Un a eling o Bo elia bu gdo e i sensu la o
genospecies di e si y in Po ugal owa ds he
de elopmen o mo e e icien diagnos ic ools o
Lyme disease
Mónica Susana Claudino Nunes
Decembe , 2016
Uni e sidade No a de Lisboa
Ins i u o de Higiene e Medicina T opical
Thesis p esen ed o ob ain he Ph.D. Deg ee in Biomedical Sciences,
specializa ion Mic obiology
Un a eling o Bo elia bu gdo e i sensu la o genospecies
di e si y in Po ugal owa ds he de elopmen o mo e
e icien diagnos ic ools o Lyme disease
Au ho : Mónica Susana Claudino Nunes
Supe iso : In es igado a Dou o a Ma ia Luísa Jo ge Viei a
Co-supe iso s:
P o essso Dou o An ónio Paulo Gou eia de Almeida
P o esso Dou o João José Inácio Sil a
Tu o ial Commission:
In es igado a Dou o a Ma ia Luísa Jo ge Viei a
P o esso Dou o Celso Vladimi o Fe ei a de Ab eu Cunha
In es igado a Dou o a Ma ia So ia Cob a Lince Núncio Soa es
Thesis p esen ed in ul illmen o he necessa y equi emen s o ob ain he Ph.D. deg ee
in Biomedical Sciences, specializa ion Mic obiology
Financial suppo o his wo k was p o ided by Fundação
pa a a Ciência e a Tecnologia (FCT), h ough he schola ship
SFRH/BD/78325/2011.
Uni e sidade No a de Lisboa
Ins i u o de Higiene e Medicina T opical
Bibliog aphic elemen s
Pape s in pee - e iewed in e na ional scien i ic jou nals di ec ly ela ed wi h he wo k
p esen ed in his hesis:
Pe ei a A, Pa ei a R, Nunes M, Casadinho A, Viei a ML, Campino L, Maia C. 2016.
Molecula de ec ion o ick-bo ne-bac e ia and p o ozoa in ce ids and wild boa s om
Po ugal, Pa asi es & Vec o s, 9: 251. Doi: 10.1186/s13071-016-1535-0;
Nunes M, Pa ei a R, Maia C, Lopes N, Finge le V, Viei a ML. 2016. Molecula
iden i ica ion o Bo elia genus in ques ing ha d icks om Po ugal: phylogene ic
cha ac e iza ion o wo no el Relapsing Fe e -like Bo elia sp. In ec ion, Gene ics and
E olu ion, 40: 266–274. Doi: 10.1016/j.meegid.2016.03.008;
Nunes M, Pa ei a R, Lopes N, Maia C, Ca ei a T, Sousa C, Fa ia S, Viei a ML. 2015.
Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om Po ugal. Vec o -
Bo ne and Zoono ic Diseases, 15 (8): 515-517. Doi: 10.1089/ bz.2014.1765;
Maia C, Almeida B, Coimb a M, Fe nandes MC, C i o ão JM, Ramos C, Ma ins A,
Ma inho F, Sil a P, Ne es N, Nunes M, Viei a ML, Ca doso L, Campino L. 2015.
Bac e ial and p o ozoal agen s o canine ec o -bo ne diseases in he blood o domes ic and
s ay dogs om sou he n Po ugal. Pa asi es & Vec o s, 8 (138): 759.
Doi: 10.1186/s13071-015-0759-8;
Fa ia AS, Pai a-Ca doso MN, Nunes M, Ca ei a T, Vale-Gonçal es HM, Veloso O,
Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2015. Fi s De ec ion o Bo elia
bu gdo e i sensu la o DNA in Se um o he Wild Boa (Sus sc o a) in No he n Po ugal
by Nes ed-PCR. EcoHeal h, 12(1): 183-187. Doi:10.1007/s10393-014-0973-4;
Maia C, Ramos C, Coimb a M, Bas os F, Ma ins A, Pin o P, Nunes M, Viei a ML,
Ca doso L, Campino L. 2014. Bac e ial and p o ozoal agen s o eline ec o -bo ne diseases
in domes ic and s ay ca s om sou he n Po ugal. Pa asi e & Vec o s, 7 (115): 2 – 8.
Doi: 10.1186/1756-3305-7-115;
Maia C, Fe ei a A, Nunes M, Viei a ML, Campino L, Ca doso L. 2014. Molecula
de ec ion o bac e ial and pa asi ic pa hogens in ha d icks om Po ugal. Ticks and Tick-
bo ne Diseases, 5(4): 409-14. Doi: 10.1016/j. bdis.2014.01.009;
Pape s in pee - e iewed in e na ional scien i ic jou nals di ec ly ela ed wi h he wo k
p esen ed in his hesis (submi ed o in p epa a ion):
Nunes M, Lopes N, Maia C, Almeida JP, Viei a ML. 2016. Cha ac e iza ion and
dis ibu ion o ixodids in nine dis ic s o mainland Po ugal whe e I. icinus p esence
was p e iously epo ed: Bo elia bu gdo e i s.l. p e alence (in submission);
Nunes M, Ca ei a T, Inácio J, Viei a ML. 2016. De elopmen and e alua ion o a wo-
s ep mul iplex TaqMan eal- ime PCR assay o de ec ion o Bo elia bu gdo e i s.l.
genospecies (in submission);
Nunes M, Nascimen o M, Ca ei a T, Inácio J, Viei a ML. 2016. De elopmen o a Loop
Media ed Iso he mal Ampli ica ion (LAMP) assay o he de ec ion o Bo elia
bu gdo e i s.l. genospecies DNA in ick samples (in p epa a ion).
O he pape s published du ing he p epa a ion o his hesis:
Pe ei a A, Figuei a L, Nunes M, Es e es A, Maia C, Co ão AJ, Viei a ML, Campino L,
Pa ei a R. 2016. Mul iple phlebo i us (Bunya i idae) gene ic g oups de ec ed in
Rhipicephalus, Hyalomma and De macen o icks om sou he n Po ugal. Ticks and
Tick-bo ne Diseases, 8 (1):45-52. Doi: 10.1016/j. bdis.2016.09.015;
Gonçal es DD, R Mou a RA, Nunes M, Ca ei a T, Vido o O, F ei as JC, Viei a ML.
2015. Bo elia bu gdo e i sensu la o in humans in a u al á ea o Pa ana S a e, B azil.
B azilian Jou nal o Mic obiology, 46 (2): 571-575. Doi: 10.1590/S1517-
838246220140097;
Gonçal es DD, Ca ei a T, Nunes M, Beni ez A, Lopes-Mo i FM, Vido o O, de F ei as
JC, Viei a ML. 2014. Fi s eco d o Bo elia bu gdo e i B31 s ain in De macen o
ni ens icks in he no he n egion o Pa ana (B azil). B azilian Jou nal o Mic obiology,
44(3): 883-7. Doi: 10.1590/S1517-83822013000300035;
Co es S, Mau ício I, Kuhls K, Nunes M, Lopes C, Ma cos M, Ca doso L, Schonian G,
Campino L. 2014. Gene ic di e si y e alua ion on Po uguese Leishmania in an um

s ains by Mul ilocus Mic osa elli e Typing. In ec ion, Gene ics and E olu ion, 26: 20-
31. Doi: 10.1016/j.meegid.2014.04.023;
Maia C, Nunes M, Ma ques M, Hen iques S, Rolão N, Campino L. 2013. In i o
suscep ibili y o Leishmania in an um isola ed om humans and dogs. Expe imen al
Pa asi ology, 135 (1): 36-41. Doi: doi: 10.1016/j.exppa a.2013.05.015.
The wo k de eloped du ing his hesis was p esen ed in nine (9) o al communica ions and
wel e (12) pos e s a na ional and in e na ional con e ences:
O al communica ions
Pe ei a A, Pa ei a R, Nunes M, Casadinho A, Viei a ML, Campino L, Maia C. 2016.
Molecula de ec ion o ick-bo ne-bac e ia and p o ozoa in ce ids and wild boa s om
Po ugal. XI In e na ional Symposium on Vec o -Bo ne Diseases. 9-13 Maio. Miami,
Es ados Unidos da Amé ica. [OC las au ho ];
Nascimen o M, Nunes M, Viei a ML. 2015. “O imização de uma écnica de ampli icação
iso é mica associada a sondas molecula es pa a iden i icação das espécies de Bo elia
bu gdo e i sensu la o mais p e alen es em Po ugal”. 3º Cong esso Nacional de
Medicina T opical / 1º Cong esso Lusó ono de Doenças T ansmi idas po Ve o es,
IHMT/UNL, 20 e 21 Ab il, Lisboa. [OC 1s au o ];
Nunes M, Viei a ML, Inácio J, Nascimen o M, Pa ei a R. 2014. “O imização da écnica
LAMP pa a a iden i icação de genoespécies de Bo elia bu gdo e i s.l.”. V Jo nadas
Cien í icas do IHMT, 12 Dezemb o, IHMT/UNL, Lisboa. [OC 1s au o ];
Fa ia AS, Pai a-Ca doso M, Nunes M, Ca ei a T, Vale-Gonçal es HM, Veloso O,
Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2014. “P imei a de eção de DNA de
Bo elia bu gdo e i sensu la o em so o de ja ali”. VIII Jo nadas de Biologia da
Uni e sidade de T ás-os-Mon es e Al o-Dou o, 22 e 23 de Ou ub o, Vila-Real. [OC 1s
au o ];
Nunes M. 2014. “Iden i ica ion o Lyme Disease agen s in he Po uguese ixodo auna.”
Semina : “A h opoda – Vec o s o human and animal Pa hogens: om epidemiology o
con ol.” Faculdade de Medicina Ve e iná ia, Uni e sidade de Lisboa, 7 de Julho, Lisboa.
[In i ed Speake ];
Maia C, Ramos C, Coimb a M, Bas os F, Ma ins A, Pin o P, Nunes M, Viei a ML,
Ca doso L, Campino L. 2014. Bac e ial and p o ozoal agen s o eline ec o -bo ne
diseases in domes ic and s ay ca s om sou he n Po ugal. IX In e na ional Symposium
on Vec o -Bo ne Diseases, 22-25 Ma ço. Lisboa. [OC 1s au o ];
Nunes M, Lopes N, Ca ei a T, Almeida P, Inácio J, Viei a ML. 2013. “P esença dos
agen es da Doença de Lyme na ixodo auna po uguesa: de e minação de axa de in eção”.
IV Jo nadas Cien í icas do IHMT, 13 Dezemb o, Ins i u o de Higiene e Medicina
T opical, Uni e sidade No a de Lisboa, Lisboa. [OC 1s au o ];
Nunes M, Lopes N, Inácio J, Viei a ML. 2013. “De elopmen o eal- ime PCR assays
a ge ing he lagellin gene o he iden i ica ion o Bo elia bu gdo e i sensu la o
genospecies”. Mic oBio ec’13, 6 – 8 Dezemb o, Uni e sidade de A ei o, A ei o ( lash
p esen a ion). [OC 1s au o ];
Nunes M, Viei a ML. 2013. “Bo eliose de Lyme como zoonose eme gen e e seu impac e
na saúde pública: a ealidade po uguesa”. Seminá io no âmbi o do Mes ado In eg ado
em Medicina Ve e iná ia. 21 Maio, Uni e sidade de T ás-os-Mon es e Al o Dou o, Vila
Real [In i ed Speake ];
Pos e s
Nunes M, Pa ei a R, Ca ei a T, Viei a ML. 2015. “Molecula Iden i ica ion o wo
Tick-bo ne Relapsing Fe e -like Bo elia sp. in ha d icks om Po ugal”.
Mic obio ec’15, 10 a 12 Dezemb o, Uni e sidade de É o a;
Nascimen o M, Nunes M, Viei a ML. 2015. “Op imiza ion o an iso he mal ampli ica ion
echnique (LAMP) o he iden i ica ion o he majo species o Bo elia bu gdo e i s.l.
in Po ugal”. Mic obio ec’15, 10 a 12 Dezemb o, Uni e sidade de É o a;
Nunes M, Ca ei a T, Inácio J, Viei a ML. 2015. “De elopmen o a quad uplex eal-
ime PCR o Bo elia bu gdo e i s.l. species iden i ica ion.” ICLB - 14 h In e na ional
Con e ence on Lyme Bo eliosis and o he Tick-Bo ne Diseases, 27 a 30 Se emb o,
Viena, Áus ia;
Nunes M, Maia C, Ca ei a T, Almeida AP, Campino L, Viei a ML. 2015. “Doença de
Lyme no sul de Po ugal: a aliação da elação en e hospedei os domés icos (caninos e
elinos) e e o ”. 3º Cong esso Nacional de Medicina T opical / 1º Cong esso Lusó ono
de Doenças T ansmi idas po Ve o es, IHMT/UNL, 20 e 21 Ab il, Lisboa;
Nunes M, Lopes N, Ca ei a T, Maia C, Almeida AP, Viei a ML. 2014. “Fi s molecula
de ec ion o human elapsing e e spi oche e Bo elia miyamo oi in Ixodes icinus om
Po ugal”. IMED – in e na ional Mee ing on Eme ging Diseases and Su eillance, 31
Ou ub o a 3 No emb o, Viena, Aus ia;
Nunes M, Lopes N, Maia C, Ca ei a T, Inácio J, Viei a ML. 2014. “P esence o Lyme
disease agen s in he Po uguese ixodo auna: de elopmen o eal- ime PCR assays o
he iden i ica ion o Bo elia bu gdo e i genospecies”. 24 h Eu opean Cong ess o
Clinical Mic obiology and In ec ious Diseases, 10 a 13 Maio, Ba celona, Espanha. [e-
pos e ];
Nunes M, Lopes N, Inácio J, Viei a ML. 2013. “De elopmen o eal- ime PCR assays
a ge ing he lagellin gene o he iden i ica ion o Bo elia bu gdo e i sensu la o
genospecies”. Mic oBio ec’13, 6 a 8 Dezemb o, Uni e sidade de A ei o, A ei o;
Lopes N, Nunes M, Almeida AP, Viei a ML. 2013. “Wa ning: Ticks ale !!! Find ou
which icks su ound us and hei ela ionship wi h Lyme Bo eliosis”. Mic oBio ec’13,
6 a 8 Dezemb o, Uni e sidade de A ei o, A ei o;
Nunes M, Lopes N, Almeida AP, Viei a ML. 2013. “Find ou which icks su ound us
and hei ela ionship wi h Lyme Bo eliosis”. Mic oBio ec’13, 6 a 8 Dezemb o,
Uni e sidade de A ei o, A ei o;
Fa ia AS, Pai a-Ca doso MN, Nunes MS, Ca ei a T, Vale-Gonçal es H, Veloso O,
Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2013. “De eção de DNA de Bo elia
bu gdo e i sensu la o em so o de Ja ali (sus sc o a) no no e de Po ugal po nes ed-
PCR”. III Jo nadas de Saúde Pública, 2 de No emb o, Uni e sidade de T ás-os-Mon es
e Al o-Dou o, Vila-Real;
Fa ia AS, Pai a-Ca doso MN, Nunes MS, Ca ei a T, Vale-Gonçal es H, Veloso O,
Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2013. “Pesquisa de DNA de Bo elia
bu gdo e i sensu la o em ixodídeos pa asi as de Ja ali (sus sc o a) no no e de Po ugal
po nes ed-PCR”. III Jo nadas de Saúde Pública, 2 de No emb o, Uni e sidade de T ás-
os-Mon es e Al o-Dou o, Vila-Real;
Nunes M, Lopes N, Inácio J, Almeida AP, Viei a ML. 2012. “A aliação da dis ibuição
das genospécies de Bo elia bu gdo e i s.l. em Po ugal, a a és do desen ol imen o de
no as écnicas molecula es”. III Jo nadas Cien í icas do IHMT, 12 Dezemb o, Ins i u o
de Higiene e Medicina T opical, Uni e sidade No a de Lisboa, Lisboa.
Resumo
x
Resumo
Ixodídeos (ca aças de co po-du o), são impo an es e o es de agen es pa ogénicos,
esponsá eis po doenças eme gen es como a doença de Lyme (DL). Es a zoonose é causada
po espi oque as do complexo Bo elia bu gdo e i sensu la o (s.l.) ansmi idas po ca aças
da espécie Ixodes icinus, o p incipal e o na Eu opa. A DL é uma doença mul isis émica
com di e sas ap esen ações clínicas e diagnós ico complexo. Em Po ugal é ainda pouco
diagnos icada e a no i icação, apesa de ob iga ó ia, é escassa.
A p esen e in es igação e e como p incipal obje i o desen ol e e amen as molecula es,
nomeadamen e um algo i mo de PCR em empo eal e uma ampli icação iso é mica, pa a
iden i ica as espécies de B. bu gdo e i s.l. mais p e alen es em Po ugal. O
desen ol imen o des e obje i o pe mi iu ambém a alia as ca ac e ís icas bioecológicas da
ixodo auna p esen e em no e dis i os do país (no e, cen o e sul) nos quais o e o I. icinus
ha ia sido an e io men e epo ado, e ainda de e mina a axa de in eção po B. bu gdo e i
s.l. no e o e hospedei os. Os esul ados ob idos são ap esen ados sob a o ma de a igos
cien í icos (dez), dos quais se e es ão publicados, dois em submissão e um em p epa ação.
Do conjun o dos esul ados alcançados, impo a ealça as a iações obse adas na
dis ibuição das ca aças pa a possi elmen e pa a no as egiões, p o a elmen e elacionadas
com al e ações ao ní el da paisagem, clima e ege ação, às quais as ca aças são mui o
sensí eis. Ac esce o ac o de á ias espécies de B. bu gdo e i s.l. e em sido de e adas em
ca aças que não aquelas a é ago a econhecidas como e o es. A espécie B. lusi aniae oi a
mais p e alen e no e o , es ando es e p esen e em seis dos no e dis i os selecionados.
Su p eenden emen e no decu so des e es udo, iden i ica am-se ês espécies do complexo
Bo elia eco en e em ca aças da ege ação, nomeadamen e, B. miyamo oi numa nin a I.
icinus, e duas possí eis ‘no as’ espécies do complexo Bo elia eco en e em ca aças da
espécie Haemaphysalis punc a a e Rhipicephalus sanguineus.
Pa alelamen e, oi iden i icado DNA de B. bu gdo e i s.l. em amos as biológicas de animais
de es imação (cães e ga os) e de animais sil á icos (ja alis), con i mando a impo ância
des es animais, p incipalmen e os de es imação, enquan o sen inela pa a uma de eção p ecoce

x i
da DL, ajudando na de e minação do isco de ansmissão das espi oque as de B. bu gdo e i
s.l. a humanos e ou os animais com impo ância económica (ex. bo inos), em á eas
geog á icas es i as.
Foi ambém possí el o imiza dois p o ocolos molecula es pa a o diagnós ico labo a o ial da
DL, um dos quais, um algo i mo de PCR em empo eal que pe mi e a iden i icação de qua o
das espécies de B. bu gdo e i s.l. mais p e alen es em Po ugal, ap esen ando ele ada
sensibilidade e especi icidade e con ibuindo pa a um diagnós ico mais p eciso da DL.
Alguns dos aspe os in oduzidos e explo ados nes a ese necessi am ainda de uma
in es igação mais de alhada. No en an o, es e abalho ale a pa a a in odução de possí eis
‘no as’ espécies do complexo de Bo elia eco en e em ca aças de co po-du o da
ege ação, cuja pa ogenicidade é ainda desconhecida, mas que pode ão o na -se um isco
pa a a saúde pública; con ibui pa a a a ualização espacial de á eas impo an es na eco-
epidemiologia da DL em Po ugal; e ino a no diagnós ico molecula des a zoonose,
cons i uindo um alioso supo e pa a os clínicos, pe mi indo uma e apêu ica mais
di ecionada dos doen es.
Pala as-cha e: Eco-epidemiologia de B. bu gdo e i s.l., B. miyamo oi, ‘no as’ espécies
de Bo elia do complexo da Feb e Reco en e; diagnós ico molecula da DL.
Lis o abb e ia ions
x ii
Lis o Abb e ia ions
ACA – Ac ode ma i is Ch onica A ophicans
ARS – Adminis ação Regional de Saúde
bDNA – b anched DNA
bd gene – Bo elia di ec epea gene
BmpA – laminin-binding p o ein
BSK II – Ba bou –S oenne –Kelly-II medium
BSK-H – Ba bou –S oenne –Kelly modi ied medium
CDC – Cen e s o Disease Con ol and P e en ion
CEVDI – Cen o de Vec o es e Doenças In ecciosas, INSA (= Cen e o Vec o s and
In ec ious Diseases Resea ch, INSA)
CL – Con ol Line
CO2 – Ca bon dioxide
COXII – Cy och ome c oxidase subuni II
CSF – Ce eb ospinal Fluid
CWD – Cell wall de icien
DEET - N,N-die hl-me a- oluamide
DGS –Di eção-Ge al de Saúde (=Di ec o a e-Gene al o Heal h)
DL – d-loop
dLAMP – Duplex LAMP
DNA – Deoxy ibonucleic Acid
D aI – Res ic ion enzyme om Deinococcus adiophilus
Ds – Double-s anded
EIA – Enzyme Immunoassay
ELISA - Enzyme-Linked Immunoso ben Assay
EM – E y hema mig ans
EUCALB – Eu opean Conce ed Ac ion on Lyme Bo eliosis
FDA – USA Food and D ug Adminis a ion
Fe – I on
FRET – Fluo escence Resonance Ene gy T ans e
IDSA – In ec ious Diseases Socie y o Ame ica
Lis o abb e ia ions
x iii
Lis o Abb e ia ions (Con .)
IFA – Indi ec Immuno luo escence Assay
IgG – Immunoglobulin G
IgM – Immunoglobulin M
INSA – Ins i u o Nacional de Saúde D . Rica do Jo ge (= Na ional Heal h Ins i u e
Dou o Rica do Jo ge)
LAMP – Loop-Media ed iso he mal Ampli ica ion
LAR – Lymphangi is-Associa ed Ricke siosis
LB – Lyme bo eliosis
LCR – ligase chain eac ion
LD – Lyme disease
LFS – La e al Flow S ip
LNB – Lyme neu obo eliosis
LTV – Lisboa Tagus Valley
MGB – Mino G oo e Binde
MKP – Kelly–Pe enko e medium
MLST – Mul ilocus Sequence Tying
Mn – Manganese
MseI – Res ic ion enzyme om Mic ococcus sp.
NAATs – Nucleic Acid Ampli ica ion Tes s
NIAID – Na ional Ins i u e o Alle gy and In ec ious Diseases
Osp – Ou e su ace p o eins
OspA – Ou e su ace p o ein A
OspC – Ou e su ace p o ein C
p66 gene – Bo elia bu gdo e i in eg in ligand gene
PCR – Polyme ase Chain Reac ion
qPCR – quan i a i e eal- ime PCR
DNA – Ribossomal DNA
RecA – Recombinase essen ial o he epai and main enance o DNA
REP – Rep ile-associa ed Bo elia
RF – Relapsing Fe e
RFB – Relapsing Fe e Bo elia
Lis o abb e ia ions
xix
Lis o Abb e ia ions (Con .)
RFLP – Res ic ion F agmen Leng h Polymo phism
RML – Rocky Moun ain Labo a o ies
poB gene – RNA polyme ase gene
RT – Re e se T ansc ip ase
Salp15 – Soluble cys eine- ich ick sali a p o ein
s.l. – sensu la o
SNPs – Single Nucleo ide Polymo phisms
s.s. – sensu s ic o
STTT – S anda dized 2- ie es ing
Taq – The mus aqua icus
TBRF – Tick-Bo ne Relapsing Fe e
Th1 – T-helpe ype 1
Th2 – T-helpe ype 2
TIBOLA – Tick-bo ne lymphadenopa hy
TL – Tes Line
TLRs – Toll-Like Recep o s
TOT – T anso a ial T ansmission
TROSPA – Tick Recep o o Ou e Su ace P o ein A
USA – Uni ed S a es o Ame ica
VlsE – Vmp ( a iable memb ane p o ein)-like sequence, Exp essed
WB – Wes e n Blo
WCS – Whole-Cell Sonica e
WHO – Wo d Heal h O ganiza ion

Table o con en s
xxi
Table o con en s
Abs ac ………………………………………………………………………………..
xiii
Resumo ………………………………………………………………………..……….
x
Lis o abb e ia ions …………………………………………………………………
x ii
Table o con en s ………………………………………………………………..
xxi
Index o Figu es ………………………………………………………………………
xxix
Index o Tables ………………………………………………………………………..
xxx
Chap e 1 - S a e o he a
1.1 – Lyme disease: his o ical e iew …………...……………………………...
3
1.2 – Bo elia spi oche es and Lyme Disease…...………………………………
5
1.2.1 – Biology, Mo phology and G ow h ………..……………………..…….
5
1.2.2 – Classi ica ion and axonomy ………………………..………..………...
9
Relapsing Fe e Bo elia (RFB) complex ……………..….………………...
9
Rep ile-associa ed Bo elia (REP) complex …………..……………..……...
11
Bo elia bu gdo e i s.l. complex ……………………..…………….…….…
12
1.2.3 – Epidemiology and geog aphic dis ibu ion o LD..…………………...
13
Lyme disease in Po ugal ……………………….…...…….………………….
18
1.3 – The ick ec o ………………………………………………………...………
20
1.3.1 – Classi ica ion and axonomy …………………………...……………...
20
1.3.2 – Ha d- icks mo phology ………………………………..………………
23
1.3.3 – Ha d- icks species in Po ugal ……………………..………………….
24
1.3.4 – Geog aphic dis ibu ion o Ixodes ec o ……………………………..
27
1.3.5 – Li e cycle o I. icinus ec o ……………………………...…………..
29
Table o con en s
xxii
1.3.6 – T ansmission and Pa hogenesis ………………………….……………
31
1.4 – Rese oi s and hos s o Bo elia spi oche es ………………………..…...
35
1.4.1 - Companion animals and Lyme disease ………………………..………
38
1.5 – Lyme disease clinical mani es a ions, diagnosis and ea men ………..…
40
1.5.1 – Human clinical mani es a ions …………………………...…………...
40
1.5.2 – Labo a o y diagnosis – Con en ional me hodologies ……………....
43
Di ec me hods ………………...………………………………………………
45
Indi ec me hods ………………..…………………………………………….
49
1.5.3 – Molecula -based s a egies o he assessmen o he B. bu gdo e i
s.l. species ……………………...………………………………………………
51
DNA ampli ica ion-based assays …...……………………………………….
52
Iso he mal DNA ampli ica ion …………...………………………………….
57
Immunoch oma og aphic assays …………...………………………………..
60
1.5.4 – P e en ion, Con ol and T ea men …………...……………………….
62
1.6 – Objec i es and hesis plan …………………...………………………………
65
1.7 – Re e ences ………………………………………………...…………………...
67
Chap e 2 - Dis ibu ion and bio-ecological cha ac e iza ion o ixodids
in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion
2.1 – Cha ac e iza ion and dis ibu ion o ha d- icks in nine dis ic s o
mainland Po ugal whe e I. icinus p esence was p e iously epo ed:
Bo elia bu gdo e i s.l. p e alence ………...……………………………………...
93
Abs ac ……………………………………...…………………………………..
94
In oduc ion ………………………………...…………………………………...
95
Ma e ial and Me hods ……………………...…………………………………...
97
Table o con en s
xxiii
Resul s …………………………………...………………………………………
104
Discussion ……………………………………………………………………….
122
Acknowledgemen s ……………………...……………………………………..
128
Re e ences ………………………………...…………………………………….
129
Supplemen a y Da a ……………………...…………………………………….
135
Chap e 3 - Dis ibu ion and di e si y o Bo elia spi oche es and
o he ick-bo ne agen s in ques ing and hos - icks
3.1 - Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om
Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e -
like Bo elia sp. …………………………...……………………………………….
143
Abs ac ………………………………...………………………………………..
143
In oduc ion …………………………...………………………………………...
143
Ma e ial and Me hods ………………...………………………………………...
144
Resul s …………………………………...………………………………………
147
Discussion ………………………………...……………………………………..
148
Acknowledgemen s ……………………...……………………………………..
149
Re e ences ………………………………...…………………………………….
149
Supplemen a y Da a ……………………...…………………………………….
152
3.2 - Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om
Po ugal ………………………...……………………………………………………
161
Abs ac …………………...……………………………………………………..
161
In oduc ion ……………...……………………………………………………...
161
Ma e ial and Me hods …...……………………………………………………...
161
Resul s ……………………...……………………………………………………
162
Table o con en s
xxi
Discussion ……………………………………………………………………….
162
Acknowledgemen s ……….……………………………………………………
163
Au ho Disclose S a emen ……...…………………………………………….
163
Re e ences …………………………...………………………………………….
163
3.3 - Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks
om Po ugal …….…………………………………………………………………
165
Abs ac …………………………...……………………………………………..
165
In oduc ion ………………………...…………………………………………...
165
Ma e ial and Me hods ………………...………………………………………...
166
Resul s …………………………………...………………………………………
167
Discussion ……………………………………………………………………….
167
Acknowledgemen s …………………...………………………………………..
169
Re e ences ……………………………...……………………………………….
169
Chap e 4 - Dis ibu ion and di e si y o Bo elia spi oche es and
o he ick-bo ne agen s in he hos s
4.1 - Molecula de ec ion o ick-bo ne bac e ia and p o ozoa in ce ids
and wild boa s om Po ugal ………...…………….....………………………….
175
Abs ac …………………………...……………………………………………..
175
Backg ound ……………………...……………………………………………...
175
Me hods ………………………………...……………………………………….
176
Resul s …………………………...………………………………………………
178
Discussion ……………………………………………………………………….
181
Conclusion ……………………………………...……………………………….
181
Compe ing in e es s ………………………...…………………………………..
181
Index o Figu es
xxxi
Figu e 7 - Ques ing ick species a e age densi y and s anda d de ia ion in Sou h
egion du ing he wo yea s o collec ions, in sp ing and summe seasons ……...
119
Figu e 8 - Box-plo analysis depic ing he dis ibu ion o (A) H. punc a a, (B)
Hy. lusi anicum and (C) I. icinus wi hin each egion. Y axis ep esen icks/min-
collec o ……………………………..…………………………………………………
111
Figu e 9 - Box-plo analysis depic ing he densi ies o I. icinus in each o he
su eyed seasons. Y axis ep esen icks/min-collec o ……………………………
112
Figu e 10 - Tick a e age densi y pe hos , o each collec ed species by season,
yea and dis ic ………………………………………………………………………..
114
Figu e 11 - Tick species a e age densi y and s anda d de ia ion pe hos in
No h egion du ing he wo yea s o collec ions, in sp ing, summe , au umn and
win e seasons …………………………………………………………………………
116
Figu e 12 - Tick species a e age densi y and s anda d de ia ion pe hos in
Lisboa and Tagus Valley egion du ing he wo yea s o collec ions, in sp ing,
au umn and win e seasons …………...……………………………………………..
117
Figu e 13 - Hos s ick species a e age densi y and s anda d de ia ion in Sou h
egion du ing he wo yea s o collec ions, in sp ing, summe , au umn and win e
seasons ……………….…………………………………….…………………………..
118
Figu e 14 - Box-plo analysis depic ing he dis ibu ion o o al ick densi y in
A) each season and B) pe hos ype ……………..…………………………………..
119
Figu e 15 - Box-plo analysis demons a ing he dis ibu ion o A) I. icinus and
B) R. sanguineus wi hin each egion ………………...………………………………
120

