Unraveling of Borrelia burgdorferi sensu lato genospecies diversity in Portugal towards the development of more efficient diagnostic tools for Lyme disease

Un a eling o Bo elia bu gdo e i sensu la o genospecies di e si y in Po ugal owa ds he de elopmen o mo e e icien diagnos ic ools o Lyme disease Mónica Susana Claudino Nunes Decembe , 2016 Uni e sidade No a de Lisboa Ins i u o de Higiene e Medicina T opical Thesis p esen ed o ob ain he Ph.D. Deg ee in Biomedical Sciences, specializa ion Mic obiology Un a eling o Bo elia bu gdo e i sensu la o genospecies di e si y in Po ugal owa ds he de elopmen o mo e e icien diagnos ic ools o Lyme disease Au ho : Mónica Susana Claudino Nunes Supe iso : In es igado a Dou o a Ma ia Luísa Jo ge Viei a Co-supe iso s: P o essso Dou o An ónio Paulo Gou eia de Almeida P o esso Dou o João José Inácio Sil a Tu o ial Commission: In es igado a Dou o a Ma ia Luísa Jo ge Viei a P o esso Dou o Celso Vladimi o Fe ei a de Ab eu Cunha In es igado a Dou o a Ma ia So ia Cob a Lince Núncio Soa es Thesis p esen ed in ul illmen o he necessa y equi emen s o ob ain he Ph.D. deg ee in Biomedical Sciences, specializa ion Mic obiology Financial suppo o his wo k was p o ided by Fundação pa a a Ciência e a Tecnologia (FCT), h ough he schola ship SFRH/BD/78325/2011. Uni e sidade No a de Lisboa Ins i u o de Higiene e Medicina T opical Bibliog aphic elemen s Pape s in pee - e iewed in e na ional scien i ic jou nals di ec ly ela ed wi h he wo k p esen ed in his hesis: Pe ei a A, Pa ei a R, Nunes M, Casadinho A, Viei a ML, Campino L, Maia C. 2016. Molecula de ec ion o ick-bo ne-bac e ia and p o ozoa in ce ids and wild boa s om Po ugal, Pa asi es & Vec o s, 9: 251. Doi: 10.1186/s13071-016-1535-0; Nunes M, Pa ei a R, Maia C, Lopes N, Finge le V, Viei a ML. 2016. Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e -like Bo elia sp. In ec ion, Gene ics and E olu ion, 40: 266–274. Doi: 10.1016/j.meegid.2016.03.008; Nunes M, Pa ei a R, Lopes N, Maia C, Ca ei a T, Sousa C, Fa ia S, Viei a ML. 2015. Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om Po ugal. Vec o - Bo ne and Zoono ic Diseases, 15 (8): 515-517. Doi: 10.1089/ bz.2014.1765; Maia C, Almeida B, Coimb a M, Fe nandes MC, C i o ão JM, Ramos C, Ma ins A, Ma inho F, Sil a P, Ne es N, Nunes M, Viei a ML, Ca doso L, Campino L. 2015. Bac e ial and p o ozoal agen s o canine ec o -bo ne diseases in he blood o domes ic and s ay dogs om sou he n Po ugal. Pa asi es & Vec o s, 8 (138): 759. Doi: 10.1186/s13071-015-0759-8; Fa ia AS, Pai a-Ca doso MN, Nunes M, Ca ei a T, Vale-Gonçal es HM, Veloso O, Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2015. Fi s De ec ion o Bo elia bu gdo e i sensu la o DNA in Se um o he Wild Boa (Sus sc o a) in No he n Po ugal by Nes ed-PCR. EcoHeal h, 12(1): 183-187. Doi:10.1007/s10393-014-0973-4; Maia C, Ramos C, Coimb a M, Bas os F, Ma ins A, Pin o P, Nunes M, Viei a ML, Ca doso L, Campino L. 2014. Bac e ial and p o ozoal agen s o eline ec o -bo ne diseases in domes ic and s ay ca s om sou he n Po ugal. Pa asi e & Vec o s, 7 (115): 2 – 8. Doi: 10.1186/1756-3305-7-115; Maia C, Fe ei a A, Nunes M, Viei a ML, Campino L, Ca doso L. 2014. Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks om Po ugal. Ticks and Tick- bo ne Diseases, 5(4): 409-14. Doi: 10.1016/j. bdis.2014.01.009; Pape s in pee - e iewed in e na ional scien i ic jou nals di ec ly ela ed wi h he wo k p esen ed in his hesis (submi ed o in p epa a ion): Nunes M, Lopes N, Maia C, Almeida JP, Viei a ML. 2016. Cha ac e iza ion and dis ibu ion o ixodids in nine dis ic s o mainland Po ugal whe e I. icinus p esence was p e iously epo ed: Bo elia bu gdo e i s.l. p e alence (in submission); Nunes M, Ca ei a T, Inácio J, Viei a ML. 2016. De elopmen and e alua ion o a wo- s ep mul iplex TaqMan eal- ime PCR assay o de ec ion o Bo elia bu gdo e i s.l. genospecies (in submission); Nunes M, Nascimen o M, Ca ei a T, Inácio J, Viei a ML. 2016. De elopmen o a Loop Media ed Iso he mal Ampli ica ion (LAMP) assay o he de ec ion o Bo elia bu gdo e i s.l. genospecies DNA in ick samples (in p epa a ion). O he pape s published du ing he p epa a ion o his hesis: Pe ei a A, Figuei a L, Nunes M, Es e es A, Maia C, Co ão AJ, Viei a ML, Campino L, Pa ei a R. 2016. Mul iple phlebo i us (Bunya i idae) gene ic g oups de ec ed in Rhipicephalus, Hyalomma and De macen o icks om sou he n Po ugal. Ticks and Tick-bo ne Diseases, 8 (1):45-52. Doi: 10.1016/j. bdis.2016.09.015; Gonçal es DD, R Mou a RA, Nunes M, Ca ei a T, Vido o O, F ei as JC, Viei a ML. 2015. Bo elia bu gdo e i sensu la o in humans in a u al á ea o Pa ana S a e, B azil. B azilian Jou nal o Mic obiology, 46 (2): 571-575. Doi: 10.1590/S1517- 838246220140097; Gonçal es DD, Ca ei a T, Nunes M, Beni ez A, Lopes-Mo i FM, Vido o O, de F ei as JC, Viei a ML. 2014. Fi s eco d o Bo elia bu gdo e i B31 s ain in De macen o ni ens icks in he no he n egion o Pa ana (B azil). B azilian Jou nal o Mic obiology, 44(3): 883-7. Doi: 10.1590/S1517-83822013000300035; Co es S, Mau ício I, Kuhls K, Nunes M, Lopes C, Ma cos M, Ca doso L, Schonian G, Campino L. 2014. Gene ic di e si y e alua ion on Po uguese Leishmania in an um s ains by Mul ilocus Mic osa elli e Typing. In ec ion, Gene ics and E olu ion, 26: 20- 31. Doi: 10.1016/j.meegid.2014.04.023; Maia C, Nunes M, Ma ques M, Hen iques S, Rolão N, Campino L. 2013. In i o suscep ibili y o Leishmania in an um isola ed om humans and dogs. Expe imen al Pa asi ology, 135 (1): 36-41. Doi: doi: 10.1016/j.exppa a.2013.05.015. The wo k de eloped du ing his hesis was p esen ed in nine (9) o al communica ions and wel e (12) pos e s a na ional and in e na ional con e ences: O al communica ions Pe ei a A, Pa ei a R, Nunes M, Casadinho A, Viei a ML, Campino L, Maia C. 2016. Molecula de ec ion o ick-bo ne-bac e ia and p o ozoa in ce ids and wild boa s om Po ugal. XI In e na ional Symposium on Vec o -Bo ne Diseases. 9-13 Maio. Miami, Es ados Unidos da Amé ica. [OC las au ho ]; Nascimen o M, Nunes M, Viei a ML. 2015. “O imização de uma écnica de ampli icação iso é mica associada a sondas molecula es pa a iden i icação das espécies de Bo elia bu gdo e i sensu la o mais p e alen es em Po ugal”. 3º Cong esso Nacional de Medicina T opical / 1º Cong esso Lusó ono de Doenças T ansmi idas po Ve o es, IHMT/UNL, 20 e 21 Ab il, Lisboa. [OC 1s au o ]; Nunes M, Viei a ML, Inácio J, Nascimen o M, Pa ei a R. 2014. “O imização da écnica LAMP pa a a iden i icação de genoespécies de Bo elia bu gdo e i s.l.”. V Jo nadas Cien í icas do IHMT, 12 Dezemb o, IHMT/UNL, Lisboa. [OC 1s au o ]; Fa ia AS, Pai a-Ca doso M, Nunes M, Ca ei a T, Vale-Gonçal es HM, Veloso O, Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2014. “P imei a de eção de DNA de Bo elia bu gdo e i sensu la o em so o de ja ali”. VIII Jo nadas de Biologia da Uni e sidade de T ás-os-Mon es e Al o-Dou o, 22 e 23 de Ou ub o, Vila-Real. [OC 1s au o ]; Nunes M. 2014. “Iden i ica ion o Lyme Disease agen s in he Po uguese ixodo auna.” Semina : “A h opoda – Vec o s o human and animal Pa hogens: om epidemiology o con ol.” Faculdade de Medicina Ve e iná ia, Uni e sidade de Lisboa, 7 de Julho, Lisboa. [In i ed Speake ]; Maia C, Ramos C, Coimb a M, Bas os F, Ma ins A, Pin o P, Nunes M, Viei a ML, Ca doso L, Campino L. 2014. Bac e ial and p o ozoal agen s o eline ec o -bo ne diseases in domes ic and s ay ca s om sou he n Po ugal. IX In e na ional Symposium on Vec o -Bo ne Diseases, 22-25 Ma ço. Lisboa. [OC 1s au o ]; Nunes M, Lopes N, Ca ei a T, Almeida P, Inácio J, Viei a ML. 2013. “P esença dos agen es da Doença de Lyme na ixodo auna po uguesa: de e minação de axa de in eção”. IV Jo nadas Cien í icas do IHMT, 13 Dezemb o, Ins i u o de Higiene e Medicina T opical, Uni e sidade No a de Lisboa, Lisboa. [OC 1s au o ]; Nunes M, Lopes N, Inácio J, Viei a ML. 2013. “De elopmen o eal- ime PCR assays a ge ing he lagellin gene o he iden i ica ion o Bo elia bu gdo e i sensu la o genospecies”. Mic oBio ec’13, 6 – 8 Dezemb o, Uni e sidade de A ei o, A ei o ( lash p esen a ion). [OC 1s au o ]; Nunes M, Viei a ML. 2013. “Bo eliose de Lyme como zoonose eme gen e e seu impac e na saúde pública: a ealidade po uguesa”. Seminá io no âmbi o do Mes ado In eg ado em Medicina Ve e iná ia. 21 Maio, Uni e sidade de T ás-os-Mon es e Al o Dou o, Vila Real [In i ed Speake ]; Pos e s Nunes M, Pa ei a R, Ca ei a T, Viei a ML. 2015. “Molecula Iden i ica ion o wo Tick-bo ne Relapsing Fe e -like Bo elia sp. in ha d icks om Po ugal”. Mic obio ec’15, 10 a 12 Dezemb o, Uni e sidade de É o a; Nascimen o M, Nunes M, Viei a ML. 2015. “Op imiza ion o an iso he mal ampli ica ion echnique (LAMP) o he iden i ica ion o he majo species o Bo elia bu gdo e i s.l. in Po ugal”. Mic obio ec’15, 10 a 12 Dezemb o, Uni e sidade de É o a; Nunes M, Ca ei a T, Inácio J, Viei a ML. 2015. “De elopmen o a quad uplex eal- ime PCR o Bo elia bu gdo e i s.l. species iden i ica ion.” ICLB - 14 h In e na ional Con e ence on Lyme Bo eliosis and o he Tick-Bo ne Diseases, 27 a 30 Se emb o, Viena, Áus ia; Nunes M, Maia C, Ca ei a T, Almeida AP, Campino L, Viei a ML. 2015. “Doença de Lyme no sul de Po ugal: a aliação da elação en e hospedei os domés icos (caninos e elinos) e e o ”. 3º Cong esso Nacional de Medicina T opical / 1º Cong esso Lusó ono de Doenças T ansmi idas po Ve o es, IHMT/UNL, 20 e 21 Ab il, Lisboa; Nunes M, Lopes N, Ca ei a T, Maia C, Almeida AP, Viei a ML. 2014. “Fi s molecula de ec ion o human elapsing e e spi oche e Bo elia miyamo oi in Ixodes icinus om Po ugal”. IMED – in e na ional Mee ing on Eme ging Diseases and Su eillance, 31 Ou ub o a 3 No emb o, Viena, Aus ia; Nunes M, Lopes N, Maia C, Ca ei a T, Inácio J, Viei a ML. 2014. “P esence o Lyme disease agen s in he Po uguese ixodo auna: de elopmen o eal- ime PCR assays o he iden i ica ion o Bo elia bu gdo e i genospecies”. 24 h Eu opean Cong ess o Clinical Mic obiology and In ec ious Diseases, 10 a 13 Maio, Ba celona, Espanha. [e- pos e ]; Nunes M, Lopes N, Inácio J, Viei a ML. 2013. “De elopmen o eal- ime PCR assays a ge ing he lagellin gene o he iden i ica ion o Bo elia bu gdo e i sensu la o genospecies”. Mic oBio ec’13, 6 a 8 Dezemb o, Uni e sidade de A ei o, A ei o; Lopes N, Nunes M, Almeida AP, Viei a ML. 2013. “Wa ning: Ticks ale !!! Find ou which icks su ound us and hei ela ionship wi h Lyme Bo eliosis”. Mic oBio ec’13, 6 a 8 Dezemb o, Uni e sidade de A ei o, A ei o; Nunes M, Lopes N, Almeida AP, Viei a ML. 2013. “Find ou which icks su ound us and hei ela ionship wi h Lyme Bo eliosis”. Mic oBio ec’13, 6 a 8 Dezemb o, Uni e sidade de A ei o, A ei o; Fa ia AS, Pai a-Ca doso MN, Nunes MS, Ca ei a T, Vale-Gonçal es H, Veloso O, Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2013. “De eção de DNA de Bo elia bu gdo e i sensu la o em so o de Ja ali (sus sc o a) no no e de Po ugal po nes ed- PCR”. III Jo nadas de Saúde Pública, 2 de No emb o, Uni e sidade de T ás-os-Mon es e Al o-Dou o, Vila-Real; Fa ia AS, Pai a-Ca doso MN, Nunes MS, Ca ei a T, Vale-Gonçal es H, Veloso O, Coelho C, Cab al JA, Viei a-Pin o M, Viei a ML. 2013. “Pesquisa de DNA de Bo elia bu gdo e i sensu la o em ixodídeos pa asi as de Ja ali (sus sc o a) no no e de Po ugal po nes ed-PCR”. III Jo nadas de Saúde Pública, 2 de No emb o, Uni e sidade de T ás- os-Mon es e Al o-Dou o, Vila-Real; Nunes M, Lopes N, Inácio J, Almeida AP, Viei a ML. 2012. “A aliação da dis ibuição das genospécies de Bo elia bu gdo e i s.l. em Po ugal, a a és do desen ol imen o de no as écnicas molecula es”. III Jo nadas Cien í icas do IHMT, 12 Dezemb o, Ins i u o de Higiene e Medicina T opical, Uni e sidade No a de Lisboa, Lisboa. Resumo x Resumo Ixodídeos (ca aças de co po-du o), são impo an es e o es de agen es pa ogénicos, esponsá eis po doenças eme gen es como a doença de Lyme (DL). Es a zoonose é causada po espi oque as do complexo Bo elia bu gdo e i sensu la o (s.l.) ansmi idas po ca aças da espécie Ixodes icinus, o p incipal e o na Eu opa. A DL é uma doença mul isis émica com di e sas ap esen ações clínicas e diagnós ico complexo. Em Po ugal é ainda pouco diagnos icada e a no i icação, apesa de ob iga ó ia, é escassa. A p esen e in es igação e e como p incipal obje i o desen ol e e amen as molecula es, nomeadamen e um algo i mo de PCR em empo eal e uma ampli icação iso é mica, pa a iden i ica as espécies de B. bu gdo e i s.l. mais p e alen es em Po ugal. O desen ol imen o des e obje i o pe mi iu ambém a alia as ca ac e ís icas bioecológicas da ixodo auna p esen e em no e dis i os do país (no e, cen o e sul) nos quais o e o I. icinus ha ia sido an e io men e epo ado, e ainda de e mina a axa de in eção po B. bu gdo e i s.l. no e o e hospedei os. Os esul ados ob idos são ap esen ados sob a o ma de a igos cien í icos (dez), dos quais se e es ão publicados, dois em submissão e um em p epa ação. Do conjun o dos esul ados alcançados, impo a ealça as a iações obse adas na dis ibuição das ca aças pa a possi elmen e pa a no as egiões, p o a elmen e elacionadas com al e ações ao ní el da paisagem, clima e ege ação, às quais as ca aças são mui o sensí eis. Ac esce o ac o de á ias espécies de B. bu gdo e i s.l. e em sido de e adas em ca aças que não aquelas a é ago a econhecidas como e o es. A espécie B. lusi aniae oi a mais p e alen e no e o , es ando es e p esen e em seis dos no e dis i os selecionados. Su p eenden emen e no decu so des e es udo, iden i ica am-se ês espécies do complexo Bo elia eco en e em ca aças da ege ação, nomeadamen e, B. miyamo oi numa nin a I. icinus, e duas possí eis ‘no as’ espécies do complexo Bo elia eco en e em ca aças da espécie Haemaphysalis punc a a e Rhipicephalus sanguineus. Pa alelamen e, oi iden i icado DNA de B. bu gdo e i s.l. em amos as biológicas de animais de es imação (cães e ga os) e de animais sil á icos (ja alis), con i mando a impo ância des es animais, p incipalmen e os de es imação, enquan o sen inela pa a uma de eção p ecoce x i da DL, ajudando na de e minação do isco de ansmissão das espi oque as de B. bu gdo e i s.l. a humanos e ou os animais com impo ância económica (ex. bo inos), em á eas geog á icas es i as. Foi ambém possí el o imiza dois p o ocolos molecula es pa a o diagnós ico labo a o ial da DL, um dos quais, um algo i mo de PCR em empo eal que pe mi e a iden i icação de qua o das espécies de B. bu gdo e i s.l. mais p e alen es em Po ugal, ap esen ando ele ada sensibilidade e especi icidade e con ibuindo pa a um diagnós ico mais p eciso da DL. Alguns dos aspe os in oduzidos e explo ados nes a ese necessi am ainda de uma in es igação mais de alhada. No en an o, es e abalho ale a pa a a in odução de possí eis ‘no as’ espécies do complexo de Bo elia eco en e em ca aças de co po-du o da ege ação, cuja pa ogenicidade é ainda desconhecida, mas que pode ão o na -se um isco pa a a saúde pública; con ibui pa a a a ualização espacial de á eas impo an es na eco- epidemiologia da DL em Po ugal; e ino a no diagnós ico molecula des a zoonose, cons i uindo um alioso supo e pa a os clínicos, pe mi indo uma e apêu ica mais di ecionada dos doen es. Pala as-cha e: Eco-epidemiologia de B. bu gdo e i s.l., B. miyamo oi, ‘no as’ espécies de Bo elia do complexo da Feb e Reco en e; diagnós ico molecula da DL. Lis o abb e ia ions x ii Lis o Abb e ia ions ACA – Ac ode ma i is Ch onica A ophicans ARS – Adminis ação Regional de Saúde bDNA – b anched DNA bd gene – Bo elia di ec epea gene BmpA – laminin-binding p o ein BSK II – Ba bou –S oenne –Kelly-II medium BSK-H – Ba bou –S oenne –Kelly modi ied medium CDC – Cen e s o Disease Con ol and P e en ion CEVDI – Cen o de Vec o es e Doenças In ecciosas, INSA (= Cen e o Vec o s and In ec ious Diseases Resea ch, INSA) CL – Con ol Line CO2 – Ca bon dioxide COXII – Cy och ome c oxidase subuni II CSF – Ce eb ospinal Fluid CWD – Cell wall de icien DEET - N,N-die hl-me a- oluamide DGS –Di eção-Ge al de Saúde (=Di ec o a e-Gene al o Heal h) DL – d-loop dLAMP – Duplex LAMP DNA – Deoxy ibonucleic Acid D aI – Res ic ion enzyme om Deinococcus adiophilus Ds – Double-s anded EIA – Enzyme Immunoassay ELISA - Enzyme-Linked Immunoso ben Assay EM – E y hema mig ans EUCALB – Eu opean Conce ed Ac ion on Lyme Bo eliosis FDA – USA Food and D ug Adminis a ion Fe – I on FRET – Fluo escence Resonance Ene gy T ans e IDSA – In ec ious Diseases Socie y o Ame ica Lis o abb e ia ions x iii Lis o Abb e ia ions (Con .) IFA – Indi ec Immuno luo escence Assay IgG – Immunoglobulin G IgM – Immunoglobulin M INSA – Ins i u o Nacional de Saúde D . Rica do Jo ge (= Na ional Heal h Ins i u e Dou o Rica do Jo ge) LAMP – Loop-Media ed iso he mal Ampli ica ion LAR – Lymphangi is-Associa ed Ricke siosis LB – Lyme bo eliosis LCR – ligase chain eac ion LD – Lyme disease LFS – La e al Flow S ip LNB – Lyme neu obo eliosis LTV – Lisboa Tagus Valley MGB – Mino G oo e Binde MKP – Kelly–Pe enko e medium MLST – Mul ilocus Sequence Tying Mn – Manganese MseI – Res ic ion enzyme om Mic ococcus sp. NAATs – Nucleic Acid Ampli ica ion Tes s NIAID – Na ional Ins i u e o Alle gy and In ec ious Diseases Osp – Ou e su ace p o eins OspA – Ou e su ace p o ein A OspC – Ou e su ace p o ein C p66 gene – Bo elia bu gdo e i in eg in ligand gene PCR – Polyme ase Chain Reac ion qPCR – quan i a i e eal- ime PCR DNA – Ribossomal DNA RecA – Recombinase essen ial o he epai and main enance o DNA REP – Rep ile-associa ed Bo elia RF – Relapsing Fe e RFB – Relapsing Fe e Bo elia Lis o abb e ia ions xix Lis o Abb e ia ions (Con .) RFLP – Res ic ion F agmen Leng h Polymo phism RML – Rocky Moun ain Labo a o ies poB gene – RNA polyme ase gene RT – Re e se T ansc ip ase Salp15 – Soluble cys eine- ich ick sali a p o ein s.l. – sensu la o SNPs – Single Nucleo ide Polymo phisms s.s. – sensu s ic o STTT – S anda dized 2- ie es ing Taq – The mus aqua icus TBRF – Tick-Bo ne Relapsing Fe e Th1 – T-helpe ype 1 Th2 – T-helpe ype 2 TIBOLA – Tick-bo ne lymphadenopa hy TL – Tes Line TLRs – Toll-Like Recep o s TOT – T anso a ial T ansmission TROSPA – Tick Recep o o Ou e Su ace P o ein A USA – Uni ed S a es o Ame ica VlsE – Vmp ( a iable memb ane p o ein)-like sequence, Exp essed WB – Wes e n Blo WCS – Whole-Cell Sonica e WHO – Wo d Heal h O ganiza ion Table o con en s xxi Table o con en s Abs ac ……………………………………………………………………………….. xiii Resumo ………………………………………………………………………..………. x Lis o abb e ia ions ………………………………………………………………… x ii Table o con en s ……………………………………………………………….. xxi Index o Figu es ……………………………………………………………………… xxix Index o Tables ……………………………………………………………………….. xxx Chap e 1 - S a e o he a 1.1 – Lyme disease: his o ical e iew …………...……………………………... 3 1.2 – Bo elia spi oche es and Lyme Disease…...……………………………… 5 1.2.1 – Biology, Mo phology and G ow h ………..……………………..……. 5 1.2.2 – Classi ica ion and axonomy ………………………..………..………... 9 Relapsing Fe e Bo elia (RFB) complex ……………..….………………... 9 Rep ile-associa ed Bo elia (REP) complex …………..……………..……... 11 Bo elia bu gdo e i s.l. complex ……………………..…………….…….… 12 1.2.3 – Epidemiology and geog aphic dis ibu ion o LD..…………………... 13 Lyme disease in Po ugal ……………………….…...…….…………………. 18 1.3 – The ick ec o ………………………………………………………...……… 20 1.3.1 – Classi ica ion and axonomy …………………………...……………... 20 1.3.2 – Ha d- icks mo phology ………………………………..……………… 23 1.3.3 – Ha d- icks species in Po ugal ……………………..…………………. 24 1.3.4 – Geog aphic dis ibu ion o Ixodes ec o …………………………….. 27 1.3.5 – Li e cycle o I. icinus ec o ……………………………...………….. 29 Table o con en s xxii 1.3.6 – T ansmission and Pa hogenesis ………………………….