P. Ta e sall, and C. R. As ell. 1986. Nucleo ide sequence and genome o ganiza ion o human pa o i us B19 isola ed om he se um o a child du ing aplas ic c isis. J. Vi ol. 58: 921–936. 22. an Elsacke -Niele, A. M. W., and A. C. M. K oes. 1999. Human pa o i us B19: ele ance in in e nal medicine. Ne h. J. Med. 54:221–230. 23. Wakama su, C., F. Takaku a, E. Kojima, Y. Ki iyama, N. Go o, K. Ma su- mo o, M. Oyama, H. Sa o, K. Okochi, and Y. Maeda. 1999. Sc eening o blood dono s o human pa o i us B19 and cha ac e isa ion o he esul s. Vox Sang. 76:14–21. 24. Ze bini, M., D. Gibellini, M. Musiani, S. Ven u oli, G. Gallinella, and G. Gen ilomi. 1995. Au oma ed de ec ion o digoxigenin-labelled B19 pa o i- us amplicons by a cap u e hyb idiza ion assay. J. Vi ol. Me hods 55:1–9. 25. Ze bini, M., G. Gallinella, E. Mana esi, M. Musiani, G. Gen ilomi, and S. Ven u oli. 1999. S anda diza ion o a PCR-ELISA in se um samples: diag- nosis o ac i e pa o i us B19 in ec ion. J. Med. Vi ol. 59:239–244. 26. Ze bini, M., G. Gen ilomi, M. C icca, E. Mana esi, F. Bon icini, and M. Mu- siani. 2001. A sys em o enhance he sensi i i y o digoxigenin-labelled p obe: de ec ion o B19 DNA in se um samples. J. Vi ol. Me hods 93:137–144. 1962 DALY ET AL. J. CLIN.MICROBIOL.