Index o Figu es
xxxii
Chap e 3
3.1 - Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om
Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e -like
Bo elia sp.
Figu e 1 - Map o Po ugal showing he o al numbe o ha d icks collec ed by
lagging pe dis ic s (B aga, Vila Real, A ei o, Lisboa, Se úbal, É o a and
Fa o) ……………………………………………………………………………………
145
Figu e 2 - De ec ion o RFB (Relapsing Fe e Bo eliae) DNA in ex ac s
p epa ed om ield-collec ed icks …………………..………………………………
147
Figu e 3 - Phylogene ic analysis o Relapsing Fe e Bo elia laB (A), 16S
RNA (B), and glpQ (C) sequences ………………………………………………….
147
Figu e 4 - glpQ and laB gene ic dis ance analysis calcula ed using he Tamu a-
Nei as implemen ed in he Mega 6.0 so wa e ………………………………………
148
Supplemen a y Figu e 1 - Comple e phylogene ic analysis o Relapsing Fe e
Bo elia laB (A), 16S RNA (B), and glpQ (C) sequences (pa ial ees a e
shown in Fig. 3) ………………………………………………………………………..
152
Supplemen a y Figu e 2 - Maximum Clade P obabili y T ees based on he
analysis o Relapsing Fe e Bo elia laB (A), 16S RNA (B), and glpQ (C)
sequences ………………………………………………………………………………
155
Supplemen a y Figu e 3 - Comple e phylogene ic analysis o Relapsing Fe e
Bo elia 16S RNA (A) and laB (B), sequences wi h he in oduc ion o
Lep ospi a in e ogans as an ou g oup ……………………...………………………
158
3.2 - Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om
Po ugal
Figu e 1 - Phylogene ic analysis o Bo elia la nucleo ide sequences …..………
163
3.3 - Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks
om Po ugal
Figu e 1 – Map o Po ugal depic ing he 4 dis ic s om whe e icks we e
collec ed ………………………………………………………………………………..
166
Index o Figu es
xxxiii
Chap e 4
4.1 – Molecula de ec ion o ick-bo ne bac e ia and p o ozoa in ce ids
and wild boa s om Po ugal
Figu e 1 - Phylogene ic ee o Anaplasma spp. based on he analysis o msp4
sequences ………………………………………………………………………………
178
Figu e 2 - Phylogene ic ee o Theile ia spp. based on 18S RNA gene
sequences ………………………………………………………………………………
179
4.2 - Fi s De ec ion o Bo elia bu gdo e i sensu la o DNA in Se um o he
Wild Boa (Sus sc o a) in No he n Po ugal by Nes ed-PCR
Figu e 1 - (a) - DNA ampli ica ion esul s o wild boa se um samples ob ained
by nes ed-PCR analysis a ge ing he la gene; (b) - Geog aphical dis ibu ion o
he hun s ( illed ci cle) a ended du ing he 2011/2012 wild boa hun ing season
in he T ás-os-Mon es egion (No he n Po ugal) and he numbe o wild boa s
sho in each hun ……………………………...……………………………………….
187
Chap e 5
5.1 – De elopmen and e alua ion o a wo-s ep mul iplex TaqMan eal-
ime PCR assay o de ec ion o Bo elia bu gdo e i s.l. genospecies
Figu e 1 - Rep esen a ion o he eal- ime PCR algo i hm o iden i ica ion o
B. bu gdo e i s.l. genospecies …………………………………….………………
216
Figu e 2 - Illus a ion o he duplex eal- ime PCR ampli ica ion cu e ob ained
o each DNA concen a ion …………………………………………...…………….
220
Figu e 3 - Illus a ion o he e aplex eal- ime PCR ampli ica ion cu es
ob ained o each p obe indi idually (A, B, C and D) and in e aplex (E) o
each DNA concen a ion …………………………..…………………………………
221
5.2 - De elopmen o a Loop Media ed Iso he mal Ampli ica ion (LAMP)
assay o he de ec ion o Bo elia bu gdo e i s.l. genospecies DNA in ick
samples
Index o Figu es
xxxi
Figu e 1 - Pa ial sequence o laB gene o B. lusi aniae, and loca ion o he
complemen a y egions used o design LAMP p ime s [F3, B3, FIP (F1c-F2),
BIP (B1c-B2)], including loop p ime s (LF, LB) ……………………………..……
237
Figu e 2 - LAMP p oduc s isualiza ion ……………………………………………
240
Figu e 3 - LAMP assay op imiza ion by es ing: di e en FIP/BIP and F3/B3
concen a ions a io (A); di e en concen a ions o Bs polyme ase (B); and
di e en empe a u es o eac ion (C) ……………………………………………….
241
Figu e 4 - Sensi i i y op imiza ion o LAMP assay wi h he B. lusi aniae
p ime s se o he ou B. bu gdo e i s.l. genospecies DNA se ial dilu ions, and
isualiza ion o ampli ica ion p oduc s by naked eye, by adding SYBR-G een
unde na u al and UV ligh , and by elec opho esis in aga ose gel ………..………
243
Index o Tables
xxx
Index o Tables
Chap e 1
Table 1 - Relapsing Fe e Bo elia species, geog aphic dis ibu ion and i s epo
10
Table 2 - Bo elia bu gdo e i s.l. species, geog aphic dis ibu ion and i s epo
13
Table 3 - Mo e impo an biologic cha ac e is ics o icks …...………………………
22
Table 4 - Ha d- icks gene a, espec i e species p esen in Po ugal …………...…….
25
Table 5 - E iologic agen s ansmi ed by Ixodids p esen , o a eme ging isk, in
Po ugal …………………………………………………………...………………………
26
Table 6 - The h ee s ages o Lyme disease and examples o some clinical
mani es a ions ……………………………………………………………………………
42
Table 7 - Case de ini ion om Cen e s o Disease Con ol and P e en ion (CDC),
o su eillance pu pose …………..……………………………………………………..
44
Chap e 2
Table 1 - Cha ac e iza ion o each su eyed dis ic ega ding he a ea, clima e and
coun ies ………………………………………...…………………………………………
99
Table 2 - To al ques ing ick species by s age collec ed in each dis ic …………….
106
Table 3 - To al icks collec ed on hos s, pe ick species and s age, collec ed in
each dis ic ……………………………………………………………………………….
115
Table 4 - Bo elia bu gdo e i s.l. in ec ion a e in ques ing icks om he h ee
su eyed egions (No h, LTV and Sou h) ……………………………………………..
121
Table 5 - Bo elia bu gdo e i s.l. in ec ion a e in icks collec ed om he hos s
in he wo su eyed egions (LTV and Sou h) …………………………………………
122
Index o Tables
xxx i
Chap e 3
3.1 - Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om
Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e -like
Bo elia sp..
Table 1 - Species, s age, gende and numbe o collec ed icks, analyzed o he
p esence o B. bu gdo e i s.l. and Relapsing Fe e Bo elia (RFB) spi oche es
DNA ………………………………………………………………………………………
146
Table 2 - P ime s used in his s udy o he speci ic analysis o Relapsing Fe e
Bo elia …………………………………………………………………………………
146
3.2 - Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om
Po ugal
Table 1 - Dis ic , s age and numbe o Ixodes icinus icks collec ed in Po ugal
analyzed o he p esence o Bo elia miyamo oi and B. bu gdo e i sensu la o ……
162
3.3 - Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks
om Po ugal
Table 1 - P ime se s and PCR condi ions o DNA ampli ica ion and sequencing
o pa hogens in icks ……………………………………………………………………..
167
Table 2 - Numbe s o icks collec ed in he dis ic s o Gua da, Lisboa, Se úbal
and Fa o …………………………………………………………………………………
168
Table 3 - Pa hogens de ec ed by PCR and DNA sequencing in icks om Po ugal
acco ding o geog aphic egion and e eb a e hos , wi h DNA Da a Bank o Japan
(DDBJ) accession numbe s …………………………………………………………….
168

Index o Tables
xxx ii
Chap e 4
4.1 – Molecula de ec ion o ick-bo ne bac e ia and p o ozoa in ce ids and
wild boa s om Po ugal
Table 1 - Sequences o he oligonucleo ide p ime s used ………………………...….
177
Table 2 - P e alence o ick-bo ne pa hogens as de ec ed by PCR in 76 ce ids
and 65 wild boa s om Cen e and sou he n Po ugal ……………...…………………
180
4.3 – Bac e ial and p o ozoal agen s o canine ec o -bo ne diseases in he
blood o domes ic and s ay dogs om sou he n Po ugal
Table 1 - P e alence o ec o -bo ne pa hogen species, gende o complex as
de ec ed by PCR in 1,010 dogs om sou he n Po ugal ………………………………
193
Table 2 - P ime s se s o PCR ampli ica ion o CVBD agen s ……………………
194
Table 3 - Single and mixed PCR-posi i i y o species, gene a and/o complex o
CVBD agen s in 1,010 dogs om sou he n Po ugal ………………………………...
194
4.4 - Bac e ial and p o ozoal agen s o eline ec o -bo ne diseases in domes ic
and s ay ca s om sou he n Po ugal
Table 1 - Compa ison o p e alence o FVBD pa hogens in di e en g oups o
ca s om sou he n Po ugal ……………………………………………………………
201
Table 2 - P ime se s o PCR ampli ica ion o FVBD agen s ……………………….
202
Table 3 - Single and mixed PCR-posi i i y o gene a (Anaplasma/Eh lichia,
Babesia, Ba onella, Hepa ozoon and Leishmania) and/o complex (B. bu gdo e i
s.l.) o FVBD agen s in 649 ca s om sou he n Po ugal ……………………………..
203
Index o Tables
xxx iii
Chap e 5
5.1 - De elopmen and e alua ion o a wo-s ep mul iplex TaqMan eal- ime
PCR assay o de ec ion o Bo elia bu gdo e i s.l. genospecies
Table 1 - Sequences o p ime s and p obes designed in his s udy ………………….
215
Table 2 - Compa ison o duplex and e aplex eal- ime PCR’s posi i e samples
wi h esul s om p e ious sequencing o ick samples ………………………………
223
5.2 - De elopmen o a Loop Media ed Iso he mal Ampli ica ion (LAMP)
assay o he de ec ion o Bo elia bu gdo e i s.l. genospecies DNA in ick
samples
Table 1 - LAMP p ime s designed a ge ing he ou B. bu gdo e i s.l.
genospecies ………………………………………………………………………………
236
Table 2 - Sensi i i ies ob ained o he de ec ion o B. bu gdo e i s.l. genospecies
wi h di e en molecula app oaches …………………………………………………
244
Chap e 1
S a e o he a
Chap e 1
S a e o he a
9
1.2.2 – Classi ica ion and axonomy
The spi oche es a e one o he ew majo bac e ial g oups whose na u al phylogene ic
ela ionships a e e iden a he le el o g oss pheno ypic cha ac e is ics (Wang e al.,
1999). These o ganisms belongs o Spi ochae es phylum con aining only Spi ochae es
class ha comp ises a single o de Spi ochae ales. This o de includes h ee amilies:
B achyspi aceae, Lep ospi aceae and Spi ochae eceae (Ka ami, 2012), whe e he
Spi ochae eceae amily comp ises Bo elia and T eponema genus, his las esponsible
o syphilis, a sexually ansmi ed disease (Wang e al., 1999; Heymann & Ellis, 2012;
Ka ami, 2012).
The genus Bo elia ep esen s a igh phylogene ic clus e , which is di e en ia ed om
o he spi oche al phylogene ic g oups by base signa u e analysis o s gene (Wang e al.,
1999). Mo e han 30 species ha e been iden i ied wi hin he genus so a (Bap is a, 2006;
No is, 2012). These Bo elia species, based on he di e ences be ween hei ecological
and gene ic cha ac e is ics (Ba bou & Hayes, 1986), a e usually ca ego ized in o h ee
majo ca ego ies, he elapsing- e e bo eliae, whose membe s cause elapsing e e
wo ldwide; he LB bo eliae, whose membe s cause Lyme disease h oughou he
No he n Hemisphe e, and he ep ile-associa ed bo eliae, whose membe s in ec ep iles
bu a e no known o cause disease in humans (Huang e al., 2015).
 Relapsing Fe e Bo elia (RFB) complex
The Relapsing Fe e (RF) complex includes species mos ly ound in so icks belonging
o he A gasidae amily, conside ed apid- eeding icks whe e hei bi es may go
unno iced. Howe e , RF has also been epo ed in se e al ha d icks (ixodids), and in lice.
The axonomic posi ion o RF spi oche es is a ma e o con o e sy, since some s udies
ha e sugges ed phylogene ic clus e ing based on geog aphic di e ences (Old Wo ld
e sus New Wo ld), and o he s udies ound RF spi oche es in ha d icks, (including B.
miyamo oi, B. heile i, and B. lones a i), which clus e ed oge he phylogene ically
sugges ing his o be a sepa a e g oup wi hin he RF complex (Ba bou e al., 2009;
(McCoy e al., 2014; Cu le 2015; Nunes e al., 2015). The e a e now a leas 23 alida ed

Chap e 1
S a e o he a
10
RF Bo elia species (Mo ais e al., 2007), al hough o he s a e wai ing su icien da a o
achie e such s a us (Table 1).
Table 1 - Relapsing Fe e Bo elia species: geog aphic dis ibu ion and i s epo .
RF Bo elia
species
Geog aphic dis ibu ion
Re e ence
B. anse ina
Wo ldwide
Sakha o , 1891
B. bal aza dii
I an
Ka imi e al., 1983
B. b asiliensis
B azil
Da is, 1952
B. caucasica
Russia
Kandelaki, 1945
B. co iaceae
USA
Jonhson e al., 1987
B. c ocidu ae
Wes A ica
Lege , 1971
B. dugesii
Mexico
Mazzo ii, 1949
B. du onii
A ica (Cen al Eas e n)
No y & Knapp, 1906
B. g ainge i
Eas A ica
Heisch, 1953
B. ha eyi
Eas A ica
Ga nham, 1947
B. he msii
Canada, Wes e n USA
Da is, 1942
B. hispanica
Alge ia, Mo occo, Po ugal Spain, Tunisia
de Buen, 1926
B. japonica
Japan
Kawaba a e al., 1994
B. la yschewii
Cen al Asia, I an, I aq
So ie , 1941
B. mazzo ii
Sou he n USA, Mexico, Gua emala
Da is, 1956
B. me ionesi
No h A ica
Blanc & Mau ice, 1948
B. mic o i
A ica, I an
Smi h & Kilbo ne, 1893
B. miyamo oi
Japan
Fukunaga e al., 1995
B. pa ke i
Wes e n USA
Da is, 1942
B. pe sica
Asia, Middles Eas
Dschunkowsky, 1913
B. sinica
China
Masuzawa e al., 2001
B. anukii
Japan
Fukunaga e al., 1997
B. heile i
Ame ica, A ica, Aus alia, Eu ope
La e an, 1903
B. illae
Cape Ve de
Zump & O gan 1961
B. u ica ae
USA, Mexico
B ump , 1933
B. enezuelensis
Cen al & Sou h Ame ica
B ump , 1921
B. ecu en is
Wo ldwide
Lebe , 1874
Chap e 1
S a e o he a
11
Howe e , a leas wo ca ego ies o RF a e known o a ec humans: i) he louse-bo ne
elapsing e e (also known as u ban o epidemic RF) caused by B. ecu en is, and
ansmi ed by he body louse Pediculus humanus humanus. His o ically, massi e
ou b eaks ha e occu ed in Eu asia and A ica, especially du ing wa ime, when people
we e highly pa asi ized wi h body lice (Ba bou & Hayes, 1986). Cu en ly, he disease
is ound only in E hiopia and neighbo ing coun ies (Cu le 2010); ii) and he ick-bo ne
elapsing e e caused by Bo elia species ansmi ed by in ec ed so icks o he genus
O ni hodo os, like o example B. hispanica ansmi ed by O. e a icus, and ound
p ima ily in A ica, Spain, Saudi A abia, Asia, and ce ain a eas o Canada and he
wes e n Uni ed S a es (Cu le 2015, Palma e al., 2012).
In he las yea s, se e al no el species ha e been desc ibed, including B. myumii in icks
om Tanzania (Mi ani e al., 2004), B. mic o i and o he species om I an (Nadda e al.,
2015), B. u ica ae-like in ba icks om he Uni ed S a es (Schwan e al., 2009), and as
o ye unnamed species om penguins in Sou h A ica (Yabsley e al., 2012), al hough
he species s a us and po en ial i ulence o hese agen s o humans emain unknown.
 Rep ile-associa ed Bo elia (REP) complex
The epidemiologic ole o ep iles has ecei ed inc easing a en ion, in he las yea s,
mainly due o he in e na ional pe ade o animals o igina ing om he wilde ness
(Bu idge, 2011). F equen ly, he impo ed ep iles a e ha bo ing a ious ick species ha
acili a e he in oduc ion o nonna i e ick-bo ne pa hogens, hus signi ican ly inc easing
he isk o public heal h (Bu idge, 2011). Va ious eme ging and/o zoono ic pa hogens
ha e been isola ed and cha ac e ized om ep iles o hei associa ed icks (Takano e al.,
2010; Pas iu e al., 2012).
The ep ile-associa ed Bo elia spp (REP) ha e been ecen ly disco e ed in ep iles and
hei associa ed ha d icks, gene a Amblyomma and Hyalomma (Takano e al., 2010). B.
u cica, a membe o he REP bo eliae g oup, was desc ibed in Hyalomma aegyp ium
icks ela ed wi h Medi e anean o oises in Tu key (Gune , 2004). B. u cica has been
Chap e 1
S a e o he a
12
demons a ed o o m a dis inc monophyle ic g oup showing a ela ionship wi h bo h RF
and LB g oups. Rep ile-associa ed Bo elia (Bo elia sp.) spi oche es we e also isola ed
om Amblyomma geoemydae icks and hey clus e ed wi h RFB based on ano he
phylogene ic analysis (Takano e al., 2011). The na u al cycle o Tick-Bo ne Relapsing
Fe e (TBRF) spi oche es in ol e a di e si y o small mammals and hei ick ec o s
(Schwan e al., 2012). They a e a neglec ed cause o zoono ic diseases which can esul
in illness and e en dea h o he hos s (Kalma e al., 2015).
 Bo elia bu gdo e i s.l. complex
Ul as uc u e o B. bu gdo e i has been he subjec o se e al in es iga ions in he USA
and Eu ope, i s desc ip ion a ies, di e ences in mo phological c i e ia, such as end shape
and he numbe o endo lagella, among isola es o di e se o igins ha e led o he
specula ion ha addi ional spi oche al species may be in ol e in e iology o LD (Hayes
& Bu gdo e , 1993).
A majo e o has been done o analyze he pheno ypic and geno ypic di e si y o B.
bu gdo e i isola es, using Polyme ase Chain Reac ion (PCR) echniques, a ge ing 16S
and 23S ibosomal DNA, lagellin, Ou e su ace p o ein A (OspA), and Bo elia di ec
epea (bd ) genes, as well as in e genic space s (Guy & S anek, 1991; Johnson e al.,
1992; Pos ic e al., 1994; Le Fleche e al., 1997; Rijpke na e al., 1997; Iye e al., 2003).
I is now appa en ha B. bu gdo e i is gene ically di e se, and belongs o a B.
bu gdo e i s.l. genospecies complex composed o 20 di e en species (Ružić-Sabljić &
Ce a , 2016), (Table 2). E olu iona y changes, mu a ion, gene ic d i , mig a ion, and
na u al selec ion c ea ed mac o e olu iona y di e gence o species. The p e ailing da a
sugges ha B. bu gdo e i s.l. was once a wide- anging species in he No he n
Hemisphe e ha apidly sepa a ed in o he cu en known species (Dykhuizen & B isson,
2010).
Chap e 1
S a e o he a
13
Table 2 – Bo elia bu gdo e i s.l. species: geog aphic dis ibu ion and i s epo .
No e: he unde line species ha e been ound in/o isola ed om human pa ien s, while he o he s species ha e
no been associa ed o humans.
1.2.3 – Epidemiology and geog aphic dis ibu ion o LD
Lyme disease is he wo ld's as es g owing ec o -bo ne zoono ic disease wi h cases
epo ed in o e 60 coun ies and endemic oci in No h Ame ica, Eu ope, and Asia
(WHO, 2013). I occu s no mally in empe a e a eas, wi h he ideal clima e and gene al
condi ions o he su i al and main enance o he ec o li e cycle in ol ed in B.
bu gdo e i s.l. species ansmission.
B. bu gdo e i s.l. species
Geog aphic dis ibu ion
Re e ence
B. bu gdo e i s.s.
USA; Eu asia
Johnson e al., 1984
B. ga inii
Eu asia
Ba an on e al., 1992
B. a zelii
Eu asia
Canica e al., 1993
B. japonica
Japan
Kawaba a e al., 1993
B. ande sonii
USA
Ma coni e al., 1995
B. anukii
Japan
Fukunaga e al., 1996
B. u di
Japan
Fukunaga e al., 1996
B. alaisiana
Eu asia
Wang e al., 1997
B. lusi aniae
Eu ope, USA
Le Fleche e al., 1997
B. bisse ii
USA
Pos ic, 1998
B. sinica
China
Masuzawa e al.,2001
B. spielmanii
Eu ope
Rich e e al., 2004
B. cali o niensis
USA
Pos ic e al., 2007
B. Yang zee
China
Chu e al., 2008
B. ame icana
USA
Rudenko e al., 2009
B. ba a iensis
Eu ope
Ma gos e al., 2009
B. ca olinensis
USA
Rudenko e al., 2010
B. ku enbachii
USA, Eu ope (?)
Ma gos e al., 2010
B. inlandensis
Eu ope
Casjens e al., 2011
B. chilensis
Chile
I ano a e al., 2014
Chap e 1
S a e o he a
14
The geog aphic dis ibu ion o LD is inc easing, esul ing in a signi ican isk, o public
heal h (Rizzoli e al., 2011). The no heas e n Uni ed S a es is adi ionally de ined as he
endemic global egion o LD and he public heal h isk is highes in his a ea, whe e
annually abou 16 000 o 25 000 new cases occu (Figu e 4). Howe e , he CDC es ima es
ha only 10% o LD cases a e being eco ded which ansla es in o app oxima ely
300,000 es ima ed cases in he Uni ed S a es each yea , only be ween 1995 and 2013
Lyme cases has inc eased abou 130% om 11.700 o 27.200 (CDC).
Figu e 4 - G aphical ep esen a ion o Lyme disease con i med and p obable annual cases
in USA, om 1995 o 2014. (Sou ce: h p://www.cdc.go /lyme/s a s/g aphs.h ml).
A majo i y (95 %) ha e been concen a ed in he no heas , ye cases ha e been epo ed
in e e y s a e and in many coun ies a ound he wo ld and hei geospa ial analysis e eals
ha LD has ex ended well beyond adi ionally de ined endemic a eas (CDC, 2014; Diuk-
Wasse e al., 2012). Lyme disease a es ha e been inc easing exponen ially a he global
scale while in he Uni ed S a es i has become he main human ec o -bo ne disease
(Abbo , 2006; Piesman & Eisen, 2008). This inc ease is due o a a ie y o in luences
like clima e change esul ing in he expansion o he Ixodes ick e i o y including
expansion o highe ele a ions, changes in small mammals and dee popula ions, changes

Chap e 1
S a e o he a
15
in de o es a ion and de elopmen , and imp o ed epo ing and awa e (Lindg en e al.,
2000; Qiu e al., 2008; G ay e al., 2009; Gilbe e al., 2014).
LD can also be ound h oughou Eu ope, Russia, and Asia (Figu e 5). The highes
epo ed equencies o he disease a e in cen al Eu ope and Scandina ia, pa icula ly in
Ge many, Aus ia, Slo enia, he Bal ic coas line o Sweden, and some Es onian and
Finnish islands, whe e epo ed incidence a es a e g ea e han 100 cases pe 100,000
inhabi an s (Lindg en & Jaenson, 2006; Rizzoli e al., 2011). Se op e alence s udies
conduc ed in indi idual coun ies in ecen yea s, including Ge many, Denma k, and
Sweden, ha e ypically ound posi i e a es less han 10%, al hough a es as high as
47.9% we e eco ded in high- isk g oups (e.g., a me s and o es y wo ke s) in Poland
(Lindg en & Jaenson, 2006; Dessau e al., 2010; Dehne e al., 2012).
Figu e 5 - Wo ld dis ibu ion o Lyme disease. In ed a e indica ed he “ho zones”.
(Sou ce: Wo ld Heal h O ganiza ion).
In Eu ope se e al species o B. bu gdo e i s.l. complex ha e been iden i ied being LD
mos ly associa ed o one o h ee species: B. bu gdo e i s.s., B. a zelii and B. ga inii
(Assous e al., 1993; an Dam e al., 1993; Rich e e al., 2004). Howe e , o he species
o B. bu gdo e i s.l. ha e al eady been associa ed o human cases, like B. bisse ii, B.
alaisiana, B. lusi aniae, and B. spielmanii (Picken e al., 1996; Rijpke na e al., 1997;
Chap e 1
S a e o he a
16
Colla es-Pe ei a e al., 2004; Finge le e al., 2008). In con as , in he USA, despi e he
p esence o se e al o he genospecies (B. ame icana, B. ande sonii, B. cali o niensis, B.
ca olinensis, B. bisse ii and B. ku enbachii), only B. bu gdo e i s.s is ecognized as
causing LD (Mu ay & Shapi o, 2010). Mo eo e , a new B. bu gdo e i s.l. genospecies
(candida us Bo elia mayonii) was ecen ly iden i ied among pa ien s and in I. scapula is
icks om he uppe Midwes e n USA (P i e al., 2016).
The dis ibu ion and p e alence B. bu gdo e i s.l. species a ies on a local and egional
scale, bo h empo ally and spa ially (Rau e & Ha ung 2005; Es ada-Peña e al., 2011),
wi h a highe biodi e si y o species be ween 4º W and 20º E coo dina es, whe e he e is
a highe p e alence o icks in ec ed wi h Bo elia (Es ada-Peña e al., 2011). The
species B. bu gdo e i s.s. is epo ed mo e equen ly in eas , while B. a zelii is mo e
common in he No h o Eu ope, B. alaisiana is mainly p esen in low empe a u e
egions wi h unde g ow h ege a ion like Scandina ian coas , Sco land o Alpine egions,
and B. lusi aniae and B. ga inii a e p edominan ly ound in he Medi e anean egion,
sou heas and wes (Figu e 6) (F anke e al., 2013).
Figu e 6 – Global dis ibu ion o he Lyme disease species. The shaded a eas show he
dis ibu ion o ick ec o s. Se en species a e ound in No h Ame ica, eigh species in
Eu ope, and eigh species in Asia. (Sou ce: Ma gos e al., 2011).
Chap e 1
S a e o he a
17
Acco ding o S anek and Rei e (2011), some in es iga o s ecognize ha he mul iplici y
o B. bu gdo e i s.l. species exis en s in Eu ope may indica e hese spi oche es as
esponsible o Lyme while eme gency disease in his con inen . Howe e , o he s udies
showed he exis ence o a mo e close ela ionship be ween he Eu opean Bo elia species
han he ones om No h Ame ica, sugges ing ha LD was in oduced in Eu ope om
he Ame ican con inen (S anek & Rei e , 2011).
The he e ogenei y o B. bu gdo e i s.l. species in Asia is simila o hose in Eu ope, six
pa hogenic species and i e ‘po en ial’ pa hogenic ha e been iden i ied in Asian
con inen . Almos all Eu opean species can be ound in Cen al and Eas e n Asia, ye B.
lusi aniae is mainly ound in wes e n Asia icks (F anke e al., 2013). B. bu gdo e i s.s.
seems absen in mos Asia ic egions, being a ely epo ed in Thailand and Sou h China
(F anke e al., 2013), while B. ga inii and B. a zelii a e he main species in ol ed in LD
cases in his con inen (Scho hoe e & F os , 2015).
In No h A ica se e al Bo elia species can be ound pa icula ly in he mos humid and
empe a e egions like Tunisia, Egyp , Mo occo, and Alge ia. B. lusi aniae is he
p edominan species in hese egions, al hough B. ga inii, B. bu gdo e i s.s. and B.
alaisiana ha e been occasionally epo ed (F anke e al., 2013). B. lusi aniae isola es
om No h A ica sugges s ha hey may be o igina e om a Po uguese clone (S anek
e al., 2012).
In Aus alia he e a e no conc e e e idences o LD exis ence, since he bac e ia as ne e
been isola ed om he ick ec o , howe e , i has been associa ed o Ixodes
holocyclus o I. co nua us (Mayne e al., 2014). The majo i y o epo ed human cases
a e based in se ologic es s, ye in 2011 DNA om B. bu gdo e i s.l. spi oche es was
de ec ed in eigh Aus alian pa ien s by PCR analysis, whe eas only one o he pa ien s
had le he coun y (F anke e al., 2013).
Mo e ecen ly in Sou h Ame ica, pa icula ly in B azil LD, known as B azilian Lyme-
like disease o Baggio-Yoshina i synd ome, has been poo ly s udied (Yoshina i e al.,
2010), i s epidemiology and he p e alen genospecies a e s ill no well de ined (Dan as-
To es e al., 2008). Howe e , some cases o his disease ha e been epo ed in humans
and animals by se ologic me hods and/o by clinical symp oms in he no he n (Amazonas
Chap e 1
S a e o he a
18
and Tocan ins S a es) (Abel e al., 2000; Ca anza-Tamayo e al., 2012), midwes e n
(Ma o G osso do Sul S a e) (Naka e al., 2008; Ca anza-Tamayo e al., 2012),
sou heas e n (Espí i o San o, Rio de Janei o and São Paulo S a es) (Azulay e al., 1991;
Yoshina i e al., 2003; Passos e al., 2009) and sou he n (Pa ana S a e) (Gonçal es e al.,
2014; 2015) egions o B azil. Mos o hese cases we e de ec ed in inhabi an s o u al
a eas, whe e due o he close p oximi y o humans o he animal popula ion o en
pa asi ized by icks, esul s in a high incidence o his zoonosis.
None heless, some ecen s udies ha e molecula ly iden i ied Bo elia DNA in h ee
pe iphe al blood samples collec ed om humans wi h clinical symp oms o bo eliosis
and epo o ick exposu e (Man o ani e al., 2012), and also in wo De macen o ni ens
ick species (Gonçal es e al., 2014). Mo e ecen ly, B. ga inii and B. bu gdo e i s.s.
we e epo ed o he i s ime in esiden s o u al a eas, who we e di ec ly o indi ec ly
exposed o wild and/o domes ic animals and icks in he no he n egion o Pa ana S a e,
con i ming he p esence o hese genospecies in B azil (Gonçal es e al., 2015).
 Lyme disease in Po ugal
In Po ugal he i s human case o LD was iden i ied in 1989 by Da id Mo ais and
collabo a o s in É o a egion. In his wo k he au ho s sugges ed, ei he new ec o s could
be implica ed in he ansmission o B. bu gdo e i s.l., since I. icinus species was
conside ed uncommon in ha egion, o he po en ial exis ence o a new Bo elia s ain
in he coun y. Subsequen s udies in he same Po uguese egion con i med he p esence
o mo e se oposi i e cases, some o hem wi h con i med clinical signs o LD (Filipe e
al., 1990, Núncio e al. 1992; Da id de Mo ais & Hen iques, 1999). Ten yea s la e his
zoonosis was conside ed a no i iable disease o he Po uguese Heal h Au ho i ies
(Po a ia 1071/98, A69.2).
The i s isola ed s ains o B. bu gdo e i s.l. we e ob ain om icks collec ed in he
Sou h o Po ugal, whe e a new species was iden i ied i s ly as PoTi B1, and la e
designa ed as B. lusi aniae (Núncio e al., 1993). Fu he s udies con i med he p esence
o o he s species o B. bu gdo e i s.l. in icks (B. a zelii, B. ga inii, B. alaisiana and B.
bu gdo e i s.s.) wi h di e en p e alence a es om 11.9% in se e al egions, o 31.2%
Chap e 1
S a e o he a
25
Table 4 - Ha d- ick gene a and espec i e species p esen in Po ugal.
Tick gene a
Ticks species
Re e ence
Specimen example
(o iginal pho os by
Mónica Nunes)
De macen o
(n=2)
ma gina us
Sulze , 1776
e icula us
Fab icius, 1794
Haemaphysalis
(n=3)
hispanica
Gil Collado, 1938
ine mis
Bi ula, 1895
punc a a
Canes ini & Fanzago,
1878
Hyalomma
(n=2)
lusi anicum
Koch, 1844
ma gina um
Koch, 1844
Ixodes
(n=10)
acumina us
Neumann, 1901
a bo icola
Schulze & Schlo ke,
1930
bi a i
Dias, 1990
canisuga
Johns on, 1849
on alis
Panze , 1798
hexagonus
Leach, 1815
icinus
Linnaeus, 1758
simplex
Neumann, 1906
en alloi
Gil Collado, 1936
espe ilionis
Koch, 1844
Rhipicephalus
(n=4)
boophilus annula us
Say, 1821
bu sa
Canes ini & Fanzago,
1878
pusillus
Gil Collado, 1938
sanguineus
La eille, 1806
Rega ding Rhipicephalus gene a, he species R. u anicus had been p e iously epo ed
in mainland Po ugal (Papadopoulos e al., 1992; Dias e al., 1994; Caei o, 1999; Es ada-
Peña e al., 2004; San os-Sil a e al. 2006) , al hough, i s p esence on he Medi e anean