…………… 31 1.4 – Rese oi s and hos s o Bo elia spi oche es ………………………..…... 35 1.4.1 - Companion animals and Lyme disease ………………………..……… 38 1.5 – Lyme disease clinical mani es a ions, diagnosis and ea men ………..… 40 1.5.1 – Human clinical mani es a ions …………………………...…………... 40 1.5.2 – Labo a o y diagnosis – Con en ional me hodologies …………….... 43 Di ec me hods ………………...……………………………………………… 45 Indi ec me hods ………………..……………………………………………. 49 1.5.3 – Molecula -based s a egies o he assessmen o he B. bu gdo e i s.l. species ……………………...……………………………………………… 51 DNA ampli ica ion-based assays …...………………………………………. 52 Iso he mal DNA ampli ica ion …………...…………………………………. 57 Immunoch oma og aphic assays …………...……………………………….. 60 1.5.4 – P e en ion, Con ol and T ea men …………...………………………. 62 1.6 – Objec i es and hesis plan …………………...……………………………… 65 1.7 – Re e ences ………………………………………………...…………………... 67 Chap e 2 - Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 2.1 – Cha ac e iza ion and dis ibu ion o ha d- icks in nine dis ic s o mainland Po ugal whe e I. icinus p esence was p e iously epo ed: Bo elia bu gdo e i s.l. p e alence ………...……………………………………... 93 Abs ac ……………………………………...………………………………….. 94 In oduc ion ………………………………...…………………………………... 95 Ma e ial and Me hods ……………………...…………………………………... 97 Table o con en s xxiii Resul s …………………………………...……………………………………… 104 Discussion ………………………………………………………………………. 122 Acknowledgemen s ……………………...…………………………………….. 128 Re e ences ………………………………...……………………………………. 129 Supplemen a y Da a ……………………...……………………………………. 135 Chap e 3 - Dis ibu ion and di e si y o Bo elia spi oche es and o he ick-bo ne agen s in ques ing and hos - icks 3.1 - Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e - like Bo elia sp. …………………………...………………………………………. 143 Abs ac ………………………………...……………………………………….. 143 In oduc ion …………………………...………………………………………... 143 Ma e ial and Me hods ………………...………………………………………... 144 Resul s …………………………………...……………………………………… 147 Discussion ………………………………...…………………………………….. 148 Acknowledgemen s ……………………...…………………………………….. 149 Re e ences ………………………………...……………………………………. 149 Supplemen a y Da a ……………………...……………………………………. 152 3.2 - Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om Po ugal ………………………...…………………………………………………… 161 Abs ac …………………...…………………………………………………….. 161 In oduc ion ……………...……………………………………………………... 161 Ma e ial and Me hods …...……………………………………………………... 161 Resul s ……………………...…………………………………………………… 162 Table o con en s xxi Discussion ………………………………………………………………………. 162 Acknowledgemen s ……….…………………………………………………… 163 Au ho Disclose S a emen ……...……………………………………………. 163 Re e ences …………………………...…………………………………………. 163 3.3 - Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks om Po ugal …….………………………………………………………………… 165 Abs ac …………………………...…………………………………………….. 165 In oduc ion ………………………...…………………………………………... 165 Ma e ial and Me hods ………………...………………………………………... 166 Resul s …………………………………...……………………………………… 167 Discussion ………………………………………………………………………. 167 Acknowledgemen s …………………...……………………………………….. 169 Re e ences ……………………………...………………………………………. 169 Chap e 4 - Dis ibu ion and di e si y o Bo elia spi oche es and o he ick-bo ne agen s in he hos s 4.1 - Molecula de ec ion o ick-bo ne bac e ia and p o ozoa in ce ids and wild boa s om Po ugal ………...…………….....…………………………. 175 Abs ac …………………………...…………………………………………….. 175 Backg ound ……………………...……………………………………………... 175 Me hods ………………………………...………………………………………. 176 Resul s …………………………...……………………………………………… 178 Discussion ………………………………………………………………………. 181 Conclusion ……………………………………...………………………………. 181 Compe ing in e es s ………………………...………………………………….. 181 Index o Figu es xxxi Figu e 7 - Ques ing ick species a e age densi y and s anda d de ia ion in Sou h egion du ing he wo yea s o collec ions, in sp ing and summe seasons ……... 119 Figu e 8 - Box-plo analysis depic ing he dis ibu ion o (A) H. punc a a, (B) Hy. lusi anicum and (C) I. icinus wi hin each egion. Y axis ep esen icks/min- collec o ……………………………..………………………………………………… 111 Figu e 9 - Box-plo analysis depic ing he densi ies o I. icinus in each o he su eyed seasons. Y axis ep esen icks/min-collec o …………………………… 112 Figu e 10 - Tick a e age densi y pe hos , o each collec ed species by season, yea and dis ic ……………………………………………………………………….. 114 Figu e 11 - Tick species a e age densi y and s anda d de ia ion pe hos in No h egion du ing he wo yea s o collec ions, in sp ing, summe , au umn and win e seasons ………………………………………………………………………… 116 Figu e 12 - Tick species a e age densi y and s anda d de ia ion pe hos in Lisboa and Tagus Valley egion du ing he wo yea s o collec ions, in sp ing, au umn and win e seasons …………...…………………………………………….. 117 Figu e 13 - Hos s ick species a e age densi y and s anda d de ia ion in Sou h egion du ing he wo yea s o collec ions, in sp ing, summe , au umn and win e seasons ……………….…………………………………….………………………….. 118 Figu e 14 - Box-plo analysis depic ing he dis ibu ion o o al ick densi y in A) each season and B) pe hos ype ……………..………………………………….. 119 Figu e 15 - Box-plo analysis demons a ing he dis ibu ion o A) I. icinus and B) R. sanguineus wi hin each egion ………………...……………………………… 120 Index o Figu es xxxii Chap e 3 3.1 - Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e -like Bo elia sp. Figu e 1 - Map o Po ugal showing he o al numbe o ha d icks collec ed by lagging pe dis ic s (B aga, Vila Real, A ei o, Lisboa, Se úbal, É o a and Fa o) …………………………………………………………………………………… 145 Figu e 2 - De ec ion o RFB (Relapsing Fe e Bo eliae) DNA in ex ac s p epa ed om ield-collec ed icks …………………..……………………………… 147 Figu e 3 - Phylogene ic analysis o Relapsing Fe e Bo elia laB (A), 16S RNA (B), and glpQ (C) sequences …………………………………………………. 147 Figu e 4 - glpQ and laB gene ic dis ance analysis calcula ed using he Tamu a- Nei as implemen ed in he Mega 6.0 so wa e ……………………………………… 148 Supplemen a y Figu e 1 - Comple e phylogene ic analysis o Relapsing Fe e Bo elia laB (A), 16S RNA (B), and glpQ (C) sequences (pa ial ees a e shown in Fig. 3) ……………………………………………………………………….. 152 Supplemen a y Figu e 2 - Maximum Clade P obabili y T ees based on he analysis o Relapsing Fe e Bo elia laB (A), 16S RNA (B), and glpQ (C) sequences ……………………………………………………………………………… 155 Supplemen a y Figu e 3 - Comple e phylogene ic analysis o Relapsing Fe e Bo elia 16S RNA (A) and laB (B), sequences wi h he in oduc ion o Lep ospi a in e ogans as an ou g oup ……………………...……………………… 158 3.2 - Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om Po ugal Figu e 1 - Phylogene ic analysis o Bo elia la nucleo ide sequences …..……… 163 3.3 - Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks om Po ugal Figu e 1 – Map o Po ugal depic ing he 4 dis ic s om whe e icks we e collec ed ……………………………………………………………………………….. 166 Index o Figu es xxxiii Chap e 4 4.1 – Molecula de ec ion o ick-bo ne bac e ia and p o ozoa in ce ids and wild boa s om Po ugal Figu e 1 - Phylogene ic ee o Anaplasma spp. based on he analysis o msp4 sequences ……………………………………………………………………………… 178 Figu e 2 - Phylogene ic ee o Theile ia spp. based on 18S RNA gene sequences ……………………………………………………………………………… 179 4.2 - Fi s De ec ion o Bo elia bu gdo e i sensu la o DNA in Se um o he Wild Boa (Sus sc o a) in No he n Po ugal by Nes ed-PCR Figu e 1 - (a) - DNA ampli ica ion esul s o wild boa se um samples ob ained by nes ed-PCR analysis a ge ing he la gene; (b) - Geog aphical dis ibu ion o he hun s ( illed ci cle) a ended du ing he 2011/2012 wild boa hun ing season in he T ás-os-Mon es egion (No he n Po ugal) and he numbe o wild boa s sho in each hun ……………………………...………………………………………. 187 Chap e 5 5.1 – De elopmen and e alua ion o a wo-s ep mul iplex TaqMan eal- ime PCR assay o de ec ion o Bo elia bu gdo e i s.l. genospecies Figu e 1 - Rep esen a ion o he eal- ime PCR algo i hm o iden i ica ion o B. bu gdo e i s.l. genospecies …………………………………….……………… 216 Figu e 2 - Illus a ion o he duplex eal- ime PCR ampli ica ion cu e ob ained o each DNA concen a ion …………………………………………...……………. 220 Figu e 3 - Illus a ion o he e aplex eal- ime PCR ampli ica ion cu es ob ained o each p obe indi idually (A, B, C and D) and in e aplex (E) o each DNA concen a ion …………………………..………………………………… 221 5.2 - De elopmen o a Loop Media ed Iso he mal Ampli ica ion (LAMP) assay o he de ec ion o Bo elia bu gdo e i s.l. genospecies DNA in ick samples Index o Figu es xxxi Figu e 1 - Pa ial sequence o laB gene o B. lusi aniae, and loca ion o he complemen a y egions used o design LAMP p ime s [F3, B3, FIP (F1c-F2), BIP (B1c-B2)], including loop p ime s (LF, LB) ……………………………..…… 237 Figu e 2 - LAMP p oduc s isualiza ion …………………………………………… 240 Figu e 3 - LAMP assay op imiza ion by es ing: di e en FIP/BIP and F3/B3 concen a ions a io (A); di e en concen a ions o Bs polyme ase (B); and di e en empe a u es o eac ion (C) ………………………………………………. 241 Figu e 4 - Sensi i i y op imiza ion o LAMP assay wi h he B. lusi aniae p ime s se o he ou B. bu gdo e i s.l. genospecies DNA se ial dilu ions, and isualiza ion o ampli ica ion p oduc s by naked eye, by adding SYBR-G een unde na u al and UV ligh , and by elec opho esis in aga ose gel ………..……… 243 Index o Tables xxx Index o Tables Chap e 1 Table 1 - Relapsing Fe e Bo elia species, geog aphic dis ibu ion and i s epo 10 Table 2 - Bo elia bu gdo e i s.l. species, geog aphic dis ibu ion and i s epo 13 Table 3 - Mo e impo an biologic cha ac e is ics o icks …...……………………… 22 Table 4 - Ha d- icks gene a, espec i e species p esen in Po ugal …………...……. 25 Table 5 - E iologic agen s ansmi ed by Ixodids p esen , o a eme ging isk, in Po ugal …………………………………………………………...……………………… 26 Table 6 - The h ee s ages o Lyme disease and examples o some clinical mani es a ions …………………………………………………………………………… 42 Table 7 - Case de ini ion om Cen e s o Disease Con ol and P e en ion (CDC), o su eillance pu pose …………..…………………………………………………….. 44 Chap e 2 Table 1 - Cha ac e iza ion o each su eyed dis ic ega ding he a ea, clima e and coun ies ………………………………………...………………………………………… 99 Table 2 - To al ques ing ick species by s age collec ed in each dis ic ……………. 106 Table 3 - To al icks collec ed on hos s, pe ick species and s age, collec ed in each dis ic ………………………………………………………………………………. 115 Table 4 - Bo elia bu gdo e i s.l. in ec ion a e in ques ing icks om he h ee su eyed egions (No h, LTV and Sou h) …………………………………………….. 121 Table 5 - Bo elia bu gdo e i s.l. in ec ion a e in icks collec ed om he hos s in he wo su eyed egions (LTV and Sou h) ………………………………………… 122 Index o Tables xxx i Chap e 3 3.1 - Molecula iden i ica ion o Bo elia genus in ques ing ha d icks om Po ugal: phylogene ic cha ac e iza ion o wo no el Relapsing Fe e -like Bo elia sp.. Table 1 - Species, s age, gende and numbe o collec ed icks, analyzed o he p esence o B. bu gdo e i s.l. and Relapsing Fe e Bo elia (RFB) spi oche es DNA ……………………………………………………………………………………… 146 Table 2 - P ime s used in his s udy o he speci ic analysis o Relapsing Fe e Bo elia ………………………………………………………………………………… 146 3.2 - Molecula iden i ica ion o Bo elia miyamo oi in Ixodes icinus om Po ugal Table 1 - Dis ic , s age and numbe o Ixodes icinus icks collec ed in Po ugal analyzed o he p esence o Bo elia miyamo oi and B. bu gdo e i sensu la o …… 162 3.3 - Molecula de ec ion o bac e ial and pa asi ic pa hogens in ha d icks om Po ugal Table 1 - P ime se s and PCR condi ions o DNA ampli ica ion and sequencing o pa hogens in icks …………………………………………………………………….. 167 Table 2 - Numbe s o icks collec ed in he dis ic s o Gua da, Lisboa, Se úbal and Fa o ………………………………………………………………………………… 168 Table 3 - Pa hogens de ec ed by PCR and DNA sequencing in icks om Po ugal acco ding o geog aphic egion and e eb a e hos , wi h DNA Da a Bank o Japan (DDBJ) accession numbe s ……………………………………………………………. 168 Index o Tables xxx ii Chap e 4 4.1 – Molecula de ec ion o ick-bo ne bac e ia and p o ozoa in ce ids and wild boa s om Po ugal Table 1 - Sequences o he oligonucleo ide p ime s used ………………………...…. 177 Table 2 - P e alence o ick-bo ne pa hogens as de ec ed by PCR in 76 ce ids and 65 wild boa s om Cen e and sou he n Po ugal ……………...………………… 180 4.3 – Bac e ial and p o ozoal agen s o canine ec o -bo ne diseases in he blood o domes ic and s ay dogs om sou he n Po ugal Table 1 - P e alence o ec o -bo ne pa hogen species, gende o complex as de ec ed by PCR in 1,010 dogs om sou he n Po ugal ……………………………… 193 Table 2 - P ime s se s o PCR ampli ica ion o CVBD agen s …………………… 194 Table 3 - Single and mixed PCR-posi i i y o species, gene a and/o complex o CVBD agen s in 1,010 dogs om sou he n Po ugal ………………………………... 194 4.4 - Bac e ial and p o ozoal agen s o eline ec o -bo ne diseases in domes ic and s ay ca s om sou he n Po ugal Table 1 - Compa ison o p e alence o FVBD pa hogens in di e en g oups o ca s om sou he n Po ugal …………………………………………………………… 201 Table 2 - P ime se s o PCR ampli ica ion o FVBD agen s ………………………. 202 Table 3 - Single and mixed PCR-posi i i y o gene a (Anaplasma/Eh lichia, Babesia, Ba onella, Hepa ozoon and Leishmania) and/o complex (B. bu gdo e i s.l.) o FVBD agen s in 649 ca s om sou he n Po ugal …………………………….. 203 Index o Tables xxx iii Chap e 5 5.1 - De elopmen and e alua ion o a wo-s ep mul iplex TaqMan eal- ime PCR assay o de ec ion o Bo elia bu gdo e i s.l. genospecies Table 1 - Sequences o p ime s and p obes designed in his s udy …………………. 215 Table 2 - Compa ison o duplex and e aplex eal- ime PCR’s posi i e samples wi h esul s om p e ious sequencing o ick samples ……………………………… 223 5.2 - De elopmen o a Loop Media ed Iso he mal Ampli ica ion (LAMP) assay o he de ec ion o Bo elia bu gdo e i s.l. genospecies DNA in ick samples Table 1 - LAMP p ime s designed a ge ing he ou B. bu gdo e i s.l. genospecies ……………………………………………………………………………… 236 Table 2 - Sensi i i ies ob ained o he de ec ion o B. bu gdo e i s.l. genospecies wi h di e en molecula app oaches ………………………………………………… 244 Chap e 1 S a e o he a Chap e 1 S a e o he a 9 1.2.2 – Classi ica ion and axonomy The spi oche es a e one o he ew majo bac e ial g oups whose na u al phylogene ic ela ionships a e e iden a he le el o g oss pheno ypic cha ac e is ics (Wang e al., 1999). These o ganisms belongs o Spi ochae es phylum con aining only Spi ochae es class ha comp ises a single o de Spi ochae ales. This o de includes h ee amilies: B achyspi aceae, Lep ospi aceae and Spi ochae eceae (Ka ami, 2012), whe e he Spi ochae eceae amily comp ises Bo elia and T eponema genus, his las esponsible o syphilis, a sexually ansmi ed disease (Wang e al., 1999; Heymann & Ellis, 2012; Ka ami, 2012). The genus Bo elia ep esen s a igh phylogene ic clus e , which is di e en ia ed om o he spi oche al phylogene ic g oups by base signa u e analysis o s gene (Wang e al., 1999). Mo e han 30 species ha e been iden i ied wi hin he genus so a (Bap is a, 2006; No is, 2012). These Bo elia species, based on he di e ences be ween hei ecological and gene ic cha ac e is ics (Ba bou & Hayes, 1986), a e usually ca ego ized in o h ee majo ca ego ies, he elapsing- e e bo eliae, whose membe s cause elapsing e e wo ldwide; he LB bo eliae, whose membe s cause Lyme disease h oughou he No he n Hemisphe e, and he ep ile-associa ed bo eliae, whose membe s in ec ep iles bu a e no known o cause disease in humans (Huang e al., 2015).  Relapsing Fe e Bo elia (RFB) complex The Relapsing Fe e (RF) complex includes species mos ly ound in so icks belonging o he A gasidae amily, conside ed apid- eeding icks whe e hei bi es may go unno iced. Howe e , RF has also been epo ed in se e al ha d icks (ixodids), and in lice. The axonomic posi ion o RF spi oche es is a ma e o con o e sy, since some s udies ha e sugges ed phylogene ic clus e ing based on geog aphic di e ences (Old Wo ld e sus New Wo ld), and o he s udies ound RF spi oche es in ha d icks, (including B. miyamo oi, B. heile i, and B. lones a i), which clus e ed oge he phylogene ically sugges ing his o be a sepa a e g oup wi hin he RF complex (Ba bou e al., 2009; (McCoy e al., 2014; Cu le 2015; Nunes e al., 2015). The e a e now a leas 23 alida ed Chap e 1 S a e o he a 10 RF Bo elia species (Mo ais e al., 2007), al hough o he s a e wai ing su icien da a o achie e such s a us (Table 1). Table 1 - Relapsing Fe e Bo elia species: geog aphic dis ibu ion and i s epo . RF Bo elia species Geog aphic dis ibu ion Re e ence B. anse ina Wo ldwide Sakha o , 1891 B. bal aza dii I an Ka imi e al., 1983 B. b asiliensis B azil Da is, 1952 B. caucasica Russia Kandelaki, 1945 B. co iaceae USA Jonhson e al., 1987 B. c ocidu ae Wes A ica Lege , 1971 B. dugesii Mexico Mazzo ii, 1949 B. du onii A ica (Cen al Eas e n) No y & Knapp, 1906 B. g ainge i Eas A ica Heisch, 1953 B. ha eyi Eas A ica Ga nham, 1947 B. he msii Canada, Wes e n USA Da is, 1942 B. hispanica Alge ia, Mo occo, Po ugal Spain, Tunisia de Buen, 1926 B. japonica Japan Kawaba a e al., 1994 B. la yschewii Cen al Asia, I an, I aq So ie , 1941 B. mazzo ii Sou he n USA, Mexico, Gua emala Da is, 1956 B. me ionesi No h A ica Blanc & Mau ice, 1948 B. mic o i A ica, I an Smi h & Kilbo ne, 1893 B. miyamo oi Japan Fukunaga e al., 1995 B. pa ke i Wes e n USA Da is, 1942 B. pe sica Asia, Middles Eas Dschunkowsky, 1913 B. sinica China Masuzawa e al., 2001 B. anukii Japan Fukunaga e al., 1997 B. heile i Ame ica, A ica, Aus alia, Eu ope La e an, 1903 B. illae Cape Ve de Zump & O gan 1961 B. u ica ae USA, Mexico B ump , 1933 B. enezuelensis Cen al & Sou h Ame ica B ump , 1921 B. ecu en is Wo ldwide Lebe , 1874 Chap e 1 S a e o he a 11 Howe e , a leas wo ca ego ies o RF a e known o a ec humans: i) he louse-bo ne elapsing e e (also known as u ban o epidemic RF) caused by B. ecu en is, and ansmi ed by he body louse Pediculus humanus humanus. His o ically, massi e ou b eaks ha e occu ed in Eu asia and A ica, especially du ing wa ime, when people we e highly pa asi ized wi h body lice (Ba bou & Hayes, 1986). Cu en ly, he disease is ound only in E hiopia and neighbo ing coun ies (Cu le 2010); ii) and he ick-bo ne elapsing e e caused by Bo elia species ansmi ed by in ec ed so icks o he genus O ni hodo os, like o example B. hispanica ansmi ed by O. e a icus, and ound p ima ily in A ica, Spain, Saudi A abia, Asia, and ce ain a eas o Canada and he wes e n Uni ed S a es (Cu le 2015, Palma e al., 2012). In he las yea s, se e al no el species ha e been desc ibed, including B. myumii in icks om Tanzania (Mi ani e al., 2004), B. mic o i and o he species om I an (Nadda e al., 2015), B. u ica ae-like in ba icks om he Uni ed S a es (Schwan e al., 2009), and as o ye unnamed species om penguins in Sou h A ica (Yabsley e al., 2012), al hough he species s a us and po en ial i ulence o hese agen s o humans emain unknown.  Rep ile-associa ed Bo elia (REP) complex The epidemiologic ole o ep iles has ecei ed inc easing a en ion, in he las yea s, mainly due o he in e na ional pe ade o animals o igina ing om he wilde ness (Bu idge, 2011). F equen ly, he impo ed ep iles a e ha bo ing a ious ick species ha acili a e he in oduc ion o nonna i e ick-bo ne pa hogens, hus signi ican ly inc easing he isk o public heal h (Bu idge, 2011). Va ious eme ging and/o zoono ic pa hogens ha e been isola ed and cha ac e ized om ep iles o hei associa ed icks (Takano e al., 2010; Pas iu e al., 2012). The ep ile-associa ed Bo elia spp (REP) ha e been ecen ly disco e ed in ep iles and hei associa ed ha d icks, gene a Amblyomma and Hyalomma (Takano e al., 2010). B. u cica, a membe o he REP bo eliae g oup, was desc ibed in Hyalomma aegyp ium icks ela ed wi h Medi e anean o oises in Tu key (Gune , 2004). B. u cica has been Chap e 1 S a e o he a 12 demons a ed o o m a dis inc monophyle ic g oup showing a ela ionship wi h bo h RF and LB g oups. Rep ile-associa ed Bo elia (Bo elia sp.) spi oche es we e also isola ed om Amblyomma geoemydae icks and hey clus e ed wi h RFB based on ano he phylogene ic analysis (Takano e al., 2011). The na u al cycle o Tick-Bo ne Relapsing Fe e (TBRF) spi oche es in ol e a di e si y o small mammals and hei ick ec o s (Schwan e al., 2012). They a e a neglec ed cause o zoono ic diseases which can esul in illness and e en dea h o he hos s (Kalma e al., 2015).  