Chap e 1
S a e o he a
26
a ea has been ques ioned. Acco ding o he opinion o Walke and collabo a o s (2000),
abou he genus Rhipicephalus, and oge he wi h he ecen molecula da a analysis om
San os-Sil a and collabo a o s, based on h ee mi ochond ial genes [12S DNA,
cy och ome c oxidase subuni II (COXII) and he con ol egion o d-loop (DL)] and one
nuclea gene (28S DNA), he icks commonly called R. u anicus in Po ugal by
mo phological analysis a e gene ically indis inguishable om R. sanguineus, poin ing
owa ds o he occu ence o a single species in Po ugal, R. sanguineus, cha ac e ized by
a high le el o mo phological polymo phism (San os-Sil a e al., 2011).
These di e en ick species can ansmi a la ge a ie y o pa hogenic agen s able o
causing disease in humans, wi h an eme gen isk in Po ugal (Table 5).
Table 5 - E iologic agen s ansmi ed by Ixodids p esen , o a eme ging isk, in Po ugal.
(Sou ce: adap ed om Núncio & Al es, 2014).
Pa hogenic agen
Disease
Ixodid species
Anaplasma phagocy ophilum
Human anaplasmosis
Ixodes icinus, I. en alloi
Babesia di e gens
Babesiosis
Ixodes spp.
Bo elia bu gdo e i s.l.
Lyme bo eliosis
Ixodes icinus
Coxiella bu ne ii
Q Fe e
Se e al species
F ancisella ula ensis
Tula emia
Se e al including Ixodes icinus and
De macen o e icula us
Ricke sia aeschlimannii
wi hou nomina ion
Hyalomma ma gina um
R. cono ii
Medi e anean Spo ed
Fe e
Rhipicephalus sanguineus
R. hel e ica
wi hou nomina ion
Ixodes icinus
R. massiliae
wi hou nomina ion
Rhipicephalus sanguineus
R. monacensis
wi hou nomina ion
Ixodes icinus
R. sibi ica mongolo imonae
LAR*
Hyalomma sp., Rhipicephalus pusillus
R. slo aca
TIBOLA**
De macen o ma gina us, D. e icula us
C imean-Congo hemo hagic
e e i us
Hemo hagic e e
Hyalomma ma gina um, Haemaphysalis
punc a a, Ixodes icinus, De macen o
spp. Rhipicephalus spp.
Eyach i us
wi hou nomina ion
Ixodes icinus, Ixodes en alloi
Tick-Bo ne Encephali is i us
Encephali is
Ixodes icinus, Haemaphysalis punc a a
* LAR - Lymphangi is-associa ed icke siosis; ** TIBOLA - Tick-bo ne lymphadenopa hy
Chap e 1
S a e o he a
27
Lyme disease agen s ha e been isola ed and iden i ied om di e en ha d- ick gene a,
al hough some icks cons i u e a g ea e isk o ansmi ing hese agen s o humans han
o he s (Sil a e al., 2006; F anke e al., 2013). These spi oche es a e ca ied mainly by
icks belonging o Ixodes genus om he Ixodidae amily (Pa ola & Raoul , 2001),
cu en ly comp ehending ou p edominan species, I. scapula is, I. paci icus, I. icinus,
and I. pe sulca us (Piesman & Ge n, 2004; S anek e al., 2012). Many, i no all, species
o his complex a e impo an ec o s o o he pa hogens ha cause human and li es ock
diseases, including ick-bo ne encephali is, anaplasmosis and babesiosis. The e o e,
h oughou his s udy, emphasis will be gi en o ick’s ep esen a i e o Ixodes genus,
classi ied as compe en ec o s, and mo e di ec ly in ol ed in B. bu gdo e i s.l. species
ansmission.
1.3.4 – Geog aphic dis ibu ion o Ixodes ec o
The e a e ou p edominan species o Ixodes icks associa ed o spi oche es ansmission
o humans, including I. scapula is in he eas e n Uni ed S a es and Canada, I. paci icus in
he wes e n USA, I. icinus in Eu ope and Asia, and I. pe sulca us in Asia (Figu e 12)
(Piesman & Ge n, 2004; S anek e al., 2012).
Figu e 12 – Geog aphical dis ibu ion o Ixodes species, ec o s o Lyme disease agen s.
(Sou ce: S anek e al., 2012).
Chap e 1
S a e o he a
28
The Eu opean ick, I. icinus species, also known as sheep ick o Cas o bean ick,
p esen s a wide geog aphic dis ibu ion ac oss Eu ope, due o abio ic and bio ic ac o s
such as speci ic mic oclima e, bio opes, and hos dynamics (Mo ila e al., 2012), and
ansmi s an e en g ea e a ay o pa hogens han i s “sis e ” in No h Ame ica, he species
I. scapula is (Lindg en & Jaenson, 2006; G ay e al., 2009). I. icinus ick has a high
a ini y o humans, making i he mos impo an b idging ec o in Eu ope (Guiguen &
Degeilh, 2001; Pa ola & Raoul , 2001). In he las decades he global wa ming in luenced
he dis ibu ion and abundance o his ec o , being p esen om he Fa oe Islands in he
wes (Jaenson & Jensen, 2007) o he Eu opean sec ion o he Russian Fede a ion in he
eas (Ko enbe g e al., 2002), and om No h A ica (Zhioua e al., 1999) o he No he n
Scandina ia (Lindg en e al., 2000), (Figu e 13).
Figu e 13 - Geog aphical dis ibu ion o Ixodes icinus in Eu ope. (Sou ce: ECDC, 2016).
This ick has he pa icula i y o ques ing o he ip o low ege a ion o mee i s hos s.
Du ing his ques ing, icks o en ha e o ace desicca ing condi ions, qui ing hei
ques ing place and mo ing o he li e /ma laye whe e hey egain los body wa e
(Randolph & S o ey, 1999; Ge n e al., 2008). Ixodes icinus mo es p e e en ially when
desicca ion isk is he lowes in na u e, a sundown (Ge n e al., 2008). I high desicca ing
condi ions a e las ing oo long, ick mo ali y is inc eased esul ing in ques ing ick
Chap e 1
S a e o he a
29
popula ion dec ease (Pe e e al., 2004). This ick is sensi i e o clima ic condi ions,
equi ing a ela i e humidi y o a leas 80% o su i e du ing i s o -hos pe iods, being
he e o e es ic ed o a eas o mode a e o high ain all wi h ege a ion ha e ains a high
humidi y (Medlock e al., 2013). Recen ly, his ick species has expand in e ms o al i ude
and la i ude, mainly due o clima ic changes, leading o he coloniza ion o new habi s
and modi ica ions in he seasonali y pa e ns (San os-Sil a e al., 2011).
In Po ugal I. icinus species can be ound ac oss he coun y, being mos p edominan in
a eas o deciduous woodland and mixed o es wi h mild empe a u es, whe e ela i e
humidi y le els a e high (Sil a e al., 2006). In un a o able condi ions (absence o
ege a ion and high empe a u e), he i ali y o each s age can be comp omised, leading
hem o ind sui able e uges o hei su i al, and o use su i al s a egies such as
diapause (Schwa z e al., 2012; S anek e al., 2012).
1.3.5 – Li e cycle o Ixodes icinus
The ick I. icinus is a iphasic ( h ee hos s), exophilic ( inds i s hos in an open
en i onmen ) and elo ophic species ( he imma u e s ages eed in di e en hos s,
including hose whe e he adul s eed), ha can ake abou h ee yea s o comple e i s li e
cycle. This ick, like all ha d-body icks, has h ee pos emb yonic de elopmen s ages -
la a, nymph, and adul (Figu e 14).
Figu e 14 - Ixodes icinus li e s ages.
(Sou ce: adap ed om h p://www.alleska en.nl/gezondheid/pa hologie-en- a macologie/).
adul emale
adul male
nymph
la a
Chap e 1
S a e o he a
30
Thei ac i i y occu s du ing all yea , howe e , i p esen s a speci ic seasonali y, being
adul s mo e ac i e be ween au umn (Oc obe ) and sp ing (Ma ch), while la ae and
nymphs a e mo e ac i e, in he hos and also in he ege a ion, be ween sp ing and
summe (Ap il o July). The du a ion o he li e cycle depends o impo an ac o s as
clima e and hos a ailabili y (Es ada-Peña e al., 2004; S anek e al., 2012; Handeland e
al., 2013).
The imma u e s ages (la a and nymph) emain mainly in low ege a ion, whe e la a
eed p ima ily on small mammals ( oden s and abbi s), and nymphs a e ound in hos s
o medium size like bi ds and ep ile, he adul s eed on a a ie y o la ge animals (Figu e
15). Wi h he excep ion o he adul male ha akes small blood meals and do no engo ge,
each li e s age equi es a blood meal om a e eb a e hos . Bo h gende s can also be
ound in high ege a ion, whe e hey expec po en ial hos s. Only one blood meal is made
in each e olu ional s age o he ick (Mannelli e al., 2012; Mo ila e al., 2012).
Figu e 15 - Li e cycle o Ixodes icinus icks. (Sou ce: adap ed om
h p:// ickapp. amu.edu/ ickbiology.php)
All s ages o I. icinus species use he same echnique o hold on o he hos , hey no mally
climb o he op o he ege a ion and when he hos passes he ick g abs o he u o

Chap e 1
S a e o he a
31
skin h ough i s ques ing legs, and hen bi es using i s specialized mou hpa s. A e i has
inished i s blood meal, which can las se e al days (3-4 days o la ae, 4-8 days o
nymphs and 5-20 days o adul emales), con ibu ing o hei geog aphical sp ead along
wi h he mo emen o he hos (Wilske, 2005), i loosen up om he hos o he soil, and
mol o he nex s age. The li e cycle o I. icinus ends wi h he ma ing, whe e he emale
ick a e ully engo ged p oduces eggs and deposi ed hem in he soil (o iposi ion). A e
he pos u e o he eggs (app oxima ely 2000), he emale dies (Es ada-Peña e al., 2004;
S anek e al., 2012; Medlock e al., 2013).
1.3.6 – T ansmission and Pa hogenesis
Bo elia bu gdo e i s.l. spi oche es can be ansmi ed o he ick by h ee possible ways:
i) h ough he blood meal in an in ec ed hos ( he mos common way); ii) by anso a ial
ansmission (TOT) and/o iii) by anss adial ansmission (Figu e 16).
Figu e 16 – Schema ic ep esen a ion o anso a ial and anss adial ansmission o
pa hogenic agen s in Ixodes icks. (Sou ce: h ps://en.wikipedia.o g/).
The anso a ial ansmission o spi oche es is a e, howe e , his hypo hesis has been
explo ed by many ick-bo ne pa hogens o main enance in na u al en i onmen and
epo ed o occu in bo h ixodid and a gasid icks (Rollend e al., 2013). Al hough s udies
ca ied ou bo h in he USA and Eu ope ha e shown B. bu gdo e i s.l. in I. scapula is
and I. icinus la ae (Rijpkema e al., 1994; Hubálek & Halouzka, 1998), his seems o
Chap e 1
S a e o he a
32
occu a a e y low a e. Fo his eason, TOT does no seem o play any signi ican ole
o he na u al main enance o B. bu gdo e i s.l. and a consequen minimal con ibu ion
o he dynamics o in ec ion in adul icks o he nex gene a ion is expec ed (Ne edo a
e al., 2004).
Ticks ansmi he spi oche es by cu aneous inocula ion o in ec ed sali a. A e he ick
a aches, he spi oche es dissemina e om he skin, o o he issues, o gans o sys ems,
h ough he blood low. I he ick has been a ached less han 24h, he isk o in ec ion is
low (Piesman, 1993), since he ansmission o Bo elia is mo e e icien as g ea e is
ixa ion ime o he ick o he hos , being necessa y an a achmen o 48-72h o a
success ul ansmission o he spi oche e. Howe e , se e al au ho s e i ied ha he
a achmen ime o he hos depends on he Bo elia species and also on he ec o (S anek
e al., 2012). Fo example, he spi oche e o B. bu gdo e i s.s. is no ansmi ed be o e
48h o a achmen , while B. a zelii can be ansmi ed in less han 24h. Also, I. icinus can
ansmi ed he spi oche es as e han I. scapula is and I. paci icus (Ma ques, 2010;
Wood & La e y, 2013).
Du ing he a achmen , icks injec s a complex mix u e o bioac i e chemicals in o he
hos , like his amine binde s and cy okine inhibi o s o media e he hos esponse,
complemen inhibi o s o supp ess he hos immune esponse, and an icoagulan s o
acili a e he blood meal (Mülle -Doblies & Wikel, 2005). This esul s in a painless “bi e”
and usually p e en s an in lamma o y esponse. Spi oche es dissemina e, along wi h he
blood meal, om he in ec ed hos o he ick, and colonize he midgu . They emain in
he midgu mul iplying un il he nex blood meal, when a ac ion o he spi oche es om
he midgu in ade he sali a y glands. While spi oche es a e in he midgu , hey exp ess
high le els o OspA, since i s p esence is a equi emen o su i al in he ick by
acili a ing adhesion o he spi oche e o he midgu wall (Pal e al., 2000), biding o a
ecep o TROSPA ( ick ecep o o ou e su ace p o ein A), essen ial o spi oche e
coloniza ion. OspA p o ein is hen down egula ed, while he ick p epa es o he blood
meal, he spi oche es passes om he midgu o he sali a y glands and om he e o he
hos . Simul aneously, Ou e su ace p o ein C (OspC) is up egula ed (Schwan e al., 1995;
Schwan & Piesman, 2002). The ole o his p o ein is no clea , since i may ha e
mul i ac o ial ac i i y including helping in hos in ec ion, in asion and dissemina ion,
(Tilly e al., 2013). OspC exp ession and in ec i i y inc eases du ing some days once he
Chap e 1
S a e o he a
33
spi oche es ha e in aded hos issues by biding o he ick sali a y p o ein, Salp15 (Pal
e al., 2004; Pal & Fik ig, 2010) (Figu e 17). Though being an igenic, i is e en ually
down egula ed o minimize hos an ibody esponse.
Figu e 17 - Tick sali a y p o ein (Salp15) ha binds and p o ec s Bo elia bu gdo e i
s.l. spi oche es. (Sou ce: Rosa, 2005).
A majo ac o in he OspA/OspC complemen a y exp ession is he empe a u e. When a
ick inds a hos and s a s o eed, i mo es om ambien empe a u e o he empe a u e
a he su ace o mammalian hos skin. This apid empe a u e change in luences he
spi oche e popula ion and induces OspC exp ession (Schwan & Piesman, 2002). This can
be impo an o Bo elia spi oche es ansmission ime om ick o hos . Tick blood
eeding beha io includes engagemen , he adhe ence o he hos ; explo a ion, he sea ch
o a sui able si e o a achmen ; and pene a ion, whe e he ick inse s he mou hpa s
in he hos o eeding (Cook, 2015). Du ing he p ocess o ick explo a ion, empe a u e
ise will ac i a e OspA/OspC egula ion and he p ocess o inc eased mo ili y and
in ec i i y begins. Explo a ion ime will be highly a iable, since i depends on how
Chap e 1
S a e o he a
34
quickly he ick mig a es o an op imal si e. This ime could a y wi h se e al ac o s as
hos animal size, compe ing icks p esence, o ejec ion o an unsui able si e (Cook, 2015).
In addi ion o icks acqui ing in ec ions di ec ly om an in ec ed blood meal, as s a ed
ea lie , hey can also ge in ec ed by a p ocess known as co eeding ansmission. In his
mode o ansmission, unin ec ed icks acqui e in ec ions om in ec ed icks ha a e
eeding in close p oximi y o hem on he same hos . This phenomenon has been
demons a ed in ansmission o B. bu gdo e i s.s. spi oche es by I. scapula is (Pa ican,
1997; Piesman & Happ, 2001) and I. icinus (Ge n & Rais, 1996), B. a zelii by I. icinus
(C ippa e al., 2002), and B. ga inii by I. pe sulca us (Sa o & Nakao, 1997). The
signi icance o co eeding ansmission o he epidemiology o LD is poo ly unde s ood;
howe e , i seems o be mo e e icien in he Eu opean “sys em” o B. a zelii and I. icinus
han he No h Ame ican “sys em” o B. bu gdo e i s.s. and I. scapula is (Voo douw,
2015). The impo ance is ela ed o he po en ial o nymph- o-la a co eeding e en s,
which depends on he synch ony o la al and nymphal hos sea ching and ques ing
ac i i y. In Eu ope, he wo s ages o imma u e icks a e ac i e du ing he same imes o
he yea om sp ing o au umn, whe eas in No h Ame ica, he peak ac i i y o hese
s ages may occu du ing di e en imes o yea (Ku enbach e al., 2006; Ba bou e al.,
2009). Because dee and o he la ge ce ids may ca y all s ages o icks simul aneously,
hese hos s may play an impo an ole in p o iding a pla o m o co eeding ansmission
o occu e en hough hey a e no in ec ed hemsel es (Voo douw, 2015).
The hos esponse o B. bu gdo e i s.l spi oche es can also play a key ole in disease
pa hogenesis. These bac e ia does no p oduce oxins o p o eases ha a e di ec ly
esponsible o issue damage upon coloniza ion. In con as , he bac e ium p oduces
mul iple molecules ha ac i a e hos esponses and can lead o localized and gene alized
in lamma o y pa hogenic esponses. Mos o hese hos esponses no mally unc ion o
con ain o clea in ec ions and a e componen s o he inna e de ense and/o in lamma o y
esponse (Benhnia e al. 2005; Behe a e al., 2006; Oos ing e al., 2010). Al hough hei
pu pose is o clea in ec ion, i con inually ac i a ed, hey lead o lesion de elopmen and
disease.
One o hese mul iple molecules, a e lipop o eins ha ac i a e Toll-like ecep o s (TLRs)
1 and 2 in a CD14-dependen manne (Hi sch eld e al., 1999), and also induces ype I
Chap e 1
S a e o he a
41
o diame e , wi h lympho e icula p oli e a ion in he de mis and/o subcu is
(Mullegge , 2004);
 in ec ion o he cen al ne ous sys em (CNS) wi h he common mani es a ions o
Lyme neu obo eliosis (LNB) including lymphocy ic meningo adiculoneu i is –
Bannwa h’s synd ome, acu e acial ne e palsy (Bell’s palsy), which consis s in a
pa alysis o weakness o muscles on one o bo h sides o he ace (Table 6), and
lymphocy ic meningi is (S anek & S le, 2008; Mygland e al., 2010). LNB is an
in ec ious diso de and he mos equen synd ome o dissemina ed in ec ion on
Eu ope, howe e , is becoming an mo e common symp om in No h Ame ican LB
pa ien s (Ga cia-Monco & Benach, 1998; Mygland e al., 2010);
 se e e muscle pain o numbness in he a ms and legs, being common pain o swelling
in he knees, shoulde s, elbows and o he la ge join s. All hese symp oms con ibu e
o Lyme a h i is (Table 6) (Hu, 2005);
 a wide ange o clinical ca diac complica ions, including palpi a ions and dizziness,
a io en icula block, pe ica di is, myoca di is o mo e a e ca diomyopa hy also
known as Lyme ca di is (Lelo as e al., 2008);

Chap e 1
S a e o he a
42
Table 6 - The h ee s ages o Lyme disease and examples o some clinical mani es a ions.
S age o disease
Timing
Common mani es a ions
Examples o
clinical
mani es a ions
Ea ly Localized
Days o
weeks
A solid ed o bull’s eye
lesion (e y hema mig ans -
EM); egional
Lymphadenopa hy.
EM
Ea ly dissemina ed
Weeks
Mos commonly mul iple
ashes, Bell’s palsy and
meningi is; a ely ca di is
wi h a ying deg ees o hea
block; also join pain,
headaches, s i neck,
lymphadenopa hy, ision
al e a ions.
Bell’s palsy
La e
Weeks o
mon hs
Recu en a h i is;
Ac ode ma i is Ch onica
A ophicans - ACA;
neu ological diso de s;
pe iphe al neu opa hy.
ACA
Chonic La e LD – Pe sis en in ec ion (s age 3) – no mally occu s mon hs o yea s a e
he ick bi e, wi h ch onic mani es a ions o a h i is, ac ode ma i is ch onica a ophicans
(ACA) (Table 6) and la e neu obo eliosis mani es a ions including se e al deg ee o
encephalopa hy and encephalomyeli is, besides a ious neu opsychia ic symp oms.
ACA is associa ed o B. a zelii and usually begins on he ex enso si es o he membe s
ex emi ies, on he lowe leg wi h ini ial in ol emen o one oo , and i does no heal
spon aneously (S anek e al., 2002), being mo e common in Eu ope and Asia bu no
equen in No h Ame ican pa ien s.
Chap e 1
S a e o he a
43
This di e si y o symp oms, can be explain in pa , by he di e en species o Bo elia
esponsible o LD in se e al geog aphic a eas, and also possibly by gene ic di e ences
among he a ec ed popula ions (Reed, 2002). Fo example in Eu ope LNB is mos o en
caused by B. ga inii, and skin complica ions a e usually associa ed o B. a zelii, howe e ,
ega ding he a icula complica ions hese can be due o se e al species like B. ga inii,
B. a zelii and B. bu gdo e i s.s.. Meanwhile, in USA B. bu gdo e i s.s. is he species
esponsible o cases o Lyme a h i is (S le & S anek, 2009), and he no el iden i ied B.
bu gdo e i s.l. genospecies – B. mayonii – also causes Lyme bo eliosis, bu wi h
subs an ially ele a ed spi ochae aemia and clinical ea u es dis inc om o he
ecognized B. bu gdo e i s.l. species (P i e al., 2016). The e o e, he clinical
mani es a ions a e dis inc in No h Ame ica and in Eu ope, e lec ing he global
dis ibu ion o he di e en spi oche es species and e e geno ypes as u he will be
explain (Wang e al., 1999).
Fu he mo e, in Eu ope LD occu s in simila equencies in bo h gende s, wi h excep ion
o ACA ha is mo e common in women. Ea ly LNB cases showed a bimodal age
dis ibu ion wi h a lowe equency in he age ange o 20 o 29 yea s old, while ACA
occu s mos ly in olde pa ien s (Wilske, 2005).
1.5.2 – Labo a o y diagnosis – Con en ional me hodologies
Lyme disease diagnosis is mainly clinical, based in signs and symp oms, he pa ien ’s
his o y o ick bi e o exposu e, anamnesis, and complemen ed by epidemiological da a.
In mos cases he clinical diagnosis should be ollowed by labo a o y es s, due o he
unspeci ic na u e o he clinical mani es a ions. The possibili y ha LD agen s can be
in ol e in o he diso de s, makes necessa y o a labo a o y esponse unequi ocal,
h ough sensi i es and speci ic es s (S anek e al., 2011).
Un o una ely, he e a e no s anda dized diagnos ic c i e ia o LD, which has led o bo h
o e and unde diagnosis o he disease. CDC has published case de ini ions o
su eillance pu poses, despi e emphasizes ha hese a e no in ended as diagnos ic c i e ia
(Table 7) (CDC, 2011).
Chap e 1
S a e o he a
44
Table 7 - Case de ini ion om Cen e s o Disease Con ol and P e en ion (CDC), o
su eillance pu pose. (Fon : adap ed om Bo che s e al., 2014).
Case de ini ion
CDC
E y hema mig ans
A skin lesion ha ypically begins as a ed
macula e o papule and expands o e a pe iod
o days o weeks o o m a la ge ound lesion,
o en wi h cen al clea ing.
The la ges diame e mus each a size ≥ 5 cm;
The diagnosis mus be made by a physician:
Labo a o y con i ma ion is ecommend o
pe son wi hou known exposu e.
Neu obo eliosis
Any o he ollowing mani es a ions (alone o
in combina ion):
Lymphocy ic meningi is;
C anial neu i is, pa icula ly acial palsy (may
be bila e al);
Radiculoneu opa hy;
Encephalomyeli is;
Encephalomyeli is mus be confi med by B.
bu gdo e i -specific an ibody p oduc ion in
CSF.
Musculoskele al sys em
Recu en b ie a acks o objec i e join
swelling in one o a ew join s, some imes
ollowed by ch onic a h i is in one o a ew
join s.
Ca dio ascula sys em
Acu e onse o high-g ade (2nd o 3 d deg ee)
a io en icula conduc ion de ec s ha
esol e in days o weeks and a e some imes
associa ed wi h myoca di is.
Suspec ed
A case o EM wi hou known exposu e
(defined as ha ing been ≤ 30 days be o e he
onse o EM in wooded, b ushy, o g assy
a eas in a coun y in which Lyme disease is
endemic);
A case wi h labo a o y e idence o in ec ion
bu wi hou a ailable clinical in o ma ion;
P obable
Any o he case o physician-diagnosed Lyme
disease ha has labo a o y e idence o
in ec ion;
Chap e 1
S a e o he a
45
(Con . Table 7)
Con i med
A case o EM wi h a known exposu e; A case
o EM wi h labo a o y e idence o in ec ion
and wi hou a known exposu e; A case wi h a
leas one la e mani es a ion ha has labo a o y
e idence o in ec ion;
Labo a o y e idence
Posi i e cul u e o Bo elia bu gdo e i o
Two- ie es ing ( o specific an ibodies)
in e p e ed using es ablished c i e ia, whe e
Posi i e IgM is su ficien du ing he i s 30
days om symp oms onse ;
Posi i e IgG is su ficien a any poin du ing
illness;
Single- ie IgG immunoblo se oposi i i y
using es ablished c i e ia; CSF an ibody
posi i e o B. bu gdo e i s.l. by enzyme
immunoassay (EIA), o indi ec
immuno luo escence assay (IFA), when he
i e is highe han i was in se um.
Also he EUCALB (Eu opean Conce ed Ac ion on Lyme Bo eliosis), has p oposed
clinical case de ini ions o use in clinical se ings and epidemiological in es iga ions
(S anek e al., 2011; Bo che s e al., 2014). Excep o EM, LD mani es a ions a e no
speci ic, ha ing a a ie y o causes. The e o e, i is impo an o ob ain a de ailed pa ien s
his o y in o de o es ablish p obable exposu e o Ixodes icks in an endemic a ea a an
app op ia e ime o he yea , and o ob ain app op ia ed and de ini i e labo a o y
con i ma ion.
Labo a o y es ha e imp o ed a lo in he las decades and clinicians ha e now a ailable
a ange o op ions o me hods ha can be classi ied in wo ypes: Di ec me hods (cul u e
and molecula app oaches), and Indi ec me hods (immunologic and se ological
app oaches).
 Di ec me hods
Labo a o y es s o di ec de ec ion o Bo elia a e gene ally limi ed by he low numbe
o spi oche es in clinical samples, also he lack o sensi i i y o di ec es s is one o he
main challenges in he diagnosis o LD. Al hough di ec es s o B. bu gdo e i can be
e y help ul, none a e usually equi ed o he diagnosis o he disease (Ma que, 2015).
Chap e 1
S a e o he a
46
The main di ec es modali ies used a e cul u e and PCR o Bo elia DNA de ec ion.
His opa hology has limi ed u ili y, being used mos ly o exclude o he diseases, and in he
e alua ion o suspec ed cases o bo elial lymphocy oma and ACA (Müllegge & Gla z,
2008; Zajkowska e al., 2011). De ec ion o B. bu gdo e i is di icul and ime consuming
because o he ex eme sca ci y o o ganisms (Du ay, 1989; de Koning e al., 1995).
Cul u e
Cul u e is no a ypically a ailable diagnos ic me hod o he diagnosis o LD in clinical
p ac ice, due o i s ela i ely low sensi i i y, long incuba ion ime, equi es special media
and expe ise. Howe e , he abili y o isola e and o main ain B. bu gdo e i s.l. cul u es
is essen ial in esea ch, and cul u e emains he gold s anda d o con i m he diagnosis.
Me hods ha would imp o e sensi i i y and simpli y he p ocedu e a e needed o allow
i o be adop ed mo e ex ensi ely. Since B. bu gdo e i s.l. has a limi ed me abolic
capaci y, a complex g ow h medium o cul i a ion is essen ial. The Ba bou -S oenne -
Kelly medium (BSK) (Pollack e al., 1993) and he modi ied Kelly-Pe enko e medium
(MKP) (Ružić-Sabljić e al., 2006) a e he mos used medias o B. bu gdo e i s.l.
cul u es. The BSK medium has he pa icula i y o changing colo , om o ange o yellow,
when he spi oche es g ow h, due o i s acidi ica ion (Figu e 20). Cul u es can be
examined using da k- ield mic oscopy o luo escen mic oscopy (Li e is e al., 2011).
The spi oche es o B. bu gdo e i s.l. species has a slow ep oduc ion a e and cul u es
a e main ained unde anae obic o mic oae ophilic condi ions wi h a empe a u e anging
om 30-34ºC, du ing a leas 8 o 12 weeks be o e being conside ed nega i e (Li e is e
al., 2011).
Figu e 20 - Cul u es o B. bu gdo e i s.l. in selec i e medium BSK. The changing o he
medium colo , om o ange o yellow, shows he spi oche es g ow h. (Sou ce: O iginal pho o
by Mónica Nunes).

Chap e 1
S a e o he a
47
The success o cul u ing B. bu gdo e i s.l. depends o he specimen, he biological
sample (e.g. luids o biopsies), he e olu ion o he disease, and he expe ise o he
labo a o y s a . I may also depend o he geno ype (Xu e al., 2013). Also, i he pa ien
was subjec ed o an an ibio ic he apy wi h e ec i e d ugs agains B. bu gdo e i s.l.
(e en a single dose) he cul u e sucess a e is signi ican ly a ec ed (Nadelman e al.,
1993; Picken e al., 1997).
Cul u e o skin biopsies om EM has a sensi i i y o 40% o 60% (Li e is e al., 2012;
Og inc e al., 2013; Ružić-Sabljić e al., 2014). In he USA, whe e disease is caused by
B. bu gdo e i s.s., posi i e cul u es a e associa ed wi h sho e du a ion o he disease
and smalle lesions (Li e is e al., 2002; Li e al., 2011). In cen al Eu ope, posi i e skin
biopsy cul u es (mos ly isola es we e B. a zelii) we e associa ed wi h la ge lesions (up o
abou 15 cm in diame e ) and inc eased du a ion (up o 30 days) (S le e al., 2013). These
indings a e p obably ela ed wi h he di e en Bo elia species and he hos immune
esponse ha e en ually con ols he in ec ion. Cul u e is mode a ely success ul in skin
biopsies o ACA lesions (Picken e al., 1997).
Cul u e o plasma samples om un ea ed pa ien s wi h ea ly dissemina ed in ec ion has
a sensi i i y o a ound 40%, which can be inc eased o 75% by equen es ing cul u e
aliquo s wi h a sensi i e PCR. Blood cul u es a e mo e likely o be posi i e in pa ien s
wi h mul iple EM (Li e is e al., 2011). B. bu gdo e i s.l. is a ely cul u ed om he
blood o LD pa ien s wi h la e mani es a ions (Nowakowski e al., 2009; Ma aspin e al.,
2011). Isola ion o B. bu gdo e i s.l. om o he o igins, as CSF and syno ial luid is
uncommon and he isola ion a e is e y low e lec ing he small numbe o iable
o ganisms p esen in hose loca ions (Wo mse e al., 2012).
Mic oscopy
The spi oche es can be di ec ly de ec ed in biologic samples such as blood, ick issues
and skin biopsies by da k- ield mic oscopy, s aining wi h app op ia e s ains, and by
his ochemical echniques. Howe e , due o he low numbe o spi oche es in samples and
o he limi a ions o mic oscopy obse a ion, his app oach is a ely used (Bap is a, 2006).
Chap e 1
S a e o he a
48
Polyme ase chain eac ion (PCR)
In he las decades, many labo a o ies ha e s a ed o gi e mo e a en ion o he molecula
assays, wi h he aim o inc ease he sensi i i y and speci ici y o LD diagnosis, and educe
he ime consuming o he con en ional echniques. The de ec ion o Bo elia DNA
ca ied h ough PCR p esen s a a iable sensi i i y, anging om 10-30% (in case o CSF
samples), o 50-70% o blood, skin biopsy and syno ial luid samples (B a on e al.,
2008; S anek e al., 2011). These a ia ion is due o he me hodology, gene a ge s and
p ime se s used (Picken e al., 1997; Glins e al., 2008).
Con en ional PCR o nes ed-PCR can be used, ye nes ed-PCR in mo e speci ic and
sensi i e since i uses wo s eps o ampli ica ion, wi h one se o p ime s each, ins ead o
he single s ep and single pai o p ime s in ol e in he classical PCR. Se e al a ge s
ha e been used o he ampli ica ion o B. bu gdo e i s.l. DNA, such as 5S/23S DNA
in e genic egion, 16S genes, lagellin and p66 ch omossomal genes o he ospA and ospB
genes (P iem e al., 1997; Schmid , 1997; Wilske e al., 2007). The a ge s ca ied on
plasmids (opsA, ospB, opsC and lsE) a e p esen in mul iple copies wi hin each
bac e ium, and assays wi h hese a ge s p esen s a g ea e sensi i i y han hose using
single-copy ch omosomal a ge s such as lagellin, ecA, poB, 16S and 23S DNA, and
in e genic space s.
Res ic ion F agmen Leng h Polymo phism-PCR (RFLP-PCR), is a de i a ion o he
PCR, and i is no mally used o geno yping B. bu gdo e i s.l. species, being he mos
used a ge he in e genic egion 23S ( l) – 5S ( ) o he DNA, we e he ampli ica ion
p oduc is hen diges ed by an endonuclease (MseI o D aI), and an pa e n o p oduc s
wi h di e en sizes is ob ained, allowing o di e en ia e be ween Bo elia genospecies
(Pos ic e al., 1994).
O he PCR-based echniques can be used o he di ec diagnosis o LD, such as Mul iplex
Real-Time PCR and Re e se T ansc ip ase PCR (RT-PCR) (Limbach e al., 1999;
Cou ney e al., 2004), howe e , a s anda dized PCR p o ocol is ye o be de ined (Wilske
e al., 2007).
A nega i e esul in a PCR es canno be in e p e ed as an exclusion o LD. Since he
numbe o spi oche es in in ec ed issues o in body luids o pa ien s a e e y low, and
app op ia ed p ocedu es o sample collec ion, anspo and DNA ex ac ion a e c i ical
Chap e 1
S a e o he a
49
o eliable and consis en PCR esul s (Wang e al., 2010). The alse posi i e esul s is
one o he limi a ion o nucleic acids ampli ica ion me hods, due o con amina ions, which
can be e y oublesome in assays se o maximum sensi i i y, a equi emen o LD
diagnosis (Schmid , 1997).
 Indi ec me hods
The hos immune esponse o B. bu gdo e i s.l. can be de ec ed by indi ec me hods,
based on he p esence/absence o an ibodies in se um agains he spi oche es. Only he
an ibody-based assays a e app o ed and ecommended o Lyme disease es ing by he
USA Food and D ug Adminis a ion (FDA) (Ma ques, 2015).
In USA abou 3.4 million o Lyme se ologic es s a e done pe yea , almos 1000x mo e
han he es ima ed numbe o 300,000 cases o LD, and a majo p oblem o hese
labo a o y es s is i s inapp op ia e use. Mos likely hese es s a e being used in condi ions
o which hey a e no ecommended, including uling ou LD in popula ions wi h a low
p obabili y o ha ing he disease. The p edic i e alue o a es is de e mined by i s
sensi i i y, speci ici y, and he p e alence o LD in he es ed popula ion. The e o e in a
pa ien wi h a low p obabili y o LD, a nega i e es s ules ou he disease, whe eas a
posi i e esul is mo e likely o be a alse-posi i e (Ma ques, 2015).
Al eady in 1995 he CDC ecommended o LD es pe o mance and in e p e a ion a
s anda dized 2- ie es ing (STTT) app oach o imp o e he speci ici y o se ologic es s
in USA (Figu e 21) (CDC, 1995).
Figu e 21 - Cu en CDC ecommenda ions o se ologic diagnosis o Lyme disease.
(Sou ce: Adap ed om Ma ques, 2015).
Chap e 1
S a e o he a
50
The se um samples should be es ed wi h a sensi i e i s - ie EIA, o IFA, and i he esul
is bo de line o posi i e, an IgM and IgG Wes e n blo (WB; also called immunoblo ) is
applied as second s ep (Ma ques, 2015; Sch ie e , 2015). La e on i was s ipula ed ha
IgM WB should only be applied o pa ien s in an ea ly phase o he disease, wi h a
du a ion o 30 days o less. The WB is in e p e ed by a s anda dized c i e ia ha equi es
a leas wo o h ee an igenic ac ions (signa u e bands) o a posi i e IgM WB (p21
[OspC], p39 [BmpA], and p41 [ lagellin B] (Engs om e al., 1995), and i e o en
an igens o a posi i e IgG WB (p18, p21 [OspC], p28, p30, p39 [BmpA], p41 [ lagellin
B], p45, p58, p66, p93 (D essle e al., 1993). The 2- ie app oach algo i hm has a good
pe o mance when used as ecommended, howe e , he e’s s ill many imp o emen s o
be done, including he si ua ions o low sensi i i y du ing ea ly in ec ion, subjec i e
in e p e a ion o bands, and di icul y o heal h ca e p o ide s in in e p e ing he esul s
(Ma ques, 2015).
The majo i y o indi ec assays is based on whole-cell sonica e (WCS) om B.
bu gdo e i s.l. cul u es, howe e , a signi ican numbe o alse-posi i e esul s can occu ,
due o c oss- eac i e an igens (Gomes-Solecki e al., 2000). Mo eo e , some an igen
exp ession can di e om cul u e o in i o, o example he exp essed VlsE lipop o ein
ha causes a s ong humo al esponse du ing in ec ion, has a minimal exp ession in
cul u ed B. bu gdo e i s.l.. The addi ion o his lipop o ein o he 2- ie app oach has
imp o ed i s pe o mance (B anda e al., 2010). Also, es s ha use C6 pep ide (26-amino
acid pep ide om conse ed egion 6 o VlsE has a sensi i i y simila o WCS-based
EIAs, wi h signi ican ly imp o ed speci ici y (B anda e al., 2011; Wo mse e al., 2013).
Se e al o he s ecombinan and syn he ic an igens ha e been e alua ed in se odiagnosis
o LD, including an igens combining po ions o di e en p o eins (A naboldi e al.,
2013).
An ibody-based es sensi i i y inc eases wi h he e olu ion o he in ec ion, and he e is
a lag om ini ial in ec ion un il he ime when he e a e su icien le els o an ibodies o
be de ec ed. Pa ien s who p esen e y ea ly symp oms a e mo e likely o ha e a nega i e
esul o LD. Less han 50% o pa ien s wi h EM a e se oposi i e a p esen a ion, and
hese pa ien s should ecei e ea men based mainly on he clinical diagnosis.
Chap e 1
S a e o he a
57
been in es iga ed using a a ie y o a ge s om bo h ypes o DNA (Schmid , 1997;
Ague o-Rosen eld e al., 2005).
Assays designed o a ge plasmid-bo ne genes, such as ospA, ospC, o lsE, a e mo e
sensi i e han hose a ge ing ch omosomal, lagellin o 16s DNA genes (Pe sing e al.,
1994; Zo e e al., 2002), mos likely because o he inding ha Bo elia o en shed
plasmid-con aining blebs, which allows o highe concen a ions o plasmid han
ch omosomal DNA. Howe e , i is now well ecognized ha hese blebs disassocia e
om he spi oche e and may pe sis in issues and body luids (Pe sing e al., 1994).
The e o e he de ec ion o plasmid DNA om hese non iable blebs may elici alse-
posi i e esul s ha do no necessa ily e lec ongoing LD. Ch omosomal a ge s usually
occu as single copies; al hough a ge ing hese genes may esul in lowe analy ical
sensi i i y, hey may be a be e p edic o o o ganism iabili y (Li e is e al., 1999).
Se e al s udies show ha some ma ices a e be e han o he s o he di ec de ec ion o
Bo elia DNA om clinical specimens. The pe o mance o hese specimens in NAATs
depends on he s age o in ec ion a he ime o pa ien p esen a ion. Al hough hese assays
ha e demons a ed high speci ici y, sensi i i y has been lacking, p obably due o he
absence o a ue gold s anda d assay, o a s anda dized app oach o compa ison o he
a ious me hods unde de elopmen . Howe e , NAATs can se e as an adjunc
diagnos ic modali y alongside wi h clinical indings and se ologic es ing (Swanson e al.,
2006; Ma aspin e al., 2011).
 Iso he mal DNA ampli ica ion
In he las decade, i has been obse ed a huge ise in he abundance and a ailabili y o
nucleic acid in o ma ion, allowing he use o DNA and RNA ampli ica ion echniques o
speci ic de ec ion, ha nessing he complexi y inhe en in gene ic ma e ial o he pu pose
o a ge ed iden i ica ion. Molecula diagnos ic echniques using nucleic acids we e
pionee ed h ough use o PCR, which emains he p edominan me hod in he ield due
o i s obus ness, sensi i i y and amilia i y. Howe e , he g owing use o hese molecula
diagnos ic me hods has emphasized speed and simplici y as key c i e ia o adop ion in
poin -o -ca e and ield applica ions, and iso he mal ampli ica ion echniques a e well-
sui ed o hese uses. Due o hei na u e, iso he mal ampli ica ion me hods equi e only

Chap e 1
S a e o he a
58
a single empe a u e, a oiding he need o cos ly he mal cycling equipmen and
po en ially e en elec ical powe , depending on incuba ion empe a u e and hea ing
(Tanne & E ans, 2014). Mo eo e , by cons an incuba ion and ampli ica ion, no
empo al es ic ions om de ined cycles a e implied, esul ing in ampli ica ion eac ions
as apid as i een minu es (Fang e al., 2010; Wang e al., 2011).
The mos widesp ead iso he mal me hod is loop-media ed iso he mal ampli ica ion
(LAMP), whe e since i s i s publica ion in 2000 by No omi and collabo a o s, hese
echnique has been applied o diagnos ic de ec ion o hund eds o pa hogens in clinical,
plan , ood and animal samples (A ai e al., 2015; Fe a a e al., 2015; Palacio-Bielsa e
al., 2015). This me hodology p esen s a simple, obus and lexible pla o m o molecula
diagnos ics.
The LAMP eac ion employs a DNA polyme ase wi h s and displacemen ac i i y and
ou o six specially designed p ime s ha ecognize six dis inc sequences on he a ge
DNA unde iso he mal condi ions (60-65°C), whe e a dena u ed empla e is no equi ed.
No mally, he eac ion uns o abou 60 minu es, showing an ex emely high speci ici y
(Nagamine e al., 2002; Mo i & No omi, 2009). Also, LAMP me hod has a high
ampli ica ion e iciency ha allows he syn hesis o la ge amoun s o DNA in a sho
ime. I s de ec ion limi is a ew copies pe eac ion and he e o e is compa able o PCR
(Mo i & No omi, 2009). Fo he assay pe o mance, only a hea ing block a a cons an
empe a u e o a wa e ba h is necessa y.
To pe o m he eac ion, a se o wo specially designed inne and ou e p ime pai s and
a DNA polyme ase wi h s and displacemen ac i i y a e equi ed o he DNA syn hesis.
The ini ial eac ion s eps a e illus a ed in Figu e 23.
DNA egions F3 and R3 a e complemen a y o F3c and R3c on he empla e, espec i ely.
The F2 egion in he o wa d inne p ime FIP is complemen a y o he F2c egion
ollowed by he F1c complemen a y o F1 o he a ge DNA. The same p inciple is used
o design he backwa d p ime . As a esul , hese ou p ime s ecognize six dis inc
sequences which ensu e high speci ici y o a ge ampli ica ion. Mo eo e , hese p ime s
enable gene a ion o a s em-loop DNA o subsequen complex LAMP cycling including
sel -p iming eac ions. In he ini ial s eps o he LAMP eac ion all ou p ime s a e
employed, bu in he la e cycling s eps, only he inne p ime s a e used o s and
Chap e 1
S a e o he a
59
displacemen DNA syn hesis. The inal p oduc s is a mix u e o s em loop DNAs wi h
se e al in e ed epea s o he a ge and cauli lowe -like s uc u es wi h mul iple loops
o med by annealing be ween al e na ely in e ed epea s in he same s and (No omi e
al., 2000; Tomi a e al., 2008). The eac ion can be accele a ed by using wo ex a loop
p ime s.
Figu e 23 - Schema ic ep esen a ion o Loop-media ed iso he mal ampli ica ion assay.
LAMP is cha ac e ized by he use o ou p ime s (F3, B3, FIP and BIP), in an iso he mal
(60–65ºC) au o-cycling s and displacemen eac ion. (Sou ce:h p://wha -when-
how.com/ opical-medicine/no el-molecula -diagnos ic-pla o m- o - opical-in ec ious-diseases-o he -
opical-in ec ious-and-non-in ec ious-condi ions-pa -1).
LAMP ampli ica ion p oduc s can be de ec ed ei he by gel elec opho esis, eal- ime
moni o ing o u bidi y wi h a u bidime e (Mo i e al., 2001; Mo i e al., 2004), o simply
wi h he naked eye. Du ing he eac ion, a la ge amoun o DNA is syn hesized, yielding
a la ge py ophospha e ion by-p oduc . I was obse ed ha py ophospha e o ms an
insoluble, obse able whi e p ecipi a e wi h di alen me allic ions (Mo i e al., 2001).
Ano he isual de ec ion me hod based on he o ma ion o py ophospha e can be
accomplished by using he luo escen me al indica o calcein, which binds ee calcium
ions. Calcein has been used o he eal- ime de ec ion o DNA o ma ion du ing LAMP
(Tomi a e al., 2008). Fu he me hods apply in e cala ing DNA dyes such as SYBR
Chap e 1
S a e o he a
60
G een I (Soliman & El-Ma bouli, 2005), FDR (Yoda e al., 2007), o oligonucleo ide
p obes labeled wi h di e en luo escen ma ke s, as well as low molecula weigh
ca ionic polyme s such as polye hylenimine (Mo i e al., 2006).
The e a e se e al wo ks epo ing he use o his echnology o de ec pa hogenic
o ganisms, howe e , o Bo elia his app oach is s ill ha dly applied, exis ing so a only
wo published s udies (Yang e al., 2013; Zhang e al., 2015).
I ’s impo an o employ LAMP echnique on la ge scale in esou ced-limi ed labo a o ies
in de eloping coun ies, whe e many a al opical diseases a e endemic. Also in he nea
u u e, LAMP es ing ki s on eadymade mic ochips a e o be used by bo h de eloped and
de eloping coun ies.
 Immunoch oma og aphic assays
In he la e 1960s immunoch oma og aphic assays we e i s desc ibed, being o iginally
de eloped o assess he p esence o se um p o eins (Kohn, 1968; Pe uski e al., 2003).
Howe e , o e he pas decade many o he applica ions ha e been de eloped o
immunoch oma og aphic assays, including he de ec ion o bac e ial pa hogens ( an
Dommelen e al., 2008; P eechakasedki e al., 2012; Widiyan i e al., 2013).
The ins an aneous examina ion o changes in one’s own physical symp oms o heal h
s a us is inc easingly p e e ed. Sel - es s pe o med a home will de ini ely be an in eg al
pa o u u e heal h ca e sys ems (P ice, 2001). In ac , he ma ke expansion o home-
e sion diagnos ic ki s in de eloped coun ies, ypically in he Uni ed S a es, a exceeds
he a e age o o e all in i o diagnos ic p oduc s. The i s comme cially success ul ki
was he p egnancy es based on he apid de ec ion o human cho ionic gonado opin in
u ine by simply adding u ine o he es ki (Bu le e al., 2001).
The mos common immunoch oma og aphic assays a e he known la e al low s ips ha
ha e been a commonly used echnology o some ime. La e al low s ips o e a numbe
o a ious bene i s including use iendly o ma , e y sho es ime, long e m s abili y,
and hey a e p oducible a low cos s. These ea u es make he la e al low s ip es s ideal
o home es ing, apid poin o ca e es ing and o ield es ing applica ions.
Chap e 1
S a e o he a
61
A la e al low s ip (LFS) p esen s ou main sec ions made o di e en ma e ials, as
shown in Figu e 24: sample pad, made o cellulose, whe e he sample is d opped;
conjuga e pad, made o glass ibe , imp egna ed wi h he bioconjuga es solu ion ( he label
pa icle and a ecep o o he analy e); de ec ion pad, a ni ocellulose (Ahmad e al.,
2009) whe e es line (TL) and con ol line (CL) a e p in ed; and abso p ion pad, also
made o cellulose.
Figu e 24 - Schema ic ep esen a ion o a LFS (la e al low s ip) and mo emen o
analy es and label pa icles ac oss i . (Sou ce: Adap ed om Quesada-González & Me koçi, 2015).
O he addi ional pa s can be in eg a ed on LFS as blood il e s, subs i u ing he sample
pad, o e ain big pa icles like ed blood cells and a oiding hei hemolysis. Ano he
example o ma e ial which can be in eg a ed on LFS is ca bon nano ubes pape , wi h high
conduc i e p ope ies o connec LFS o elec onic de ices (Zhu e al., 2014).
The p inciple o an assay wi h a LFS is simple: he sample is added on he sample pad
and hen he liquid will s a lowing o he conjuga e pad whe e he analy e, i p esen on
he sample, will be linked o he ansduce s ( he label pa icles), p e iously conjuga ed
Chap e 1
S a e o he a
62
wi h a bio ecep o speci ic o he analy e. The conjuga e, ehyd a ed by he liquid, will
low by capilla i y o ces ac oss he de ec ion pad o he abso ben pad, passing h ough
he TL, whe e i will be cap u ed only i he conjuga e has he analy e a ached (posi i e
esponse), and o he CL, being always cap u ed, e idencing ha he assay wo ked (Figu e
24) (Quesada-González & Me koçi, 2015).
LFSs can be used o de ec a la ge ange o bioma ke s ha may include no only p o eins,
bu also nucleic acids and e en whole cells, among o he biocompounds. Fu he mo e,
LFSs a e no limi ed only o biomolecules de ec ion; se e al publica ions ha e appea ed
in he las yea s abou he de ec ion o pollu an s such as me allic ions, pes icides, e c.
The ange o LFSs applica ions is including de ec ion o haza dous (Shyu e al., 2002),
hea y me als in d inking wa e s (López-Ma zo e al., 2013), alle gens and pa hogens in
ood (Be lina e al., 2013), pes icides (Wang e al., 2009), d ugs sc eening (Inoue e al.,
2007), e c.
These es s a e, he e o e, o g ea alue in si ua ions whe e heal h p o essionals need o
make decisions and ake immedia e measu es. La e al- low assays we e also p e iously
desc ibed o he diagnosis o LD (Le ne e al., 2013).
1.5.4 – P e en ion, Con ol and T ea men
Gi en he inc easing h ea o LD, he need o e ec i e me hods o p o ec agains his
disease has ne e been g ea e (Ogden e al., 2013). The op ions o his pu pose a e
limi ed, since he e a e no licensed human accines agains Lyme disease and also an
a ea-wide and cen ally o ganized ick con ol p og ams a e lacking (Poland, 2011).
Howe e , exposu e o icks and B. bu gdo e i s.l. can be con olled, usually a he
indi idual pe son o indi idual p ope y le el, wi h se e al ela i ely simple in e en ions
(Poland, 2001; Co api e al., 2007; Piesman & Eisen, 2008):
 A oiding a eas whe e icks ha ansmi B. bu gdo e i s.l. occu , a imes ha he
icks a e ac i e;
 Applying pe sonal p o ec i e measu es, such as wea ing app op ia e clo hing, using
ick epellen s and clo hing ea men s, and emo ing icks be o e hey can a ach and
ansmi B. bu gdo e i s.l.;

Chap e 1
S a e o he a
63
 Reducing en i onmen al isk by con olling icks and ick in ec ions wi h pes icide
applica ions; ese oi - a ge ed in e en ions (e.g., bai boxes); and landscape
managemen ;
 Using p ophylac ic an ibio ics in an app op ia e manne a e a ick bi e o p e en
ansmi ed B. bu gdo e i s.l. om e olu ion o clinical LD.
A simple ule o LD is: “i you don’ ge a ick, you don’ ge sick.” P e iously his ule
could be achie ed jus by a oiding he a eas whe e LD occu s, howe e , he ange
expansion o Ixodes species and LD in USA and Eu ope has changed his, and hese icks
a e now ound in mo e egions and ha e also mo ed in o mo e densely popula ed a eas,
including on o close o p i a e/ esiden ial p ope ies (S anek & Rei e , 2011; Li e al.,
2012; Medlock e al., 2013; Vollme e al., 2013). None heless, a oidance can be a iable
isk- educ ion app oach, a leas in some loca ions and si ua ions.
I i ’s no possible o a oid he ick habi a s, hen isk educ ion elies on p e en ing bi es
o emo e a ached icks be o e hey ha e ime o ansmi Bo elia. This can be
accomplished by wea ing app op ia e clo hing, like ligh -colo ed and long-slee e shi s,
socks, and ull ouse s; o use app o ed, opical epellen s like DEET (N,N-die hl-me a-
oluamide) and pe me h in based p oduc s, on skin o wea insec icide- ea ed clo hing;
do ick checks a leas once a day and emo e any icks ha a e ound wi h ine- ipped,
s i , and angled o ceps ( weeze s) placed a ound he head o he ick as nea as possible
o he skin, ollowed by a s eady, upwa d pulling mo emen (Figu e 25) (Piesman &
Dolan, 2002; Dusche e al., 2012); inally ba h o showe soon a e lea ing ick habi a ,
wi hin he wo ollowing hou s.
Figu e 25 - Scheme showing how o emo e a ick.
(Sou ce: adap ed om h p://www.heal h.ha a d.edu/blog/ma chless-s a egy- o - ick- emo al-6-s eps-
o-a oid- ick-bi es 201306076360).
Chap e 1
S a e o he a
64
LD accina ion is s ill a p oblem, since he e is no licensed human accine. Al hough,
some s udies de end ha his disease can be p e en ed by accina ion wi h he OspA
(Edelman e al., 1999; Rahn, 2001). A accine a ge ing LB (LYME ix) based on OspA
om B. bu gdo e i s.l. was es ed, and show o be e ec i e, being a ailable in he USA
om 1998 o 2000 (Golde e al., 1995; S ee e e al., 1998). Howe e , he du a ion o his
accine was ela i ely sho , and i was emo ed om he ma ke by i s manu ac u e in
2002. Cu en ly, e o s a e being made owa ds he de elopmen o a b oadly p o ec i e
LB accine. Se e al p o eins ha e been assessed as po en ial accine candida es.
(Ma coni & Ea nha , 2010; Coms ed e al., 2015).
Rega ding he ea men o LD, his is ou inely wi h an ibio ics; he apy has ens he
esolu ion and la gely p e en s he de elopmen o o he disease mani es a ions. The
classes o an ibio ics ha ha e shown he g ea es e ec i eness agains Bo elia
spi oche es a e b-lac ams (in pa icula cephalospo ins) e acyclines and, o a lesse
ex en , mac olides. The bes ea men app oach, in pa icula he du a ion o he apy, is
a ma e o ongoing deba e. I is qui e e iden ha no all pa ien s, and mos ce ainly no
all species o s ains o Bo elia espond equally o he an ibio ics mos commonly used
in he ea men o LD (P eac-Mu sic e al., 1996). Based on he a ailable e idence om
andomized con olled ials, ea men ecommenda ions ha e been published by he
In ec ious Diseases Socie y o Ame ica (IDSA) (Wo mse e al., 2006), he Ame ican
Academy o Pedia ics, and by a a ie y o na ional and sup ana ional associa ions in
Eu ope (Mygland e al., 2010; EUCALB). Bo h guidelines published by he IDSA and
he EUCALB, a e simila on bo h sides o he A lan ic ega ding he app oaches o
he apy, ye he e a e some di e ences in he ecommended dosage and ea men
du a ion.
1.6 – Objec i es and hesis plan
In Po ugal LD s ill emains unde diagnosed and unde epo ed. Despi e he exis ence o
he ec o in he coun y and he iden i ica ion and isola ion o se e al genospecies o B.
bu gdo e i s.l. om pa ien samples and om he ec o , he ue p e alence o he
Chap e 1
S a e o he a
65
disease is s ill unknown. Howe e , an inc ease impo ance has been gi en o his disease
wo ldwide, which is cu en ly conside ed an eme ging disease.
The diagnosis i is mainly clinic, al hough he labo a o y in o ma ion based in se ologic
o molecula assays, is a undamen al suppo con ibu ing o an adequa e and imely
ea men , and a he same ime, helping o limi he isk o esis ances o ea men s o
he e olu ion o he in ec ion o a ch onic si ua ion, esul ing in high cos s o he pa ien
and o he communi y.
Objec i es
The main goals o he p esen s udy we e o e alua e he p e alence o LD agen s in he
Po uguese ixodo auna, mainly in I. icinus ec o and in syl a ic and domes ic hos s; and
o de elop wo new molecula me hodologies o he iden i ica ion o ou o he mos
p e alen genospecies o B. bu gdo e i s.l. in Eu ope. Thus, his hesis was di ided in o
ou main pa s:
1) To e alua e he bio-ecological cha ac e is ics o he ixodids collec ed in he selec
dis ic s om Po ugal;
2) To analyze ec o -pa hogen-hos ela ionships as hey happen in na u e, he e o e
gaining insigh in o he di e si y and p e alence o B. bu gdo e i s.l. o ganisms in
di e en hos s and ick species;
3) To de elop and op imize a eal- ime PCR assay o he iden i ica ion and quan i ica ion
o ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope/Po ugal;
4) To de elop wo duplex Loop-Media ed Iso he mal DNA Ampli ica ion Assays
(dLAMP) coupled wi h colo ime ic la e al low de ices, o he iden i ica ion o ou o
he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope/Po ugal;
Thesis plan
This disse a ion is o ganized in o six chap e s. In chap e 1, a gene al heo e ical
in oduc ion emb acing he subjec unde s udy is p esen ed, wi h emphasis o he opics
ega ding he majo cha ac e is ics o he B. bu gdo e i s.l. complex membe s, and i s
labo a o y diagnosis; chap e 2 cha ac e ize bio-ecologically he icks as ec o s,
Chap e 1
S a e o he a
66
collec ed om he ege a ion and hos s in p e iously selec ed dis ic s om mainland
Po ugal, and de e mined he in ec ion a e by B. bu gdo e i s.l.; in chap e 3 he ec o -
pa hogen ela ionships in na u e a e analyzed; in chap e 4 he pa hogen-hos ela ionship
is e alua ed; in chap e 5 he de elopmen o a apid iden i ica ion eal- ime PCR
algo i hm o B. bu gdo e i s.l. complex species using speci ic dual-labelled hyd olysis
p obes in a mul iplex o ma a e desc ibed, and also wo duplex Loop-Media ed
Iso he mal DNA Ampli ica ion assay (dLAMP) coupled wi h colo ime ic la e al low
de ices, o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i
s.l.. Finally, in chap e 6, conside a ions abou he wo k p esen ed and he main esul s
ha we e achie ed a e highligh ed, as long as sugges ions o u u e wo k.
Chap e 1
S a e o he a
73
PCR: E ec s o dye concen a ion and sequence composi ion on DNA ampli ica ion and mel ing
empe a u e. Nucleic Acids Resea ch, 35(19): 1–8. doi: 10.1093/na /gkm671;
Guiguen C and Degeilh B. (2001). Les iques d’in é ê médical : ôle ec eu e diagnose de
labo a oi e. Re ue F ançaise des Labo a oi es, 338: 49–57. doi:10.1016/S0338-9898(01)80351-
6;
Gune ES, Wa anabe M, Hashimo o N, e al. (2004). Bo elia u cica sp. no ., isola ed om he
ha d ick Hyalomma aegyp ium in Tu key. In e na ional Jou nal o Sys ema ic and E olu iona y
Mic obiology, 54(5): 1649–1652. doi: 10.1099/ijs.0.03050-0;
Guy EC and S anek G. (1991). De ec ion o Bo elia bu gdo e i in pa ien s wi h Lyme disease
by he polyme ase chain eac ion. Jou nal o Clinical Pa hology, 44(7): 610–1.
Hame SA, Tsao JI, Walke ED, e al. (2009). Use o ick su eys and se osu eys o e alua e pe
dogs as a sen inel species o eme ging Lyme disease. Ame ican Jou nal o Ve e ina y Resea ch,
70(1): 49–56. doi: 10.2460/aj .70.1.49;
Handeland K, Q ille L, Vikø en T, e al. (2013). Ixodes icinus in es a ion in ee- anging ce ids
in No way-a s udy based upon ea examina ions o hun ed animals. Ve e ina y Pa asi ology,
195(1-2): 142–9. doi: 10.1016/j. e pa .2013.02.012;
Haninco á K, Schä e SM and E i S. (2003). Associa ion o Bo elia a zelii wi h oden s in
Eu ope. Pa asi ology, 126: 11–20;
Hayes SF and Bu gdo e W. (1993). Ul as uc u e o Bo elia bu gdo e i. Webe K, Bu gdo e
W, Schie z G, edi o s. In: Aspec s o Lyme Bo eliosis, Sp inge -V, p.29–43;
Heyman P, Cochez C, Ho huis A, e al. (2010). A clea and p esen dange : ick-bo ne diseases
in Eu ope. Expe Re iew o An i-In ec i e The apy, 8(1): 33–50. doi: 10.1586/e i.09.118;
Heymann WR and Ellis DL. (2012). Bo elia bu gdo e i In ec ions in he Uni ed S a es. The
Jou nal o Clinical and Aes he ic De ma ology, 5(8): 18–28;
Higuchi R, Dollinge G, Walsh PS e al. (1992). Simul aneous ampli ica ion and de ec ion o
speci ic DNA sequences. Bio echnology (Na u e Publishing Company), 10(4): 413–7;
Hi sch eld M, Ki schning CJ, Schwandne R, e al. (1999). Cu ing edge: in lamma o y signaling
by Bo elia bu gdo e i lipop o eins is media ed by oll-like ecep o 2. Jou nal o Immunology,
163(5): 2382–2386;
Hu L. (2005). Lyme a h i is. In ec ious Disease Clinics o No h Ame ica, 19(4): 947–961. doi:
10.1016/j.idc.2005.07.007;
Huang W, Ojaimi C, Fallon JT, e al. (2015). Genome Sequence o Bo elia chilensis VA1, a
Sou h Ame ican Membe o he Lyme Bo eliosis G oup. Genome Aannouncemen s, 3(1):
e01535-14. doi: 10.1128/genomeA.01535-14;
Hubálek Z and Halouzka J. (1998). P e alence a es o Bo elia bu gdo e i sensu la o in hos -
seeking Ixodes icinus icks in Eu ope. Pa asi ology Resea ch, 84(3): 167–72;
Humai PF, Tu ian N, Aeschilimann A e al. (1993). Bo elia bu gdo e i in a ocus o Lyme
bo eliosis: epizoo iologic con ibu ion o small mammals. Folia Pa asi ologica, 40(1): 65–70;
Inoue K, Fe an e P, Hi ano Y, e al. (2007). A compe i i e immunoch oma og aphic assay o
es os e one based on elec ochemical de ec ion. Talan a, 73(5): 886–892.