Bo elia bu gdo e i s.l. complex Ul as uc u e o B. bu gdo e i has been he subjec o se e al in es iga ions in he USA and Eu ope, i s desc ip ion a ies, di e ences in mo phological c i e ia, such as end shape and he numbe o endo lagella, among isola es o di e se o igins ha e led o he specula ion ha addi ional spi oche al species may be in ol e in e iology o LD (Hayes & Bu gdo e , 1993). A majo e o has been done o analyze he pheno ypic and geno ypic di e si y o B. bu gdo e i isola es, using Polyme ase Chain Reac ion (PCR) echniques, a ge ing 16S and 23S ibosomal DNA, lagellin, Ou e su ace p o ein A (OspA), and Bo elia di ec epea (bd ) genes, as well as in e genic space s (Guy & S anek, 1991; Johnson e al., 1992; Pos ic e al., 1994; Le Fleche e al., 1997; Rijpke na e al., 1997; Iye e al., 2003). I is now appa en ha B. bu gdo e i is gene ically di e se, and belongs o a B. bu gdo e i s.l. genospecies complex composed o 20 di e en species (Ružić-Sabljić & Ce a , 2016), (Table 2). E olu iona y changes, mu a ion, gene ic d i , mig a ion, and na u al selec ion c ea ed mac o e olu iona y di e gence o species. The p e ailing da a sugges ha B. bu gdo e i s.l. was once a wide- anging species in he No he n Hemisphe e ha apidly sepa a ed in o he cu en known species (Dykhuizen & B isson, 2010). Chap e 1 S a e o he a 13 Table 2 – Bo elia bu gdo e i s.l. species: geog aphic dis ibu ion and i s epo . No e: he unde line species ha e been ound in/o isola ed om human pa ien s, while he o he s species ha e no been associa ed o humans. 1.2.3 – Epidemiology and geog aphic dis ibu ion o LD Lyme disease is he wo ld's as es g owing ec o -bo ne zoono ic disease wi h cases epo ed in o e 60 coun ies and endemic oci in No h Ame ica, Eu ope, and Asia (WHO, 2013). I occu s no mally in empe a e a eas, wi h he ideal clima e and gene al condi ions o he su i al and main enance o he ec o li e cycle in ol ed in B. bu gdo e i s.l. species ansmission. B. bu gdo e i s.l. species Geog aphic dis ibu ion Re e ence B. bu gdo e i s.s. USA; Eu asia Johnson e al., 1984 B. ga inii Eu asia Ba an on e al., 1992 B. a zelii Eu asia Canica e al., 1993 B. japonica Japan Kawaba a e al., 1993 B. ande sonii USA Ma coni e al., 1995 B. anukii Japan Fukunaga e al., 1996 B. u di Japan Fukunaga e al., 1996 B. alaisiana Eu asia Wang e al., 1997 B. lusi aniae Eu ope, USA Le Fleche e al., 1997 B. bisse ii USA Pos ic, 1998 B. sinica China Masuzawa e al.,2001 B. spielmanii Eu ope Rich e e al., 2004 B. cali o niensis USA Pos ic e al., 2007 B. Yang zee China Chu e al., 2008 B. ame icana USA Rudenko e al., 2009 B. ba a iensis Eu ope Ma gos e al., 2009 B. ca olinensis USA Rudenko e al., 2010 B. ku enbachii USA, Eu ope (?) Ma gos e al., 2010 B. inlandensis Eu ope Casjens e al., 2011 B. chilensis Chile I ano a e al., 2014 Chap e 1 S a e o he a 14 The geog aphic dis ibu ion o LD is inc easing, esul ing in a signi ican isk, o public heal h (Rizzoli e al., 2011). The no heas e n Uni ed S a es is adi ionally de ined as he endemic global egion o LD and he public heal h isk is highes in his a ea, whe e annually abou 16 000 o 25 000 new cases occu (Figu e 4). Howe e , he CDC es ima es ha only 10% o LD cases a e being eco ded which ansla es in o app oxima ely 300,000 es ima ed cases in he Uni ed S a es each yea , only be ween 1995 and 2013 Lyme cases has inc eased abou 130% om 11.700 o 27.200 (CDC). Figu e 4 - G aphical ep esen a ion o Lyme disease con i med and p obable annual cases in USA, om 1995 o 2014. (Sou ce: h p://www.cdc.go /lyme/s a s/g aphs.h ml). A majo i y (95 %) ha e been concen a ed in he no heas , ye cases ha e been epo ed in e e y s a e and in many coun ies a ound he wo ld and hei geospa ial analysis e eals ha LD has ex ended well beyond adi ionally de ined endemic a eas (CDC, 2014; Diuk- Wasse e al., 2012). Lyme disease a es ha e been inc easing exponen ially a he global scale while in he Uni ed S a es i has become he main human ec o -bo ne disease (Abbo , 2006; Piesman & Eisen, 2008). This inc ease is due o a a ie y o in luences like clima e change esul ing in he expansion o he Ixodes ick e i o y including expansion o highe ele a ions, changes in small mammals and dee popula ions, changes Chap e 1 S a e o he a 15 in de o es a ion and de elopmen , and imp o ed epo ing and awa e (Lindg en e al., 2000; Qiu e al., 2008; G ay e al., 2009; Gilbe e al., 2014). LD can also be ound h oughou Eu ope, Russia, and Asia (Figu e 5). The highes epo ed equencies o he disease a e in cen al Eu ope and Scandina ia, pa icula ly in Ge many, Aus ia, Slo enia, he Bal ic coas line o Sweden, and some Es onian and Finnish islands, whe e epo ed incidence a es a e g ea e han 100 cases pe 100,000 inhabi an s (Lindg en & Jaenson, 2006; Rizzoli e al., 2011). Se op e alence s udies conduc ed in indi idual coun ies in ecen yea s, including Ge many, Denma k, and Sweden, ha e ypically ound posi i e a es less han 10%, al hough a es as high as 47.9% we e eco ded in high- isk g oups (e.g., a me s and o es y wo ke s) in Poland (Lindg en & Jaenson, 2006; Dessau e al., 2010; Dehne e al., 2012). Figu e 5 - Wo ld dis ibu ion o Lyme disease. In ed a e indica ed he “ho zones”. (Sou ce: Wo ld Heal h O ganiza ion). In Eu ope se e al species o B. bu gdo e i s.l. complex ha e been iden i ied being LD mos ly associa ed o one o h ee species: B. bu gdo e i s.s., B. a zelii and B. ga inii (Assous e al., 1993; an Dam e al., 1993; Rich e e al., 2004). Howe e , o he species o B. bu gdo e i s.l. ha e al eady been associa ed o human cases, like B. bisse ii, B. alaisiana, B. lusi aniae, and B. spielmanii (Picken e al., 1996; Rijpke na e al., 1997; Chap e 1 S a e o he a 16 Colla es-Pe ei a e al., 2004; Finge le e al., 2008). In con as , in he USA, despi e he p esence o se e al o he genospecies (B. ame icana, B. ande sonii, B. cali o niensis, B. ca olinensis, B. bisse ii and B. ku enbachii), only B. bu gdo e i s.s is ecognized as causing LD (Mu ay & Shapi o, 2010). Mo eo e , a new B. bu gdo e i s.l. genospecies (candida us Bo elia mayonii) was ecen ly iden i ied among pa ien s and in I. scapula is icks om he uppe Midwes e n USA (P i e al., 2016). The dis ibu ion and p e alence B. bu gdo e i s.l. species a ies on a local and egional scale, bo h empo ally and spa ially (Rau e & Ha ung 2005; Es ada-Peña e al., 2011), wi h a highe biodi e si y o species be ween 4º W and 20º E coo dina es, whe e he e is a highe p e alence o icks in ec ed wi h Bo elia (Es ada-Peña e al., 2011). The species B. bu gdo e i s.s. is epo ed mo e equen ly in eas , while B. a zelii is mo e common in he No h o Eu ope, B. alaisiana is mainly p esen in low empe a u e egions wi h unde g ow h ege a ion like Scandina ian coas , Sco land o Alpine egions, and B. lusi aniae and B. ga inii a e p edominan ly ound in he Medi e anean egion, sou heas and wes (Figu e 6) (F anke e al., 2013). Figu e 6 – Global dis ibu ion o he Lyme disease species. The shaded a eas show he dis ibu ion o ick ec o s. Se en species a e ound in No h Ame ica, eigh species in Eu ope, and eigh species in Asia. (Sou ce: Ma gos e al., 2011). Chap e 1 S a e o he a 17 Acco ding o S anek and Rei e (2011), some in es iga o s ecognize ha he mul iplici y o B. bu gdo e i s.l. species exis en s in Eu ope may indica e hese spi oche es as esponsible o Lyme while eme gency disease in his con inen . Howe e , o he s udies showed he exis ence o a mo e close ela ionship be ween he Eu opean Bo elia species han he ones om No h Ame ica, sugges ing ha LD was in oduced in Eu ope om he Ame ican con inen (S anek & Rei e , 2011). The he e ogenei y o B. bu gdo e i s.l. species in Asia is simila o hose in Eu ope, six pa hogenic species and i e ‘po en ial’ pa hogenic ha e been iden i ied in Asian con inen . Almos all Eu opean species can be ound in Cen al and Eas e n Asia, ye B. lusi aniae is mainly ound in wes e n Asia icks (F anke e al., 2013). B. bu gdo e i s.s. seems absen in mos Asia ic egions, being a ely epo ed in Thailand and Sou h China (F anke e al., 2013), while B. ga inii and B. a zelii a e he main species in ol ed in LD cases in his con inen (Scho hoe e & F os , 2015). In No h A ica se e al Bo elia species can be ound pa icula ly in he mos humid and empe a e egions like Tunisia, Egyp , Mo occo, and Alge ia. B. lusi aniae is he p edominan species in hese egions, al hough B. ga inii, B. bu gdo e i s.s. and B. alaisiana ha e been occasionally epo ed (F anke e al., 2013). B. lusi aniae isola es om No h A ica sugges s ha hey may be o igina e om a Po uguese clone (S anek e al., 2012). In Aus alia he e a e no conc e e e idences o LD exis ence, since he bac e ia as ne e been isola ed om he ick ec o , howe e , i has been associa ed o Ixodes holocyclus o I. co nua us (Mayne e al., 2014). The majo i y o epo ed human cases a e based in se ologic es s, ye in 2011 DNA om B. bu gdo e i s.l. spi oche es was de ec ed in eigh Aus alian pa ien s by PCR analysis, whe eas only one o he pa ien s had le he coun y (F anke e al., 2013). Mo e ecen ly in Sou h Ame ica, pa icula ly in B azil LD, known as B azilian Lyme- like disease o Baggio-Yoshina i synd ome, has been poo ly s udied (Yoshina i e al., 2010), i s epidemiology and he p e alen genospecies a e s ill no well de ined (Dan as- To es e al., 2008). Howe e , some cases o his disease ha e been epo ed in humans and animals by se ologic me hods and/o by clinical symp oms in he no he n (Amazonas Chap e 1 S a e o he a 18 and Tocan ins S a es) (Abel e al., 2000; Ca anza-Tamayo e al., 2012), midwes e n (Ma o G osso do Sul S a e) (Naka e al., 2008; Ca anza-Tamayo e al., 2012), sou heas e n (Espí i o San o, Rio de Janei o and São Paulo S a es) (Azulay e al., 1991; Yoshina i e al., 2003; Passos e al., 2009) and sou he n (Pa ana S a e) (Gonçal es e al., 2014; 2015) egions o B azil. Mos o hese cases we e de ec ed in inhabi an s o u al a eas, whe e due o he close p oximi y o humans o he animal popula ion o en pa asi ized by icks, esul s in a high incidence o his zoonosis. None heless, some ecen s udies ha e molecula ly iden i ied Bo elia DNA in h ee pe iphe al blood samples collec ed om humans wi h clinical symp oms o bo eliosis and epo o ick exposu e (Man o ani e al., 2012), and also in wo De macen o ni ens ick species (Gonçal es e al., 2014). Mo e ecen ly, B. ga inii and B. bu gdo e i s.s. we e epo ed o he i s ime in esiden s o u al a eas, who we e di ec ly o indi ec ly exposed o wild and/o domes ic animals and icks in he no he n egion o Pa ana S a e, con i ming he p esence o hese genospecies in B azil (Gonçal es e al., 2015).  Lyme disease in Po ugal In Po ugal he i s human case o LD was iden i ied in 1989 by Da id Mo ais and collabo a o s in É o a egion. In his wo k he au ho s sugges ed, ei he new ec o s could be implica ed in he ansmission o B. bu gdo e i s.l., since I. icinus species was conside ed uncommon in ha egion, o he po en ial exis ence o a new Bo elia s ain in he coun y. Subsequen s udies in he same Po uguese egion con i med he p esence o mo e se oposi i e cases, some o hem wi h con i med clinical signs o LD (Filipe e al., 1990, Núncio e al. 1992; Da id de Mo ais & Hen iques, 1999). Ten yea s la e his zoonosis was conside ed a no i iable disease o he Po uguese Heal h Au ho i ies (Po a ia 1071/98, A69.2). The i s isola ed s ains o B. bu gdo e i s.l. we e ob ain om icks collec ed in he Sou h o Po ugal, whe e a new species was iden i ied i s ly as PoTi B1, and la e designa ed as B. lusi aniae (Núncio e al., 1993). Fu he s udies con i med he p esence o o he s species o B. bu gdo e i s.l. in icks (B. a zelii, B. ga inii, B. alaisiana and B. bu gdo e i s.s.) wi h di e en p e alence a es om 11.9% in se e al egions, o 31.2% Chap e 1 S a e o he a 25 Table 4 - Ha d- ick gene a and espec i e species p esen in Po ugal. Tick gene a Ticks species Re e ence Specimen example (o iginal pho os by Mónica Nunes) De macen o (n=2) ma gina us Sulze , 1776 e icula us Fab icius, 1794 Haemaphysalis (n=3) hispanica Gil Collado, 1938 ine mis Bi ula, 1895 punc a a Canes ini & Fanzago, 1878 Hyalomma (n=2) lusi anicum Koch, 1844 ma gina um Koch, 1844 Ixodes (n=10) acumina us Neumann, 1901 a bo icola Schulze & Schlo ke, 1930 bi a i Dias, 1990 canisuga Johns on, 1849 on alis Panze , 1798 hexagonus Leach, 1815 icinus Linnaeus, 1758 simplex Neumann, 1906 en alloi Gil Collado, 1936 espe ilionis Koch, 1844 Rhipicephalus (n=4) boophilus annula us Say, 1821 bu sa Canes ini & Fanzago, 1878 pusillus Gil Collado, 1938 sanguineus La eille, 1806 Rega ding Rhipicephalus gene a, he species R. u anicus had been p e iously epo ed in mainland Po ugal (Papadopoulos e al., 1992; Dias e al., 1994; Caei o, 1999; Es ada- Peña e al., 2004; San os-Sil a e al. 2006) , al hough, i s p esence on he Medi e anean Chap e 1 S a e o he a 26 a ea has been ques ioned. Acco ding o he opinion o Walke and collabo a o s (2000), abou he genus Rhipicephalus, and oge he wi h he ecen molecula da a analysis om San os-Sil a and collabo a o s, based on h ee mi ochond ial genes [12S DNA, cy och ome c oxidase subuni II (COXII) and he con ol egion o d-loop (DL)] and one nuclea gene (28S DNA), he icks commonly called R. u anicus in Po ugal by mo phological analysis a e gene ically indis inguishable om R. sanguineus, poin ing owa ds o he occu ence o a single species in Po ugal, R. sanguineus, cha ac e ized by a high le el o mo phological polymo phism (San os-Sil a e al., 2011). These di e en ick species can ansmi a la ge a ie y o pa hogenic agen s able o causing disease in humans, wi h an eme gen isk in Po ugal (Table 5). Table 5 - E iologic agen s ansmi ed by Ixodids p esen , o a eme ging isk, in Po ugal. (Sou ce: adap ed om Núncio & Al es, 2014). Pa hogenic agen Disease Ixodid species Anaplasma phagocy ophilum Human anaplasmosis Ixodes icinus, I. en alloi Babesia di e gens Babesiosis Ixodes spp. Bo elia bu gdo e i s.l. Lyme bo eliosis Ixodes icinus Coxiella bu ne ii Q Fe e Se e al species F ancisella ula ensis Tula emia Se e al including Ixodes icinus and De macen o e icula us Ricke sia aeschlimannii wi hou nomina ion Hyalomma ma gina um R. cono ii Medi e anean Spo ed Fe e Rhipicephalus sanguineus R. hel e ica wi hou nomina ion Ixodes icinus R. massiliae wi hou nomina ion Rhipicephalus sanguineus R. monacensis wi hou nomina ion Ixodes icinus R. sibi ica mongolo imonae LAR* Hyalomma sp., Rhipicephalus pusillus R. slo aca TIBOLA** De macen o ma gina us, D. e icula us C imean-Congo hemo hagic e e i us Hemo hagic e e Hyalomma ma gina um, Haemaphysalis punc a a, Ixodes icinus, De macen o spp. Rhipicephalus spp. Eyach i us wi hou nomina ion Ixodes icinus, Ixodes en alloi Tick-Bo ne Encephali is i us Encephali is Ixodes icinus, Haemaphysalis punc a a * LAR - Lymphangi is-associa ed icke siosis; ** TIBOLA - Tick-bo ne lymphadenopa hy Chap e 1 S a e o he a 27 Lyme disease agen s ha e been isola ed and iden i ied om di e en ha d- ick gene a, al hough some icks cons i u e a g ea e isk o ansmi ing hese agen s o humans han o he s (Sil a e al., 2006; F anke e al., 2013). These spi oche es a e ca ied mainly by icks belonging o Ixodes genus om he Ixodidae amily (Pa ola & Raoul , 2001), cu en ly comp ehending ou p edominan species, I. scapula is, I. paci icus, I. icinus, and I. pe sulca us (Piesman & Ge n, 2004; S anek e al., 2012). Many, i no all, species o his complex a e impo an ec o s o o he pa hogens ha cause human and li es ock diseases, including ick-bo ne encephali is, anaplasmosis and babesiosis. The e o e, h oughou his s udy, emphasis will be gi en o ick’s ep esen a i e o Ixodes genus, classi ied as compe en ec o s, and mo e di ec ly in ol ed in B. bu gdo e i s.l. species ansmission. 1.3.4 – Geog aphic dis ibu ion o Ixodes ec o The e a e ou p edominan species o Ixodes icks associa ed o spi oche es ansmission o humans, including I. scapula is in he eas e n Uni ed S a es and Canada, I. paci icus in he wes e n USA, I. icinus in Eu ope and Asia, and I. pe sulca us in Asia (Figu e 12) (Piesman & Ge n, 2004; S anek e al., 2012). Figu e 12 – Geog aphical dis ibu ion o Ixodes species, ec o s o Lyme disease agen s. (Sou ce: S anek e al., 2012). Chap e 1 S a e o he a 28 The Eu opean ick, I. icinus species, also known as sheep ick o Cas o bean ick, p esen s a wide geog aphic dis ibu ion ac oss Eu ope, due o abio ic and bio ic ac o s such as speci ic mic oclima e, bio opes, and hos dynamics (Mo ila e al., 2012), and ansmi s an e en g ea e a ay o pa hogens han i s “sis e ” in No h Ame ica, he species I. scapula is (Lindg en & Jaenson, 2006; G ay e al., 2009). I. icinus ick has a high a ini y o humans, making i he mos impo an b idging ec o in Eu ope (Guiguen & Degeilh, 2001; Pa ola & Raoul , 2001). In he las decades he global wa ming in luenced he dis ibu ion and abundance o his ec o , being p esen om he Fa oe Islands in he wes (Jaenson & Jensen, 2007) o he Eu opean sec ion o he Russian Fede a ion in he eas (Ko enbe g e al., 2002), and om No h A ica (Zhioua e al., 1999) o he No he n Scandina ia (Lindg en e al., 2000), (Figu e 13). Figu e 13 - Geog aphical dis ibu ion o Ixodes icinus in Eu ope. (Sou ce: ECDC, 2016). This ick has he pa icula i y o ques ing o he ip o low ege a ion o mee i s hos s. Du ing his ques ing, icks o en ha e o ace desicca ing condi ions, qui ing hei ques ing place and mo ing o he li e /ma laye whe e hey egain los body wa e (Randolph & S o ey, 1999; Ge n e al., 2008). Ixodes icinus mo es p e e en ially when desicca ion isk is he lowes in na u e, a sundown (Ge n e al., 2008). I high desicca ing condi ions a e las ing oo long, ick mo ali y is inc eased esul ing in ques ing ick Chap e 1 S a e o he a 29 popula ion dec ease (Pe e e al., 2004). This ick is sensi i e o clima ic condi ions, equi ing a ela i e humidi y o a leas 80% o su i e du ing i s o -hos pe iods, being he e o e es ic ed o a eas o mode a e o high ain all wi h ege a ion ha e ains a high humidi y (Medlock e al., 2013). Recen ly, his ick species has expand in e ms o al i ude and la i ude, mainly due o clima ic changes, leading o he coloniza ion o new habi s and modi ica ions in he seasonali y pa e ns (San os-Sil a e al., 2011). In Po ugal I. icinus species can be ound ac oss he coun y, being mos p edominan in a eas o deciduous woodland and mixed o es wi h mild empe a u es, whe e ela i e humidi y le els a e high (Sil a e al., 2006). In un a o able condi ions (absence o ege a ion and high empe a u e), he i ali y o each s age can be comp omised, leading hem o ind sui able e uges o hei su i al, and o use su i al s a egies such as diapause (Schwa z e al., 2012; S anek e al., 2012). 