Chap e 1
S a e o he a
74
doi:10.1016/j. alan a.2007.05.008;
Ishigu o T, Sai oh J, Yawa a H, e al. (1995). Homogeneous quan i a i e assay o hepa i is C i us
RNA by polyme ase chain eac ion in he p esence o a luo escen in e cala e . Analy ical
Biochemis y, 229(2): 207–13. doi:10.1006/abio.1995.1404;
I acic L, Reed KD, Mi chell PD. (2007). A Ligh Cycle TaqMan assay o de ec ion o Bo elia
bu gdo e i sensu la o in clinical samples. Diagnos ic Mic obiology and In ec ious Disease,
57(2): 137–143. doi:10.1016/j.diagmic obio.2006.08.005;
Iye R, Kalu O, Pu se J, e al. (2003). Linea and ci cula plasmid con en in Bo elia bu gdo e i
clinical isola es. In ec ion and Immuni y, 71(7): 3699–3706. doi: 10.1128/IAI.71.7.3699-
3706.2003;
Jaenson TGT and Jensen J. (2007). Reco ds o icks (Aca i, Ixodidae) om he Fa oe Islands.
Ag icul u e, 54: 11–15;
Johnson BJ, Happ CM, Maye LW e al. (1992). De ec ion o Bo elia bu gdo e i in icks by
species-speci ic ampli ica ion o he lagellin gene. The Ame ican Jou nal o T opical Medicine
and Hygiene, 47(6): 730–41;
Johnson RC, Schmid GP, Hyde FW, e al. (1984). Bo elia bu gdo e i sp. no .: E iologic Agen
o Lyme Disease. In e na ional Jou nal o Sys ema ic Bac e iology, 34(4): 496–497;
Kalish RA, McHugh G, G anquis J, e al. (2001). Pe sis ence o immunoglobulin M o
immunoglobulin G an ibody esponses o Bo elia bu gdo e i 10-20 yea s a e ac i e Lyme
disease. Clinical in ec ious diseases, 33(6): 780–5. doi: 10.1086/322669;
Kalma Z, Cozma V, Sp ong H, e al. (2015). T anss adial ansmission o Bo elia u cica in
Hyalomma aegyp ium icks. PLoS ONE, 10(2): 1–9. doi: 10.1371/jou nal.pone.0115520;
Kal enboeck B and Wang C. (2005). Ad ances in Real-Time PCR: Applica ion o Clinical
Labo a o y Diagnos ics. Ad ances in Clinical Chemis y, 40(05): 219–259;
Ka ami A. (2012). Molecula Biology o Bo elia bu gdo e i. Ka ami edi o . In: Lyme Disease.
InTech, p. 1–26;
Kohn J. (1968). An immunoch oma og aphic echnique. Immunology, 6: 863-865;
Ko enbe g E, Go elo a N and Ko ale skii Y. (2002). Ecology o Bo elia bu gdo e i sensu la o
in Russia. G ay JS, Kahl O, Lane RS, S anek G, edi o s. In: Lyme bo eliosis: biology,
epidemiology and con ol. CABI Book, p. 175. doi:10.1079/9780851996325.0000;
K upka I and S aubinge RK. (2010). Lyme Bo eliosis in Dogs and Ca s: Backg ound,
Diagnosis, T ea men and P e en ion o In ec ions wi h Bo elia bu gdo e i sensu s ic o.
Ve e ina y Clinics o No h Ame ica - Small Animal P ac ice, 40(6): 1103–1119. doi:
10.1016/j.c sm.2010.07.011;
K upka M, Raska M, Belako a J, e al. (2007). Biological aspec s o Lyme disease spi oche es:
unique bac e ia o he Bo elia bu gdo e i species g oup. Biomedical pape s o he Medical
Facul y o he Uni e si y Palack,Olomouc, Czechoslo akia, 151(2): 175–186;
Ku enbach K, Ca ey D, Hoodless AN, e al. (1998). Compe ence o pheasan s as ese oi s o
Lyme disease spi oche es. Jou nal o Medical En omology, 35: 77–81;
Ku enbach K, Haninco á K, Tsao JI, e al. (2006). Fundamen al p ocesses in he e olu iona y
Chap e 1
S a e o he a
75
ecology o Lyme bo eliosis. Na u e e iews. Mic obiology, 4(9): 660–669.
doi:10.1038/n mic o1475;
Ku enbach K, Kampen H, Dizij A, e al. (1995). In es a ion o oden s wi h la al Ixodes icinus
(Aca i: Ixodidae) is an impo an ac o in he ansmission cycle o Bo elia bu gdo e i s.l. in
Ge man woodlands. Jou nal o Medical En omology, 32(6): 807–817;
Le Fleche A, Pos ic D, Gi a de K, e al. (1997). Cha ac e iza ion o Bo elia lusi aniae sp. no .
by 16S ibosomal DNA sequence analysis. In e na ional Jou nal o Sys ema ic Bac e iology,
47(4): 921–925;
Lelo as P, Don as I, Bassiakou E e al. (2008). Ca diac implica ions o Lyme disease, diagnosis
and he apeu ic app oach. In e na ional Jou nal o Ca diology, 129(1): 15–21. doi:
10.1016/j.ijca d.2008.01.044;
Le ne MB, Dailey J, Goldsmi h BR, e al. (2013). De ec ing Lyme disease using an ibody-
unc ionalized single-walled ca bon nano ube ansis o s. Biosenso s and Bioelec onics, 45:
163–167. doi: 10.1016/j.bios.2013.01.035;
Le y SA and Magna elli LA. (1992). Rela ionship be ween de elopmen o an ibodies o Bo elia
bu gdo e i in dogs and he subsequen de elopmen o limb/join bo eliosis. Jou nal o he
Ame ican Ve e ina y Medical Associa ion, 200(3): 344–347;
Leyde BF and Liang FT. (2014). De ec ion o Lyme Bo elia in ques ing Ixodes scapula is
(Aca i: Ixodidae) and small mammals in Louisiana. Jou nal o Medical En omology, 51(1): 278–
82. doi: 10.1603/ME12273;
Li S, Ha emink N, Speyb oeck N, e al. (2012). Consequences o Landscape F agmen a ion on
Lyme Disease Risk: A Cellula Au oma a App oach. PLoS ONE, 7(6): e39612. doi:
10.1371/jou nal.pone.0039612;
Li X, McHugh GA, Damle N, e al. (2011). Bu den and iabili y o Bo elia bu gdo e i in skin
and join s o pa ien s wi h e y hema mig ans o lyme a h i is. A h i is and Rheuma ism, 63(8):
2238–2247. doi: 10.1002/a .30384;
Limbach FX, Jaulhac B, Piémon Y, e al. (1999). One-s ep e e se ansc ip ase PCR me hod o
de ec ion o Bo elia bu gdo e i mRNA in mouse lyme a h i is issue samples. Jou nal o
Clinical Mic obiology, 37(6): 2037–2039;
Lindg en E and Jaenson TGT. (2006). Lyme bo eliosis in Eu ope: in luences o clima e and
clima e change, epidemiology, ecology and adap a ion measu es. Copenhagen: Wo ld Heal h
O ganiza ion Regional O ice o Eu ope, p.35:
Lindg en E, Tälleklin L and Pol eld T. (2000). Impac o clima ic change on he no he n la i ude
limi and popula ion densi y o he disease- ansmi ing Eu opean ick Ixodes icinus.
En i onmen al Heal h Pe spec i es, 108(2): 119–23;
Li e is D, Schwa z I, Bi ke S, e al. (2011). Imp o ing he yield o blood cul u es om pa ien s
wi h ea ly Lyme disease. Jou nal o Clinical Mic obiology, 49(6): 2166–2168.
doi: 10.1128/JCM.00350-11;
Li e is D, Schwa z I, McKenna D, e al. (2012). Compa ison o i e diagnos ic modali ies o
di ec de ec ion o Bo elia bu gdo e i in pa ien s wi h ea ly Lyme disease. Diagnos ic
Mic obiology and In ec ious Disease, 73(3): 243–5. doi: 10.1016/j.diagmic obio.2012.03.026;
Chap e 1
S a e o he a
76
Li e is D, Va de S, Iye R, e al. (1999). Gene ic di e si y o Bo elia bu gdo e i in lyme disease
pa ien s as de e mined by cul u e e sus di ec PCR wi h clinical specimens. Jou nal o Clinical
Mic obiology 37(3): 565–9;
Li e is D, Wang G, Gi ao G, e al. (2002). Quan i a i e de ec ion o Bo elia bu gdo e i in 2-
millime e skin samples o e y hema mig ans lesions: co ela ion o esul s wi h clinical and
labo a o y indings. Jou nal o Clinical Mic obiology 40(4): 1249–53.
doi: 10.1128/JCM.40.4.1249-1253.2002;
Longo MC, Be ninge MS and Ha ley JL. (1990). Use o u acil DNA glycosylase o con ol
ca y-o e con amina ion in polyme ase chain eac ions. Gene, 93(1): 125–128;
Lopes de Ca alho I and Núncio MS. (2006). Labo a o y diagnosis o Lyme bo eliosis a he
Po uguese Na ional Ins i u e o Heal h (1990-2004). Eu o su eillance : Eu opean
Communicable Disease Bulle in, 11(10): 257–60;
López.Ma zo AM, Pons J, Blake DA e al. (2013). All-in eg a ed and highly sensi i e pape based
de ice wi h sample ea men pla o m o Cd2+ immunode ec ion in d inking/ ap wa e s.
Analy ical Chemis y, 85(7): 3532–3538. doi: 10.1021/ac3034536;
Malloy DC, Nauman RK and Pax on H. (1990). De ec ion o Bo elia bu gdo e i using he
polyme ase chain eac ion. Jou nal o Clinical Mic obiology, 28(6): 1089–1093.
Mannelli A, Be olo i L, Ge n L e al. (2012). Ecology o Bo elia bu gdo e i sensu la o in
Eu ope: ansmission dynamics in mul i-hos sys ems, in luence o molecula p ocesses and
e ec s o clima e change. FEMS Mic obiology Re iews, 36(4): 837–861. doi: 10.1111/j.1574-
6976.2011.00312.x;
Man o ani E, Ma angoni RG, Gaudi ano G, e al. (2012). Ampli ica ion o he lgE gene p o ides
e idence o he exis ence o a B azilian bo eliosis. Re is a do Ins i u o de Medicina T opical de
São Paulo, 54(3): 153–7. Doi: 10.1590/S0036-46652012000300007;
Mao F, Leung WY and Xin X. (2007) Cha ac e iza ion o E aG een and he implica ion o i s
physicochemical p ope ies o qPCR applica ions. BMC Bio echnology, 7: 76. doi:
10.1186/1472-6750-7-76;
Ma coni RT and Ea nha CG. (2010). Lyme Disease Vaccines. In: Samuels DS and Radol JD,
edi o s. Bo elia: Molecula Biology, Hos In e ac ion and Pa hogenesis, No olk, UK: Cais e
Academic P ess, p. 467–486;
Ma aspin V, Og inc K, Ružić-Sabljić E, e al. (2011). Isola ion o Bo elia bu gdo e i sensu la o
om blood o adul pa ien s wi h bo elial lymphocy oma, Lyme neu obo eliosis, Lyme a h i is
and ac ode ma i is ch onica a ophicans. In ec ion, 39(1): 35–40. doi: 10.1007/s15010-010-0062-
8;
Ma gos G, Vollme SA, Co ne M, e al (2009). A new Bo elia species de ined by mul ilocus
sequence analysis o housekeeping genes. Applied and En i onmen al Mic obiology, 75(16):
5410–5416. doi: 10.1128/AEM.00116-09;
Ma gos G, Vollme SA, Ogden NH, e al. (2011). Popula ion gene ics, axonomy, phylogeny and
e olu ion o Bo elia bu gdo e i sensu la o. In ec ion, Gene ics and E olu ion, 11: 1545-1563.
doi: 10.1016/j.meegid.2011.07.022
Ma ques AR. (2010). Lyme Disease: A Re iew. Cu en Alle gy As hma Repo s, 10: 13–20. doi:
10.1007/s11882-009-0077-3;
Chap e 1
S a e o he a
77
Ma ques AR. (2015). Labo a o y Diagnosis o Lyme Disease: ada ances and chalenges.
In ec ious Disease Clinics o No h Ame ica, 29(2): 295–307. doi: 10.1016/j.idc.2015.02.005;
Má quez-Jiménez FJ, Hidalgo-Pon i e os A, Con e as-Cho a F, e al. (2005). Ticks (Aca ina:
Ixodidae) as ec o s and ese oi s o pa hogen mic oo ganisms in Spain. En e medades
In ecciosas y Mic obiología Clínica, 23(2): 94–102;
Ma man HL. (2001). Cell Wall De icien Fo ms, Thi d Edi ion: S eal h Pa hogens. CRC P ess.
pp. 405;
Mayne P, Song S, Shao R e al. (2014). E idence o Ixodes holocyclus (Aca ina: Ixodidae) as a
Vec o o Human Lyme Bo eliosis In ec ion in Aus alia. Jou nal o Insec Science, 14(1): 271–
271. doi: 10.1093/jisesa/ieu133;
McCoy BN, Maïga O and Schwan TG. (2014). De ec ion o Bo elia heile i in Rhipicephalus
geigyi om Mali. Ticks and Tick-Bo ne Diseases, 5(4): 401–3. doi: 10.1016/j. bdis.2014.01.007;
Medlock JM, Hans o d KM, Bo mane A. (2013). D i ing o ces o changes in geog aphical
dis ibu ion o Ixodes icinus icks in Eu ope. Pa asi es & Vec o s, 6(1): 1. doi: 10.1186/1756-
3305-6-1;
Mi ani H, Talbe A and Fukunaga M. (2004). New Wo ld elapsing e e Bo elia ound in
O ni hodo os po cinus icks in cen al Tanzania. Mic obiology and Immunology, 48 (7): 501–
505. doi: 10.1111/j.1348-0421.2004. b03545.x;
Monis PT and Giglio S. (2006). Nucleic acid ampli ica ion-based echniques o pa hogen
de ec ion and iden i ica ion. In ec ion, Gene ics and E olu ion, 6(1): 2–12.
doi:10.1016/j.meegid.2005.08.004;
Monis PT, Giglio S and Sain CP. (2005). Compa ison o SYTO9 and SYBR G een I o eal-
ime polyme ase chain eac ion and in es iga ion o he e ec o dye concen a ion on
ampli ica ion and DNA mel ing cu e analysis. Analy ical Biochemis y, 340(1): 24–34;
Mo i Y, Nagamine K, Tomi a N e al. (2001). De ec ion o loop-media ed iso he mal
ampli ica ion eac ion by u bidi y de i ed om magnesium py ophospha e o ma ion.
Biochemical and Biophysical Resea ch Communica ions, 289(1): 150–154.
doi:10.1006/bb c.2001.5921;
Mo i Y, Hi ano T and No omi T. (2006). Sequence speci ic isual de ec ion o LAMP eac ions
by addi ion o ca ionic polyme s. BMC bio echnology, 6: 3. doi: 10.1186/1472-6750-6-3;
Mo i Y, Ki ao M, Tomi a N e al. (2004). Real- ime u bidime y o LAMP eac ion o
quan i ying empla e DNA. Jou nal o Biochemical and Biophysical Me hods, 59(2): 145–157.
doi:10.1016/j.jbbm.2003.12.005;
Mo i Y and No omi T. (2009). Loop-media ed iso he mal ampli ica ion (LAMP): A apid,
accu a e, and cos -e ec i e diagnos ic me hod o in ec ious diseases. Jou nal o In ec ion and
Chemo he apy ,15(2): 62–69. Doi: 10.1007/s10156-009-0669-9;
Mo he shed EA and Whi ney AM. (2006). Nucleic acid-based me hods o he de ec ion o
bac e ial pa hogens: p esen and u u e conside a ions o he clinical labo a o y. Clinical Chimica
Ac a: In e na ional Jou nal o Clinical Chemis y, 363(1-2): 206–220.
doi:10.1016/j.cccn.2005.05.050;
Mo ila A, Tode as I and Dubinina H. (2012). Zoono ic Peculia i ies o Bo elia bu gdo e i s .l.:
Chap e 1
S a e o he a
78
Vec o s Compe ence and Ve eb a e Hos Speci ici y. Ka ami edi o . In: Lyme Disease, pp. 27–
54; doi: 10.5772/32690;
Müllegge R and Gla z M. (2008). Skin mani es a ions o lyme bo eliosis: diagnosis and
managemen . Ame ican Jou nal o Clinical De ma ology, 9(6): 355–68. doi: 10.2165/0128071-
200809060-00002;
Mullegge RR. (2004). De ma ological mani es a ions o Lyme bo eliosis. Eu opean -jou nal o
De ma ology, 14(5): 296–309;
Mülle -Doblies U and Wikel S. (2005). The human eac ion o icks (Washing on). In: Goodman
J, Dennis D and and Sonenshine D, edi o s. In: Tick-Bo ne Diseases o Humans. ASM P ess, pp.
440. doi:10.3201/eid1111.051160;
Mülle -Doblies U, Maxwell SS, Boppana VD, e al. (2007). Feeding by he ick, Ixodes
scapula is, causes CD4+ T cells esponding o cogna e an igen o de elop he capaci y o exp ess
IL-4. Pa asi e Immunology, 29(10): 485–499. Doi: 10.1111/j.1365-3024.2007.00966.x;
Mu ay PR, Rosen hal KS, and P alle MA. (2008). Medical Mic obiology, (6 h edi ion). Mosby
Else ie , pp. 848;
Mygland Å, Ljøs ad U, Finge le V, e al. (2010). EFNS guidelines on he diagnosis and
managemen o Eu opean lyme neu obo eliosis. Eu opean Jou nal o Neu ology, 17(1): 8–16.
doi: 10.1111/j.1468-1331.2009.02862.x;
Nadda S, Ghazinezhad BSM. (2015). Tickbo ne elapsing e e in sou he n I an, 2011–2013.
Eme ging In ec ious Diseases, 21: 1078–1080. doi: h p://dx.doi.o g/10.3201/eid2106.141715;
Nadelman RB, Nowakowski J, Fo se e G, e al. (1993). Failu e o isola e Bo elia bu gdo e i
a e an imic obial he apy in cul u e-documen ed Lyme bo eliosis associa ed wi h e y hema
mig ans: epo o a p ospec i e s udy. The Ame ican Jou nal o Medicine, 94(6): 583–588;
Nagamine K, Hase T and No omi T. (2002). Accele a ed eac ion by loop-media ed iso he mal
ampli ica ion using loop p ime s. Molecula and Cellula P obes, 16(3): 223–229.
doi:10.1006/mcp .2002.0415;
Nagamine K, Wa anabe K, Oh suka K, e al. (2001). Loop-media ed Iso he mal Ampli ica ion
Reac ion Using a Nondena u ed Templa e. Clinical Chemis y, 47(9): 1742–1743;
Naka E, Cos a I, A ão C, e al. (2008). Pesquisa de an ico pos an i-Bo elia e an i-Babesia em
so o de c ianças com mani es ações clínicas e epidemiologia compa í eis com a doença de Lyme-
Simile no Es ado de Ma o G osso do Sul. Re is a B asilei a de Reuma ologia, 48(2): 74-85. doi:
10.1590/S0482-50042008000200003;
Na a o E, Se ano-He as G, Cas año MJ, e al. (2014). Real- ime PCR de ec ion chemis y.
Clinica Chimica Ac a, 439: 231-250. doi: 10.1016/j.cca.2014.10.017;
Ne edo a VV, Ko enbe g EI, Go elo a NB e al. (2004). S udies on he anso a ial ansmission
o Bo elia bu gdo e i sensu la o in he aiga ick Ixodes pe sulca us. Folia Pa asi ologica,
51(1): 67–71;
Nol e O. (2012). Nucleic Acid Ampli ica ion Based Diagnos ic o Lyme (Neu o) bo eliosis -
Los in he Jungle o Me hods, Ta ge s, and Assays? The Open Neu ology Jou nal, 6: 129–39.
doi: 10.2174/1874205X01206010129;
No is SJ. (2012.) How do lyme bo elia o ganisms cause disease? The ques o i ulence

Chap e 1
S a e o he a
79
de e minan s. The Open Neu ology Jou nal, 6: 119–23. doi: 10.2174/1874205X01206010119;
No omi T, Okayama H, Masubuchi H, e al. (2000). Loop-media ed iso he mal ampli ica ion o
DNA. Nucleic Acids Resea ch, 28(12): E63;
Nowakowski J, McKenna D, Nadelman RB, e al. (2009). Blood cul u es o pa ien s wi h
ex acu aneous mani es a ions o Lyme disease in he Uni ed S a es. Clinical in ec ious diseases,
49(11): 1733–1735. doi: 10.1086/648076;
Núncio MS, and Al es MJ. (2014). Doenças associadas a a ópodes e o es e oedo es. Ins i u o
Nacional de Saúde D . Rica do Jo ge, IP. Guide – A es G á icas, Lda, pp. 183;
Núncio MS, Pé e O, Al es M, Bacella F e al. (1993). Isolamen o e ca ac e ização de bo élias
de Ixodes icinus em Po ugal. Re is a Po uguesa de Doenças In ecciosas, 16: 175–179;
Núncio MS, Da id de Mo ais JA and Filipe AR. (1992). Pesquisa de an ico pos an i-Bo elia
bu gdo e i numa população do dis i o de É o a. Re is a Po uguesa de Doenças In ecciosas,
15: 173–176.
Nunes M, Pa ei a R, Lopes N, e al. (2015). Molecula Iden i ica ion o Bo elia miyamo oi in
Ixodes icinus om Po ugal. Vec o -Bo ne and Zoono ic Diseases, 15(8): 515–517. doi:
10.1089/ bz.2014.1765;
Ogden NH, Lindsay LR and Leigh on PA. (2013). P edic ing he a e o in asion o he agen o
Lyme disease Bo elia bu gdo e i. Jou nal o Applied Ecology, 50(2): 510–518. doi:
10.1111/1365-2664.12050;
Og inc K, Lo ič-Fu lan S, Ma aspin V, e al. (2013). Suspec ed ea ly Lyme neu obo eliosis in
pa ien s wi h e y hema mig ans. Clinical In ec ious Diseases, 57(4): 501–509. doi:
10.1093/cid/ci 317;
Oli e JH. (1989). Biology and sys ema ics o icks (Aca i:Ixodida). Annual Re iew o Ecology
and Sys ema ics, 20(1): 397–430.
Olson PE, Kallen AJ, Bjo neby JM, e al. (2000). Canines as sen inels o Lyme disease in San
Diego Coun y, Cali o nia. Jou nal o Ve e ina y Diagnos ic In es iga ion, 12(2): 126–9;
Oos ing M, Be ende A, S u m P, al. (2010). Recogni ion o Bo elia bu gdo e i by NOD2 is
cen al o he induc ion o an in lamma o y eac ion. The Jou nal o In ec ious Diseases, 201(12):
1849–1858. doi: 10.1086/652871;
O ns ein K, Be glund J, Be gs öm S, e al. (2002). Th ee majo Lyme Bo elia genospecies
(Bo elia bu gdo e i sensu s ic o, B. a zelii and B. ga inii) iden i ied by PCR in ce eb ospinal
luid om pa ien s wi h neu obo eliosis in Sweden. Scandina ian Jou nal o In ec ious Diseases,
34(5): 341–346. doi: 10.1080/00365540110080313;
Pal U and Fik ig E. (2010). Ticks In e ac ions. Samuels S, and Radol J, edi o s. In: Bo elia:
Molecula Biology, Hos In e ac ion and Pa hogenesis. Cais e Academic P ess, pp. 279–298.
Pal U, Li X, Wang T, e al. (2004). TROSPA, an Ixodes scapula is ecep o o Bo elia
bu gdo e i. Cell, 119(4): 457–468. doi:10.1016/j.cell.2004.10.027;
Pal U, de Sil a AM, Mon gome y RR, e al. (2000). A achmen o Bo elia bu gdo e i wi hin
Ixodes scapula is media ed by ou e su ace p o ein A. The Jou nal o Clinical In es iga ion,
106(4): 561–9;
Chap e 1
S a e o he a
80
Palacio-Bielsa A, López-So iano P, Bühlmann A, e al. (2015). E alua ion o a eal- ime PCR
and a loop-media ed iso he mal ampli ica ion o de ec ion o Xan homonas a bo icola p . p uni
in plan issue samples. Jou nal o Mic obiological Me hods, 112: 36–39.
doi:10.1016/j.mime .2015.03.005;
Palma M, Lopes de Ca alho I, Figuei edo M, e al. (2012). Bo elia hispanica in O ni hodo os
e a icus, Po ugal. Clinical Mic obiology and In ec ion, 18(7): 696–701. doi: 10.1111/j.1469-
0691.2011.03623.x;
Papadopoulos B, Nuncio M and Filipe A. (1992). The occu ence o Rhipicephalus u anicus
Pome an ze , Ma iskas ili & Lo o zky, 1940, a species o Rhipicephalus sanguineus g oup, in
Po ugal. Aca ologia, 33: 331–333;
Pa ola P and Raoul D. (2001). Ticks and ickbo ne bac e ial diseases in humans: an eme ging
in ec ious h ea . Clinical In ec ious Diseases, 32(6): 897–928.
Passos S, Gaze a R and La o e M. (2009). Ca ac e ís icas clínico-epidemiológicas da doença de
Lyme-símile em c ianças. Re is a da Associação Medica B asilei a, 55(2): 139–144;
Paș iu AI, Ma ei IA, Mihalca AD, e al. (2012). Zoono ic pa hogens associa ed wi h Hyalomma
aegyp ium in endange ed o oises: e idence o hos -swi ching beha iou in icks? Pa asi es &
ec o s, 5: 301. doi: 10.1186/1756-3305-5-301;
Pa ican LA. (1997). Acquisi ion o Lyme disease spi oche es by co eeding Ixodes scapula is
icks. Ame ican Jou nal o T opical Medicine and Hygiene, 57(5): 589–593;
Pel omaa M, McHugh G and S ee e AC. (2003). Pe sis ence o he an ibody esponse o he VlsE
six h in a ian egion (IR6) pep ide o Bo elia bu gdo e i a e success ul an ibio ic ea men
o Lyme disease. The Jou nal o In ec ious Diseases, 187(8): 1178–1186. doi: 10.1086/374376;
Pe uski AH and Pe usk, LF J . (2003). Immunological me hods o de ec ion and iden i ica ion
o in ec ious disease and biological wa a e agen s. Clinical and Diagnos ic Labo a o y
Immunology, 10: 506-13.
Pe e J-L, Rais O and Ge n L. (2004). In luence o Clima e on he P opo ion o Ixodes icinus
Nymphs and Adul s Ques ing in a Tick Popula ion. Jou nal o Medical En omology 41(3): 361–
365. doi:10.1603/0022-2585-41.3.361;
Pe sing DH, Ru ledge BJ, Rys PN, e al. (1994). Ta ge imbalance: dispa i y o Bo elia
bu gdo e i gene ic ma e ial in syno ial luid om Lyme a h i is pa ien s. Jou nal o In ec ious
Diseases, 169(3): 668–672;
Pe zke MM, B ooks A, K upna MA, e al. (2009). Recogni ion o Bo elia bu gdo e i, he Lyme
disease spi oche e, by TLR7 and TLR9 induces a ype I IFN esponse by human immune cells.
Jou nal o Immunology, 183(8): 5279–5292. doi: 10.4049/jimmunol.0901390;
Picken MM, Picken RN, Han D, e al. (1997). A wo yea p ospec i e s udy o compa e cul u e
and polyme ase chain eac ion ampli ica ion o he de ec ion and diagnosis o Lyme bo eliosis.
Jou nal o Clinical Pa hology, 50: 186–193;
Picken MM, Picken RN, Han D, e al. (1996). Single- ube nes ed polyme ase chain eac ion assay
based on Flagellin gene sequences o de ec ion o Bo elia bu gdo e i sensu la o. Eu opean
Jou nal o Clinical Mic obiology & In ec ious Diseases, 15(6): 489–98;
Piesman J. (1993). S anda d Sys em o In ec ing Ticks (Aca i: Ixodidae) wi h he Lyme Disease
Chap e 1
S a e o he a
81
Spi oche e, Bo elia bu gdo e i. Jou nal o Medical En omology, 30(1): 199–203;
Piesman J and Dolan MC. (2002). P o ec ion agains lyme disease spi oche e ansmission
p o ided by p omp emo al o nymphal Ixodes scapula is (Aca i: Ixodidae). Jou nal o Medical
En omology, 39(3): 509–512.
Piesman J and Eisen L. (2008) P e en ion o Tick-Bo ne Diseases. Annual Re iews o
En omology, 53: 323–43. doi: 10.1146/annu e .en o.53.103106.093429;
Piesman J and Ge n L. (2004). Lyme bo eliosis in Eu ope and No h Ame ica. Pa asi ology,
129: 191-220;
Piesman J and Happ CM. (2001). The e icacy o co- eeding as a means o main aining Bo elia
bu gdo e i: a No h Ame ican model sys em. Jou nal o Vec o Ecology, 26(2): 216–20;
Poland GA. (2001). P e en ion o Lyme disease: a e iew o he e idence. Mayo Clinic
p oceedings, 76(7): 713–24. doi:10.4065/76.7.713;
Poland GA. (2011). Vaccines agains Lyme disease: Wha happened and wha lessons can we
lea n? Clinical In ec ious Diseases, 52(3): 253–258. doi: 10.1093/cid/ciq116;
Pollack RJ, Tel o d SR and Spielman A. (1993). S anda diza ion o medium o cul u ing Lyme
disease spi oche es. Jou nal o Clinical Mic obiology, 31(5): 1251–5;
Posey JE and Ghe a dini FC. (2000). Lack o a ole o i on in he Lyme disease pa hogen.
Science, 288(5471): 1651–1653.
Pos ic D, Assous MV, G imon PA. (1994). Di e si y o Bo elia bu gdo e i sensu la o
e idenced by es ic ion agmen leng h polymo phism o (5S)- l (23S) in e genic space
amplicons. In e na ional Jou nal o Sys ema ic Bac e iology, 44(4): 743–752;
P eac Mu sic V, Wanne G, Reinha d S, e al. (1996). Fo ma ion and cul i a ion o bo elia
bu gdo e i sphe oplas -L- o m a ian s. In ec ion, 24(3): 218–226;
P eechakasedki P, Pinwa ana K, Dungchai W. (2012). De elopmen o a one-s ep
immunoch oma og aphic s ip es using gold nanopa icles o he apid de ec ion o Salmonella
yphi in human se um. Biosenso s & bioelec onics, 31(1): 562–6. doi:
10.1016/j.bios.2011.10.031;
P ice CP. (2001). Poin o ca e es ing. BMJ, 322: 1285–1288. doi: 10.1136/bmj.322.7297.1285
P iem S, Ri ig MG, Kam ad T, e al. (1997). An op imized PCR leads o apid and highly
sensi i e de ec ion o Bo elia bu gdo e i in pa ien s wi h Lyme bo eliosis. Jou nal o Clinical
Mic obiology 35(3): 685–90;
P i BS, Mead PS, Johnson DKH, e al. (2016). Iden i ica ion o a no el pa hogenic Bo elia
species causing Lyme bo eliosis wi h unusually high spi ochae aemia: a desc ip i e s udy. The
Lance In ec ious Diseases, 3099(15): 1–9. doi: 10.1016/S1473-3099(15)00464-8;
Qiu W-G, B uno JF, McCaig WD, e al. (2008). Wide dis ibu ion o a high- i ulence Bo elia
bu gdo e i clone in Eu ope and No h Ame ica. Eme ging In ec ious Diseases, 14: 1097–1104.
doi: 10.3201/eid1407.070880;
Quesada-González D and Me koçi A. (2015). Nanopa icle-based la e al low biosenso s.
Biosenso s and Bioelec onics, 73: 47–63. doi:10.1016/j.bios.2015.05.050;
Radol JD, Caimano MJ, S e enson B e al. (2012). O icks, mice and men: unde s anding he
Chap e 1
S a e o he a
82
dual-hos li es yle o Lyme disease spi ochae es. Na u e Re iews Mic obiology, 87–99. doi:
10.1038/n mic o2714;
Rahn DW. (2001). Lyme Vaccine: Issues and Con o e sies. In ec ious Disease Clinics o No h
Ame ica, 15: 171-187; doi:10.1016/S0891-5520(05)70274-9;
Randolph SE and C aine NG. (1995). Gene al amewo k o compa a i e quan i a i e s udies on
ansmission o ick-bo ne diseases using Lyme bo eliosis in Eu ope as an example. Jou nal o
Medical En omology, 32(6): 765–777;
Randolph SE and S o ey K. (1999). Impac o mic oclima e on Imma u e Tick-Roden Hos
In e ac ions (Aca i: Ixodidae): Implica ions o Pa asi e T ansmission. Jou nal o Medical
En omology, 36(6): 741–748;
Ranka R, Bo mane A, Salmina K e al. (2004). Iden i ica ion o h ee clinically ele an Bo elia
bu gdo e i sensu la o genospecies by PCR- es ic ion agmen leng h polymo phism analysis o
16S-23S ibosomal DNA space amplicons. Jou nal o Clinical Mic obiology, 42(4): 1444–9.
doi: 10.1128/JCM.42.4.1444-1449.2004;
Rau e C and Ha ung T. (2005) P e alence o Bo elia bu gdo e i sensu la o genospecies in
Ixodes icinus icks in Eu ope: a me aanalysis. Applied and En i onmen al Mic obiology, 71(11):
7203–16. doi: 10.1128/AEM.71.11.7203-7216.2005;
Rau e C, Oehme R, Di e ich I, e al. (2002). Dis ibu ion o clinically ele an Bo elia
genospecies in icks assessed by a no el, single- un, eal- ime PCR. Jou nal o Clinical
Mic obiology, 40(1): 36–43. doi: 10.1128/JCM.40.1.36-43.2002;
Reed KD. (2002). Labo a o y es ing o Lyme disease: possibili ies and p ac icali ies. Jou nal o
Clinical Mic obiology, 40(2): 319–24. doi: 10.1128/JCM.40.2.319-324.2002;
Rich e D, Schlee DB, Allgöwe R e al. (2004). Rela ionships o a no el Lyme disease spi oche e,
Bo elia spielmani sp. no ., wi h i s hos s in Cen al Eu ope. Applied and En i onmen al
Mic obiology, 70: 6414–6419. doi: 10.1128/AEM.70.11.6414-6419.2004;
Rich e D, Sch öde B, Ha mann NK e al. (2013). Spa ial s a i ica ion o a ious Lyme disease
spi oche es in a Cen al Eu opean si e. FEMS Mic obiology Ecology, 83(3): 738–744. doi:
10.1111/1574-6941.12029;
Rijpkema S, Nieuwenhuijs J, F anssen FFJ e al. (1994). In ec ion a es o Bo elia bu gdo e i
in di e en ins a s o lxodes icinus icks om he Du ch No h Sea Island o Ameland.
Expe imen al & Applied Aca ology, 18: 531–542;
Rijpke na SGT, Taxelaa D, Molkenboe MCH, e al. (1997). De ec ion o Bo elia a zelii, B
bu gdo e i ss, Bo elia ga inii and g oup VS116 by PCR in skin biopsies o pa ien s wi h
e y hema mig ans and ac ode ma i is ch onica a ophicans. Clinical Mic obiology and In ec ion,
3: 109–116;
Ri ie KM, Rasmussen RP and Wi we CT. (1997). P oduc di e en ia ion by analysis o DNA
mel ing cu es du ing he polyme ase chain eac ion. Analy ical biochemis y, 245(2): 154–60;
Rizzoli A, Hau e HC, Ca pi G, e al. (2011). Lyme bo eliosis in Eu ope. Eu osu eillance,
16(27): 1–8;
Rollend L, Fish D and Childs J. (2013). T anso a ial ansmission o Bo elia spi oche es by
Ixodes scapula is: A summa y o he li e a u e and ecen obse a ions. Ticks and Tick-Bo ne
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed
a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion

91
2. Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o
Po ugal: Bo elia bu gdo e i s.l. in ec ion
Ticks a e obliga e pa asi es, conside ed o be second wo ldwide o mosqui oes as ec o s o
human diseases, bu hey a e he mos impo an ec o s o disease-causing pa hogens in
domes ic and wild animals. The impo an ole ha icks play in main aining and ansmi ing
ick-bo ne pa hogens in Po ugal, ein o ces he need o o e an up o da e summa y o he
in o ma ion on icks, hei biology, ecology and associa ions wi h e eb a e hos s. Also, a
be e knowledge o B. bu gdo e i s.l. in ec ion a e in hese a h opods, mainly in he ec o
Ixodes icinus, is impo an in o de o de e mina e possible isk a eas o human and
e e ina y heal h. The e o e, his chap e he dis ibu ion and cha ac e iza ion o ixodids will
be add essed in nine dis ic s o Po ugal, p e iously selec ed, alongside wi h hei in ec ion
a e by B. bu gdo e i s.l. using wo nes ed-PCR.
This chap e is based on he esea ch pape :
Nunes M, Viei a ML, Lopes N, Maia C, Almeida APG. 2016. Cha ac e iza ion and
dis ibu ion o ha d- icks in nine dis ic s o mainland Po ugal whe e I. icinus p esence was
p e iously epo ed: Bo elia bu gdo e i s.l. p e alence.
(in submission)
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
93
2.1 Cha ac e iza ion and dis ibu ion o ha d- icks in nine dis ic s o mainland
Po ugal whe e I. icinus p esence was p e iously epo ed: Bo elia bu gdo e i s.l.
p e alence
Mónica Nunes1,2, Mª. Luísa Viei a1,2, Nádia Lopes1, Ca la Maia2,3, A. Paulo G. Almeida2,3,4
1Unidade de Mic obiologia Médica, Ins i u o de Higiene e Medicina T opical, IHMT,
Uni e sidade No a de Lisboa, UNL, Lisboa, Po ugal;
2Global Heal h and T opical Medicine, GHTM, IHMT, UNL;
3Unidade de Pa asi ologia Médica, IHMT, UNL;
4Zoonosis Resea ch Uni , Depa men o Medical Vi ology, Facul y o Heal h Sciences,
Uni e si y o P e o ia, P e o ia, Sou h A ica.
Co espondence should be add essed o:
Mónica Nunes
G upo de Lep ospi ose e Bo eliose de Lyme, Unidade de Mic obiologia Médica, Global
Heal h and T opical Medicine, GHTM, Ins i u o de Higiene e Medicina T opical, HMT,
Uni e sidade No a de Lisboa, UNL
Rua da Junquei a, nº100
1349-008 Lisboa, Po ugal
Phone: +351 213652600; Fax: +351 213632105
(E-mail: [email p o ec ed])
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
94
Abs ac
Se e al changes in spa ial dis ibu ion and abundance o ick species and hei associa ed
pa hogens ha e occu ed in he las yea s, due o clima e change, habi a modi ica ions and
globaliza ion o human ac i i ies. Consequen ly, i ’s inc easingly impo an o upda e ick
dis ibu ion, biology, ecology and associa ion wi h hos s and pa hogens. In Po ugal, he e
a e a o able clima ic condi ions o he main enance o icks and hei pa hogenic agen s. An
example o ha a e he spi oche es o B. bu gdo e i s.l. complex, Lyme disease (LB) agen s,
whose main ec o in Eu ope is he ick Ixodes icinus. Al hough his disease is
unde diagnosed and unde epo ed, se e al s udies ha e con i med he ci cula ion o hese
spi oche es in ick popula ions om di e en a eas o Po ugal. Thus, he aim o his s udy
was o collec and iden i y icks om hos s and ege a ion, in nine dis ic s o Po ugal,
p e iously iden i ied as a eas wi h bo h he ec o and he pa hogen, and o de e mine B.
bu gdo e i s.l. in ec ion a e, con ibu ing o upda e ick’s auna and LB epidemiology.
Ques ing icks we e collec ed in se en o he su eyed dis ic s, being Rhipicephalus
sanguineus he mos widesp ead species, al hough, in Lisboa Ixodes icinus imma u e we e
he mos abundan species. Rega ding he hos s, pe s (dogs and ca s), syl a ic (ce ids and
wild boa s), and li es ock (ca le, sheep and donkeys) animals we e su eyed, om se en
dis ic s, and again R. sanguineus was he mos widesp ead species, excep in Lisboa and
É o a dis ic s, whe e I. icinus and R. bu sa we e he mos abundan species, espec i ely.
Rega ding B. bu gdo e i s.l. in ec ion a e, 8% and 1% o he collec ed icks we e posi i e,
a ege a ion and hos le el, espec i ely. Bo elia bu gdo e i s.l. posi i e icks we e
collec ed in B aga, Vila Real, Lisboa, Se úbal, É o a and Fa o, six o he nine su eyed
dis ic s, showing ha his pa hogen p esen s a gene al dis ibu ion h oughou he coun y.
Changes in he dis ibu ion o icks and hei in asion in o new egions we e obse ed in his
s udy, possibly ela ed o changes in he landscape, clima e and ege a ion, o which icks a e
e y sensi i e. Also he equen la ge-scale mo emen s o humans and hei animals may be
speeding up he in oduc ion o no el ick species and hei associa ed pa hogens ha can
ha e se e e consequences in human and animal heal h. The e o e, mo e s udies conce ning

Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
95
ick dis ibu ion and beha io should be ca ied ou in o de o unde s and he biological
mechanisms unde lying success ul ick in asions and adap a ion o new local condi ions
leading o a success ul es ablishmen .
In oduc ion
Ticks (Ixodida) a e obliga e hema ophagous a h opod ec opa asi es wi h a wo ldwide
dis ibu ion, and esponsible o ansmi ing pa hogens ha cause diseases in humans and
animals (de La Fuen e & Con e as, 2015), leading o public heal h issues and economical
losses in li es ock p oduc ion (Pa ola & Raoul , 2001). The incidence o ick-bo ne diseases
(TBDs) is inc easing wo ldwide, since icks a e capable o ansmi ing disease-causing
p o ozoa, bac e ia and i uses. Fo ins ance, mo e han 250 000 human cases o Lyme disease
we e epo ed in he las decade in he USA (h p://www.cdc.go /lyme/), and in Eu ope abou
50 000 cases a e epo ed each yea in humans (Piesman and Eisen, 2008). This is due o he
con inuous human exploi a ion o en i onmen al esou ces and o he inc ease o human
ou doo ac i i ies ha allow con ac wi h icks no mally p esen in na u al habi a s (de La
Fuen e & Con e as, 2015). Fu he mo e, he expansion o ick popula ions due o clima e
changes and human in e en ions ha a ec ese oi hos s mobili y and human con ac wi h
in ec ed icks, is a g owing p oblem (G ay e al., 2009; Es ada-Peña e al., 2012; O an o e
al., 2015; Os eld & B unne , 2015).
These a h opods ex end om he opics o suba c ic a eas and a e well adap ed o li ing in
s ic and di e si ied habi a s, seeking hos s o eed upon, diges ing blood meals, and
de eloping h ough di e en li e s ages o adul hood, and u he ep oducing (Magna elli,
2009). Al hough mos icks ha e close ela ionships wi h e eb a e animals, some species
ha e limi ed hos p e e ences, while o he s ha e b oad hos anges.
Se e al s udies ha e been ca ied ou o unde s and ick species dis ibu ion, bio-ecological
p e e ences and hos - ec o -pa hogen ela ionships in di e en se ings. Faunis ic s udies
ac oss se e al egions, namely he Medi e anean egion, a e o g ea impo ance and in e es
o cha ac e ize he dis ibu ion and composi ion o ick species a ec ing li es ock, as a
p elimina y s ep o he knowledge o he pa hogens hey may ansmi , and he economic
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
96
e ec s o hese on animal p oduc ion, and in public heal h (Papadopoulos e al., 1996;
Boua ou , 1999; Es ada-Peña & San os-Sil a, 2005).
Po ugal, he wes e nmos coun y in con inen al Eu ope, p esen s a o al o 92 090 km2 o
land su ace, 3.4 million hec a es co espond o o es ed a eas, mainly localized in he No h
o he Tagus i e , wi h ag o o es y and o es g azing a eas localized in he Sou h o he
coun y (Figu e 1).
Figu e 1 - Schema ic ep esen a ion o A lan ic Ocean and Medi e anean Sea in luence in
he Po uguese clima e (A) and he Po uguese dis ic s a e o o es a ion (B). (Sou ce: de
Macedo, 1997).
Acco ding o Koeppen-Geige classi ica ion, Po ugal has a empe a e con inen al clima e,
Type C, checking he sub ype Cs (a empe a e clima e wi h d y summe ) and he ollowing
a ie ies: Csa, empe a e clima e wi h wa m summe and d y in he in e io egions o he
Dou o Valley (pa o he dis ic o B agança), as well as in Sou h egions o he moun ain
sys em Mon ejun o-Es ela (excep on he wes coas o Alen ejo and Alga e); Csb,
empe a e clima e wi h d y and mild summe , in almos all egions o he No he n moun ain
sys em Mon ejun o-Es ela and he egions o he wes coas o Alen ejo and Alga e. In a
small egion o Alen ejo, in he dis ic o Beja, is A id Clima e - Type B Sub ype BS (s eppe
clima e), BSK a ie y (cold s eppe clima e o mid-la i ude).
A lan ic
Clima e
Medi e anean
Clima e
A lan ic-
Medi e anean
Clima e
A
A lan ic
Ocean
Spain
Km
B
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
97
The ecological, clima ic and en i onmen al condi ions o Po ugal a e a o able o he
de elopmen and main enance o se e al ha d- ick species ha can ansmi a la ge a ie y
o pa hogenic agen s able o causing diseases in humans and animals, wi h an eme gen isk
in he coun y. Fo example, he ick Ixodes icinus, compe en ec o o B. bu gdo e i s.l.
agen s, is p esen in se e al egions wi hin he coun y wi h di e en clima e ypes and land
co e (Núncio e al., 1993; Bap is a e al., 2004; Es ada-Peña & San os-Sil a, 2005;
Bap is a, 2006).
In his s udy nine dis ic s ep esen a i e o No h, Lisboa Tagus Valley (LTV), and Sou h
egions o mainland Po ugal we e selec ed o ick collec ions, based on da a om p e ious
s udies, whe e I. icinus p esence was egis e ed (Bap is a, 2006; San os-Sil a e al., 2011).
Also, he collec ed icks we e su eyed o B. bu gdo e i s.l. DNA, o u he cha ac e ize
he in ec ion a e wi h his pa hogenic agen ac oss he coun y.
Ma e ial and Me hods
Cha ac e iza ion and loca ion o sampling si es
A o al o nine dis ic s we e selec ed: B aga, Vila Real, A ei o, Gua da, (conside ed No h
egion o compa ison pu poses), San a ém, Lisboa (conside ed Lisboa and Tagus Valley-
LTV), and É o a, Se úbal and Fa o (conside ed Sou h egion), (Figu e 2). Ticks we e
collec ed om he ege a ion and om se e al hos s p esen in he chosen a eas.
Figu e 2 – Map o mainland Po ugal showing
he dis ic s whe e ick collec ions we e
pe o med (in g een).
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
98
In he di e en dis ic s, collec ions o ques ing icks in he ege a ion was ca ied ou in
se e al habi a s (Figu e 3), and mo e emphasis was gi en o he o es a eas wi h bio ic
ac o s (hos s) and abio ic ac o s ( ege a ion and habi a ypes), humidi y, empe a u e,
ele a ion and dis ance o wa e line) a o able o he de elopmen o Ixodes icinus. The
cha ac e iza ion o each dis ic is p esen ed in Table 1.
Figu e 3 – Examples o habi a s whe e icks we e collec ed: A – Ama es (B aga); B –
Mondim de Bas o (Vila Real); C – Dunas de São Jacin o (A ei o); D – Gua da; E – San a em;
F – Tapada Nacional de Ma a (Lisboa); G –G andola (Se úbal); H – Alcaço as (É o a); I –
Se a de Monchique (Fa o).
A
B
C
D
E
F
G
H
I
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
105
Figu e 4 – Ques ing ick species a e age densi y o each collec ed species by season, yea and dis ic . (Dm – De macen o
ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, Hi – Haemaphysalis ine mis, Hyl – Hyalomma lusi anicum, Hym –
Hyalomma ma gina um, I – Ixodes icinus, Ih – Ixodes hexagonus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb –
Rhipicephalus bu sa).

Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
106
Table 2 – To al ques ing ick species by s age collec ed in each dis ic .
Ticks collec ed om he ege a ion
S age
Dis ic s
Tick species
La ae
Nymphs
Females
Males
TOTAL
B aga
De macen o ma gina us
26
15
41
De macen o e icula us
2
3
5
Haemaphysalis punc a a
1
2
3
6
Hyalomma ma gina um
1
0
1
Ixodes icinus
4
0
4
Ixodes hexagonus
3
0
3
Rhipicephalus sanguineus
77
73
150
To al
1
115
94
210
Vila Real
De macen o ma gina us
3
1
4
Ixodes icinus
1
7
8
16
Rhipicephalus bu sa
1
1
Rhipicephalus sanguineus
2
65
44
111
To al
3
75
54
132
A ei o
Ixodes icinus
3
3
Rhipicephalus sanguineus
141
95
236
To al
141
98
239
Lisboa
De macen o ma gina us
7
1
8
Haemaphysalis ine mis
1
26
16
43
Haemaphysalis punc a a
259
76
22
39
396
Hyalomma lusi anicum
8
21
107
56
192
Hyalomma ma gina um
1
35
36
Ixodes icinus
490
1011
43
60
1604
Rhipicephalus boophilus
1
1
2
4
Rhipicephalus bu sa
38
33
71
Rhipicephalus sanguineus
271
1
6
2
280
To al
1030
1109
251
244
2634
Se úbal
De macen o ma gina us
65
35
100
Haemaphysalis punc a a
1
1
Ixodes icinus
12
7
19
Rhipicephalus sanguineus
165
130
295
To al
242
173
415
É o a
Rhipicephalus sanguineus
83
64
147
To al
83
64
147
Fa o
De macen o ma gina us
13
6
19
Haemaphysalis punc a a
1
1
Ixodes icinus
17
18
35
Rhipicephalus bu sa
1
1
Rhipicephalus sanguineus
28
5
200
185
418
To al
28
5
231
210
474
TOTAL
1058
1118
1138
937
4251
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
107
Ques ing Ticks in he No h egion
In he No h egion (Figu e 5), R. sanguineus was he mos p e alen species, du ing he wo
yea s o collec ions, pa icula ly in he sp ing. The species D. e icula us was only collec ed
in his egion (B aga dis ic ) du ing summe o 2012 and sp ing o 2013 and 2014, being
always collec ed in he same si e, which was a hun ing a ea wi h wild boa s nea by. Also, I.
hexagonus was only collec ed in Vila Real du ing he 2012 au umn in a si e wi h high
ele a ion, si ua ed in he na u al pa k o Al ão. Rega ding A ei o dis ic he collec ions we e
only made once in he sp ing o 2013 nea he seaside a Dunas de São Jacin o, whe e R.
sanguineus was he mos abundan species.
Figu e 5 – Ques ing ick species a e age densi y and s anda d de ia ion in he No h egion
du ing he wo yea s o collec ions, in sp ing, summe and au umn seasons. (Dm – De macen o
ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, Hym – Hyalomma ma gina um, I
– Ixodes icinus, Ih – Ixodes hexagonus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa).
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
108
Ques ing icks in Lisboa and Tagus Valley (LTV) egion
In his egion he majo i y o he collec ions we e made in TNM, whe e I. icinus imma u e
s ages we e he mos collec ed species and s age in he Sp ings o 2012, 2013 and 2014, while
in summe imma u e s ages o H. punc a a and R. sanguineus whe e ob ained (Figu e 6).
Adul icks om I. icinus, H. punc a a and Hy. lusi anicum we e also collec ed bu wi h a
low densi y du ing he Au umn o each yea . In TNM du ing he coldes days o Au umn H.
ine mis, also known as he win e ick, was collec ed. Cu iously, no adul R. sanguineus was
e e collec ed om he ege a ion in his si e, al hough he imma u e s ages we e p esen .
Figu e 6 – Ques ing ick species a e age densi y and s anda d de ia ion in Lisboa and Tagus
Valley egion du ing he wo yea s o collec ions, in sp ing, summe and au umn seasons.
(Dm – De macen o ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, Hi –
Haemaphysalis ine mis, Hyl – Hyalomma lusi anicum, Hym – Hyalomma ma gina um, I – Ixodes icinus, Rbo
– Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa).
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
109
Ques ing icks in he Sou h egion
In he Sou h egion he collec ions we e ca ied ou only du ing Sp ing (Figu e 7), al hough
a collec ion was made in he Se úbal dis ic in he Summe o 2013, bu no icks we e
collec ed, since he land had been plowed. Rega ding ick species R. sanguineus was he
mos abundan species in he h ee dis ic s, al hough I. icinus and D. ma gina us we e also
collec ed bu wi h a lowe densi y, pa icula ly in one o he collec ion si es in Se úbal dis ic
which was a hun ing a ea wi h wild boa s.
Figu e 7 – Ques ing ick species a e age densi y and s anda d de ia ion in Sou h egion
du ing he wo yea s o collec ions, in sp ing and summe seasons. (Dm – De macen o
ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, I – Ixodes icinus, Rs –
Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa).
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
110
Bioecological analysis o icks collec ed om he ege a ion
To al ick densi y, and he mos abundan species we e analysed acco ding o en i onmen al
a iables ega ding he collec ing si es.
To al ick densi ies we e signi ican ly di e en acco ding o: 1) egion o he collec ions,
among LTV and No h egion, being highe in LTV (KW = 20.614, P < 0.0001); 2) season,
highe in Sp ing han Summe (KW = 8.716, P = 0.01); 3) ele a ion, being highe below
100m han abo e 200m (KW = 20.302, P < 0.0001); 4) he h ee ypes o ege a ion al hough
he P alue was nea 0.05 (KW = 6.047, P < 0.049), esul ing in no di e ences in pai wise
compa isons. No di e ences we e ob ained o he habi a s.
To al ick densi y showed a signi ican nega i e co ela ion wi h he empe a u e
(Spea man’s’s hô = -0.462, P = 0.001) and he dis ance o wa e line (Spea man’s’s hô = -
0.479, P = 0.001), bu no co ela ion wi h ela i e a mosphe ic humidi y.
Iden ical analysis was pe o med o he i e mo e ep esen a i e ick species in he h ee
egions, namely D. ma gina us, H. punc a a, Hy. lusi anicum, I. icinus and R. sanguineus.
Conce ning he egions, H. punc a a, Hy. lusi anicum and I. icinus, we e mo e abundan in
LTV (KW = 17.543, P < 0.0001), in compa ison o he No h and he Sou h egions (Figu e
8), while R. sanguineus was highe in Sou h han LTV (KW = 14.579, P = 0.001). No
di e ences we e ob ained o D. ma gina us (P > 0.05).
Rega ding he seasons, I. icinus was he species wi h he highe di e ences be ween seasons,
namely i was mo e abundan in au umn han in ei he sp ing o summe (KW = 11.767, P =
0.003), (Figu e 9); R. sanguineus was mo e abundan in Sp ing han in au umn (KW =
22.254, P < 0.0001); H. punc a a in au umn han in Sp ing (KW = 8.981, P = 0.01); and D.
ma gina us in sp ing han in summe (KW = 9.046, P = 0.01). No di e ences we e ob ained
o Hy. lusi anicum (P > 0.05).

Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
111
Figu e 8 – Box-plo analysis depic ing he dis ibu ion o (A) H. punc a a, (B) Hy. lusi anicum
and (C) I. icinus wi hin each egion. Y axis ep esen icks/min-collec o .
A
B
C
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
112
Figu e 9 – Box-plo analysis depic ing he densi ies o I. icinus in each o he su eyed
seasons. Y axis ep esen icks/min-collec o .
Fo he ele a ion I. icinus, Hy. lusi anicum and D. ma gina us we e mo e abundan in
ele a ions below 100m han in 100-200m o abo e 200m (KW = 11.173, P = 0.004), while
H. punc a a was mo e abudan in ele a ions be ween 100-200m (KW = 26.965, P < 0.0001).
No di e ences we e ob ained o R. sanguineus (P > 0.05).
Conce ning he ege a ion only I. icinus and H. punc a a e eled o be mo e abundan in
sh ubland ege a ion han in pas u e and o es ege a ions (KW = 15.643, P < 0.0001). In
elas ionship o he habi a , I. icinus was mo e abundan in hun ing & o es a eas han in
pas u e & ag icul u e and pe i-u ban & public pa ks (KW = 7.000, P = 0.03); and o H.
punc a a, di e ences we e ob ained be ween he habi a s (KW = 7.858, P = 0.02), howe e ,
he pai wise compa isions showed he same dis ibu ion in he h ee habi a s.
Finally H. pun ac a and I. icinus had a nega i e co ela ion wi h he empe a u e
(Spea man’s hô = -0.327, P = 0.02; Spea man’s’s hô = -0.475, P = 0.001, espec i ely) and
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
113
he dis ance o he wa e line (Spea man’s hô = -0.629, P < 0.0001; Spea man’s hô = -0.562,
P < 0.0001), al hough I. icinus p esen ed a posi i e co ela ion wi h he humidi y
(Spea man’s hô = 0.334, P = 0.02), and Hy. lusi anicum showed a nega i e co ela ion wi h
he dis ance o wa e line (Spea man’s’s hô = -0.343, P = 0.02).
Ticks collec ed om hos s
A o al o 2171 icks we e emo ed om se en di e en hos species (n=112), dis ibu ed
along se en dis ic s om No h o Sou h Po ugal, du ing he wo-yea pe iod. Al hough he
majo i y o icks we e collec ed om syl a ic hos s, namely ce ids, he “pe s” hos s we e
he mos su eyed, especially dogs. Tick dis ibu ion acco ding o s age was: 1 la ae
(0.04%), 36 nymphs (1.7%), 1256 emales (57.9%) and 878 males (40.4%), (Table 3).
Fi e ick gene a we e iden i ied, including nine species, being R. sanguineus he mos
collec ed and widesp ead ick (858, 39.5%), ollowed by I. icinus (743, 34.2%), R. bu sa
(278, 12.8%), H. punc a a (148, 6.8%), Hy. ma gina um (85, 3.9%), Hy. lusi anicum (35,
1.6%), D. ma gina us (19, 0.9%), I. hexagonus (3, 0.1%) and H. ine mis (2, 0.1%) (Table 3).
Conce ning he dis ibu ion o icks in he se e al dis ic s, he majo i y o icks we e ob ained
om Lisboa dis ic (1053, 48.5%), ollowed by É o a (350, 16.1%), Fa o (341, 15.7%),
Se úbal (213, 9.8%), Vila Real (115, 5.3%), Gua da (65, 3%) and San a ém (34, 1.6%),
(Table 3).
Densi ies o he se e al ick species collec ed in each yea , dis ic and season a e ep esen ed
in Figu e 10, being R. sanguineus he mos abundan species collec ed in all dis ic s, excep
in Lisboa, which was I. icinus species. Fo a mo e accu a e analysis he dis ibu ion o ick
species was analyzed by egions, being he g aphics in di e en scales o a be e
comp ehension o ick densi ies.
Chap e 2
Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia
bu gdo e i s.l. in ec ion
114
Figu e 10 – Tick a e age densi y pe hos , o each collec ed species by season, yea and dis ic . Dm – De macen o
ma gina us, Hp – Haemaphysalis punc a a, Hi – Haemaphysalis ine mis, Hyl – Hyalomma lusi anicum, Hym – Hyalomma ma gina um, I –
Ixodes icinus, Ih – Ixodes hexagonus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa.
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
217
Duplex eal- ime PCR eac ions we e ca ied ou in a o al olume o 20 μl con aining 1×
SensiFAST™ (Bioline), 0.3 μM o each p ime (F_Bbsl, R_Bbsl; F_18S RNA, _18S RNA
o F_β-ac in, R_ β-ac in), 0.25 μM o each TaqMan p obe (P_Bbsl; P_18S RNA o P_ β-
ac in), DNase ee wa e (Bioline) and 2 μl o he ex ac ed DNA empla e. The he mal cycling
condi ions we e: 1 cycle a 95 °C o 1 min, ollowed by 40 cycles a 95 °C o 10 s and 60 °C
o 45 s. The e aplex eal- ime PCR eac ions used 1× SensiFAST™ (Bioline), 0.3 μM o
F_Bspp, R_Bspp p ime s, 0.25 μM o P_Ba z, P_Bga , P_Bbss and 0.15 μM o P_Blus TaqMan
p obes, DNase ee wa e (Bioline), and 2 µl o he ex ac ed DNA empla e, in a o al olume
o 20 μl. The he mal cycling condi ions we e: 1 cycle a 95 °C o 5 min, ollowed by 45
cycles a 95 °C o 10 s and 60 °C o 30 s. All posi i e samples we e e es ed o con i ma ion.
Non- empla e nega i e con ols (wi h PCR g ade wa e ) we e included in each un o ule ou
he possibili y o c oss-con amina ion. The mal cycling, luo escen da a collec ion, and da a
analysis we e pe o med in a 7500 Fas eal- ime PCR Sys em (Applied Biosys ems),
acco ding o he manu ac u e ’s ins uc ions.
Analy ical speci ici y and sensi i i y
To in es iga e whe he he p obes and espec i e lanking p ime s de ec hei speci ic a ge s,
DNA om B. bu gdo e i s.l., om o he spi oche es (Lep ospi a in e ogans and T eponema
paliddum) and om o he s ick-bo ne pa hogens (Theile ia sp. and Babesia sp.), we e used as
empla es in eal ime PCR.
To es ima e he de ec ion h eshold o he assays (analy ical sensi i i y), indi idually and as
duplex and e aplex eal- ime PCR, a s anda d cu e was cons uc ed using 10- old se ial
dilu ions o DNA ex ac ed om B. alaisiana, B. ba a iensis, B. bu gdo e i s.s., B. a zelii,
B. ga inii and B. lusi aniae s ains. The DNA dilu ions o B. bu gdo e i s.l. co esponded o
10 – 106 genome equi alen s (GE), acco ding o he Na ional Re e ence Cen e o Bo elia
(NRZ uni s: 50 g/µl=10GE). Fo each s ain and concen a ion he PCR assays we e pe o med
in iplica e. The end-poin co esponded o he dilu ion a which he assay could de ec he
espec i e DNA a ge s in all h ee eplica es.

Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
218
To ob ain an indica ion i he eal- ime PCR assays can be used wi h clinical samples, i.e.,
ma e ial o pa ien s in ec ed by B. bu gdo e i s.l., se a we e mixed wi h a 10- old se ial
dilu ion o B. bu gdo e i s.l. DNA (mix u e o B. bu gdo e i s.s., B. a zelii, B. ga inii and B.
lusi aniae) anging om 10 o 106 NRZ uni s o GE. Bo elia DNA was e-ex ac ed om his
mix u e using Gen a Pu egene comme cial ki om QIAGEN®, acco ding o he
manu ac u e ’s p o ocol. These pa ien samples expe imen ally inocula ed we e sc eened
acco dingly wi h he eal ime PCR assay.
B. bu gdo e i s.l. e e ence s ains
B. bu gdo e i s.s. (B31), B. a zelii (PGau), B. ga inii (PBi) isola ed om Japan, B. lusi aniae
(PoHL1), B. ba a iensis (PBi) and B. alaisiana (VS116) esh cul u es om he labo a o y
o Lep ospi osis and Lyme Bo eliosis G oup om Ins i u o de Higiene e Medicina T opical
(IHMT)/UNL, we e cul u ed in BSK-H medium, incuba ed a 34ºC and obse ed wi h a da k-
ield mic oscope e e y o he day. When he cul u es a chi ed he loga i hmic phase, he
bac e ia we e ha es ed by cen i uga ion a a speed o 14000g, and genomic DNA ex ac ion
was pe o med wi h Gen a Pu egene comme cial ki om QIAGEN®, acco ding o he
manu ac u e ’s p o ocol. A e ex ac ion he DNA concen a ion and pu i y om each B.
bu gdo e i s.l. genospecies we e es ima ed by measu ing he abso bance a 260 nm (A260)
and by A260/A280 and A260/A230 a ios, using a NanoD op 1000 spec opho ome e
(NanoD opTM). The DNA concen a ion was adjus ed o 106 GE o he six B. bu gdo e i s.l.
genospecies and dilu ions om 10 o 106 GE we e p epa ed.
E alua ion o eal- ime PCR wi h ield-collec ed icks and clinical samples
Fo he e alua ion o he wo-s ep mul iplex eal- ime PCR iden i ica ion assay, a panel o
DNA samples, p e iously posi i e o nega i e o B. bu gdo e i s.l., we e ob ained om (i)
se a (n= 20) and ce eb ospinal luid (CSF) (n= 10) samples om human pa ien s a ailable a
Lep ospi osis and Lyme Bo eliosis G oup ( om 2012 o 2015) and (ii) ques ing nymphs and
adul s o Ixodes icinus species (n=50) collec ed ac oss Po ugal in p e ious s udies (Nunes e
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
219
al., 2015; Nunes e al., 2016). The p esence o B. bu gdo e i s.l. DNA was o me ly e alua ed
by wo nes ed-PCR a ge ing he genes encoding he 5S-23S in e genic space egion
(Rijpkema e al., 1995) and he laB gene (Wodecka e al., 2010). Nes ed-PCR ampli ica ion
p oduc s om ick samples, we e also p e iously sequenced o he iden i ica ion o B.
bu gdo e i s.l. genospecies.
S a is ical analysis
Fo measu ing he ag eemen be ween he esul s o he ou inely pe o med molecula
iden i ica ion o clinical and ick samples, and he eal- ime PCR assay, kappa coe icien was
used. This coe icien , wi h con idence in e als, was de e mined wi h BioEs a 5.0.
Resul s
Analy ical speci ici y and sensi i i y
The wo eal- ime PCR assays only de ec ed B. bu gdo e i s.l. DNA and did no p oduce any
non-speci ic ampli ica ion p oduc s in epea ed expe imen s. In addi ion, he e we e no alse
posi i es due o c oss- eac ion be ween luo opho e signals wi hin each assay.
Fo he e alua ion o he sensi i i y, he assay was es ed using DNA ex ac ed om B.
bu gdo e i s.l. cul u es as empla e. In he i s s ep, dilu ions om 10 o 106 GE o B.
bu gdo e i s.l. genospecies DNA we e es ed one by one and in a mix u e wi h he six
genospecies DNA, along wi h he in e nal con ols; in he second s ep dilu ions om 10 o 106
GE o DNA om B. bu gdo e i s.s., B. a zelii, B. ga inii and B. lusi aniae we e es ed
indi idually and in e aplex (Figu e 3).
The esul s o he analy ical sensi i i y we e as ollows:
The i s duplex eac ion could de ec he p esence o B. bu gdo e i s.l. un il he dilu ion
con aining 50 g/µL = 10 GE o DNA empla e, ega dless he genospecies es ed. The s anda d
cu e o DNA mix u e showed a co ela ion coe icien (R2) o 0.98 and a slope o – 3.2,
indica ing a good e iciency (106%) o PCR ampli ica ion (Figu e 2).
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
220
Figu e 2 – Illus a ion o he duplex eal- ime PCR ampli ica ion cu e ob ained o each DNA
concen a ion. (A) B. bu gdo e i s.l. DNA dilu ions om 10 o 106 GE; (B) espec i e linea
ela ionship be ween he loga i hm o he s a ing concen a ion o DNA and he ampli ica ion
C alues; Neg – eal- ime PCR nega i e con ol using DNase ee wa e as empla e; C -
in e cep ion in he minimum h eshold (10 GE); RFU - Rela i e Fluo escence Uni s.
Fo he e aplex eac ion a ge ing he laB gene o he ou genospecies o B. bu gdo e i s.l.,
when each p obe was indi idually es ed, he de ec ion limi was 50 g/µl = 10 GE o B. a zelii
(C ≈ 37), B. ga inii (C ≈ 37) and B. lusi aniae (C ≈ 37) and 0.5pg/µl = 102 GE o B.
bu gdo e i s.s. (C ≈ 36), (Figu e 3 A,B,C and D); when es ed in e aplex he de ec ion limi
was 0.5pg/µl o B. a zelii (C ≈ 32), B. ga inii (C ≈ 35), B. lusi aniae (C ≈ 35) and B.
bu gdo e i s.s. (C ≈ 35), (Figu e 3E). The s anda d cu es o he e aplex eac ion showed
co ela ion coe icien s (R2) anging om 0.929 o 0.997 and slopes o -2.296 o -3.377 (Figu e
3F).
106
105
104
102
10
Neg
B. bu gdo e i s.l.
A
B
103
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
221
Figu e 3 - Illus a ion o he e aplex eal- ime PCR ampli ica ion cu es ob ained o each
p obe indi idually (A, B, C and D) and in e aplex (E) o each DNA concen a ion; and
espec i e linea ela ionship be ween he loga i hm o he s a ing concen a ion o DNA and
he ampli ica ion C alues (F). A – eal- ime PCR o B. a zelii (dilu ions om 10 – 106 GE);
B – eal- ime PCR o B. ga inii (dilu ions om 106 – 10 GE); C – eal- ime PCR o B.
lusi aniae (dilu ions om 106 – 10 GE); D – eal- ime PCR o B. bu gdo e i s.s. (dilu ions
om 106 – 102 GE); E – e aplex eal- ime PCR o he dilu ion o 106 GE; Neg – eal- ime
PCR nega i e con ol using DNase ee wa e as empla e; C - in e cep ion in he minimum
h eshold; RFU - Rela i e Fluo escence Uni s.
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
222
Expe imen al inocula ed se um samples
Sc eening o dilu ion se ies o DNA pu i ied om pa ien ’s se a samples spiked wi h B.
bu gdo e i s.l. DNA, e ealed no di e ences in he sensi i i y o he duplex assay o he used
ma e ial, since i was possible o ob ained ampli ica ion signal un il he dilu ion o 10 GE wi h
a C alue o 35. Rega ding he e aplex assay, he ou genospecies es ed did no show majo
di e ences in he sensi i i y, since i was possible o ob ain ampli ica ion signal un il o
dilu ion o 102 GE wi h C alues o : 32 o B. a zelii and B. bu gdo e i s.s., 35 o B. ga inii,
and 34 o B. lusi aniae.
E alua ion o eal- ime PCR wi h ield-collec ed icks and clinical samples
F om he 50 ick samples es ed, 24 (48%) p e iously posi i e o he wo nes ed-PCR’s, we e
also posi i e o he duplex eal- ime PCR, howe e , o he e aplex eal- ime PCR jus 23
(46%, es k= 0.96) samples we e posi i e (Table 2). The genospecies o B. bu gdo e i s.l.
iden i ied in his assay, we e in ag eemen wi h he p e iously sequencing esul s (Table 2).
Conce ning he clinical samples es ed (n=30), om he 11 samples (40%) p e iously posi i e
o he wo nes ed-PCR, 11 (37%,), we e also posi i e o he duplex eal- ime PCR, bu only
h ee (10%), we e posi i e o he e aplex assay, whe e he genospecies ob ained we e
iden i ied as: B. a zelii; B. ga inii and B. lusi aniae (Table 2) and he K alue was 0.93 and
0.32 o he duplex and e aplex eal- ime PCR, espec i ely.

Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
223
Table 2 – Compa ison o duplex and e aplex eal- ime PCR’s posi i e samples wi h esul s
om p e ious sequencing o ick samples.
I. icinus samples (n=50)
Samples
(Nes ed-PCR’s
posi i e o
nega i e)
Sequencing
esul s
Duplex eal – ime PCR
Te aplex eal- ime PCR
1
B. a zelii
1 posi i e (C  17)
1 B. a zelii (C  21)
3
B. bu gdo e i s.s.
3 posi i es
2 B. bu gdo e i s.s. (C  33; C  36)
1 nega i e
8
B. ga inii
8 posi i es (C  17 o C  19)
8 B. ga inii (C  16 o C  33)
12
B. lusi aniae
12 posi i es (C  18 o C  26)
12 B. lusi aniae (C  20 o C  35)
26 nega i es
-------
26 nega i es
26 nega i es
Clinical samples (n= 30)
Samples
(Nes ed-PCR’s
posi i e o
nega i e)
Sequencing
esul s
Duplex eal – ime PCR
Te aplex eal- ime PCR
5 se a
6 CSF
(posi i e)
-------
-------
11 posi i es (C  17 o C  36)
1 se um as B. a zelii (C  29)
1 se um as B. ga inii (C  30)
1 se um as B. lusi aniae (C  32)
8 nega i es (2 se a; 6 CSF)
15 se a; 4 CSF
(nega i es)
-------
19 nega i es
19 nega i es
Discussion
Acco ding o Eu opean Cen e o disease P e en ion and Con ol (ECDC) he diagnosis o
Bo elia spp. in ec ion should be based mainly on clinical symp oms, he pa ien ’s medical
his o y and an e alua ion o he isk o exposu e o in ec ed icks, along wi h diagnos ic es s
including he assessmen o an ibodies o Bo elia spp. class IgM and IgG (Bil-Lula e al.,
2015). Howe e , he se ologic es s based in an ibodies sea ch ha e some p oblems conce ning
he la ge amoun o alse nega i e esul s, p obably due o he “window pe iod” in which IgM
an ibodies a e no ye p oduced. Consequen ly, molecula app oaches as eal- ime PCR assays
would be help ul in es ing pa ien s ea ly in he disease, be o e an an ibody esponse de elops,
and in pa ien s p esen ing non classic symp oms.
I is also known ha di e en Bo elia genospecies a e associa ed wi h di e se biological
o igins (B. a zelii wi h small mammals, B. ga inii wi h bi ds and B. lusi aniae wi h liza ds)
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
224
(Ku enbach e al., 2002; Mannelli e al., 2012) , di e en clinical mani es a ions (B. ga inii
wi h neu ological mani es a ion, B. a zelii wi h skin mani es a ions) ( an Dam e al., 1993),
se e i y o disease (B. bu gdo e i s.s. is mo e se e e han B. a zelii) (Jungnick e al., 2015),
and geog aphic dis ibu ion o species (B. a zelii, B. ga inii and B. lusi aniae in Eu ope and B.
bu gdo e i s.s. in No h Ame ica) ( an Dam e al., 1993; S anek e al., 2002; S anek & S le,
2003) Consequen ly, ha ing he capaci y o iden i ying he Bo elia genospecies in ol ed in
an in ec ion, whe he in he ec o o in he hos , is becoming inc easingly impo an since i
also p o ides in o ma ion on he ecological cha ac e is ics o indi idual species, allows a be e
p ognosis and ea men s a egy, and is needed o gene ic analysis (Mukhache a & Ko ale ,
2014).
Quan i a i e eal- ime PCR o di ec molecula de ec ion and quan i ica ion o pa hogens is a
widely used echnology nowadays o clinical applica ion, being also aluable o con i ming
a diagnosis based on less clea mani es a ions o LD o o in es iga ing con o e sial disease
synd omes a ibu ed o in ec ion wi h B. bu gdo e i s.l.. Se e al eal ime PCR assays o
he de ec ion o B. bu gdo e i s.l. ha e been epo ed p e iously, howe e , ew ha e included
an in e nal con ol (Ge me e al., 1999; Gooskens e al., 2006), no has a quan i a i e e aplex
PCR s udy o ou o he mos p e alen Bo elia genospecies in Eu ope been published o
da e.
The e o e, in his s udy, we p esen a combined mul iplex TaqMan eal- ime PCR s a egy o
in e he p esence o B. bu gdo e i s.l. genospecies in clinical and ec o samples. In he i s
s ep we e alua ed i a sample is in ec ed wi h Bo elia bu gdo e i s.l. by a ge ing he laB
gene. The laB gene encodes a 41-kDa lagellin p o ein and is loca ed on a single-copy in he
linea ch omosome (Wang e al., 1999). In his s ep he inclusion o an in e nal con ol allowed
success ul DNA ex ac ion o be moni o ed. The second s ep iden i ies simul aneously ou o
he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope, namely B. a zelii, B. ga inii,
B. bu gdo e i s.s. and B. lusi aniae. Al hough i a ge s he same gene as he p e ious s ep,
he p ime s we e designed in a di e en mo e a iable egion, esul ing in a agmen wi h
su icien polymo phisms ha allowed o design he ou speci ic p obes o each genospecies.
In he duplex eal- ime PCR, DNA om each B. bu gdo e i s.l. genospecies, a ailable a
Lep ospi osis and Lyme Bo eliosis labo a o y, IHMT/UNL, was es ed indi idually and in a
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
225
mix u e con aining he same DNA concen a ion o he six genospecies (B. a zelii, B. ga inii,
B. lusi aniae, B. bu gdo e i s.s., B. alaisiana and B. ba a iensis). Whe he he DNA is es ed
indi idually o simul aneously, all genospecies showed e y good eac i i y, since no
di e ences we e ob ained ega ding he sensi i i y (10 GE). Simila esul s we e ob ained o
B. bu gdo e i s.l. in p e iously s udies, whose sensi i i y’s ange om 1 o 10 GE (Gooskens
e al., 2006; O’Rou ke e al., 2013; Venczel e al., 2015). Fu he mo e, he assay is highly
speci ic, as i ailed o de ec he laB gene o o he mic obial species.
Fo he e aplex assay he sensi i i y o he assay dec eases om 10 GE o 102 GE o B.
ga inii, B. a zelii and B. lusi aniae bu emains he same o B. bu gdo e i s.s., when he ou
p obes a e es ed simul aneously. This loss o sensi i i y is no mal when passing om a
singleplex o a mul iplex eal- ime PCR, and is ela ed wi h he compe i ion be ween he
a ge s, since we a e using he same pai o p ime s o he ou a ge s, being he di e ences
only ound in he p obes.
When he assay was applied o ield ick samples, he duplex s ep p esen ed a e y good
pe o mance, since i ga e he same esul s ega ding he posi i e and nega i e samples
ob ained p e iously by he wo nes ed-PCR a ge ing he laB gene and he IGS egion. Also
o he e aplex assay only one o he posi i e ick samples yielded a nega i e esul , p obably
due o he de ec ion limi o he assay, since i is lowe han he de ec ion limi o he duplex
assay. Mo eo e , he B. bu gdo e i s.l. genospecies iden i ied by he e aplex we e 100%
equal as hose ob ained om he sequencing esul s. The assays sensi i i y is c ucial when
analyzing ick samples, since hey ha e he capaci y o ha bo ing complex mic obial
popula ions (T e en & Sjås ad, 2011). The di e se bac e ial con en in icks could be
esponsible o a low amoun o Bo elia spi oche es, due o he na u al size o he icks, and
also o he en i onmen al compe i ion be ween bac e ial species (Hibbing e al., 2010).
Rega ding he es ing o clinical samples (se a and CSF) wi h he duplex assay, a 100%
ag eemen was achie ed wi h he esul s p e iously ob ained wi h he nes ed-PCR’s p o ocols.
Howe e , in he e aplex assay only h ee samples we e posi i e, and iden i ied as B. a zelii,
B. ga inii and B. lusi aniae; he emainde eigh nes ed-PCR-posi i e samples we e nega i e
wi h his assay, including all he CSF samples es ed. This ac is ela ed wi h he loss o
sensi i i y when he ou p obes a e used simul aneously. Howe e , p e iously s udies showed
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o
imp o e Lyme disease diagnosis
226
ha Bo elia coun s in CSF a e e y low, a ound 20 bac e ia pe 100µL CSF lysed ( Noc on
e al., 1996; Schwaige e al., 2001; Gooskens e al., 2006; Bil-Lula e al., 2015), which is
below he e aplex sensi i i y, bu in he same baseline o he duplex assay de eloped in ou
s udy.
Nume ous PCR assays ha e been desc ibed o he de ec ion o B. bu gdo e i s.l. DNA in
CSF, bu he sensi i i ies a ied om 12% o 100% (Kelle e al., 1992; Lebech & Hansen,
1992; Ei e e al., 1995; Noc on e al., 1996; Lebech e al., 2000; Schwaige e al., 2001).
These esul s a e di icul o in e p e because o he use o small sample sizes, he selec ion
di e ences o clinical specimens, he es ing o poo ly de ined pa ien ca ego ies, and he
equen lack o an in e nal con ol o moni o PCR inhibi ion. In ou case, bo h nega i e and
posi i e con ols and an in e nal con ol (mammals-β-ac in gene) we e included in each un o
de e mine whe he o no inhibi o y subs ances we e p esen in he pa ien ’s clinical sample,
o whe he alse posi i e esul s could appea du ing ampli ica ions. Thus he possibili y o
low es sensi i i y due o he p esence o PCR inhibi o s in CSF samples is excluded.
Howe e , o a be e e alua ion o his combined mul iplex TaqMan eal- ime PCR, u he
in es iga ion using o he clinical samples is equi ed.
In conclusion, his wo-s ep mul iplex TaqMan eal- ime PCR assay a ge ing he laB locus,
p o ed o be an e icien me hod when sc eening o Bo elia in ec ion in ick samples, and a
p omising ool o ea ly diagnos ic pu poses on clinical samples. Mo eo e , he abili y o de ec
ou o he mos p e alen B. bu gdo e i s.l. genospecies in Eu ope, in a single- un is a ime-
sa ing ac o , and cos educ ion when compa ed wi h he con en ional PCR and sequencing
me hods.
Acknowledgmen s
This wo k was suppo ed by Minis y o Educa ion and Science o Po ugal, Fundação pa a a
Ciência e a Tecnologia, h ough a PhD g an (SFRH/BD/78325/2011), and Funds om GHTM
– UID/Mul i/04413/2013.
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
233
ampli ica ion p oduc s can be obse ed by naked eye. The e o e, his echnique may ha e i s
ole as a ool in low- esou ce labo a o ies o he diagnosis o LD in an ea ly s age o
in ec ion.
In oduc ion
Bo elia bu gdo e i sensu la o (B. bu gdo e i s.l.) complex is a g oup o se e al
genospecies o spi oche es esponsible o Lyme disease (LD), he wo ld's as es g owing
ec o -bo ne zoono ic disease wi h cases epo ed in o e 60 coun ies and endemic oci in
No h Ame ica, Eu ope, and Asia (WHO, 2013). This complex is ep esen ed by 20
genospecies, se e al o which can cause LD in humans. These genospecies a y in hei
geog aphic dis ibu ion, hos speci ici y and abili y o cause disease in humans. Clinically he
di e en pa hogenic Bo elia spp. a e o in e es as hey ha e been associa ed wi h di e en
disease symp oms which may be obse ed in he la e s ages o he condi ion (Ma gos e al.,
2011). In Eu ope LD is mos ly associa ed o one o h ee genospecies: B. bu gdo e i s.s., B.
a zelii and B. ga inii (Assous e al., 1993; an Dam e al., 1993; Rich e e al., 2004). B
bu gdo e i s.s. is no mally associa ed wi h a h i is, B. ga inii wi h neu ological e ec s
(musculoskele al and ne ous sys ems), and B. a zelii wi h skin complica ions, like
Ac ode ma i is Ch onica A ophicans (ACA) ( an Dam e al., 1993).
The labo a o y diagnosis is based mainly on se ological and molecula biology me hods.
Se ological me hods includes sc eening es s such as enzyme-linked immunoso ben assays
(ELISA), indi ec immuno luo escence assays (IFA), and con i ma ion es s such as Wes e n
blo (Robe son e al., 2000; S ee e e al., 2008; Hin e sehe e al., 2012; Liu e al., 2013).
Rega ding he molecula app oaches, se e al PCR-based me hods ha e been de eloped o
de ec B. bu gdo e i s.l. DNA, such as con en ional PCR, nes ed PCR, and eal- ime PCR
based in speci ic gene de ec ion, o se e al ma ke s such as, ospA, s, - l in e genic
space , g oEL, ecA, hbb, la, and o he s (Picken e al., 1996; P iem e al., 1997; Ague o-
Rosen eld e al., 2005; Kond usik e al., 2007; Wang e al., 2010; Wodecka e al., 2010;
Wodecka 2011; de Leeuw e al., 2014). Ne e heless, mos o hese molecula app oaches
ha e se e al disad an ages: ime-consuming, a iable sensi i i y and equi es speci ic

Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
234
expensi e ins umen s o he ampli ica ion eac ion, which is di icul in low incoming
coun ies. The e o e, apid, simple, low-cos , and e ec i e diagnos ic me hods a e u gen ly
equi ed.
Loop-media ed iso he mal ampli ica ion (LAMP) was i s epo ed in 2000 by No omi
(No omi, 2000), and since hen he numbe o s udies pe o med o he de ec ion o a wide
ange o i uses, pa asi es and bac e ia, using his echnology is inc easing e e y yea (Pooja
e al., 2014; Fallahi e al., 2015; Gao e al., 2015; Jung e al., 2015; Wang e al., 2015a). The
p inciple o his echnology elies on an au ocycling s and displacemen DNA syn hesis by
a DNA polyme ase wi h high s and displacemen ac i i y (Bs ), supe seding he mal
dena u a ion s eps (No omi, 2000). The esea ch and de elopmen e o s on LAMP
echnology, in he las yea s, ha e been ocused on i s p ac ical applica ion in clinical se ings
including he imp o emen o exis ing assays. The mos dis inc i e cha ac e is ics o LAMP
a e i s simplici y and i s apidi y, ep esen ing i s majo ad an ages o e he PCR-based
echnique (Mo i e al., 2013; No omi e al., 2015). Because his echnology is an iso he mal
me hod, LAMP can be pe o med jus by using an inexpensi e hea e like a block hea e o
a wa e ba h, allowing, his way, o LAMP o be conduc ed in any ime and any se ing.
Mo eo e , besides he con en ional me hods o analyze LAMP p oduc s, such as aga ose gel
elec opho esis, isual inspec ion o he inc ease u bidi y, o colou change o he eac ion
mix u e (Mo i e al., 2001), his echnology can be a ached o o he de ices such as la e al-
low de ices (LFDs) o he de ec ion o labels inco po a ed in o he ampli ica ion p oduc s.
LFD es s ha e a numbe o ad an ages o use in he ield, and speci ic LFD immunoassays
ha e been pa icula ly success ul in a eas o poin -o -ca e and on-si e es ing (Assadollahi e
al., 2009; Baume & T an, 2015; Sajid e al., 2015). The e a e LFD gene ic es comme cially
a ailable, like ch oma og aphic s ips ha can de ec bio in-labelled DNA agmen s
hyb idized wi h complemen a y FITC-labelled p obes. FITC is de ec ed in he s ips by he
o ma ion o complexes wi h gold-conjuga ed an i-FITC an ibodies.
The aim o his s udy was o de elop and e alua e wo duplex LAMP assays (dLAMP) based
on laB gene, combined wi h a LFD echnology, o implemen a apid, simple and sensi i e
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
235
assay o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l.
complex (B. a zelii, B. ga inii, B. bu gdo e i sensu s ic o (s.s.) and B. lusi aniae).
Ma e ial and me hods
Bo elia bu gdo e i s.l. s ains
B. bu gdo e i s.s. (B31), B. a zelii (PGau), B. ga inii (PBi), and B. lusi aniae (PoHL1), esh
cul u es a ailable a he G oup o Lep ospi osis and Lyme Bo eliosis (GLBL) om Ins i u o
de Higiene e Medicina T opical (IHMT)/UNL, we e incuba ed o one week in BSK-H
medium a 34ºC. The g ow h was de ec ed by examining he cul u e using a da k- ield
mic oscope and collec ion o he spi oche es was done in he log-phase (app oxima ely 108
– 109 bac e ia/ml).
DNA ex ac ion
To al genomic DNA ex ac ion om B. bu gdo e i s.l. cul u es was pe o med wi h Gen a
Pu egene comme cial ki om QIAGEN®, acco ding o he manu ac u e ’s p o ocol. A e
ex ac ion he DNA concen a ion and pu i y we e es ima ed by measu ing he abso bance a
260 nm (A260) and by A260⁄A280 and A260/A230 a ios, using a NanoD op 1000
spec opho ome e (NanoD op™). The DNA concen a ion was adjus ed o 106 genome
equi alen s (GE)  5 ng/µl o DNA, acco ding o he Na ional Re e ence Cen e o Bo elia
(NRZ uni s), o he ou B. bu gdo e i s.l. genospecies and dilu ions om 10 o 106 GE
we e p epa ed.
Design o LAMP p ime s
A mul iple alignmen o lagellin ( laB) sequences e ie ed om GenBank was c ea ed in
Mega 6 (Kuma e al., 2008), and a Flagellin sequence consensus o each genospecies was
selec ed: B. bu gdo e i s.s. (accession numbe X15661.1), B. ga inii (accession numbe
DQ650333.1), B. a zelii (accession numbe DQ016619.1), and B. lusi aniae (accession
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
236
numbe D82856.1). The p ime se s o each LAMP we e designed using P ime Explo e V4
so wa e (h p:// p ime explo e .jp/elamp4.0.0/index.h ml). This p ime se included wo
ou e p ime s (F3 and B3) and wo inne p ime s (FIP and BIP) o each Bo elia
genospecies. To educe he eac ion imes, we also designed wo loop p ime s (LF and LB)
o each species (Figu e 1). The p ime sequences a e shown in Table 1. All p ime s we e
syn hesized and HPLC-pu i ied by S abVida Lda, Po ugal.
Table 1 – LAMP p ime s designed a ge ing he ou B. bu gdo e i s.l. genospecies.
Genospecies
P ime s
Sequence
B. a zelii
Fo wa d Inne P ime (FIPBa)
5’-TTCATCTTGATTTGCTCCCACATG-
AACACACCAGCATCACTTTC-3’
Backwa d Inne P ime (BIPBa)
5’-AGCTAATGTTGCAAATCTTTTTGCT-
CTTCTTCTTGAGCACCCTC-3’
Fo wa d 3 (F3Ba)
5’-AGCTGAAGAGCTTGGAATG-3’
Backwa d 3 (B3Ba)
5’-TTGAGTAGGTGCTGTAGC-3’
Loop Fo wa d (LFBa)
5’-AGTCCAAGAAGCTTGAGATCCT-3’
Loop Backwa d (LBBa)
5’-GGAGCTCAAGCTGCTCAGGC-3’
B. bu gdo e i s.s.
Fo wa d Inne P ime (FIPBb)
5’- GGTTGCTCCAACATGAACTCTTAA-
AACACACCAGCATCACTTTC - 3’
Backwa d Inne P ime (BIPBb)
5’-GCAGCTAATGTTGCAAATCTTTT-
CTGAACACCCTCTTGAACCG-3’
Fo wa d 3 (F3Bb)
5’-AGCTGAAGAGCTTGGAATG-3’
Backwa d 3 (B3Bb)
5’-GTTGAGCTCCTTCCTGTT-3’
Loop Fo wa d (LFBb)
5’-CCAAGACGCTTGAGACCCT-3’
Loop Backwa d (LBBb)
5´-GAGGGAGCTCAAACTGCTCAGG-3´
B. ga inii
Fo wa d Inne P ime (FIPBg)
5’-TCACCAGAGAATAGATTTGCAA-
CATGAGCAAATCAAGATGAAGCG-3’
Backwa d Inne P ime (BIPBg)
5’-ACCTGTTCAAGAAGGAGCTCA-
AATTAACTCCACCCTGAGAA-3’
Fo wa d 3 (F3Bg)
5’-TCTTGGACCTTAAGAGTTCA-3’
Backwa d 3 (B3Bg)
5’-GATGTATTAGCGTCAACTGTG-3’
Loop Fo wa d (LFBg)
5’-TTAAGGTCCAAGAAGCTTGAGATC-3’
Loop Backwa d (LBBg)
5’-TCTGGTGAAGGAGCTCAGGCT-3’
B. lusi aniae
Fo wa d Inne P ime (FIPBl)
5’-ATCTTGATTTGCTCCCACATG-
AACTCACCAGCATCACTTTCAGG-3’
Backwa d Inne P ime (BIPBl)
5’-ATGTTGCAAATCTGTTTTCTGGT -
GGCTCCTTCTTGTTGAACAC-3’
Fo wa d 3 (F3Bl)
5’-AGCTTGGAATGCAACCTG-3’
Backwa d 3 (B3Bl)
5’-CTTGAGAAGGCGCTGTAG-3’
Loop Fo wa d (LFBl)
5’-CTCAAAGTCCAAGAAGCTTGAGAT-3’
Loop Backwa d (LBBl)
5’-GGGAGCTCAAGTTGCTCAGACTG-3’
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
237
Figu e 1 – Pa ial sequence o laB gene o B. lusi aniae, and loca ion o he complemen a y
egions used o design LAMP p ime s [F3, B3, FIP (F1c-F2), BIP (B1c-B2)], including loop
p ime s (LF, LB). A ows indica e he di ec ion o ex ension.
Op imiza ion o LAMP eac ion
Based on he ini ial condi ions o he LAMP eac ion adop ed om No omi e al., (2000),
h ee Mg2+ concen a ions (2 mM, 8mM, and 10 mM), h ee Bs DNA polyme ase
concen a ions (2.0 U, 4.0 U, and 8.0 U), wo concen a ion a ios be ween inne o ou e
p ime s (4:1 and 8:1) and wo be aine concen a ions (0.80 M and 1.0M) we e es ed in 10
µL eac ion mix u es, while he concen a ions o all he o he componen s emained
cons an . The empe a u e o LAMP eac ion was also op imized by es ing ou empe a u es
(66, 67, 68 and 69ºC), and also wo incuba ion pe iods (45 and 60 min). These condi ions
we e i s es ed only wi h B. lusi aniae LAMP assay, and a e op imiza ion he inal
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
238
condi ions we e applied o he emaining h ee LAMP assays a ge ing B. a zelii, B. ga inii
and B. bu gdo e i s.s..
Analy ical speci ici y and sensi i i y o LAMP assays
The speci ici y o he LAMP assays o de ec ing B. bu gdo e i s.l. DNA was de e mined
using genomic DNA o B. bu gdo e i s.s. (B31), B. a zelii (PGau), B. ga inii (PBi), and B.
lusi aniae (PoHL1) e e ence s ains, and DNA om o he mic oo ganisms namely o he
spi oche es like Lep ospi a in e ogans (Se o a Ic e ohaemo hagiae) and T eponema
pallidum; and o he ick-bo ne pa hogens like Theile ia sp. and Babesia sp..
The sensi i i y o LAMP eac ion was de e mined by using 10- old se ial dilu ions o DNA
ex ac ed om B. bu gdo e i s.l. cul u es, co esponding o 10 – 106 GE.
Nes ed-PCR p o ocols and eal- ime PCR
The se ial dilu ions o B. bu gdo e i s.l. cul u es we e also used o e alua e he sensi i i y
o wo nes ed-PCR p o ocols and one eal- ime PCR, in o de o compa e hem wi h he
sensi i i y o LAMP assays.
One o he nes ed-PCR a ge ed he in e genic space egion (IGS), loca ed be ween he 5S
and 23S RNA, using he 23SN1 and 23SC1 ex e nal p ime s (which ampli y a 320 bp DNA
agmen ), and he 23SN2 and 5SC inne p ime s (which ampli y a 280 bp DNA agmen ),
as desc ibed by Rijpkema e al., 1995. The second nes ed-PCR p o ocol used, a ge ed he
lagellin gene ( laB) (Wodecka e al., 2010). This included a i s ampli ica ion eac ion based
on he use o ou e p ime s 123 and 905 (which ampli y a 774 bp DNA agmen ), wi h a
second ampli ica ion s ep using he inne p ime s 220 and 824 (yielding an ampli ica ion
p oduc o 605 bp). PCR p o ocols we e done in a sepa a e e ical lamina low bench using
a di e en se o mic opipe es, o PCR use-only as well il e ed ips and s e ilized ma e ial
o ensu e a con amina ion- ee en i onmen . B. ga inii DNA was used as posi i e con ol and
ul apu e wa e as nega i e con ol. P oduc s we e de ec ed by elec opho esis in 1.5%

Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
239
aga ose gels s ained wi h G eenSa e P emium (NZYTech), and isualized unde UV ligh ,
using a Dolphin-1D Gel Image Analysis So wa e (Weal ec®) equipmen .
Rega ding he eal- ime PCR p o ocol, i consis ed in a duplex eac ion a ge ing he laB
gene o B.bu gdo e i s.l. and he in e nal con ol 18S DNA o ha d- ick samples. This
eal- ime PCR p o ocol was de eloped and op imized by ou labo a o y (da a submi ed).
The PCR eac ion was ca ied ou in a o al olume o 20 μl con aining 1× SensiFAST™
(Bioline), 0.3 μM o each p ime (F_Bbsl, R_Bbsl), 0.25 μM o each TaqMan p obe (P_Bbsl),
DNase ee wa e (Bioline) and 2 μl o he ex ac ed DNA empla e. The he mal cycling
condi ions we e: 1 cycle a 95 °C o 1 min, ollowed by 40 cycles a 95 °C o 10 s and 60
°C o 45 s. The mal cycling, luo escen da a collec ion, and da a analysis we e pe o med
in a 7500 Fas eal- ime PCR Sys em (Applied Biosys ems), acco ding o he manu ac u e ’s
ins uc ions.
LAMP p oduc de ec ion
LAMP eac ion was pe o med in a inal olume o 25 µl, con aining 1× LAMP bu e
(BioLabs®), 8 mM MgSO4, 1 M Be aine (Sigma®), 0.4 mM dNTP, 1.6 µM o FIP and BIP
p ime s, 0.2 µM o F3 and B3 p ime s, 0.4 µM o LF and LB p ime s, 8 U Bs 2.0 Wa mS a ®
DNA polyme ase (New England BioLabs® Inc., USA) and 2.5 µl o ex ac ed DNA. The
eac ion mix u e was incuba ed in an au oma ic he mocycle (Mycylce , BioRad) a 68ºC
o 45 min, and hen inac i a ed a 80 ºC o 5 min.
LAMP p oduc s we e de ec ed by: i) assessmen o u bidi y by he naked eye esul ing om
he magnesium py ophospha e (Mg2P2O7), p ecipi a ion (Figu e 2A); ii) colo change a
naked eye and unde UV by adding 1.0 μl o 1/10-dilu ed o iginal SYBR G een I
(In i ogen™), whe e samples ha u ned yellowish g een we e conside ed posi i e, while
hose emained o ange we e assumed o be nega i e (Figu e 2B1 and B2); iii) by UV
ansillumina ion (Dolphin-Doc Plus Gel Image sys em, Weal ec® equipmen ) in a 2.5%
aga ose gel ollowing elec opho esis in T is-Ace a e-EDTA (TAE) bu e s ained wi h 2μl
o G eenSa e P emium (NZYTech) (Figu e 2C).
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
240
Figu e 2 – LAMP p oduc s isualiza ion, by naked eye h ough he obse a ion o he
u bidi y (A), 1 and 2 - posi i e samples, 3 - nega i e con ol; by in e cala ing dyes like
SYBR-G een unde na u al ligh (B1) and UV ligh (B2), 1 and 2 - posi i e samples, 3
nega i e con ol; by elec opho esis in a 2.5% aga ose gel (C), 1,2 and 3 – posi i e samples,
4 – nega i e con ol.
La e al Flow De ice s ips
Fo de ec ion o LAMP p oduc s by LFD, he adequa e FITC-labeled p obe should be added
o he LAMP p oduc s. The p o ocol include a i s s ep o hyb idiza ion a 65 ºC o 5 min,
and hen 8 µl o he hyb idized p oduc is added o 100 µl assay bu e in a new ube. An
LFD s ip is dipped in o he mix u e o 2 min. Comme cial uni e sal LFD de ices o he
de ec ion o labelled LAMP p oduc s we e pu chased om Milenia Bio ec (Hyb iDe ec 2T)
and used acco ding o he ins uc ions o he manu ac u e .
S a is ical analysis
The esul s we e analyzed by he Chi-squa e es using BioEs a 5.0. A di e ence was
conside ed s a is ically signi ican a P < 0.05.
Resul s
Op imiza ion o LAMP eac ion
When he concen a ion o Mg2+ was e alua ed, we obse ed ha oge he wi h he inc ease
o he empe a u e om 66 o 69ºC, he bes concen a ion was 8 mM, since ha a 2 mM he
A
B2
B1
C
1
2
3
1
2
3
1
2
3
1 2 3 4
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
241
de ec ion limi o he eac ion dec eased and a 10 mM LAMP eac ion was inhibi ed.
Rega ding he a io o inne o ou e p ime s mo e in ense ladde -like bands we e ob ained a
he concen a ion a io 8:1 (Figu e 3A), also he ampli ica ion imp o ed ob iously as he
dosage o Bs DNA polyme ase inc eased om 2.0 U o 8.0 U, as e idenced by b igh e
bands on aga ose gels (Figu e 3B). F om he empe a u e and ime o eac ion a ia ion, he
de ec ion limi was g ea e wi h highe empe a u es (68ºC) and less ime o eac ion (45
min), since no unspeci ic esul s appea ed (Figu e 3C). The e o e he abo e esul s
demons a ed ha he op imized LAMP eac ion consis ed o using Mg2+ a a concen a ion
o 8 mM, he a io o inne o ou e p ime s a 8:1, and he concen a ion o Bs DNA
polyme ase a 8.0 U. Also, LAMP assay was easy o conduc , al hough some measu es
conce ning he p e en ion o con amina ion we e necessa y. P ecau ions such as changing
glo es be ween e e y LAMP assay and di e en wo k a eas o di e en pa s o he
expe imen we e aken in o accoun .
Figu e 3 – LAMP assay op imiza ion by es ing: di e en FIP/BIP and F3/B3 concen a ions
a io (A); di e en concen a ions o Bs polyme ase (B); and di e en empe a u es o
eac ion (C).
A
B
C
4x
8x
2U
4U
8U
68oC 66 oC 65 oC
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
242
Analy ical speci ici y o LAMP assay
LAMP eac ion speci ici y was e alua ed and esul s showed ha only he ou B. bu gdo e i
s.l. genospecies p oduced a ypical ladde o mul iple bands on he aga ose gel, while o he
DNA samples o nega i e con ol did no p oduce such bands. Howe e , when each LAMP
se was es ed wi h DNA om he espec i e B. bu gdo e i s.l. genospecies, he speci ici y
ob ained was no he expec ed, since each o he ou se s ampli ied no only he espec i e
B. bu gdo e i s.l. genospecies bu also one o mo e o he o he s B. bu gdo e i s.l.
genospecies. Fo example LAMP se o B. ga inii ampli ied B. ga inii DNA bu also B.
a zelii DNA, and LAMP se o B. lusi aniae ampli ied B. lusi aniae DNA bu also he o he s
h ee genospecies DNA, B. ga inii, B. bu gdo e i s.s. and B. a zelii. The e o e each LAMP
se was speci ic o B. bu gdo e i s.l. gene a bu no o each genospecies. This lack o
speci ici y led us o con inue he wo k wi h only he B. lusi aniae LAMP p ime s se since i
was able o ampli y DNA empla es o all ou genospecies. This way we decided o de elop
a LAMP assay a ge ing he ou o he mos p e alen species o B. bu gdo e i s.l. complex.
Analy ical sensi i i y
Since he e was no speci ici y o LAMP se s o each genospecies, he analy ical sensi i i y
o LAMP eac ion was e alua ed only wi h he B. lusi aniae p ime s se , since i ampli ied
he ou mos impo an genospecies. The esul s showed ha he de ec ion limi was 0.5
ng/µl  104 GE o B. a zelii, 2.5 ng/µl  103 GE o B. ga inii, 1 ng/µl  103 GE o B.
bu gdo e i s.s. and 2.5 pg/µl  102 GE o B. lusi aniae (Figu e 4).
Rega ding he nes ed-PCR p o ocol o laB gene, he de ec ion limi was 5 pg/µl 103 GE
o B. a zelii, 0.5 pg/µl  102 GE o B. lusi aniae, and 0.05 pg/µl  10 GE o B. bu gdo e i
s.s and B. ga inii. The nes ed-PCR p o ocol o IGS, p esen ed a de ec ion limi o 5 pg/µL
103 GE o B. a zelii, B. bu gdo e i s.s and B. ga inii, and 0.5 pg/µl 102 GE o B.
lusi aniae. These esul s sugges ha LAMP sensi i i y was simila o ha o he IGS a ge ed
nes ed-PCR p o ocol, excep o B. a zelii which was lowe .
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
249
Assous MV, Pos ic D, Paul G, Né o P and Ba an on G. (1993). Wes e n blo analysis o se a om
Lyme bo eliosis pa ien s acco ding o he genomic species o he Bo elia s ains used as an igens.
Eu opean Jou nal o Clinical Mic obiology & In ec ious diseases, 12(4): 261–8;
Baume JL and T an DH. (2015). La e al low de ices o de ec ing alle gens in ood. Handbook o
Food Alle gen De ec ion and Con ol, 219–228. doi:10.1533/9781782420217.2.219;
de Leeuw BH, Ma aha B, Hollemans L, e al. (2014). E alua ion o Bo elia eal ime PCR DNA
a ge ing OspA, FlaB and 5S–23S IGS and Bo elia 16S RNA RT-qPCR. Jou nal o Mic obiological
Me hods, 107: 41–46. doi: 10.1016/j.mime .2014.09.001;
Fallahi S, Maza ZA, Ghasemian M, e al. (2015). Challenging loop-media ed iso he mal
ampli ica ion (LAMP) echnique o molecula de ec ion o Toxoplasma gondii. Asian Paci ic
Jou nal o T opical Medicine, 8(5): 366–372. doi: 10.1016/S1995-7645(14)60345-X;
Gao C, Ding D, Wang J, e al. (2015). De elopmen o a LAMP assay o de ec ion o Leishmania
in an um in ec ion in dogs using conjunc i al swab samples. Pa asi es & Vec o s, 8: 370.
doi: 10.1186/s13071-015-0991-2;
Hin e sehe I, Gäbel G, Co inus F, e al. (2012). P esence o Bo elia bu gdo e i sensu la o
an ibodies in he se um o pa ien s wi h abdominal ao ic aneu ysms. Eu opean Jou nal o Clinical
Mic obiology & In ec ious Diseases , 31(5): 781–9. doi: 10.1007/s10096-011-1375-y;
Jung JH, Pa k BH, Oh SJ, e al. (2015). In eg a ed cen i ugal e e se ansc ip ase loop-media ed
iso he mal ampli ica ion mic ode ice o in luenza A i us de ec ion. Biosenso s and Bioelec onics,
68: 218–224. doi: 10.1039/c4lc01033g;
Kond usik M, G ygo czuk S, Sko a czak B, e al. (2007). Molecula and se ological diagnosis o
Bo elia bu gdo e i in ec ion among pa ien s wi h diagnosed E y hema mig ans. Annals o
Ag icul u al and En i onmen al Medicine : AAEM, 14(2): 209–213;
Kuma S, Nei M, Dudley J, e al. (2008). MEGA: A biologis -cen ic so wa e o e olu iona y
analysis o DNA and p o ein sequences. B ie ings in Bioin o ma ics, 9(4): 299–306. doi:
10.1093/bib/bbn017;
Liu ZY, Hao Q, Hou XX, e al. (2013). A s udy o he echnique o wes e n blo o diagnosis o lyme
disease caused by Bo elia a zelii in China. Biomedical and En i onmen al Sciences : BES, 26(3):
190–200. doi: 10.3967/0895-3988.2013.03.006;
Ma gos G, Vollme SA, Ogden NH e al. (2011). Popula ion gene ics, axonomy, phylogeny and
e olu ion o Bo elia bu gdo e i sensu la o. In ec ion, Gene ics and E olu ion, 11(7): 1545–1563.
doi: 10.1016/j.meegid.2011.07.022;
Mo i Y, Hi ano T and No omi T. (2006). Sequence speci ic isual de ec ion o LAMP eac ions by
addi ion o ca ionic polyme s. BMC bio echnology, 6: 3. doi: 10.1186/1472-6750-6-3;
Mo i Y, Kanda H and No omi T. (2013). Loop-media ed iso he mal ampli ica ion (LAMP): ecen
p og ess in esea ch and de elopmen . Jou nal o In ec ion and Chemo he apy, 19(3): 404–411. doi:
10.1007/s10156-013-0590-0;

Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
250
Mo i Y, Nagamine K, Tomi a N, e al. (2001). De ec ion o loop-media ed iso he mal ampli ica ion
eac ion by u bidi y de i ed om magnesium py ophospha e o ma ion. Biochemical and
Biophysical Resea ch Communica ions, 289(1): 150–154. doi:10.1006/bb c.2001.5921;
No e AC, Al es da Sil a A, Al es J, e al. (2015). The impo ance o liza ds and small mammals as
ese oi s o Bo elia lusi aniae in Po ugal. En i onmen al Mic obiology Repo s, 7(2): 188–193.
doi: 10.1111/1758-2229.12218;
No omi T. (2000). Loop-media ed iso he mal ampli ica ion o DNA. Nucleic Acids Resea ch, 28(12):
63e–63;
No omi T, Mo i Y, Tomi a N, e al. (2015). Loop-media ed iso he mal ampli ica ion (LAMP):
p inciple, ea u es, and u u e p ospec s. Jou nal o Mic obiology, 53(1): 1–5. doi: 10-1007/s12275-
015-4656-9;
No omi T, Okayama H, Masubuchi H, e al. (2000). Loop-media ed iso he mal ampli ica ion o DNA.
Nucleic Acids Resea ch, 28(12): E63. doi: 10.1093/na /28.12.e63;
Picken MM, Picken RN, Han D, e al. (1996). Single- ube nes ed polyme ase chain eac ion assay
based on Flagellin gene sequences o de ec ion o Bo elia bu gdo e i sensu la o. Eu opean Jou nal
o Clinical mMic obiology & In ec ious Diseases, 15(6): 489–98;
Pooja S, Sudesh D, Poonam K, e al. (2014). Loop-media ed iso he mal ampli ica ion (LAMP) based
de ec ion o bac e ia: A Re iew. A ican Jou nal o Bio echnology. 13(19): 1920–1928. doi:
10.1007/s00253-014-5531-z;
P iem S, Ri ig MG, Kam ad T, e al. (1997). An op imized PCR leads o apid and highly sensi i e
de ec ion o Bo elia bu gdo e i in pa ien s wi h Lyme bo eliosis. Jou nal o Clinical Mic obiology,
35(3): 685–90;
Rau e C, Oehme R, Di e ich I, e al. (2002). Dis ibu ion o clinically ele an Bo elia genospecies
in icks assessed by a no el, single- un, eal- ime PCR. Jou nal o Clinical Mic obiology. 40(1): 36–
43. doi: 10.1128/JCM.40.1.36-43.2002;
Rich e D, Schlee DB, Allgöwe R, e al. (2004). Rela ionships o a no el Lyme disease spi oche e,
Bo elia spielmani sp. no ., wi h i s hos s in Cen al Eu ope. Applied and En i onmen al
Mic obiology, 70: 6414–6419. doi: 10.1128/AEM.70.11.6414-6419.2004;
Rijpkema SGT, Molkenboe MJCH, Schouls LM, e al. (1995). Simul aneous de ec ion and
geno yping o h ee genomic g oups o Bo elia bu gdo e i sensu la o in Du ch Ixodes icinus icks
by cha ac e iza ion o he ampli ied in e genic space egion be ween 5S and 23S RNA genes.
Jou nal o Clinical Mic obiology, 33(12): 3091–3095;
Robe son J, Guy E, And ews N, e al. (2000). A Eu opean mul icen e s udy o immunoblo ing in
se odiagnosis o Lyme bo eliosis. Jou nal o Clinical Mic obiology, 38(6): 2097–2102;
Sajid M, Kawde AN and Daud M. (2015). Designs, o ma s and applica ions o la e al low assay: A
li e a u e e iew. Jou nal o Saudi Chemical Socie y, 19(6): 689–705.
doi:10.1016/j.jscs.2014.09.001;
Chap e 5
De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies
o imp o e Lyme disease diagnosis
251
Shih CM and Chao LL. (2002). Gene ic analysis o he ou e su ace p o ein C gene o Lyme disease
spi ochae es (Bo elia bu gdo e i sensu la o) isola ed om oden s in Taiwan. Jou nal o Medical
Mic obiology, 51(4): 318–325. doi: 10.1099/0022-1317-51-4-318;
S ee e AC, McHugh G, Damle N, e al. (2008). P ospec i e s udy o se ologic es s o Lyme disease.
Clinical In ec ious Diseases, 47(2): 188–195. doi:10.1086/589242;
S unzne D, Hubalek Z, Halouzka J, e al. (1998). P e alence o Bo elia bu gdo e i s.I. in Ixodes
icinus icks om S y ia (Aus ia) and species iden i ica ion by PCR-RFLP analysis. Zen albla ü
Bak e iologie, 288(4): 471–478;
Van Dam AP, Kuipe H, Vos K, e al. (1993). Di e en genospecies o Bo elia bu gdo e i a e
associa ed wi h dis inc clinical mani es a ions o Lyme bo eliosis. Clinical In ec ious Diseases,
17(4): 708–717. doi: 10.1093/clinids/17.4.708;
Wang DG, Wang Y, Xiao F, e al. (2015a). A compa ison o in-house eal- ime LAMP assays wi h a
comme cial assay o he de ec ion o pa hogenic bac e ia. Molecules, 20(6): 9487–9495. doi:
10.3390/molecules20069487;
Wang DG, B ews e JD, Paul M e al. (2015b). Two me hods o inc eased speci ici y and sensi i i y
in loop-media ed iso he mal ampli ica ion. Molecules, 20(4): 6048–6059. doi:
10.3390/molecules20046048;
Wang G, Ague o-Rosen eld A, Wo mse G e al. (2010). De ec ion o Bo elia bu gdo e i. Samuels
D and Radol J, edi o s. In: Bo elia. Molecula Biology, Hos In e ac ion, and Pa hogenesis. Cais e
Academic P ess, 279–298;
Wodecka B. (2011). laB gene as a molecula ma ke o dis inc iden i ica ion o Bo elia species
in en i onmen al samples by he PCR- es ic ion agmen leng h polymo phism me hod. Applied
and En i onmen al Mic obiology, 77(19): 7088–7092. doi: 10.1128/AEM.05437-11;
Wodecka B, Leońska A and Sko a czak B. (2010). A compa a i e analysis o molecula ma ke s o
he de ec ion and iden i ica ion o Bo elia spi ochae es in Ixodes icinus. Jou nal o Medical
Mic obiology, 59: 309–314. doi: 10.1099/jmm.0.013508-0;
Yang J, Guan G, Niu Q, e al. (2013). De elopmen and applica ion o a loop-media ed iso he mal
ampli ica ion assay o apid de ec ion o Bo elia bu gdo e i s. l. in icks. T ansbounda y and
Eme ging Diseases, 60(3): 238–44. doi: 10.1111/j.1865-1682.2012.01335.x;
Zhang LL, Hou XX, Geng Z, e al. (2015). Combina ion o Loop-Media ed Iso he mal Amplifica ion
Assay and Nes ed PCR o De ec ion o Bo elia bu gdo e i sensu la o in Human Se um Samples.
Biomedical and En i onmen al Sciences : BES, 28(4): 312–5. doi: 10.3967/bes2015.044;
Zhou D, Guo J, Xu L, e al. (2014). Es ablishmen and applica ion o a loop-media ed iso he mal
ampli ica ion (LAMP) sys em o de ec ion o c y1Ac ansgenic suga cane. Scien i ic Repo s, 4:
4912. Doi: 10-1038/s ep04912;
Chap e 6
Concluding ema ks and pe spec i es

Chap e 6
Concluding ema ks and pe spec i es
255
6. Concluding ema ks and pe spec i es
Lyme disease is inc easing apidly in many pa s o he wo ld and is he mos commonly
occu ing ec o -bo ne disease in Eu ope and he USA. In Po ugal, despi e LD has been
iden i ied wen y i e yea s ago, his zoonosis s ill emains unde diagnosed and
unde epo ed, being o en assigned by ou physicians as a pa hology only p esen in USA.
Mo eo e a gold s anda d es wi h s anda dized diagnos ic c i e ia o LD diagnosis, is no
ye es ablish, exis ing a a ie y o di ec and indi ec app oaches, mos o hem used
inco ec ly and inadequa e o he e olu ion s age o he disease. Thus, he s udies de eloped
in he p esen hesis aimed o con ibu e o:
 a bio-ecological cha ac e iza ion o he ixodo auna in nine dis ic s ac oss mainland
Po ugal, whe e he p esence o I. icinus icks we e p e iously epo ed, and o
de e mina e B. bu gdo e i s.l. in ec ion a e in he collec ed icks;
 a be e knowledge o he eco-epidemiology o B. bu gdo e i s.l. genospecies and
Relapsing Fe e Bo elia a he ec o and animal hos s le el;
 a mo e imp o ed molecula diagnosis o LD, by he de elopmen and e alua ion o
wo molecula ools namely a TaqMan eal- ime PCR algo i hm and a iso he mal
ampli ica ion p o ocol o he iden i ica ion o ou o he mos p e alen genospecies
o B. bu gdo e i s.l. in Po ugal.
In he cap u es ca ied ou in he nine dis ic s, se e al ick species we e possible o collec
om he ege a ion (n = 4251) as well as om he hos s (n = 2171). The mos widesp ead
ick species was R. sanguineus ega ding he ege a ion and he animal hos s, al hough we
could no co e all Po uguese dis ic s, an possible expansion o ick species in o new
egions was no iced namely D. e icula us in B aga dis ic and I. icinus in A ei o dis ic ,
since he e a e no eco ds o he p esence o hese species in he wo dis ic s. This ac may
ha e nume ous consequences, including modi ica ions in hei ecological cha ac e is ics,
impac s on he dynamic o local hos popula ions, and also impo an implica ions when
conside ing he ick-bo ne pa hogens ha could a ec humans and o he animal species. Also
Chap e 6
Concluding ema ks and pe spec i es
256
B. bu gdo e i s.l. in ec ion a e was i s ly de e mined by wo nes ed-PCR a ge ing he laB
gene and he in e genic space egion 5S-23S, being I. icinus nymphs he mo e in ec ed s age,
al hough, o he ick species we e also in ec ed by hese pa hogenic agen s.
The posi i e icks we e sequenced and he ick samples ha we e no iden i ied as B.
bu gdo e i s.l. species, we e subjec ed o wo o he PCR p o ocols a ge ing he glpQ gene,
and he 16S DNA gene. The sequencing esul s e ealed ha B. lusi aniae was he mos
p e alen species in I. icinus ick om Vila-Real, Lisboa, Se úbal and Fa o dis ic s.
Mo eo e , B. ga inii, B. bu gdo e i s.s., B. alaisiana and B. a zelii DNA we e also
iden i ied in se e al icks species a he han I. icinus, namely D. ma gina us om B aga
dis ic , R. sanguineus om B aga, Vila-Real, and É o a dis ic s and Hy. lusi anicum and
H. punc a a om Lisboa dis ic . These esul s con i m p e ious epo s indica ing a
coun ywide dis ibu ion o B. bu gdo e i s.l. genospecies in ques ing icks, being B.
lusi aniae he mos p e alen species a he ec o le el.
Unexpec edly, B. miyamo oi DNA was iden i ied o he i s ime in he coun y, in a
ques ing I. icinus nymph om Lisboa dis ic , al hough no human cases ha e been iden i ied
so a in he coun y, his species has been associa ed o human disease in o he s coun ies
om Eu ope. Despi e his species belongs o Relapsing Fe e Bo elia g oup, whose
spi oche es a e usually ansmi ed by so -body icks, B. miyamo oi has been ound in ha d-
body icks om Ame ica, Eu ope and Asia con inen s, mainly in Ixodes genus, e ealing an
ex ensi e geog aphic dis ibu ion. The e o e, u he s udies in ol ing mo e collec ions in
o he dis ic s a e needed, o be e unde s and he possible sp ead o B. miyamo oi in
Po ugal, con ibu ing o he de e mina ion o he human isk o exposu e o he ec o and
he bac e ia.
Addi ionally, DNA om wo possible new Relapsing Fe e like Bo elia species we e also
iden i ied, one in i e pools o ques ing la ae and one ques ing nymph o H. punc a a ick
om Lisboa dis ic , and he o he in wo ques ing R. sanguineus emales om B aga and
É o a dis ic s. By phylogene ic analysis o 16S RNA, laB and glpQ sequences, hese wo
no el species o m wo independen clus e s placed in a la ge subg oup o Relapsing Fe e
Bo elia ha included B. heile i, B. lones a i and a numbe o unclassi ied spi oche es. Due
Chap e 6
Concluding ema ks and pe spec i es
257
o he small numbe o posi i e samples i is no clea i hese bac e ia a e es ic ed o ick
species o o he a ea whe e hey ha e been ound, he e o e isola ion o hese spi oche es in
i o, hei cha ac e iza ion and he ole in human and e e ina y disease, will be he ocus in
a u u e esea ch, associa ed o a mo e widesp ead collec ion o icks ac oss he coun y.
Conce ning he icks collec ed om he hos s, i was possible o iden i y DNA om se e al
pa hogens, namely Anaplasma spp., Babesia spp., B. bu gdo e i s.l., Ce copi hi ila ia spp.,
Hepa ozoon spp., and Ricke sia spp., in icks collec ed om dogs and ca s ha belonged o
Gua da, Lisboa, Se úbal and Fa o dis ic s. Ri. massiliae DNA was ampli ied o he i s
ime in icks collec ed om ca s, al hough he e is no e idence ha i can cause illness o ha
he animal can play a ole in he ansmission o his bac e ium o humans. Also,
Ce copi hi ila ia spp. was de ec ed o he i s ime in a R. sanguineus collec ed om a dog.
Rega ding DNA om B. bu gdo e i s.l., i was possible o iden i y i in only one ick sample
om R. sanguineus species collec ed om a dog in Se úbal dis ic . This s udy was he i s
in he coun y ha e ealed he p esence o p o ozoa and nema odes wi h e e ina y medical
impo ance, in icks collec ed om domes ic animals, sugges ing a isk o eme gence o hese
ick-bo ne diseases in domes ic animals and in humans. Consequen ly, mo e s udies on hese
and o he ick-bo ne agen s should be pe o med in mo e dis ic s ac oss he coun y, o be e
unde s and i s epidemiological and clinical impo ance.
The s udies ega ding he esea ch o se e al ick-bo ne pa hogens in biological samples
collec ed om se e al wildli e hos s, e ealed o he i s ime he p esence o Anaplasma
spp. and Theile ia spp. DNA, among ed dee , allow dee and wild boa s in cen al/sou he n
Po ugal, howe e he abili y o Anaplasma pla ys, he species iden i ied in ed dee and wild
boa s, o cause disease in hese animals has no been es ablished ye . Also, B. a zelii DNA,
was iden i ied by he i s ime in se um samples om wild boa s om T ás-os-Mon es
egion, indica ing ha he wild boa hun ing dogs may ac as a link be ween he wild and he
domes ic Bo elia ansmission cycle, by ca ying icks in o he hun e ’s households,
exposing hem o a highe isk o ick-bo ne diseases.
These indings poin o he impo ance o wildli e hos s in main aining se e al ick-bo ne
pa hogens, ep esen ing a isk o e e ina y and human heal h, since he in e ac ion o
Chap e 6
Concluding ema ks and pe spec i es
258
di e en pa hogens wi hin he e eb a e hos migh lead o inc eased suscep ibili y o o he
in ec ions, o o modi ica ions o he pa hogenesis o each agen , esul ing in high isks o
wildli e and human heal h. The e o e, u he epidemiological s udies conce ning Bo elia,
Anaplasma and Theile ia species, in ec ing wild ungula es, a e equi ed o a p ope in ec ion
isk assessmen ac oss he coun y. This app oach is impo an o de elop u u e s a egies o
p e en ion and disease con ol oo ed in a mul idisciplina y app oach ha encompasses bo h
human and animal heal h.
Fo biological samples collec ed om domes ic animals such as dogs and ca s om he
sou he n egion o Po ugal, DNA om se e al eline and canine ec o -bo ne diseases
agen s we e iden i ied. Feline samples we e posi i e o Leishmania spp., Hepa ozoon spp.,
Babesia spp., Anaplasma spp./Eh lichia spp., Ba onella spp., and B. bu gdo e i s.l., while
he canine samples we e posi i e o Anaplasma spp./Eh lichia spp., B. bu gdo e i s.l.,
Hepa ozoon spp, and Leishmania in an um. The iden i ica ion o eline and canine ec o -
bo ne diseases agen s in domes ic animals om sou he n Po ugal, some o hem o zoono ic
conce n, ein o ces he impo ance o ale he e e ina y au ho i ies o he isk o
ansmission o hese ec o -bo ne agen s o o he e eb a e hos s, including humans. The
use o ec opa asi icides agains a h opods and educa ion and awa eness o he popula ion
mus be done, o p e en and a oid he dissemina ion o hese pa hogens o o he hos s.
Rega ding he s udies conce ning he de elopmen and op imiza ion o wo molecula
echniques o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i
s.l. in Po ugal, he wo-s ep mul iplex TaqMan eal- ime PCR assay a ge ing he laB locus,
p o ed o be an e icien me hod when sc eening o Bo elia in ec ion in ick samples, and
a p omising ool o ea ly diagnos ic pu poses on clinical samples. Mo eo e , he abili y o
de ec ou o he mos p e alen B. bu gdo e i s.l. genospecies in Eu ope, in a single- un is
a ime-sa ing ac o , besides he cos educ ion when compa ed wi h he con en ional PCR
and sequencing me hods. Conce ning he LAMP echnique some p oblems occu ed du ing
i s op imiza ion, since he designed p ime s we e no speci ic o each B. bu gdo e i s.l.
genospecies, bu only o he complex, and also he p esence o unspeci ic ampli ica ions a
he nega i e con ols le el. Fo a be e esul , his echnique will be enhanced in he u u e,