1.3.5 – Li e cycle o Ixodes icinus The ick I. icinus is a iphasic ( h ee hos s), exophilic ( inds i s hos in an open en i onmen ) and elo ophic species ( he imma u e s ages eed in di e en hos s, including hose whe e he adul s eed), ha can ake abou h ee yea s o comple e i s li e cycle. This ick, like all ha d-body icks, has h ee pos emb yonic de elopmen s ages - la a, nymph, and adul (Figu e 14). Figu e 14 - Ixodes icinus li e s ages. (Sou ce: adap ed om h p://www.alleska en.nl/gezondheid/pa hologie-en- a macologie/). adul emale adul male nymph la a Chap e 1 S a e o he a 30 Thei ac i i y occu s du ing all yea , howe e , i p esen s a speci ic seasonali y, being adul s mo e ac i e be ween au umn (Oc obe ) and sp ing (Ma ch), while la ae and nymphs a e mo e ac i e, in he hos and also in he ege a ion, be ween sp ing and summe (Ap il o July). The du a ion o he li e cycle depends o impo an ac o s as clima e and hos a ailabili y (Es ada-Peña e al., 2004; S anek e al., 2012; Handeland e al., 2013). The imma u e s ages (la a and nymph) emain mainly in low ege a ion, whe e la a eed p ima ily on small mammals ( oden s and abbi s), and nymphs a e ound in hos s o medium size like bi ds and ep ile, he adul s eed on a a ie y o la ge animals (Figu e 15). Wi h he excep ion o he adul male ha akes small blood meals and do no engo ge, each li e s age equi es a blood meal om a e eb a e hos . Bo h gende s can also be ound in high ege a ion, whe e hey expec po en ial hos s. Only one blood meal is made in each e olu ional s age o he ick (Mannelli e al., 2012; Mo ila e al., 2012). Figu e 15 - Li e cycle o Ixodes icinus icks. (Sou ce: adap ed om h p:// ickapp. amu.edu/ ickbiology.php) All s ages o I. icinus species use he same echnique o hold on o he hos , hey no mally climb o he op o he ege a ion and when he hos passes he ick g abs o he u o Chap e 1 S a e o he a 31 skin h ough i s ques ing legs, and hen bi es using i s specialized mou hpa s. A e i has inished i s blood meal, which can las se e al days (3-4 days o la ae, 4-8 days o nymphs and 5-20 days o adul emales), con ibu ing o hei geog aphical sp ead along wi h he mo emen o he hos (Wilske, 2005), i loosen up om he hos o he soil, and mol o he nex s age. The li e cycle o I. icinus ends wi h he ma ing, whe e he emale ick a e ully engo ged p oduces eggs and deposi ed hem in he soil (o iposi ion). A e he pos u e o he eggs (app oxima ely 2000), he emale dies (Es ada-Peña e al., 2004; S anek e al., 2012; Medlock e al., 2013). 1.3.6 – T ansmission and Pa hogenesis Bo elia bu gdo e i s.l. spi oche es can be ansmi ed o he ick by h ee possible ways: i) h ough he blood meal in an in ec ed hos ( he mos common way); ii) by anso a ial ansmission (TOT) and/o iii) by anss adial ansmission (Figu e 16). Figu e 16 – Schema ic ep esen a ion o anso a ial and anss adial ansmission o pa hogenic agen s in Ixodes icks. (Sou ce: h ps://en.wikipedia.o g/). The anso a ial ansmission o spi oche es is a e, howe e , his hypo hesis has been explo ed by many ick-bo ne pa hogens o main enance in na u al en i onmen and epo ed o occu in bo h ixodid and a gasid icks (Rollend e al., 2013). Al hough s udies ca ied ou bo h in he USA and Eu ope ha e shown B. bu gdo e i s.l. in I. scapula is and I. icinus la ae (Rijpkema e al., 1994; Hubálek & Halouzka, 1998), his seems o Chap e 1 S a e o he a 32 occu a a e y low a e. Fo his eason, TOT does no seem o play any signi ican ole o he na u al main enance o B. bu gdo e i s.l. and a consequen minimal con ibu ion o he dynamics o in ec ion in adul icks o he nex gene a ion is expec ed (Ne edo a e al., 2004). Ticks ansmi he spi oche es by cu aneous inocula ion o in ec ed sali a. A e he ick a aches, he spi oche es dissemina e om he skin, o o he issues, o gans o sys ems, h ough he blood low. I he ick has been a ached less han 24h, he isk o in ec ion is low (Piesman, 1993), since he ansmission o Bo elia is mo e e icien as g ea e is ixa ion ime o he ick o he hos , being necessa y an a achmen o 48-72h o a success ul ansmission o he spi oche e. Howe e , se e al au ho s e i ied ha he a achmen ime o he hos depends on he Bo elia species and also on he ec o (S anek e al., 2012). Fo example, he spi oche e o B. bu gdo e i s.s. is no ansmi ed be o e 48h o a achmen , while B. a zelii can be ansmi ed in less han 24h. Also, I. icinus can ansmi ed he spi oche es as e han I. scapula is and I. paci icus (Ma ques, 2010; Wood & La e y, 2013). Du ing he a achmen , icks injec s a complex mix u e o bioac i e chemicals in o he hos , like his amine binde s and cy okine inhibi o s o media e he hos esponse, complemen inhibi o s o supp ess he hos immune esponse, and an icoagulan s o acili a e he blood meal (Mülle -Doblies & Wikel, 2005). This esul s in a painless “bi e” and usually p e en s an in lamma o y esponse. Spi oche es dissemina e, along wi h he blood meal, om he in ec ed hos o he ick, and colonize he midgu . They emain in he midgu mul iplying un il he nex blood meal, when a ac ion o he spi oche es om he midgu in ade he sali a y glands. While spi oche es a e in he midgu , hey exp ess high le els o OspA, since i s p esence is a equi emen o su i al in he ick by acili a ing adhesion o he spi oche e o he midgu wall (Pal e al., 2000), biding o a ecep o TROSPA ( ick ecep o o ou e su ace p o ein A), essen ial o spi oche e coloniza ion. OspA p o ein is hen down egula ed, while he ick p epa es o he blood meal, he spi oche es passes om he midgu o he sali a y glands and om he e o he hos . Simul aneously, Ou e su ace p o ein C (OspC) is up egula ed (Schwan e al., 1995; Schwan & Piesman, 2002). The ole o his p o ein is no clea , since i may ha e mul i ac o ial ac i i y including helping in hos in ec ion, in asion and dissemina ion, (Tilly e al., 2013). OspC exp ession and in ec i i y inc eases du ing some days once he Chap e 1 S a e o he a 33 spi oche es ha e in aded hos issues by biding o he ick sali a y p o ein, Salp15 (Pal e al., 2004; Pal & Fik ig, 2010) (Figu e 17). Though being an igenic, i is e en ually down egula ed o minimize hos an ibody esponse. Figu e 17 - Tick sali a y p o ein (Salp15) ha binds and p o ec s Bo elia bu gdo e i s.l. spi oche es. (Sou ce: Rosa, 2005). A majo ac o in he OspA/OspC complemen a y exp ession is he empe a u e. When a ick inds a hos and s a s o eed, i mo es om ambien empe a u e o he empe a u e a he su ace o mammalian hos skin. This apid empe a u e change in luences he spi oche e popula ion and induces OspC exp ession (Schwan & Piesman, 2002). This can be impo an o Bo elia spi oche es ansmission ime om ick o hos . Tick blood eeding beha io includes engagemen , he adhe ence o he hos ; explo a ion, he sea ch o a sui able si e o a achmen ; and pene a ion, whe e he ick inse s he mou hpa s in he hos o eeding (Cook, 2015). Du ing he p ocess o ick explo a ion, empe a u e ise will ac i a e OspA/OspC egula ion and he p ocess o inc eased mo ili y and in ec i i y begins. Explo a ion ime will be highly a iable, since i depends on how Chap e 1 S a e o he a 34 quickly he ick mig a es o an op imal si e. This ime could a y wi h se e al ac o s as hos animal size, compe ing icks p esence, o ejec ion o an unsui able si e (Cook, 2015). In addi ion o icks acqui ing in ec ions di ec ly om an in ec ed blood meal, as s a ed ea lie , hey can also ge in ec ed by a p ocess known as co eeding ansmission. In his mode o ansmission, unin ec ed icks acqui e in ec ions om in ec ed icks ha a e eeding in close p oximi y o hem on he same hos . This phenomenon has been demons a ed in ansmission o B. bu gdo e i s.s. spi oche es by I. scapula is (Pa ican, 1997; Piesman & Happ, 2001) and I. icinus (Ge n & Rais, 1996), B. a zelii by I. icinus (C ippa e al., 2002), and B. ga inii by I. pe sulca us (Sa o & Nakao, 1997). The signi icance o co eeding ansmission o he epidemiology o LD is poo ly unde s ood; howe e , i seems o be mo e e icien in he Eu opean “sys em” o B. a zelii and I. icinus han he No h Ame ican “sys em” o B. bu gdo e i s.s. and I. scapula is (Voo douw, 2015). The impo ance is ela ed o he po en ial o nymph- o-la a co eeding e en s, which depends on he synch ony o la al and nymphal hos sea ching and ques ing ac i i y. In Eu ope, he wo s ages o imma u e icks a e ac i e du ing he same imes o he yea om sp ing o au umn, whe eas in No h Ame ica, he peak ac i i y o hese s ages may occu du ing di e en imes o yea (Ku enbach e al., 2006; Ba bou e al., 2009). Because dee and o he la ge ce ids may ca y all s ages o icks simul aneously, hese hos s may play an impo an ole in p o iding a pla o m o co eeding ansmission o occu e en hough hey a e no in ec ed hemsel es (Voo douw, 2015). The hos esponse o B. bu gdo e i s.l spi oche es can also play a key ole in disease pa hogenesis. These bac e ia does no p oduce oxins o p o eases ha a e di ec ly esponsible o issue damage upon coloniza ion. In con as , he bac e ium p oduces mul iple molecules ha ac i a e hos esponses and can lead o localized and gene alized in lamma o y pa hogenic esponses. Mos o hese hos esponses no mally unc ion o con ain o clea in ec ions and a e componen s o he inna e de ense and/o in lamma o y esponse (Benhnia e al. 2005; Behe a e al., 2006; Oos ing e al., 2010). Al hough hei pu pose is o clea in ec ion, i con inually ac i a ed, hey lead o lesion de elopmen and disease. One o hese mul iple molecules, a e lipop o eins ha ac i a e Toll-like ecep o s (TLRs) 1 and 2 in a CD14-dependen manne (Hi sch eld e al., 1999), and also induces ype I Chap e 1 S a e o he a 41 o diame e , wi h lympho e icula p oli e a ion in he de mis and/o subcu is (Mullegge , 2004);  in ec ion o he cen al ne ous sys em (CNS) wi h he common mani es a ions o Lyme neu obo eliosis (LNB) including lymphocy ic meningo adiculoneu i is – Bannwa h’s synd ome, acu e acial ne e palsy (Bell’s palsy), which consis s in a pa alysis o weakness o muscles on one o bo h sides o he ace (Table 6), and lymphocy ic meningi is (S anek & S le, 2008; Mygland e al., 2010). LNB is an in ec ious diso de and he mos equen synd ome o dissemina ed in ec ion on Eu ope, howe e , is becoming an mo e common symp om in No h Ame ican LB pa ien s (Ga cia-Monco & Benach, 1998; Mygland e al., 2010);  se e e muscle pain o numbness in he a ms and legs, being common pain o swelling in he knees, shoulde s, elbows and o he la ge join s. All hese symp oms con ibu e o Lyme a h i is (Table 6) (Hu, 2005);  a wide ange o clinical ca diac complica ions, including palpi a ions and dizziness, a io en icula block, pe ica di is, myoca di is o mo e a e ca diomyopa hy also known as Lyme ca di is (Lelo as e al., 2008); Chap e 1 S a e o he a 42 Table 6 - The h ee s ages o Lyme disease and examples o some clinical mani es a ions. S age o disease Timing Common mani es a ions Examples o clinical mani es a ions Ea ly Localized Days o weeks A solid ed o bull’s eye lesion (e y hema mig ans - EM); egional Lymphadenopa hy. EM Ea ly dissemina ed Weeks Mos commonly mul iple ashes, Bell’s palsy and meningi is; a ely ca di is wi h a ying deg ees o hea block; also join pain, headaches, s i neck, lymphadenopa hy, ision al e a ions. Bell’s palsy La e Weeks o mon hs Recu en a h i is; Ac ode ma i is Ch onica A ophicans - ACA; neu ological diso de s; pe iphe al neu opa hy. ACA Chonic La e LD – Pe sis en in ec ion (s age 3) – no mally occu s mon hs o yea s a e he ick bi e, wi h ch onic mani es a ions o a h i is, ac ode ma i is ch onica a ophicans (ACA) (Table 6) and la e neu obo eliosis mani es a ions including se e al deg ee o encephalopa hy and encephalomyeli is, besides a ious neu opsychia ic symp oms. ACA is associa ed o B. a zelii and usually begins on he ex enso si es o he membe s ex emi ies, on he lowe leg wi h ini ial in ol emen o one oo , and i does no heal spon aneously (S anek e al., 2002), being mo e common in Eu ope and Asia bu no equen in No h Ame ican pa ien s. Chap e 1 S a e o he a 43 This di e si y o symp oms, can be explain in pa , by he di e en species o Bo elia esponsible o LD in se e al geog aphic a eas, and also possibly by gene ic di e ences among he a ec ed popula ions (Reed, 2002). Fo example in Eu ope LNB is mos o en caused by B. ga inii, and skin complica ions a e usually associa ed o B. a zelii, howe e , ega ding he a icula complica ions hese can be due o se e al species like B. ga inii, B. a zelii and B. bu gdo e i s.s.. Meanwhile, in USA B. bu gdo e i s.s. is he species esponsible o cases o Lyme a h i is (S le & S anek, 2009), and he no el iden i ied B. bu gdo e i s.l. genospecies – B. mayonii – also causes Lyme bo eliosis, bu wi h subs an ially ele a ed spi ochae aemia and clinical ea u es dis inc om o he ecognized B. bu gdo e i s.l. species (P i e al., 2016). The e o e, he clinical mani es a ions a e dis inc in No h Ame ica and in Eu ope, e lec ing he global dis ibu ion o he di e en spi oche es species and e e geno ypes as u he will be explain (Wang e al., 1999). Fu he mo e, in Eu ope LD occu s in simila equencies in bo h gende s, wi h excep ion o ACA ha is mo e common in women. Ea ly LNB cases showed a bimodal age dis ibu ion wi h a lowe equency in he age ange o 20 o 29 yea s old, while ACA occu s mos ly in olde pa ien s (Wilske, 2005). 1.5.2 – Labo a o y diagnosis – Con en ional me hodologies Lyme disease diagnosis is mainly clinical, based in signs and symp oms, he pa ien ’s his o y o ick bi e o exposu e, anamnesis, and complemen ed by epidemiological da a. In mos cases he clinical diagnosis should be ollowed by labo a o y es s, due o he unspeci ic na u e o he clinical mani es a ions. The possibili y ha LD agen s can be in ol e in o he diso de s, makes necessa y o a labo a o y esponse unequi ocal, h ough sensi i es and speci ic es s (S anek e al., 2011). Un o una ely, he e a e no s anda dized diagnos ic c i e ia o LD, which has led o bo h o e and unde diagnosis o he disease. CDC has published case de ini ions o su eillance pu poses, despi e emphasizes ha hese a e no in ended as diagnos ic c i e ia (Table 7) (CDC, 2011). Chap e 1 S a e o he a 44 Table 7 - Case de ini ion om Cen e s o Disease Con ol and P e en ion (CDC), o su eillance pu pose. (Fon : adap ed om Bo che s e al., 2014). Case de ini ion CDC E y hema mig ans A skin lesion ha ypically begins as a ed macula e o papule and expands o e a pe iod o days o weeks o o m a la ge ound lesion, o en wi h cen al clea ing. The la ges diame e mus each a size ≥ 5 cm; The diagnosis mus be made by a physician: Labo a o y con i ma ion is ecommend o pe son wi hou known exposu e. Neu obo eliosis Any o he ollowing mani es a ions (alone o in combina ion): Lymphocy ic meningi is; C anial neu i is, pa icula ly acial palsy (may be bila e al); Radiculoneu opa hy; Encephalomyeli is; Encephalomyeli is mus be confi med by B. bu gdo e i -specific an ibody p oduc ion in CSF. Musculoskele al sys em Recu en b ie a acks o objec i e join swelling in one o a ew join s, some imes ollowed by ch onic a h i is in one o a ew join s. Ca dio ascula sys em Acu e onse o high-g ade (2nd o 3 d deg ee) a io en icula conduc ion de ec s ha esol e in days o weeks and a e some imes associa ed wi h myoca di is. Suspec ed A case o EM wi hou known exposu e (defined as ha ing been ≤ 30 days be o e he onse o EM in wooded, b ushy, o g assy a eas in a coun y in which Lyme disease is endemic); A case wi h labo a o y e idence o in ec ion bu wi hou a ailable clinical in o ma ion; P obable Any o he case o physician-diagnosed Lyme disease ha has labo a o y e idence o in ec ion; Chap e 1 S a e o he a 45 (Con . Table 7) Con i med A case o EM wi h a known exposu e; A case o EM wi h labo a o y e idence o in ec ion and wi hou a known exposu e; A case wi h a leas one la e mani es a ion ha has labo a o y e idence o in ec ion; Labo a o y e idence Posi i e cul u e o Bo elia bu gdo e i o Two- ie es ing ( o specific an ibodies) in e p e ed using es ablished c i e ia, whe e Posi i e IgM is su ficien du ing he i s 30 days om symp oms onse ; Posi i e IgG is su ficien a any poin du ing illness; Single- ie IgG immunoblo se oposi i i y using es ablished c i e ia; CSF an ibody posi i e o B. bu gdo e i s.l. by enzyme immunoassay (EIA), o indi ec immuno luo escence assay (IFA), when he i e is highe han i was in se um. Also he EUCALB (Eu opean Conce ed Ac ion on Lyme Bo eliosis), has p oposed clinical case de ini ions o use in clinical se ings and epidemiological in es iga ions (S anek e al., 2011; Bo che s e al., 2014). Excep o EM, LD mani es a ions a e no speci ic, ha ing a a ie y o causes. The e o e, i is impo an o ob ain a de ailed pa ien s his o y in o de o es ablish p obable exposu e o Ixodes icks in an endemic a ea a an app op ia e ime o he yea , and o ob ain app op ia ed and de ini i e labo a o y con i ma ion. Labo a o y es ha e imp o ed a lo in he las decades and clinicians ha e now a ailable a ange o op ions o me hods ha can be classi ied in wo ypes: Di ec me hods (cul u e and molecula app oaches), and Indi ec me hods (immunologic and se ological app oaches).  Di ec me hods Labo a o y es s o di ec de ec ion o Bo elia a e gene ally limi ed by he low numbe o spi oche es in clinical samples, also he lack o sensi i i y o di ec es s is one o he main challenges in he diagnosis o LD. Al hough di ec es s o B. bu gdo e i can be e y help ul, none a e usually equi ed o he diagnosis o he disease (Ma que, 2015). Chap e 1 S a e o he a 46 The main di ec es modali ies used a e cul u e and PCR o Bo elia DNA de ec ion. His opa hology has limi ed u ili y, being used mos ly o exclude o he diseases, and in he e alua ion o suspec ed cases o bo elial lymphocy oma and ACA (Müllegge & Gla z, 2008; Zajkowska e al., 2011). De ec ion o B. bu gdo e i is di icul and ime consuming because o he ex eme sca ci y o o ganisms (Du ay, 1989; de Koning e al., 1995). Cul u e Cul u e is no a ypically a ailable diagnos ic me hod o he diagnosis o LD in clinical p ac ice, due o i s ela i ely low sensi i i y, long incuba ion ime, equi es special media and expe ise. Howe e , he abili y o isola e and o main ain B. bu gdo e i s.l. cul u es is essen ial in esea ch, and cul u e emains he gold s anda d o con i m he diagnosis. Me hods ha would imp o e sensi i i y and simpli y he p ocedu e a e needed o allow i o be adop ed mo e ex ensi ely. Since B. bu gdo e i s.l. has a limi ed me abolic capaci y, a complex g ow h medium o cul i a ion is essen ial. The Ba bou -S oenne - Kelly medium (BSK) (Pollack e al., 1993) and he modi ied Kelly-Pe enko e medium (MKP) (Ružić-Sabljić e al., 2006) a e he mos used medias o B. bu gdo e i s.l. cul u es. The BSK medium has he pa icula i y o changing colo , om o ange o yellow, when he spi oche es g ow h, due o i s acidi ica ion (Figu e 20). Cul u es can be examined using da k- ield mic oscopy o luo escen mic oscopy (Li e is e al., 2011). The spi oche es o B. bu gdo e i s.l. species has a slow ep oduc ion a e and cul u es a e main ained unde anae obic o mic oae ophilic condi ions wi h a empe a u e anging om 30-34ºC, du ing a leas 8 o 12 weeks be o e being conside ed nega i e (Li e is e al., 2011). Figu e 20 - Cul u es o B. bu gdo e i s.l. in selec i e medium BSK. The changing o he medium colo , om o ange o yellow, shows he spi oche es g ow h. (Sou ce: O iginal pho o by Mónica Nunes). Chap e 1 S a e o he a 47 The success o cul u ing B. bu gdo e i s.l. depends o he specimen, he biological sample (e.g. luids o biopsies), he e olu ion o he disease, and he expe ise o he labo a o y s a . I may also depend o he geno ype (Xu e al., 2013). Also, i he pa ien was subjec ed o an an ibio ic he apy wi h e ec i e d ugs agains B. bu gdo e i s.l. (e en a single dose) he cul u e sucess a e is signi ican ly a ec ed (Nadelman e al., 1993; Picken e al., 1997). Cul u e o skin biopsies om EM has a sensi i i y o 40% o 60% (Li e is e al., 2012; Og inc e al., 2013; Ružić-Sabljić e al., 2014). In he USA, whe e disease is caused by B. bu gdo e i s.s., posi i e cul u es a e associa ed wi h sho e du a ion o he disease and smalle lesions (Li e is e al., 2002; Li e al., 2011). In cen al Eu ope, posi i e skin biopsy cul u es (mos ly isola es we e B. a zelii) we e associa ed wi h la ge lesions (up o abou 15 cm in diame e ) and inc eased du a ion (up o 30 days) (S le e al., 2013). These indings a e p obably ela ed wi h he di e en Bo elia species and he hos immune esponse ha e en ually con ols he in ec ion. Cul u e is mode a ely success ul in skin biopsies o ACA lesions (Picken e al., 1997). Cul u e o plasma samples om un ea ed pa ien s wi h ea ly dissemina ed in ec ion has a sensi i i y o a ound 40%, which can be inc eased o 75% by equen es ing cul u e aliquo s wi h a sensi i e PCR. Blood cul u es a e mo e likely o be posi i e in pa ien s wi h mul iple EM (Li e is e al., 2011). B. bu gdo e i s.l. is a ely cul u ed om he blood o LD pa ien s wi h la e mani es a ions (Nowakowski e al., 2009; Ma aspin e al., 2011). Isola ion o B. bu gdo e i s.l. om o he o igins, as CSF and syno ial luid is uncommon and he isola ion a e is e y low e lec ing he small numbe o iable o ganisms p esen in hose loca ions (Wo mse e al., 2012). Mic oscopy The spi oche es can be di ec ly de ec ed in biologic samples such as blood, ick issues and skin biopsies by da k- ield mic oscopy, s aining wi h app op ia e s ains, and by his ochemical echniques. Howe e , due o he low numbe o spi oche es in samples and o he limi a ions o mic oscopy obse a ion, his app oach is a ely used (Bap is a, 2006). Chap e 1 S a e o he a 48 Polyme ase chain eac ion (PCR) In he las decades, many labo a o ies ha e s a ed o gi e mo e a en ion o he molecula assays, wi h he aim o inc ease he sensi i i y and speci ici y o LD diagnosis, and educe he ime consuming o he con en ional echniques. The de ec ion o Bo elia DNA ca ied h ough PCR p esen s a a iable sensi i i y, anging om 10-30% (in case o CSF samples), o 50-70% o blood, skin biopsy and syno ial luid samples (B a on e al., 2008; S anek e al., 2011). These a ia ion is due o he me hodology, gene a ge s and p ime se s used (Picken e al., 1997; Glins e al., 2008). Con en ional PCR o nes ed-PCR can be used, ye nes ed-PCR in mo e speci ic and sensi i e since i uses wo s eps o ampli ica ion, wi h one se o p ime s each, ins ead o he single s ep and single pai o p ime s in ol e in he classical PCR. Se e al a ge s ha e been used o he ampli ica ion o B. bu gdo e i s.l. DNA, such as 5S/23S DNA in e genic egion, 16S genes, lagellin and p66 ch omossomal genes o he ospA and ospB genes (P iem e al., 1997; Schmid , 1997; Wilske e al., 2007). The a ge s ca ied on plasmids (opsA, ospB, opsC and lsE) a e p esen in mul iple copies wi hin each bac e ium, and assays wi h hese a ge s p esen s a g ea e sensi i i y han hose using single-copy ch omosomal a ge s such as lagellin, ecA, poB, 16S and 23S DNA, and in e genic space s. Res ic ion F agmen Leng h Polymo phism-PCR (RFLP-PCR), is a de i a ion o he PCR, and i is no mally used o geno yping B. bu gdo e i s.l. species, being he mos used a ge he in e genic egion 23S ( l) – 5S ( ) o he DNA, we e he ampli ica ion p oduc is hen diges ed by an endonuclease (MseI o D aI), and an pa e n o p oduc s wi h di e en sizes is ob ained, allowing o di e en ia e be ween Bo elia genospecies (Pos ic e al., 1994). O he PCR-based echniques can be used o he di ec diagnosis o LD, such as Mul iplex Real-Time PCR and Re e se T ansc ip ase PCR (RT-PCR) (Limbach e al., 1999; Cou ney e al., 2004), howe e , a s anda dized PCR p o ocol is ye o be de ined (Wilske e al., 2007). A nega i e esul in a PCR es canno be in e p e ed as an exclusion o LD. Since he numbe o spi oche es in in ec ed issues o in body luids o pa ien s a e e y low, and app op ia ed p ocedu es o sample collec ion, anspo and DNA ex ac ion a e c i ical Chap e 1 S a e o he a 49 o eliable and consis en PCR esul s (Wang e al., 2010). The alse posi i e esul s is one o he limi a ion o nucleic acids ampli ica ion me hods, due o con amina ions, which can be e y oublesome in assays se o maximum sensi i i y, a equi emen o LD diagnosis (Schmid , 1997).  Indi ec me hods The hos immune esponse o B. bu gdo e i s.l. can be de ec ed by indi ec me hods, based on he p esence/absence o an ibodies in se um agains he spi oche es. Only he an ibody-based assays a e app o ed and ecommended o Lyme disease es ing by he USA Food and D ug Adminis a ion (FDA) (Ma ques, 2015). In USA abou 3.4 million o Lyme se ologic es s a e done pe yea , almos 1000x mo e han he es ima ed numbe o 300,000 cases o LD, and a majo p oblem o hese labo a o y es s is i s inapp op ia e use. Mos likely hese es s a e being used in condi ions o which hey a e no ecommended, including uling ou LD in popula ions wi h a low p obabili y o ha ing he disease. The p edic i e alue o a es is de e mined by i s sensi i i y, speci ici y, and he p e alence o LD in he es ed popula ion. The e o e in a pa ien wi h a low p obabili y o LD, a nega i e es s ules ou he disease, whe eas a posi i e esul is mo e likely o be a alse-posi i e (Ma ques, 2015). Al eady in 1995 he CDC ecommended o LD es pe o mance and in e p e a ion a s anda dized 2- ie es ing (STTT) app oach o imp o e he speci ici y o se ologic es s in USA (Figu e 21) (CDC, 1995). Figu e 21 - Cu en CDC ecommenda ions o se ologic diagnosis o Lyme disease. (Sou ce: Adap ed om Ma ques, 2015). Chap e 1 S a e o he a 50 The se um samples should be es ed wi h a sensi i e i s - ie EIA, o IFA, and i he esul is bo de line o posi i e, an IgM and IgG Wes e n blo (WB; also called immunoblo ) is applied as second s ep (Ma ques, 2015; Sch ie e , 2015). La e on i was s ipula ed ha IgM WB should only be applied o pa ien s in an ea ly phase o he disease, wi h a du a ion o 30 days o less. The WB is in e p e ed by a s anda dized c i e ia ha equi es a leas wo o h ee an igenic ac ions (signa u e bands) o a posi i e IgM WB (p21 [OspC], p39 [BmpA], and p41 [ lagellin B] (Engs om e al., 1995), and i e o en an igens o a posi i e IgG WB (p18, p21 [OspC], p28, p30, p39 [BmpA], p41 [ lagellin B], p45, p58, p66, p93 (D essle e al., 1993). The 2- ie app oach algo i hm has a good pe o mance when used as ecommended, howe e , he e’s s ill many imp o emen s o be done, including he si ua ions o low sensi i i y du ing ea ly in ec ion, subjec i e in e p e a ion o bands, and di icul y o heal h ca e p o ide s in in e p e ing he esul s (Ma ques, 2015). The majo i y o indi ec assays is based on whole-cell sonica e (WCS) om B. bu gdo e i s.l. cul u es, howe e , a signi ican numbe o alse-posi i e esul s can occu , due o c oss- eac i e an igens (Gomes-Solecki e al., 2000). Mo eo e , some an igen exp ession can di e om cul u e o in i o, o example he exp essed VlsE lipop o ein ha causes a s ong humo al esponse du ing in ec ion, has a minimal exp ession in cul u ed B. bu gdo e i s.l.. The addi ion o his lipop o ein o he 2- ie app oach has imp o ed i s pe o mance (B anda e al., 2010). Also, es s ha use C6 pep ide (26-amino acid pep ide om conse ed egion 6 o VlsE has a sensi i i y simila o WCS-based EIAs, wi h signi ican ly imp o ed speci ici y (B anda e al., 2011; Wo mse e al., 2013). Se e al o he s ecombinan and syn he ic an igens ha e been e alua ed in se odiagnosis o LD, including an igens combining po ions o di e en p o eins (A naboldi e al., 2013). An ibody-based es sensi i i y inc eases wi h he e olu ion o he in ec ion, and he e is a lag om ini ial in ec ion un il he ime when he e a e su icien le els o an ibodies o be de ec ed. Pa ien s who p esen e y ea ly symp oms a e mo e likely o ha e a nega i e esul o LD. Less han 50% o pa ien s wi h EM a e se oposi i e a p esen a ion, and hese pa ien s should ecei e ea men based mainly on he clinical diagnosis. Chap e 1 S a e o he a 57 been in es iga ed using a a ie y o a ge s om bo h ypes o DNA (Schmid , 1997; Ague o-Rosen eld e al., 2005). Assays designed o a ge plasmid-bo ne genes, such as ospA, ospC, o lsE, a e mo e sensi i e han hose a ge ing ch omosomal, lagellin o 16s DNA genes (Pe sing e al., 1994; Zo e e al., 2002), mos likely because o he inding ha Bo elia o en shed plasmid-con aining blebs, which allows o highe concen a ions o plasmid han ch omosomal DNA. Howe e , i is now well ecognized ha hese blebs disassocia e om he spi oche e and may pe sis in issues and body luids (Pe sing e al., 1994). The e o e he de ec ion o plasmid DNA om hese non iable blebs may elici alse- posi i e esul s ha do no necessa ily e lec ongoing LD. Ch omosomal a ge s usually occu as single copies; al hough a ge ing hese genes may esul in lowe analy ical sensi i i y, hey may be a be e p edic o o o ganism iabili y (Li e is e al., 1999). Se e al s udies show ha some ma ices a e be e han o he s o he di ec de ec ion o Bo elia DNA om clinical specimens. The pe o mance o hese specimens in NAATs depends on he s age o in ec ion a he ime o pa ien p esen a ion. Al hough hese assays ha e demons a ed high speci ici y, sensi i i y has been lacking, p obably due o he absence o a ue gold s anda d assay, o a s anda dized app oach o compa ison o he a ious me hods unde de elopmen . Howe e , NAATs can se e as an adjunc diagnos ic modali y alongside wi h clinical indings and se ologic es ing (Swanson e al., 2006; Ma aspin e al., 2011).  Iso he mal DNA ampli ica ion In he las decade, i has been obse ed a huge ise in he abundance and a ailabili y o nucleic acid in o ma ion, allowing he use o DNA and RNA ampli ica ion echniques o speci ic de ec ion, ha nessing he complexi y inhe en in gene ic ma e ial o he pu pose o a ge ed iden i ica ion. Molecula diagnos ic echniques using nucleic acids we e pionee ed h ough use o PCR, which emains he p edominan me hod in he ield due o i s obus ness, sensi i i y and amilia i y. Howe e , he g owing use o hese molecula diagnos ic me hods has emphasized speed and simplici y as key c i e ia o adop ion in poin -o -ca e and ield applica ions, and iso he mal ampli ica ion echniques a e well- sui ed o hese uses. Due o hei na u e, iso he mal ampli ica ion me hods equi e only Chap e 1 S a e o he a 58 a single empe a u e, a oiding he need o cos ly he mal cycling equipmen and po en ially e en elec ical powe , depending on incuba ion empe a u e and hea ing (Tanne & E ans, 2014). Mo eo e , by cons an incuba ion and ampli ica ion, no empo al es ic ions om de ined cycles a e implied, esul ing in ampli ica ion eac ions as apid as i een minu es (Fang e al., 2010; Wang e al., 2011). The mos widesp ead iso he mal me hod is loop-media ed iso he mal ampli ica ion (LAMP), whe e since i s i s publica ion in 2000 by No omi and collabo a o s, hese echnique has been applied o diagnos ic de ec ion o hund eds o pa hogens in clinical, plan , ood and animal samples (A ai e al., 2015; Fe a a e al., 2015; Palacio-Bielsa e al., 2015). This me hodology p esen s a simple, obus and lexible pla o m o molecula diagnos ics. The LAMP eac ion employs a DNA polyme ase wi h s and displacemen ac i i y and ou o six specially designed p ime s ha ecognize six dis inc sequences on he a ge DNA unde iso he mal condi ions (60-65°C), whe e a dena u ed empla e is no equi ed. No mally, he eac ion uns o abou 60 minu es, showing an ex emely high speci ici y (Nagamine e al., 2002; Mo i & No omi, 2009). Also, LAMP me hod has a high ampli ica ion e iciency ha allows he syn hesis o la ge amoun s o DNA in a sho ime. I s de ec ion limi is a ew copies pe eac ion and he e o e is compa able o PCR (Mo i & No omi, 2009). Fo he assay pe o mance, only a hea ing block a a cons an empe a u e o a wa e ba h is necessa y. To pe o m he eac ion, a se o wo specially designed inne and ou e p ime pai s and a DNA polyme ase wi h s and displacemen ac i i y a e equi ed o he DNA syn hesis. The ini ial eac ion s eps a e illus a ed in Figu e 23. DNA egions F3 and R3 a e complemen a y o F3c and R3c on he empla e, espec i ely. The F2 egion in he o wa d inne p ime FIP is complemen a y o he F2c egion ollowed by he F1c complemen a y o F1 o he a ge DNA. The same p inciple is used o design he backwa d p ime . As a esul , hese ou p ime s ecognize six dis inc sequences which ensu e high speci ici y o a ge ampli ica ion. Mo eo e , hese p ime s enable gene a ion o a s em-loop DNA o subsequen complex LAMP cycling including sel -p iming eac ions. In he ini ial s eps o he LAMP eac ion all ou p ime s a e employed, bu in he la e cycling s eps, only he inne p ime s a e used o s and Chap e 1 S a e o he a 59 displacemen DNA syn hesis. The inal p oduc s is a mix u e o s em loop DNAs wi h se e al in e ed epea s o he a ge and cauli lowe -like s uc u es wi h mul iple loops o med by annealing be ween al e na ely in e ed epea s in he same s and (No omi e al., 2000; Tomi a e al., 2008). The eac ion can be accele a ed by using wo ex a loop p ime s. Figu e 23 - Schema ic ep esen a ion o Loop-media ed iso he mal ampli ica ion assay. LAMP is cha ac e ized by he use o ou p ime s (F3, B3, FIP and BIP), in an iso he mal (60–65ºC) au o-cycling s and displacemen eac ion. (Sou ce:h p://wha -when- how.com/ opical-medicine/no el-molecula -diagnos ic-pla o m- o - opical-in ec ious-diseases-o he - opical-in ec ious-and-non-in ec ious-condi ions-pa -1). LAMP ampli ica ion p oduc s can be de ec ed ei he by gel elec opho esis, eal- ime moni o ing o u bidi y wi h a u bidime e (Mo i e al., 2001; Mo i e al., 2004), o simply wi h he naked eye. Du ing he eac ion, a la ge amoun o DNA is syn hesized, yielding a la ge py ophospha e ion by-p oduc . I was obse ed ha py ophospha e o ms an insoluble, obse able whi e p ecipi a e wi h di alen me allic ions (Mo i e al., 2001). Ano he isual de ec ion me hod based on he o ma ion o py ophospha e can be accomplished by using he luo escen me al indica o calcein, which binds ee calcium ions. Calcein has been used o he eal- ime de ec ion o DNA o ma ion du ing LAMP (Tomi a e al., 2008). Fu he me hods apply in e cala ing DNA dyes such as SYBR Chap e 1 S a e o he a 60 G een I (Soliman & El-Ma bouli, 2005), FDR (Yoda e al., 2007), o oligonucleo ide p obes labeled wi h di e en luo escen ma ke s, as well as low molecula weigh ca ionic polyme s such as polye hylenimine (Mo i e al., 2006). The e a e se e al wo ks epo ing he use o his echnology o de ec pa hogenic o ganisms, howe e , o Bo elia his app oach is s ill ha dly applied, exis ing so a only wo published s udies (Yang e al., 2013; Zhang e al., 2015). I ’s impo an o employ LAMP echnique on la ge scale in esou ced-limi ed labo a o ies in de eloping coun ies, whe e many a al opical diseases a e endemic. Also in he nea u u e, LAMP es ing ki s on eadymade mic ochips a e o be used by bo h de eloped and de eloping coun ies.  Immunoch oma og aphic assays In he la e 1960s immunoch oma og aphic assays we e i s desc ibed, being o iginally de eloped o assess he p esence o se um p o eins (Kohn, 1968; Pe uski e al., 2003). Howe e , o e he pas decade many o he applica ions ha e been de eloped o immunoch oma og aphic assays, including he de ec ion o bac e ial pa hogens ( an Dommelen e al., 2008; P eechakasedki e al., 2012; Widiyan i e al., 2013). The ins an aneous examina ion o changes in one’s own physical symp oms o heal h s a us is inc easingly p e e ed. Sel - es s pe o med a home will de ini ely be an in eg al pa o u u e heal h ca e sys ems (P ice, 2001). In ac , he ma ke expansion o home- e sion diagnos ic ki s in de eloped coun ies, ypically in he Uni ed S a es, a exceeds he a e age o o e all in i o diagnos ic p oduc s. The i s comme cially success ul ki was he p egnancy es based on he apid de ec ion o human cho ionic gonado opin in u ine by simply adding u ine o he es ki (Bu le e al., 2001). The mos common immunoch oma og aphic assays a e he known la e al low s ips ha ha e been a commonly used echnology o some ime. La e al low s ips o e a numbe o a ious bene i s including use iendly o ma , e y sho es ime, long e m s abili y, and hey a e p oducible a low cos s. These ea u es make he la e al low s ip es s ideal o home es ing, apid poin o ca e es ing and o ield es ing applica ions. Chap e 1 S a e o he a 61 A la e al low s ip (LFS) p esen s ou main sec ions made o di e en ma e ials, as shown in Figu e 24: sample pad, made o cellulose, whe e he sample is d opped; conjuga e pad, made o glass ibe , imp egna ed wi h he bioconjuga es solu ion ( he label pa icle and a ecep o o he analy e); de ec ion pad, a ni ocellulose (Ahmad e al., 2009) whe e es line (TL) and con ol line (CL) a e p in ed; and abso p ion pad, also made o cellulose. Figu e 24 - Schema ic ep esen a ion o a LFS (la e al low s ip) and mo emen o analy es and label pa icles ac oss i . (Sou ce: Adap ed om Quesada-González & Me koçi, 2015). O he addi ional pa s can be in eg a ed on LFS as blood il e s, subs i u ing he sample pad, o e ain big pa icles like ed blood cells and a oiding hei hemolysis. Ano he example o ma e ial which can be in eg a ed on LFS is ca bon nano ubes pape , wi h high conduc i e p ope ies o connec LFS o elec onic de ices (Zhu e al., 2014). The p inciple o an assay wi h a LFS is simple: he sample is added on he sample pad and hen he liquid will s a lowing o he conjuga e pad whe e he analy e, i p esen on he sample, will be linked o he ansduce s ( he label pa icles), p e iously conjuga ed Chap e 1 S a e o he a 62 wi h a bio ecep o speci ic o he analy e. The conjuga e, ehyd a ed by he liquid, will low by capilla i y o ces ac oss he de ec ion pad o he abso ben pad, passing h ough he TL, whe e i will be cap u ed only i he conjuga e has he analy e a ached (posi i e esponse), and o he CL, being always cap u ed, e idencing ha he assay wo ked (Figu e 24) (Quesada-González & Me koçi, 2015). LFSs can be used o de ec a la ge ange o bioma ke s ha may include no only p o eins, bu also nucleic acids and e en whole cells, among o he biocompounds. Fu he mo e, LFSs a e no limi ed only o biomolecules de ec ion; se e al publica ions ha e appea ed in he las yea s abou he de ec ion o pollu an s such as me allic ions, pes icides, e c. The ange o LFSs applica ions is including de ec ion o haza dous (Shyu e al., 2002), hea y me als in d inking wa e s (López-Ma zo e al., 2013), alle gens and pa hogens in ood (Be lina e al., 2013), pes icides (Wang e al., 2009), d ugs sc eening (Inoue e al., 2007), e c. These es s a e, he e o e, o g ea alue in si ua ions whe e heal h p o essionals need o make decisions and ake immedia e measu es. La e al- low assays we e also p e iously desc ibed o he diagnosis o LD (Le ne e al., 2013). 1.5.4 – P e en ion, Con ol and T ea men Gi en he inc easing h ea o LD, he need o e ec i e me hods o p o ec agains his disease has ne e been g ea e (Ogden e al., 2013). The op ions o his pu pose a e limi ed, since he e a e no licensed human accines agains Lyme disease and also an a ea-wide and cen ally o ganized ick con ol p og ams a e lacking (Poland, 2011). Howe e , exposu e o icks and B. bu gdo e i s.l. can be con olled, usually a he indi idual pe son o indi idual p ope y le el, wi h se e al ela i ely simple in e en ions (Poland, 2001; Co api e al., 2007; Piesman & Eisen, 2008):  A oiding a eas whe e icks ha ansmi B. bu gdo e i s.l. occu , a imes ha he icks a e ac i e;  Applying pe sonal p o ec i e measu es, such as wea ing app op ia e clo hing, using ick epellen s and clo hing ea men s, and emo ing icks be o e hey can a ach and ansmi B. bu gdo e i s.l.; Chap e 1 S a e o he a 63  Reducing en i onmen al isk by con olling icks and ick in ec ions wi h pes icide applica ions; ese oi - a ge ed in e en ions (e.g., bai boxes); and landscape managemen ;  Using p ophylac ic an ibio ics in an app op ia e manne a e a ick bi e o p e en ansmi ed B. bu gdo e i s.l. om e olu ion o clinical LD. A simple ule o LD is: “i you don’ ge a ick, you don’ ge sick.” P e iously his ule could be achie ed jus by a oiding he a eas whe e LD occu s, howe e , he ange expansion o Ixodes species and LD in USA and Eu ope has changed his, and hese icks a e now ound in mo e egions and ha e also mo ed in o mo e densely popula ed a eas, including on o close o p i a e/ esiden ial p ope ies (S anek & Rei e , 2011; Li e al., 2012; Medlock e al., 2013; Vollme e al., 2013). None heless, a oidance can be a iable isk- educ ion app oach, a leas in some loca ions and si ua ions. I i ’s no possible o a oid he ick habi a s, hen isk educ ion elies on p e en ing bi es o emo e a ached icks be o e hey ha e ime o ansmi Bo elia. This can be accomplished by wea ing app op ia e clo hing, like ligh -colo ed and long-slee e shi s, socks, and ull ouse s; o use app o ed, opical epellen s like DEET (N,N-die hl-me a- oluamide) and pe me h in based p oduc s, on skin o wea insec icide- ea ed clo hing; do ick checks a leas once a day and emo e any icks ha a e ound wi h ine- ipped, s i , and angled o ceps ( weeze s) placed a ound he head o he ick as nea as possible o he skin, ollowed by a s eady, upwa d pulling mo emen (Figu e 25) (Piesman & Dolan, 2002; Dusche e al., 2012); inally ba h o showe soon a e lea ing ick habi a , wi hin he wo ollowing hou s. Figu e 25 - Scheme showing how o emo e a ick. (Sou ce: adap ed om h p://www.heal h.ha a d.edu/blog/ma chless-s a egy- o - ick- emo al-6-s eps- o-a oid- ick-bi es 201306076360). Chap e 1 S a e o he a 64 LD accina ion is s ill a p oblem, since he e is no licensed human accine. Al hough, some s udies de end ha his disease can be p e en ed by accina ion wi h he OspA (Edelman e al., 1999; Rahn, 2001). A accine a ge ing LB (LYME ix) based on OspA om B. bu gdo e i s.l. was es ed, and show o be e ec i e, being a ailable in he USA om 1998 o 2000 (Golde e al., 1995; S ee e e al., 1998). Howe e , he du a ion o his accine was ela i ely sho , and i was emo ed om he ma ke by i s manu ac u e in 2002. Cu en ly, e o s a e being made owa ds he de elopmen o a b oadly p o ec i e LB accine. Se e al p o eins ha e been assessed as po en ial accine candida es. (Ma coni & Ea nha , 2010; Coms ed e al., 2015). Rega ding he ea men o LD, his is ou inely wi h an ibio ics; he apy has ens he esolu ion and la gely p e en s he de elopmen o o he disease mani es a ions. The classes o an ibio ics ha ha e shown he g ea es e ec i eness agains Bo elia spi oche es a e b-lac ams (in pa icula cephalospo ins) e acyclines and, o a lesse ex en , mac olides. The bes ea men app oach, in pa icula he du a ion o he apy, is a ma e o ongoing deba e. I is qui e e iden ha no all pa ien s, and mos ce ainly no all species o s ains o Bo elia espond equally o he an ibio ics mos commonly used in he ea men o LD (P eac-Mu sic e al., 1996). Based on he a ailable e idence om andomized con olled ials, ea men ecommenda ions ha e been published by he In ec ious Diseases Socie y o Ame ica (IDSA) (Wo mse e al., 2006), he Ame ican Academy o Pedia ics, and by a a ie y o na ional and sup ana ional associa ions in Eu ope (Mygland e al., 2010; EUCALB). Bo h guidelines published by he IDSA and he EUCALB, a e simila on bo h sides o he A lan ic ega ding he app oaches o he apy, ye he e a e some di e ences in he ecommended dosage and ea men du a ion. 1.6 – Objec i es and hesis plan In Po ugal LD s ill emains unde diagnosed and unde epo ed. Despi e he exis ence o he ec o in he coun y and he iden i ica ion and isola ion o se e al genospecies o B. bu gdo e i s.l. om pa ien samples and om he ec o , he ue p e alence o he Chap e 1 S a e o he a 65 disease is s ill unknown. Howe e , an inc ease impo ance has been gi en o his disease wo ldwide, which is cu en ly conside ed an eme ging disease. The diagnosis i is mainly clinic, al hough he labo a o y in o ma ion based in se ologic o molecula assays, is a undamen al suppo con ibu ing o an adequa e and imely ea men , and a he same ime, helping o limi he isk o esis ances o ea men s o he e olu ion o he in ec ion o a ch onic si ua ion, esul ing in high cos s o he pa ien and o he communi y. Objec i es The main goals o he p esen s udy we e o e alua e he p e alence o LD agen s in he Po uguese ixodo auna, mainly in I. icinus ec o and in syl a ic and domes ic hos s; and o de elop wo new molecula me hodologies o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope. Thus, his hesis was di ided in o ou main pa s: 1) To e alua e he bio-ecological cha ac e is ics o he ixodids collec ed in he selec dis ic s om Po ugal; 2) To analyze ec o -pa hogen-hos ela ionships as hey happen in na u e, he e o e gaining insigh in o he di e si y and p e alence o B. bu gdo e i s.l. o ganisms in di e en hos s and ick species; 3) To de elop and op imize a eal- ime PCR assay o he iden i ica ion and quan i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope/Po ugal; 4) To de elop wo duplex Loop-Media ed Iso he mal DNA Ampli ica ion Assays (dLAMP) coupled wi h colo ime ic la e al low de ices, o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope/Po ugal; Thesis plan This disse a ion is o ganized in o six chap e s. In chap e 1, a gene al heo e ical in oduc ion emb acing he subjec unde s udy is p esen ed, wi h emphasis o he opics ega ding he majo cha ac e is ics o he B. bu gdo e i s.l. complex membe s, and i s labo a o y diagnosis; chap e 2 cha ac e ize bio-ecologically he icks as ec o s, Chap e 1 S a e o he a 66 collec ed om he ege a ion and hos s in p e iously selec ed dis ic s om mainland Po ugal, and de e mined he in ec ion a e by B. bu gdo e i s.l.; in chap e 3 he ec o - pa hogen ela ionships in na u e a e analyzed; in chap e 4 he pa hogen-hos ela ionship is e alua ed; in chap e 5 he de elopmen o a apid iden i ica ion eal- ime PCR algo i hm o B. bu gdo e i s.l. complex species using speci ic dual-labelled hyd olysis p obes in a mul iplex o ma a e desc ibed, and also wo duplex Loop-Media ed Iso he mal DNA Ampli ica ion assay (dLAMP) coupled wi h colo ime ic la e al low de ices, o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l.. Finally, in chap e 6, conside a ions abou he wo k p esen ed and he main esul s ha we e achie ed a e highligh ed, as long as sugges ions o u u e wo k. Chap e 1 S a e o he a 73 PCR: E ec s o dye concen a ion and sequence composi ion on DNA ampli ica ion and mel ing empe a u e. Nucleic Acids Resea ch, 35(19): 1–8. doi: 10.1093/na /gkm671; Guiguen C and Degeilh B. (2001). Les iques d’in é ê médical : ôle ec eu e diagnose de labo a oi e. Re ue F ançaise des Labo a oi es, 338: 49–57. doi:10.1016/S0338-9898(01)80351- 6; Gune ES, Wa anabe M, Hashimo o N, e al. (2004). Bo elia u cica sp. no ., isola ed om he ha d ick Hyalomma aegyp ium in Tu key. In e na ional Jou nal o Sys ema ic and E olu iona y Mic obiology, 54(5): 1649–1652. doi: 10.1099/ijs.0.03050-0; Guy EC and S anek G. (1991). De ec ion o Bo elia bu gdo e i in pa ien s wi h Lyme disease by he polyme ase chain eac ion. Jou nal o Clinical Pa hology, 44(7): 610–1. Hame SA, Tsao JI, Walke ED, e al. (2009). Use o ick su eys and se osu eys o e alua e pe dogs as a sen inel species o eme ging Lyme disease. Ame ican Jou nal o Ve e ina y Resea ch, 70(1): 49–56. doi: 10.2460/aj .70.1.49; Handeland K, Q ille L, Vikø en T, e al. (2013). Ixodes icinus in es a ion in ee- anging ce ids in No way-a s udy based upon ea examina ions o hun ed animals. Ve e ina y Pa asi ology, 195(1-2): 142–9. doi: 10.1016/j. e pa .2013.02.012; Haninco á K, Schä e SM and E i S. (2003). Associa ion o Bo elia a zelii wi h oden s in Eu ope. Pa asi ology, 126: 11–20; Hayes SF and Bu gdo e W. (1993). Ul as uc u e o Bo elia bu gdo e i. Webe K, Bu gdo e W, Schie z G, edi o s. In: Aspec s o Lyme Bo eliosis, Sp inge -V, p.29–43; Heyman P, Cochez C, Ho huis A, e al. (2010). A clea and p esen dange : ick-bo ne diseases in Eu ope. Expe Re iew o An i-In ec i e The apy, 8(1): 33–50. doi: 10.1586/e i.09.118; Heymann WR and Ellis DL. (2012). Bo elia bu gdo e i In ec ions in he Uni ed S a es. The Jou nal o Clinical and Aes he ic De ma ology, 5(8): 18–28; Higuchi R, Dollinge G, Walsh PS e al. (1992). Simul aneous ampli ica ion and de ec ion o speci ic DNA sequences. Bio echnology (Na u e Publishing Company), 10(4): 413–7; Hi sch eld M, Ki schning CJ, Schwandne R, e al. (1999). Cu ing edge: in lamma o y signaling by Bo elia bu gdo e i lipop o eins is media ed by oll-like ecep o 2. Jou nal o Immunology, 163(5): 2382–2386; Hu L. (2005). Lyme a h i is. In ec ious Disease Clinics o No h Ame ica, 19(4): 947–961. doi: 10.1016/j.idc.2005.07.007; Huang W, Ojaimi C, Fallon JT, e al. (2015). Genome Sequence o Bo elia chilensis VA1, a Sou h Ame ican Membe o he Lyme Bo eliosis G oup. Genome Aannouncemen s, 3(1): e01535-14. doi: 10.1128/genomeA.01535-14; Hubálek Z and Halouzka J. (1998). P e alence a es o Bo elia bu gdo e i sensu la o in hos - seeking Ixodes icinus icks in Eu ope. Pa asi ology Resea ch, 84(3): 167–72; Humai PF, Tu ian N, Aeschilimann A e al. (1993). Bo elia bu gdo e i in a ocus o Lyme bo eliosis: epizoo iologic con ibu ion o small mammals. Folia Pa asi ologica, 40(1): 65–70; Inoue K, Fe an e P, Hi ano Y, e al. (2007). A compe i i e immunoch oma og aphic assay o es os e one based on elec ochemical de ec ion. Talan a, 73(5): 886–892. Chap e 1 S a e o he a 74 doi:10.1016/j. alan a.2007.05.008; Ishigu o T, Sai oh J, Yawa a H, e al. (1995). Homogeneous quan i a i e assay o hepa i is C i us RNA by polyme ase chain eac ion in he p esence o a luo escen in e cala e . Analy ical Biochemis y, 229(2): 207–13. doi:10.1006/abio.1995.1404; I acic L, Reed KD, Mi chell PD. (2007). A Ligh Cycle TaqMan assay o de ec ion o Bo elia bu gdo e i sensu la o in clinical samples. Diagnos ic Mic obiology and In ec ious Disease, 57(2): 137–143. doi:10.1016/j.diagmic obio.2006.08.005; Iye R, Kalu O, Pu se J, e al. (2003). Linea and ci cula plasmid con en in Bo elia bu gdo e i clinical isola es. In ec ion and Immuni y, 71(7): 3699–3706. doi: 10.1128/IAI.71.7.3699- 3706.2003; Jaenson TGT and Jensen J. (2007). Reco ds o icks (Aca i, Ixodidae) om he Fa oe Islands. Ag icul u e, 54: 11–15; Johnson BJ, Happ CM, Maye LW e al. (1992). De ec ion o Bo elia bu gdo e i in icks by species-speci ic ampli ica ion o he lagellin gene. The Ame ican Jou nal o T opical Medicine and Hygiene, 47(6): 730–41; Johnson RC, Schmid GP, Hyde FW, e al. (1984). Bo elia bu gdo e i sp. no .: E iologic Agen o Lyme Disease. In e na ional Jou nal o Sys ema ic Bac e iology, 34(4): 496–497; Kalish RA, McHugh G, G anquis J, e al. (2001). Pe sis ence o immunoglobulin M o immunoglobulin G an ibody esponses o Bo elia bu gdo e i 10-20 yea s a e ac i e Lyme disease. Clinical in ec ious diseases, 33(6): 780–5. doi: 10.1086/322669; Kalma Z, Cozma V, Sp ong H, e al. (2015). T anss adial ansmission o Bo elia u cica in Hyalomma aegyp ium icks. PLoS ONE, 10(2): 1–9. doi: 10.1371/jou nal.pone.0115520; Kal enboeck B and Wang C. (2005). Ad ances in Real-Time PCR: Applica ion o Clinical Labo a o y Diagnos ics. Ad ances in Clinical Chemis y, 40(05): 219–259; Ka ami A. (2012). Molecula Biology o Bo elia bu gdo e i. Ka ami edi o . In: Lyme Disease. InTech, p. 1–26; Kohn J. (1968). An immunoch oma og aphic echnique. Immunology, 6: 863-865; Ko enbe g E, Go elo a N and Ko ale skii Y. (2002). Ecology o Bo elia bu gdo e i sensu la o in Russia. G ay JS, Kahl O, Lane RS, S anek G, edi o s. In: Lyme bo eliosis: biology, epidemiology and con ol. CABI Book, p. 175. doi:10.1079/9780851996325.0000; K upka I and S aubinge RK. (2010). Lyme Bo eliosis in Dogs and Ca s: Backg ound, Diagnosis, T ea men and P e en ion o In ec ions wi h Bo elia bu gdo e i sensu s ic o. Ve e ina y Clinics o No h Ame ica - Small Animal P ac ice, 40(6): 1103–1119. doi: 10.1016/j.c sm.2010.07.011; K upka M, Raska M, Belako a J, e al. (2007). Biological aspec s o Lyme disease spi oche es: unique bac e ia o he Bo elia bu gdo e i species g oup. Biomedical pape s o he Medical Facul y o he Uni e si y Palack,Olomouc, Czechoslo akia, 151(2): 175–186; Ku enbach K, Ca ey D, Hoodless AN, e al. (1998). Compe ence o pheasan s as ese oi s o Lyme disease spi oche es. Jou nal o Medical En omology, 35: 77–81; Ku enbach K, Haninco á K, Tsao JI, e al. (2006). Fundamen al p ocesses in he e olu iona y Chap e 1 S a e o he a 75 ecology o Lyme bo eliosis. Na u e e iews. Mic obiology, 4(9): 660–669. doi:10.1038/n mic o1475; Ku enbach K, Kampen H, Dizij A, e al. (1995). In es a ion o oden s wi h la al Ixodes icinus (Aca i: Ixodidae) is an impo an ac o in he ansmission cycle o Bo elia bu gdo e i s.l. in Ge man woodlands. Jou nal o Medical En omology, 32(6): 807–817; Le Fleche A, Pos ic D, Gi a de K, e al. (1997). Cha ac e iza ion o Bo elia lusi aniae sp. no . by 16S ibosomal DNA sequence analysis. In e na ional Jou nal o Sys ema ic Bac e iology, 47(4): 921–925; Lelo as P, Don as I, Bassiakou E e al. (2008). Ca diac implica ions o Lyme disease, diagnosis and he apeu ic app oach. In e na ional Jou nal o Ca diology, 129(1): 15–21. doi: 10.1016/j.ijca d.2008.01.044; Le ne MB, Dailey J, Goldsmi h BR, e al. (2013). De ec ing Lyme disease using an ibody- unc ionalized single-walled ca bon nano ube ansis o s. Biosenso s and Bioelec onics, 45: 163–167. doi: 10.1016/j.bios.2013.01.035; Le y SA and Magna elli LA. (1992). Rela ionship be ween de elopmen o an ibodies o Bo elia bu gdo e i in dogs and he subsequen de elopmen o limb/join bo eliosis. Jou nal o he Ame ican Ve e ina y Medical Associa ion, 200(3): 344–347; Leyde BF and Liang FT. (2014). De ec ion o Lyme Bo elia in ques ing Ixodes scapula is (Aca i: Ixodidae) and small mammals in Louisiana. Jou nal o Medical En omology, 51(1): 278– 82. doi: 10.1603/ME12273; Li S, Ha emink N, Speyb oeck N, e al. (2012). Consequences o Landscape F agmen a ion on Lyme Disease Risk: A Cellula Au oma a App oach. PLoS ONE, 7(6): e39612. doi: 10.1371/jou nal.pone.0039612; Li X, McHugh GA, Damle N, e al. (2011). Bu den and iabili y o Bo elia bu gdo e i in skin and join s o pa ien s wi h e y hema mig ans o lyme a h i is. A h i is and Rheuma ism, 63(8): 2238–2247. doi: 10.1002/a .30384; Limbach FX, Jaulhac B, Piémon Y, e al. (1999). One-s ep e e se ansc ip ase PCR me hod o de ec ion o Bo elia bu gdo e i mRNA in mouse lyme a h i is issue samples. Jou nal o Clinical Mic obiology, 37(6): 2037–2039; Lindg en E and Jaenson TGT. (2006). Lyme bo eliosis in Eu ope: in luences o clima e and clima e change, epidemiology, ecology and adap a ion measu es. Copenhagen: Wo ld Heal h O ganiza ion Regional O ice o Eu ope, p.35: Lindg en E, Tälleklin L and Pol eld T. (2000). Impac o clima ic change on he no he n la i ude limi and popula ion densi y o he disease- ansmi ing Eu opean ick Ixodes icinus. En i onmen al Heal h Pe spec i es, 108(2): 119–23; Li e is D, Schwa z I, Bi ke S, e al. (2011). Imp o ing he yield o blood cul u es om pa ien s wi h ea ly Lyme disease. Jou nal o Clinical Mic obiology, 49(6): 2166–2168. doi: 10.1128/JCM.00350-11; Li e is D, Schwa z I, McKenna D, e al. (2012). Compa ison o i e diagnos ic modali ies o di ec de ec ion o Bo elia bu gdo e i in pa ien s wi h ea ly Lyme disease. Diagnos ic Mic obiology and In ec ious Disease, 73(3): 243–5. doi: 10.1016/j.diagmic obio.2012.03.026; Chap e 1 S a e o he a 76 Li e is D, Va de S, Iye R, e al. (1999). Gene ic di e si y o Bo elia bu gdo e i in lyme disease pa ien s as de e mined by cul u e e sus di ec PCR wi h clinical specimens. Jou nal o Clinical Mic obiology 37(3): 565–9; Li e is D, Wang G, Gi ao G, e al. (2002). Quan i a i e de ec ion o Bo elia bu gdo e i in 2- millime e skin samples o e y hema mig ans lesions: co ela ion o esul s wi h clinical and labo a o y indings. Jou nal o Clinical Mic obiology 40(4): 1249–53. doi: 10.1128/JCM.40.4.1249-1253.2002; Longo MC, Be ninge MS and Ha ley JL. (1990). Use o u acil DNA glycosylase o con ol ca y-o e con amina ion in polyme ase chain eac ions. Gene, 93(1): 125–128; Lopes de Ca alho I and Núncio MS. (2006). Labo a o y diagnosis o Lyme bo eliosis a he Po uguese Na ional Ins i u e o Heal h (1990-2004). Eu o su eillance : Eu opean Communicable Disease Bulle in, 11(10): 257–60; López.Ma zo AM, Pons J, Blake DA e al. (2013). All-in eg a ed and highly sensi i e pape based de ice wi h sample ea men pla o m o Cd2+ immunode ec ion in d inking/ ap wa e s. Analy ical Chemis y, 85(7): 3532–3538. doi: 10.1021/ac3034536; Malloy DC, Nauman RK and Pax on H. (1990). De ec ion o Bo elia bu gdo e i using he polyme ase chain eac ion. Jou nal o Clinical Mic obiology, 28(6): 1089–1093. Mannelli A, Be olo i L, Ge n L e al. (2012). Ecology o Bo elia bu gdo e i sensu la o in Eu ope: ansmission dynamics in mul i-hos sys ems, in luence o molecula p ocesses and e ec s o clima e change. FEMS Mic obiology Re iews, 36(4): 837–861. doi: 10.1111/j.1574- 6976.2011.00312.x; Man o ani E, Ma angoni RG, Gaudi ano G, e al. (2012). Ampli ica ion o he lgE gene p o ides e idence o he exis ence o a B azilian bo eliosis. Re is a do Ins i u o de Medicina T opical de São Paulo, 54(3): 153–7. Doi: 10.1590/S0036-46652012000300007; Mao F, Leung WY and Xin X. (2007) Cha ac e iza ion o E aG een and he implica ion o i s physicochemical p ope ies o qPCR applica ions. BMC Bio echnology, 7: 76. doi: 10.1186/1472-6750-7-76; Ma coni RT and Ea nha CG. (2010). Lyme Disease Vaccines. In: Samuels DS and Radol JD, edi o s. Bo elia: Molecula Biology, Hos In e ac ion and Pa hogenesis, No olk, UK: Cais e Academic P ess, p. 467–486; Ma aspin V, Og inc K, Ružić-Sabljić E, e al. (2011). Isola ion o Bo elia bu gdo e i sensu la o om blood o adul pa ien s wi h bo elial lymphocy oma, Lyme neu obo eliosis, Lyme a h i is and ac ode ma i is ch onica a ophicans. In ec ion, 39(1): 35–40. doi: 10.1007/s15010-010-0062- 8; Ma gos G, Vollme SA, Co ne M, e al (2009). A new Bo elia species de ined by mul ilocus sequence analysis o housekeeping genes. Applied and En i onmen al Mic obiology, 75(16): 5410–5416. doi: 10.1128/AEM.00116-09; Ma gos G, Vollme SA, Ogden NH, e al. (2011). Popula ion gene ics, axonomy, phylogeny and e olu ion o Bo elia bu gdo e i sensu la o. In ec ion, Gene ics and E olu ion, 11: 1545-1563. doi: 10.1016/j.meegid.2011.07.022 Ma ques AR. (2010). Lyme Disease: A Re iew. Cu en Alle gy As hma Repo s, 10: 13–20. doi: 10.1007/s11882-009-0077-3; Chap e 1 S a e o he a 77 Ma ques AR. (2015). Labo a o y Diagnosis o Lyme Disease: ada ances and chalenges. In ec ious Disease Clinics o No h Ame ica, 29(2): 295–307. doi: 10.1016/j.idc.2015.02.005; Má quez-Jiménez FJ, Hidalgo-Pon i e os A, Con e as-Cho a F, e al. (2005). Ticks (Aca ina: Ixodidae) as ec o s and ese oi s o pa hogen mic oo ganisms in Spain. En e medades In ecciosas y Mic obiología Clínica, 23(2): 94–102; Ma man HL. (2001). Cell Wall De icien Fo ms, Thi d Edi ion: S eal h Pa hogens. CRC P ess. pp. 405; Mayne P, Song S, Shao R e al. (2014). E idence o Ixodes holocyclus (Aca ina: Ixodidae) as a Vec o o Human Lyme Bo eliosis In ec ion in Aus alia. Jou nal o Insec Science, 14(1): 271– 271. doi: 10.1093/jisesa/ieu133; McCoy BN, Maïga O and Schwan TG. (2014). De ec ion o Bo elia heile i in Rhipicephalus geigyi om Mali. Ticks and Tick-Bo ne Diseases, 5(4): 401–3. doi: 10.1016/j. bdis.2014.01.007; Medlock JM, Hans o d KM, Bo mane A. (2013). D i ing o ces o changes in geog aphical dis ibu ion o Ixodes icinus icks in Eu ope. Pa asi es & Vec o s, 6(1): 1. doi: 10.1186/1756- 3305-6-1; Mi ani H, Talbe A and Fukunaga M. (2004). New Wo ld elapsing e e Bo elia ound in O ni hodo os po cinus icks in cen al Tanzania. Mic obiology and Immunology, 48 (7): 501– 505. doi: 10.1111/j.1348-0421.2004. b03545.x; Monis PT and Giglio S. (2006). Nucleic acid ampli ica ion-based echniques o pa hogen de ec ion and iden i ica ion. In ec ion, Gene ics and E olu ion, 6(1): 2–12. doi:10.1016/j.meegid.2005.08.004; Monis PT, Giglio S and Sain CP. (2005). Compa ison o SYTO9 and SYBR G een I o eal- ime polyme ase chain eac ion and in es iga ion o he e ec o dye concen a ion on ampli ica ion and DNA mel ing cu e analysis. Analy ical Biochemis y, 340(1): 24–34; Mo i Y, Nagamine K, Tomi a N e al. (2001). De ec ion o loop-media ed iso he mal ampli ica ion eac ion by u bidi y de i ed om magnesium py ophospha e o ma ion. Biochemical and Biophysical Resea ch Communica ions, 289(1): 150–154. doi:10.1006/bb c.2001.5921; Mo i Y, Hi ano T and No omi T. (2006). Sequence speci ic isual de ec ion o LAMP eac ions by addi ion o ca ionic polyme s. BMC bio echnology, 6: 3. doi: 10.1186/1472-6750-6-3; Mo i Y, Ki ao M, Tomi a N e al. (2004). Real- ime u bidime y o LAMP eac ion o quan i ying empla e DNA. Jou nal o Biochemical and Biophysical Me hods, 59(2): 145–157. doi:10.1016/j.jbbm.2003.12.005; Mo i Y and No omi T. (2009). Loop-media ed iso he mal ampli ica ion (LAMP): A apid, accu a e, and cos -e ec i e diagnos ic me hod o in ec ious diseases. Jou nal o In ec ion and Chemo he apy ,15(2): 62–69. Doi: 10.1007/s10156-009-0669-9; Mo he shed EA and Whi ney AM. (2006). Nucleic acid-based me hods o he de ec ion o bac e ial pa hogens: p esen and u u e conside a ions o he clinical labo a o y. Clinical Chimica Ac a: In e na ional Jou nal o Clinical Chemis y, 363(1-2): 206–220. doi:10.1016/j.cccn.2005.05.050; Mo ila A, Tode as I and Dubinina H. (2012). Zoono ic Peculia i ies o Bo elia bu gdo e i s .l.: Chap e 1 S a e o he a 78 Vec o s Compe ence and Ve eb a e Hos Speci ici y. Ka ami edi o . In: Lyme Disease, pp. 27– 54; doi: 10.5772/32690; Müllegge R and Gla z M. (2008). Skin mani es a ions o lyme bo eliosis: diagnosis and managemen . Ame ican Jou nal o Clinical De ma ology, 9(6): 355–68. doi: 10.2165/0128071- 200809060-00002; Mullegge RR. (2004). De ma ological mani es a ions o Lyme bo eliosis. Eu opean -jou nal o De ma ology, 14(5): 296–309; Mülle -Doblies U and Wikel S. (2005). The human eac ion o icks (Washing on). In: Goodman J, Dennis D and and Sonenshine D, edi o s. In: Tick-Bo ne Diseases o Humans. ASM P ess, pp. 440. doi:10.3201/eid1111.051160; Mülle -Doblies U, Maxwell SS, Boppana VD, e al. (2007). Feeding by he ick, Ixodes scapula is, causes CD4+ T cells esponding o cogna e an igen o de elop he capaci y o exp ess IL-4. Pa asi e Immunology, 29(10): 485–499. Doi: 10.1111/j.1365-3024.2007.00966.x; Mu ay PR, Rosen hal KS, and P alle MA. (2008). Medical Mic obiology, (6 h edi ion). Mosby Else ie , pp. 848; Mygland Å, Ljøs ad U, Finge le V, e al. (2010). EFNS guidelines on he diagnosis and managemen o Eu opean lyme neu obo eliosis. Eu opean Jou nal o Neu ology, 17(1): 8–16. doi: 10.1111/j.1468-1331.2009.02862.x; Nadda S, Ghazinezhad BSM. (2015). Tickbo ne elapsing e e in sou he n I an, 2011–2013. Eme ging In ec ious Diseases, 21: 1078–1080. doi: h p://dx.doi.o g/10.3201/eid2106.141715; Nadelman RB, Nowakowski J, Fo se e G, e al. (1993). Failu e o isola e Bo elia bu gdo e i a e an imic obial he apy in cul u e-documen ed Lyme bo eliosis associa ed wi h e y hema mig ans: epo o a p ospec i e s udy. The Ame ican Jou nal o Medicine, 94(6): 583–588; Nagamine K, Hase T and No omi T. (2002). Accele a ed eac ion by loop-media ed iso he mal ampli ica ion using loop p ime s. Molecula and Cellula P obes, 16(3): 223–229. doi:10.1006/mcp .2002.0415; Nagamine K, Wa anabe K, Oh suka K, e al. (2001). Loop-media ed Iso he mal Ampli ica ion Reac ion Using a Nondena u ed Templa e. Clinical Chemis y, 47(9): 1742–1743; Naka E, Cos a I, A ão C, e al. (2008). Pesquisa de an ico pos an i-Bo elia e an i-Babesia em so o de c ianças com mani es ações clínicas e epidemiologia compa í eis com a doença de Lyme- Simile no Es ado de Ma o G osso do Sul. Re is a B asilei a de Reuma ologia, 48(2): 74-85. doi: 10.1590/S0482-50042008000200003; Na a o E, Se ano-He as G, Cas año MJ, e al. (2014). Real- ime PCR de ec ion chemis y. Clinica Chimica Ac a, 439: 231-250. doi: 10.1016/j.cca.2014.10.017; Ne edo a VV, Ko enbe g EI, Go elo a NB e al. (2004). S udies on he anso a ial ansmission o Bo elia bu gdo e i sensu la o in he aiga ick Ixodes pe sulca us. Folia Pa asi ologica, 51(1): 67–71; Nol e O. (2012). Nucleic Acid Ampli ica ion Based Diagnos ic o Lyme (Neu o) bo eliosis - Los in he Jungle o Me hods, Ta ge s, and Assays? The Open Neu ology Jou nal, 6: 129–39. doi: 10.2174/1874205X01206010129; No is SJ. (2012.) How do lyme bo elia o ganisms cause disease? The ques o i ulence Chap e 1 S a e o he a 79 de e minan s. The Open Neu ology Jou nal, 6: 119–23. doi: 10.2174/1874205X01206010119; No omi T, Okayama H, Masubuchi H, e al. (2000). Loop-media ed iso he mal ampli ica ion o DNA. Nucleic Acids Resea ch, 28(12): E63; Nowakowski J, McKenna D, Nadelman RB, e al. (2009). Blood cul u es o pa ien s wi h ex acu aneous mani es a ions o Lyme disease in he Uni ed S a es. Clinical in ec ious diseases, 49(11): 1733–1735. doi: 10.1086/648076; Núncio MS, and Al es MJ. (2014). Doenças associadas a a ópodes e o es e oedo es. Ins i u o Nacional de Saúde D . Rica do Jo ge, IP. Guide – A es G á icas, Lda, pp. 183; Núncio MS, Pé e O, Al es M, Bacella F e al. (1993). Isolamen o e ca ac e ização de bo élias de Ixodes icinus em Po ugal. Re is a Po uguesa de Doenças In ecciosas, 16: 175–179; Núncio MS, Da id de Mo ais JA and Filipe AR. (1992). Pesquisa de an ico pos an i-Bo elia bu gdo e i numa população do dis i o de É o a. Re is a Po uguesa de Doenças In ecciosas, 15: 173–176. Nunes M, Pa ei a R, Lopes N, e al. (2015). Molecula Iden i ica ion o Bo elia miyamo oi in Ixodes icinus om Po ugal. Vec o -Bo ne and Zoono ic Diseases, 15(8): 515–517. doi: 10.1089/ bz.2014.1765; Ogden NH, Lindsay LR and Leigh on PA. (2013). P edic ing he a e o in asion o he agen o Lyme disease Bo elia bu gdo e i. Jou nal o Applied Ecology, 50(2): 510–518. doi: 10.1111/1365-2664.12050; Og inc K, Lo ič-Fu lan S, Ma aspin V, e al. (2013). Suspec ed ea ly Lyme neu obo eliosis in pa ien s wi h e y hema mig ans. Clinical In ec ious Diseases, 57(4): 501–509. doi: 10.1093/cid/ci 317; Oli e JH. (1989). Biology and sys ema ics o icks (Aca i:Ixodida). Annual Re iew o Ecology and Sys ema ics, 20(1): 397–430. Olson PE, Kallen AJ, Bjo neby JM, e al. (2000). Canines as sen inels o Lyme disease in San Diego Coun y, Cali o nia. Jou nal o Ve e ina y Diagnos ic In es iga ion, 12(2): 126–9; Oos ing M, Be ende A, S u m P, al. (2010). Recogni ion o Bo elia bu gdo e i by NOD2 is cen al o he induc ion o an in lamma o y eac ion. The Jou nal o In ec ious Diseases, 201(12): 1849–1858. doi: 10.1086/652871; O ns ein K, Be glund J, Be gs öm S, e al. (2002). Th ee majo Lyme Bo elia genospecies (Bo elia bu gdo e i sensu s ic o, B. a zelii and B. ga inii) iden i ied by PCR in ce eb ospinal luid om pa ien s wi h neu obo eliosis in Sweden. Scandina ian Jou nal o In ec ious Diseases, 34(5): 341–346. doi: 10.1080/00365540110080313; Pal U and Fik ig E. (2010). Ticks In e ac ions. Samuels S, and Radol J, edi o s. In: Bo elia: Molecula Biology, Hos In e ac ion and Pa hogenesis. Cais e Academic P ess, pp. 279–298. Pal U, Li X, Wang T, e al. (2004). TROSPA, an Ixodes scapula is ecep o o Bo elia bu gdo e i. Cell, 119(4): 457–468. doi:10.1016/j.cell.2004.10.027; Pal U, de Sil a AM, Mon gome y RR, e al. (2000). A achmen o Bo elia bu gdo e i wi hin Ixodes scapula is media ed by ou e su ace p o ein A. The Jou nal o Clinical In es iga ion, 106(4): 561–9; Chap e 1 S a e o he a 80 Palacio-Bielsa A, López-So iano P, Bühlmann A, e al. (2015). E alua ion o a eal- ime PCR and a loop-media ed iso he mal ampli ica ion o de ec ion o Xan homonas a bo icola p . p uni in plan issue samples. Jou nal o Mic obiological Me hods, 112: 36–39. doi:10.1016/j.mime .2015.03.005; Palma M, Lopes de Ca alho I, Figuei edo M, e al. (2012). Bo elia hispanica in O ni hodo os e a icus, Po ugal. Clinical Mic obiology and In ec ion, 18(7): 696–701. doi: 10.1111/j.1469- 0691.2011.03623.x; Papadopoulos B, Nuncio M and Filipe A. (1992). The occu ence o Rhipicephalus u anicus Pome an ze , Ma iskas ili & Lo o zky, 1940, a species o Rhipicephalus sanguineus g oup, in Po ugal. Aca ologia, 33: 331–333; Pa ola P and Raoul D. (2001). Ticks and ickbo ne bac e ial diseases in humans: an eme ging in ec ious h ea . Clinical In ec ious Diseases, 32(6): 897–928. Passos S, Gaze a R and La o e M. (2009). Ca ac e ís icas clínico-epidemiológicas da doença de Lyme-símile em c ianças. Re is a da Associação Medica B asilei a, 55(2): 139–144; Paș iu AI, Ma ei IA, Mihalca AD, e al. (2012). Zoono ic pa hogens associa ed wi h Hyalomma aegyp ium in endange ed o oises: e idence o hos -swi ching beha iou in icks? Pa asi es & ec o s, 5: 301. doi: 10.1186/1756-3305-5-301; Pa ican LA. (1997). Acquisi ion o Lyme disease spi oche es by co eeding Ixodes scapula is icks. Ame ican Jou nal o T opical Medicine and Hygiene, 57(5): 589–593; Pel omaa M, McHugh G and S ee e AC. (2003). Pe sis ence o he an ibody esponse o he VlsE six h in a ian egion (IR6) pep ide o Bo elia bu gdo e i a e success ul an ibio ic ea men o Lyme disease. The Jou nal o In ec ious Diseases, 187(8): 1178–1186. doi: 10.1086/374376; Pe uski AH and Pe usk, LF J . (2003). Immunological me hods o de ec ion and iden i ica ion o in ec ious disease and biological wa a e agen s. Clinical and Diagnos ic Labo a o y Immunology, 10: 506-13. Pe e J-L, Rais O and Ge n L. (2004). In luence o Clima e on he P opo ion o Ixodes icinus Nymphs and Adul s Ques ing in a Tick Popula ion. Jou nal o Medical En omology 41(3): 361– 365. doi:10.1603/0022-2585-41.3.361; Pe sing DH, Ru ledge BJ, Rys PN, e al. (1994). Ta ge imbalance: dispa i y o Bo elia bu gdo e i gene ic ma e ial in syno ial luid om Lyme a h i is pa ien s. Jou nal o In ec ious Diseases, 169(3): 668–672; Pe zke MM, B ooks A, K upna MA, e al. (2009). Recogni ion o Bo elia bu gdo e i, he Lyme disease spi oche e, by TLR7 and TLR9 induces a ype I IFN esponse by human immune cells. Jou nal o Immunology, 183(8): 5279–5292. doi: 10.4049/jimmunol.0901390; Picken MM, Picken RN, Han D, e al. (1997). A wo yea p ospec i e s udy o compa e cul u e and polyme ase chain eac ion ampli ica ion o he de ec ion and diagnosis o Lyme bo eliosis. Jou nal o Clinical Pa hology, 50: 186–193; Picken MM, Picken RN, Han D, e al. (1996). Single- ube nes ed polyme ase chain eac ion assay based on Flagellin gene sequences o de ec ion o Bo elia bu gdo e i sensu la o. Eu opean Jou nal o Clinical Mic obiology & In ec ious Diseases, 15(6): 489–98; Piesman J. (1993). S anda d Sys em o In ec ing Ticks (Aca i: Ixodidae) wi h he Lyme Disease Chap e 1 S a e o he a 81 Spi oche e, Bo elia bu gdo e i. Jou nal o Medical En omology, 30(1): 199–203; Piesman J and Dolan MC. (2002). P o ec ion agains lyme disease spi oche e ansmission p o ided by p omp emo al o nymphal Ixodes scapula is (Aca i: Ixodidae). Jou nal o Medical En omology, 39(3): 509–512. Piesman J and Eisen L. (2008) P e en ion o Tick-Bo ne Diseases. Annual Re iews o En omology, 53: 323–43. doi: 10.1146/annu e .en o.53.103106.093429; Piesman J and Ge n L. (2004). Lyme bo eliosis in Eu ope and No h Ame ica. Pa asi ology, 129: 191-220; Piesman J and Happ CM. (2001). The e icacy o co- eeding as a means o main aining Bo elia bu gdo e i: a No h Ame ican model sys em. Jou nal o Vec o Ecology, 26(2): 216–20; Poland GA. (2001). P e en ion o Lyme disease: a e iew o he e idence. Mayo Clinic p oceedings, 76(7): 713–24. doi:10.4065/76.7.713; Poland GA. (2011). Vaccines agains Lyme disease: Wha happened and wha lessons can we lea n? Clinical In ec ious Diseases, 52(3): 253–258. doi: 10.1093/cid/ciq116; Pollack RJ, Tel o d SR and Spielman A. (1993). S anda diza ion o medium o cul u ing Lyme disease spi oche es. Jou nal o Clinical Mic obiology, 31(5): 1251–5; Posey JE and Ghe a dini FC. (2000). Lack o a ole o i on in he Lyme disease pa hogen. Science, 288(5471): 1651–1653. Pos ic D, Assous MV, G imon PA. (1994). Di e si y o Bo elia bu gdo e i sensu la o e idenced by es ic ion agmen leng h polymo phism o (5S)- l (23S) in e genic space amplicons. In e na ional Jou nal o Sys ema ic Bac e iology, 44(4): 743–752; P eac Mu sic V, Wanne G, Reinha d S, e al. (1996). Fo ma ion and cul i a ion o bo elia bu gdo e i sphe oplas -L- o m a ian s. In ec ion, 24(3): 218–226; P eechakasedki P, Pinwa ana K, Dungchai W. (2012). De elopmen o a one-s ep immunoch oma og aphic s ip es using gold nanopa icles o he apid de ec ion o Salmonella yphi in human se um. Biosenso s & bioelec onics, 31(1): 562–6. doi: 10.1016/j.bios.2011.10.031; P ice CP. (2001). Poin o ca e es ing. BMJ, 322: 1285–1288. doi: 10.1136/bmj.322.7297.1285 P iem S, Ri ig MG, Kam ad T, e al. (1997). An op imized PCR leads o apid and highly sensi i e de ec ion o Bo elia bu gdo e i in pa ien s wi h Lyme bo eliosis. Jou nal o Clinical Mic obiology 35(3): 685–90; P i BS, Mead PS, Johnson DKH, e al. (2016). Iden i ica ion o a no el pa hogenic Bo elia species causing Lyme bo eliosis wi h unusually high spi ochae aemia: a desc ip i e s udy. The Lance In ec ious Diseases, 3099(15): 1–9. doi: 10.1016/S1473-3099(15)00464-8; Qiu W-G, B uno JF, McCaig WD, e al. (2008). Wide dis ibu ion o a high- i ulence Bo elia bu gdo e i clone in Eu ope and No h Ame ica. Eme ging In ec ious Diseases, 14: 1097–1104. doi: 10.3201/eid1407.070880; Quesada-González D and Me koçi A. (2015). Nanopa icle-based la e al low biosenso s. Biosenso s and Bioelec onics, 73: 47–63. doi:10.1016/j.bios.2015.05.050; Radol JD, Caimano MJ, S e enson B e al. (2012). O icks, mice and men: unde s anding he Chap e 1 S a e o he a 82 dual-hos li es yle o Lyme disease spi ochae es. Na u e Re iews Mic obiology, 87–99. doi: 10.1038/n mic o2714; Rahn DW. (2001). Lyme Vaccine: Issues and Con o e sies. In ec ious Disease Clinics o No h Ame ica, 15: 171-187; doi:10.1016/S0891-5520(05)70274-9; Randolph SE and C aine NG. (1995). Gene al amewo k o compa a i e quan i a i e s udies on ansmission o ick-bo ne diseases using Lyme bo eliosis in Eu ope as an example. Jou nal o Medical En omology, 32(6): 765–777; Randolph SE and S o ey K. (1999). Impac o mic oclima e on Imma u e Tick-Roden Hos In e ac ions (Aca i: Ixodidae): Implica ions o Pa asi e T ansmission. Jou nal o Medical En omology, 36(6): 741–748; Ranka R, Bo mane A, Salmina K e al. (2004). Iden i ica ion o h ee clinically ele an Bo elia bu gdo e i sensu la o genospecies by PCR- es ic ion agmen leng h polymo phism analysis o 16S-23S ibosomal DNA space amplicons. Jou nal o Clinical Mic obiology, 42(4): 1444–9. doi: 10.1128/JCM.42.4.1444-1449.2004; Rau e C and Ha ung T. (2005) P e alence o Bo elia bu gdo e i sensu la o genospecies in Ixodes icinus icks in Eu ope: a me aanalysis. Applied and En i onmen al Mic obiology, 71(11): 7203–16. doi: 10.1128/AEM.71.11.7203-7216.2005; Rau e C, Oehme R, Di e ich I, e al. (2002). Dis ibu ion o clinically ele an Bo elia genospecies in icks assessed by a no el, single- un, eal- ime PCR. Jou nal o Clinical Mic obiology, 40(1): 36–43. doi: 10.1128/JCM.40.1.36-43.2002; Reed KD. (2002). Labo a o y es ing o Lyme disease: possibili ies and p ac icali ies. Jou nal o Clinical Mic obiology, 40(2): 319–24. doi: 10.1128/JCM.40.2.319-324.2002; Rich e D, Schlee DB, Allgöwe R e al. (2004). Rela ionships o a no el Lyme disease spi oche e, Bo elia spielmani sp. no ., wi h i s hos s in Cen al Eu ope. Applied and En i onmen al Mic obiology, 70: 6414–6419. doi: 10.1128/AEM.70.11.6414-6419.2004; Rich e D, Sch öde B, Ha mann NK e al. (2013). Spa ial s a i ica ion o a ious Lyme disease spi oche es in a Cen al Eu opean si e. FEMS Mic obiology Ecology, 83(3): 738–744. doi: 10.1111/1574-6941.12029; Rijpkema S, Nieuwenhuijs J, F anssen FFJ e al. (1994). In ec ion a es o Bo elia bu gdo e i in di e en ins a s o lxodes icinus icks om he Du ch No h Sea Island o Ameland. Expe imen al & Applied Aca ology, 18: 531–542; Rijpke na SGT, Taxelaa D, Molkenboe MCH, e al. (1997). De ec ion o Bo elia a zelii, B bu gdo e i ss, Bo elia ga inii and g oup VS116 by PCR in skin biopsies o pa ien s wi h e y hema mig ans and ac ode ma i is ch onica a ophicans. Clinical Mic obiology and In ec ion, 3: 109–116; Ri ie KM, Rasmussen RP and Wi we CT. (1997). P oduc di e en ia ion by analysis o DNA mel ing cu es du ing he polyme ase chain eac ion. Analy ical biochemis y, 245(2): 154–60; Rizzoli A, Hau e HC, Ca pi G, e al. (2011). Lyme bo eliosis in Eu ope. Eu osu eillance, 16(27): 1–8; Rollend L, Fish D and Childs J. (2013). T anso a ial ansmission o Bo elia spi oche es by Ixodes scapula is: A summa y o he li e a u e and ecen obse a ions. Ticks and Tick-Bo ne Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 91 2. Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion Ticks a e obliga e pa asi es, conside ed o be second wo ldwide o mosqui oes as ec o s o human diseases, bu hey a e he mos impo an ec o s o disease-causing pa hogens in domes ic and wild animals. The impo an ole ha icks play in main aining and ansmi ing ick-bo ne pa hogens in Po ugal, ein o ces he need o o e an up o da e summa y o he in o ma ion on icks, hei biology, ecology and associa ions wi h e eb a e hos s. Also, a be e knowledge o B. bu gdo e i s.l. in ec ion a e in hese a h opods, mainly in he ec o Ixodes icinus, is impo an in o de o de e mina e possible isk a eas o human and e e ina y heal h. The e o e, his chap e he dis ibu ion and cha ac e iza ion o ixodids will be add essed in nine dis ic s o Po ugal, p e iously selec ed, alongside wi h hei in ec ion a e by B. bu gdo e i s.l. using wo nes ed-PCR. This chap e is based on he esea ch pape : Nunes M, Viei a ML, Lopes N, Maia C, Almeida APG. 2016. Cha ac e iza ion and dis ibu ion o ha d- icks in nine dis ic s o mainland Po ugal whe e I. icinus p esence was p e iously epo ed: Bo elia bu gdo e i s.l. p e alence. (in submission) Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 93 2.1 Cha ac e iza ion and dis ibu ion o ha d- icks in nine dis ic s o mainland Po ugal whe e I. icinus p esence was p e iously epo ed: Bo elia bu gdo e i s.l. p e alence Mónica Nunes1,2, Mª. Luísa Viei a1,2, Nádia Lopes1, Ca la Maia2,3, A. Paulo G. Almeida2,3,4 1Unidade de Mic obiologia Médica, Ins i u o de Higiene e Medicina T opical, IHMT, Uni e sidade No a de Lisboa, UNL, Lisboa, Po ugal; 2Global Heal h and T opical Medicine, GHTM, IHMT, UNL; 3Unidade de Pa asi ologia Médica, IHMT, UNL; 4Zoonosis Resea ch Uni , Depa men o Medical Vi ology, Facul y o Heal h Sciences, Uni e si y o P e o ia, P e o ia, Sou h A ica. Co espondence should be add essed o: Mónica Nunes G upo de Lep ospi ose e Bo eliose de Lyme, Unidade de Mic obiologia Médica, Global Heal h and T opical Medicine, GHTM, Ins i u o de Higiene e Medicina T opical, HMT, Uni e sidade No a de Lisboa, UNL Rua da Junquei a, nº100 1349-008 Lisboa, Po ugal Phone: +351 213652600; Fax: +351 213632105 (E-mail: [email p o ec ed]) Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 94 Abs ac Se e al changes in spa ial dis ibu ion and abundance o ick species and hei associa ed pa hogens ha e occu ed in he las yea s, due o clima e change, habi a modi ica ions and globaliza ion o human ac i i ies. Consequen ly, i ’s inc easingly impo an o upda e ick dis ibu ion, biology, ecology and associa ion wi h hos s and pa hogens. In Po ugal, he e a e a o able clima ic condi ions o he main enance o icks and hei pa hogenic agen s. An example o ha a e he spi oche es o B. bu gdo e i s.l. complex, Lyme disease (LB) agen s, whose main ec o in Eu ope is he ick Ixodes icinus. Al hough his disease is unde diagnosed and unde epo ed, se e al s udies ha e con i med he ci cula ion o hese spi oche es in ick popula ions om di e en a eas o Po ugal. Thus, he aim o his s udy was o collec and iden i y icks om hos s and ege a ion, in nine dis ic s o Po ugal, p e iously iden i ied as a eas wi h bo h he ec o and he pa hogen, and o de e mine B. bu gdo e i s.l. in ec ion a e, con ibu ing o upda e ick’s auna and LB epidemiology. Ques ing icks we e collec ed in se en o he su eyed dis ic s, being Rhipicephalus sanguineus he mos widesp ead species, al hough, in Lisboa Ixodes icinus imma u e we e he mos abundan species. Rega ding he hos s, pe s (dogs and ca s), syl a ic (ce ids and wild boa s), and li es ock (ca le, sheep and donkeys) animals we e su eyed, om se en dis ic s, and again R. sanguineus was he mos widesp ead species, excep in Lisboa and É o a dis ic s, whe e I. icinus and R. bu sa we e he mos abundan species, espec i ely. Rega ding B. bu gdo e i s.l. in ec ion a e, 8% and 1% o he collec ed icks we e posi i e, a ege a ion and hos le el, espec i ely. Bo elia bu gdo e i s.l. posi i e icks we e collec ed in B aga, Vila Real, Lisboa, Se úbal, É o a and Fa o, six o he nine su eyed dis ic s, showing ha his pa hogen p esen s a gene al dis ibu ion h oughou he coun y. Changes in he dis ibu ion o icks and hei in asion in o new egions we e obse ed in his s udy, possibly ela ed o changes in he landscape, clima e and ege a ion, o which icks a e e y sensi i e. Also he equen la ge-scale mo emen s o humans and hei animals may be speeding up he in oduc ion o no el ick species and hei associa ed pa hogens ha can ha e se e e consequences in human and animal heal h. The e o e, mo e s udies conce ning Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 95 ick dis ibu ion and beha io should be ca ied ou in o de o unde s and he biological mechanisms unde lying success ul ick in asions and adap a ion o new local condi ions leading o a success ul es ablishmen . In oduc ion Ticks (Ixodida) a e obliga e hema ophagous a h opod ec opa asi es wi h a wo ldwide dis ibu ion, and esponsible o ansmi ing pa hogens ha cause diseases in humans and animals (de La Fuen e & Con e as, 2015), leading o public heal h issues and economical losses in li es ock p oduc ion (Pa ola & Raoul , 2001). The incidence o ick-bo ne diseases (TBDs) is inc easing wo ldwide, since icks a e capable o ansmi ing disease-causing p o ozoa, bac e ia and i uses. Fo ins ance, mo e han 250 000 human cases o Lyme disease we e epo ed in he las decade in he USA (h p://www.cdc.go /lyme/), and in Eu ope abou 50 000 cases a e epo ed each yea in humans (Piesman and Eisen, 2008). This is due o he con inuous human exploi a ion o en i onmen al esou ces and o he inc ease o human ou doo ac i i ies ha allow con ac wi h icks no mally p esen in na u al habi a s (de La Fuen e & Con e as, 2015). Fu he mo e, he expansion o ick popula ions due o clima e changes and human in e en ions ha a ec ese oi hos s mobili y and human con ac wi h in ec ed icks, is a g owing p oblem (G ay e al., 2009; Es ada-Peña e al., 2012; O an o e al., 2015; Os eld & B unne , 2015). These a h opods ex end om he opics o suba c ic a eas and a e well adap ed o li ing in s ic and di e si ied habi a s, seeking hos s o eed upon, diges ing blood meals, and de eloping h ough di e en li e s ages o adul hood, and u he ep oducing (Magna elli, 2009). Al hough mos icks ha e close ela ionships wi h e eb a e animals, some species ha e limi ed hos p e e ences, while o he s ha e b oad hos anges. Se e al s udies ha e been ca ied ou o unde s and ick species dis ibu ion, bio-ecological p e e ences and hos - ec o -pa hogen ela ionships in di e en se ings. Faunis ic s udies ac oss se e al egions, namely he Medi e anean egion, a e o g ea impo ance and in e es o cha ac e ize he dis ibu ion and composi ion o ick species a ec ing li es ock, as a p elimina y s ep o he knowledge o he pa hogens hey may ansmi , and he economic Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 96 e ec s o hese on animal p oduc ion, and in public heal h (Papadopoulos e al., 1996; Boua ou , 1999; Es ada-Peña & San os-Sil a, 2005). Po ugal, he wes e nmos coun y in con inen al Eu ope, p esen s a o al o 92 090 km2 o land su ace, 3.4 million hec a es co espond o o es ed a eas, mainly localized in he No h o he Tagus i e , wi h ag o o es y and o es g azing a eas localized in he Sou h o he coun y (Figu e 1). Figu e 1 - Schema ic ep esen a ion o A lan ic Ocean and Medi e anean Sea in luence in he Po uguese clima e (A) and he Po uguese dis ic s a e o o es a ion (B). (Sou ce: de Macedo, 1997). Acco ding o Koeppen-Geige classi ica ion, Po ugal has a empe a e con inen al clima e, Type C, checking he sub ype Cs (a empe a e clima e wi h d y summe ) and he ollowing a ie ies: Csa, empe a e clima e wi h wa m summe and d y in he in e io egions o he Dou o Valley (pa o he dis ic o B agança), as well as in Sou h egions o he moun ain sys em Mon ejun o-Es ela (excep on he wes coas o Alen ejo and Alga e); Csb, empe a e clima e wi h d y and mild summe , in almos all egions o he No he n moun ain sys em Mon ejun o-Es ela and he egions o he wes coas o Alen ejo and Alga e. In a small egion o Alen ejo, in he dis ic o Beja, is A id Clima e - Type B Sub ype BS (s eppe clima e), BSK a ie y (cold s eppe clima e o mid-la i ude). A lan ic Clima e Medi e anean Clima e A lan ic- Medi e anean Clima e A A lan ic Ocean Spain Km B Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 97 The ecological, clima ic and en i onmen al condi ions o Po ugal a e a o able o he de elopmen and main enance o se e al ha d- ick species ha can ansmi a la ge a ie y o pa hogenic agen s able o causing diseases in humans and animals, wi h an eme gen isk in he coun y. Fo example, he ick Ixodes icinus, compe en ec o o B. bu gdo e i s.l. agen s, is p esen in se e al egions wi hin he coun y wi h di e en clima e ypes and land co e (Núncio e al., 1993; Bap is a e al., 2004; Es ada-Peña & San os-Sil a, 2005; Bap is a, 2006). In his s udy nine dis ic s ep esen a i e o No h, Lisboa Tagus Valley (LTV), and Sou h egions o mainland Po ugal we e selec ed o ick collec ions, based on da a om p e ious s udies, whe e I. icinus p esence was egis e ed (Bap is a, 2006; San os-Sil a e al., 2011). Also, he collec ed icks we e su eyed o B. bu gdo e i s.l. DNA, o u he cha ac e ize he in ec ion a e wi h his pa hogenic agen ac oss he coun y. Ma e ial and Me hods Cha ac e iza ion and loca ion o sampling si es A o al o nine dis ic s we e selec ed: B aga, Vila Real, A ei o, Gua da, (conside ed No h egion o compa ison pu poses), San a ém, Lisboa (conside ed Lisboa and Tagus Valley- LTV), and É o a, Se úbal and Fa o (conside ed Sou h egion), (Figu e 2). Ticks we e collec ed om he ege a ion and om se e al hos s p esen in he chosen a eas. Figu e 2 – Map o mainland Po ugal showing he dis ic s whe e ick collec ions we e pe o med (in g een). Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 98 In he di e en dis ic s, collec ions o ques ing icks in he ege a ion was ca ied ou in se e al habi a s (Figu e 3), and mo e emphasis was gi en o he o es a eas wi h bio ic ac o s (hos s) and abio ic ac o s ( ege a ion and habi a ypes), humidi y, empe a u e, ele a ion and dis ance o wa e line) a o able o he de elopmen o Ixodes icinus. The cha ac e iza ion o each dis ic is p esen ed in Table 1. Figu e 3 – Examples o habi a s whe e icks we e collec ed: A – Ama es (B aga); B – Mondim de Bas o (Vila Real); C – Dunas de São Jacin o (A ei o); D – Gua da; E – San a em; F – Tapada Nacional de Ma a (Lisboa); G –G andola (Se úbal); H – Alcaço as (É o a); I – Se a de Monchique (Fa o). A B C D E F G H I Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 105 Figu e 4 – Ques ing ick species a e age densi y o each collec ed species by season, yea and dis ic . (Dm – De macen o ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, Hi – Haemaphysalis ine mis, Hyl – Hyalomma lusi anicum, Hym – Hyalomma ma gina um, I – Ixodes icinus, Ih – Ixodes hexagonus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa). Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 106 Table 2 – To al ques ing ick species by s age collec ed in each dis ic . Ticks collec ed om he ege a ion S age Dis ic s Tick species La ae Nymphs Females Males TOTAL B aga De macen o ma gina us 26 15 41 De macen o e icula us 2 3 5 Haemaphysalis punc a a 1 2 3 6 Hyalomma ma gina um 1 0 1 Ixodes icinus 4 0 4 Ixodes hexagonus 3 0 3 Rhipicephalus sanguineus 77 73 150 To al 1 115 94 210 Vila Real De macen o ma gina us 3 1 4 Ixodes icinus 1 7 8 16 Rhipicephalus bu sa 1 1 Rhipicephalus sanguineus 2 65 44 111 To al 3 75 54 132 A ei o Ixodes icinus 3 3 Rhipicephalus sanguineus 141 95 236 To al 141 98 239 Lisboa De macen o ma gina us 7 1 8 Haemaphysalis ine mis 1 26 16 43 Haemaphysalis punc a a 259 76 22 39 396 Hyalomma lusi anicum 8 21 107 56 192 Hyalomma ma gina um 1 35 36 Ixodes icinus 490 1011 43 60 1604 Rhipicephalus boophilus 1 1 2 4 Rhipicephalus bu sa 38 33 71 Rhipicephalus sanguineus 271 1 6 2 280 To al 1030 1109 251 244 2634 Se úbal De macen o ma gina us 65 35 100 Haemaphysalis punc a a 1 1 Ixodes icinus 12 7 19 Rhipicephalus sanguineus 165 130 295 To al 242 173 415 É o a Rhipicephalus sanguineus 83 64 147 To al 83 64 147 Fa o De macen o ma gina us 13 6 19 Haemaphysalis punc a a 1 1 Ixodes icinus 17 18 35 Rhipicephalus bu sa 1 1 Rhipicephalus sanguineus 28 5 200 185 418 To al 28 5 231 210 474 TOTAL 1058 1118 1138 937 4251 Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 107 Ques ing Ticks in he No h egion In he No h egion (Figu e 5), R. sanguineus was he mos p e alen species, du ing he wo yea s o collec ions, pa icula ly in he sp ing. The species D. e icula us was only collec ed in his egion (B aga dis ic ) du ing summe o 2012 and sp ing o 2013 and 2014, being always collec ed in he same si e, which was a hun ing a ea wi h wild boa s nea by. Also, I. hexagonus was only collec ed in Vila Real du ing he 2012 au umn in a si e wi h high ele a ion, si ua ed in he na u al pa k o Al ão. Rega ding A ei o dis ic he collec ions we e only made once in he sp ing o 2013 nea he seaside a Dunas de São Jacin o, whe e R. sanguineus was he mos abundan species. Figu e 5 – Ques ing ick species a e age densi y and s anda d de ia ion in he No h egion du ing he wo yea s o collec ions, in sp ing, summe and au umn seasons. (Dm – De macen o ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, Hym – Hyalomma ma gina um, I – Ixodes icinus, Ih – Ixodes hexagonus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa). Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 108 Ques ing icks in Lisboa and Tagus Valley (LTV) egion In his egion he majo i y o he collec ions we e made in TNM, whe e I. icinus imma u e s ages we e he mos collec ed species and s age in he Sp ings o 2012, 2013 and 2014, while in summe imma u e s ages o H. punc a a and R. sanguineus whe e ob ained (Figu e 6). Adul icks om I. icinus, H. punc a a and Hy. lusi anicum we e also collec ed bu wi h a low densi y du ing he Au umn o each yea . In TNM du ing he coldes days o Au umn H. ine mis, also known as he win e ick, was collec ed. Cu iously, no adul R. sanguineus was e e collec ed om he ege a ion in his si e, al hough he imma u e s ages we e p esen . Figu e 6 – Ques ing ick species a e age densi y and s anda d de ia ion in Lisboa and Tagus Valley egion du ing he wo yea s o collec ions, in sp ing, summe and au umn seasons. (Dm – De macen o ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, Hi – Haemaphysalis ine mis, Hyl – Hyalomma lusi anicum, Hym – Hyalomma ma gina um, I – Ixodes icinus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa). Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 109 Ques ing icks in he Sou h egion In he Sou h egion he collec ions we e ca ied ou only du ing Sp ing (Figu e 7), al hough a collec ion was made in he Se úbal dis ic in he Summe o 2013, bu no icks we e collec ed, since he land had been plowed. Rega ding ick species R. sanguineus was he mos abundan species in he h ee dis ic s, al hough I. icinus and D. ma gina us we e also collec ed bu wi h a lowe densi y, pa icula ly in one o he collec ion si es in Se úbal dis ic which was a hun ing a ea wi h wild boa s. Figu e 7 – Ques ing ick species a e age densi y and s anda d de ia ion in Sou h egion du ing he wo yea s o collec ions, in sp ing and summe seasons. (Dm – De macen o ma gina us, D – De macen o e icula us, Hp – Haemaphysalis punc a a, I – Ixodes icinus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa). Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 110 Bioecological analysis o icks collec ed om he ege a ion To al ick densi y, and he mos abundan species we e analysed acco ding o en i onmen al a iables ega ding he collec ing si es. To al ick densi ies we e signi ican ly di e en acco ding o: 1) egion o he collec ions, among LTV and No h egion, being highe in LTV (KW = 20.614, P < 0.0001); 2) season, highe in Sp ing han Summe (KW = 8.716, P = 0.01); 3) ele a ion, being highe below 100m han abo e 200m (KW = 20.302, P < 0.0001); 4) he h ee ypes o ege a ion al hough he P alue was nea 0.05 (KW = 6.047, P < 0.049), esul ing in no di e ences in pai wise compa isons. No di e ences we e ob ained o he habi a s. To al ick densi y showed a signi ican nega i e co ela ion wi h he empe a u e (Spea man’s’s hô = -0.462, P = 0.001) and he dis ance o wa e line (Spea man’s’s hô = - 0.479, P = 0.001), bu no co ela ion wi h ela i e a mosphe ic humidi y. Iden ical analysis was pe o med o he i e mo e ep esen a i e ick species in he h ee egions, namely D. ma gina us, H. punc a a, Hy. lusi anicum, I. icinus and R. sanguineus. Conce ning he egions, H. punc a a, Hy. lusi anicum and I. icinus, we e mo e abundan in LTV (KW = 17.543, P < 0.0001), in compa ison o he No h and he Sou h egions (Figu e 8), while R. sanguineus was highe in Sou h han LTV (KW = 14.579, P = 0.001). No di e ences we e ob ained o D. ma gina us (P > 0.05). Rega ding he seasons, I. icinus was he species wi h he highe di e ences be ween seasons, namely i was mo e abundan in au umn han in ei he sp ing o summe (KW = 11.767, P = 0.003), (Figu e 9); R. sanguineus was mo e abundan in Sp ing han in au umn (KW = 22.254, P < 0.0001); H. punc a a in au umn han in Sp ing (KW = 8.981, P = 0.01); and D. ma gina us in sp ing han in summe (KW = 9.046, P = 0.01). No di e ences we e ob ained o Hy. lusi anicum (P > 0.05). Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 111 Figu e 8 – Box-plo analysis depic ing he dis ibu ion o (A) H. punc a a, (B) Hy. lusi anicum and (C) I. icinus wi hin each egion. Y axis ep esen icks/min-collec o . A B C Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 112 Figu e 9 – Box-plo analysis depic ing he densi ies o I. icinus in each o he su eyed seasons. Y axis ep esen icks/min-collec o . Fo he ele a ion I. icinus, Hy. lusi anicum and D. ma gina us we e mo e abundan in ele a ions below 100m han in 100-200m o abo e 200m (KW = 11.173, P = 0.004), while H. punc a a was mo e abudan in ele a ions be ween 100-200m (KW = 26.965, P < 0.0001). No di e ences we e ob ained o R. sanguineus (P > 0.05). Conce ning he ege a ion only I. icinus and H. punc a a e eled o be mo e abundan in sh ubland ege a ion han in pas u e and o es ege a ions (KW = 15.643, P < 0.0001). In elas ionship o he habi a , I. icinus was mo e abundan in hun ing & o es a eas han in pas u e & ag icul u e and pe i-u ban & public pa ks (KW = 7.000, P = 0.03); and o H. punc a a, di e ences we e ob ained be ween he habi a s (KW = 7.858, P = 0.02), howe e , he pai wise compa isions showed he same dis ibu ion in he h ee habi a s. Finally H. pun ac a and I. icinus had a nega i e co ela ion wi h he empe a u e (Spea man’s hô = -0.327, P = 0.02; Spea man’s’s hô = -0.475, P = 0.001, espec i ely) and Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 113 he dis ance o he wa e line (Spea man’s hô = -0.629, P < 0.0001; Spea man’s hô = -0.562, P < 0.0001), al hough I. icinus p esen ed a posi i e co ela ion wi h he humidi y (Spea man’s hô = 0.334, P = 0.02), and Hy. lusi anicum showed a nega i e co ela ion wi h he dis ance o wa e line (Spea man’s’s hô = -0.343, P = 0.02). Ticks collec ed om hos s A o al o 2171 icks we e emo ed om se en di e en hos species (n=112), dis ibu ed along se en dis ic s om No h o Sou h Po ugal, du ing he wo-yea pe iod. Al hough he majo i y o icks we e collec ed om syl a ic hos s, namely ce ids, he “pe s” hos s we e he mos su eyed, especially dogs. Tick dis ibu ion acco ding o s age was: 1 la ae (0.04%), 36 nymphs (1.7%), 1256 emales (57.9%) and 878 males (40.4%), (Table 3). Fi e ick gene a we e iden i ied, including nine species, being R. sanguineus he mos collec ed and widesp ead ick (858, 39.5%), ollowed by I. icinus (743, 34.2%), R. bu sa (278, 12.8%), H. punc a a (148, 6.8%), Hy. ma gina um (85, 3.9%), Hy. lusi anicum (35, 1.6%), D. ma gina us (19, 0.9%), I. hexagonus (3, 0.1%) and H. ine mis (2, 0.1%) (Table 3). Conce ning he dis ibu ion o icks in he se e al dis ic s, he majo i y o icks we e ob ained om Lisboa dis ic (1053, 48.5%), ollowed by É o a (350, 16.1%), Fa o (341, 15.7%), Se úbal (213, 9.8%), Vila Real (115, 5.3%), Gua da (65, 3%) and San a ém (34, 1.6%), (Table 3). Densi ies o he se e al ick species collec ed in each yea , dis ic and season a e ep esen ed in Figu e 10, being R. sanguineus he mos abundan species collec ed in all dis ic s, excep in Lisboa, which was I. icinus species. Fo a mo e accu a e analysis he dis ibu ion o ick species was analyzed by egions, being he g aphics in di e en scales o a be e comp ehension o ick densi ies. Chap e 2 Dis ibu ion and bio-ecological cha ac e iza ion o ixodids in selec ed a eas o Po ugal: Bo elia bu gdo e i s.l. in ec ion 114 Figu e 10 – Tick a e age densi y pe hos , o each collec ed species by season, yea and dis ic . Dm – De macen o ma gina us, Hp – Haemaphysalis punc a a, Hi – Haemaphysalis ine mis, Hyl – Hyalomma lusi anicum, Hym – Hyalomma ma gina um, I – Ixodes icinus, Ih – Ixodes hexagonus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bu sa. Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 217 Duplex eal- ime PCR eac ions we e ca ied ou in a o al olume o 20 μl con aining 1× SensiFAST™ (Bioline), 0.3 μM o each p ime (F_Bbsl, R_Bbsl; F_18S RNA, _18S RNA o F_β-ac in, R_ β-ac in), 0.25 μM o each TaqMan p obe (P_Bbsl; P_18S RNA o P_ β- ac in), DNase ee wa e (Bioline) and 2 μl o he ex ac ed DNA empla e. The he mal cycling condi ions we e: 1 cycle a 95 °C o 1 min, ollowed by 40 cycles a 95 °C o 10 s and 60 °C o 45 s. The e aplex eal- ime PCR eac ions used 1× SensiFAST™ (Bioline), 0.3 μM o F_Bspp, R_Bspp p ime s, 0.25 μM o P_Ba z, P_Bga , P_Bbss and 0.15 μM o P_Blus TaqMan p obes, DNase ee wa e (Bioline), and 2 µl o he ex ac ed DNA empla e, in a o al olume o 20 μl. The he mal cycling condi ions we e: 1 cycle a 95 °C o 5 min, ollowed by 45 cycles a 95 °C o 10 s and 60 °C o 30 s. All posi i e samples we e e es ed o con i ma ion. Non- empla e nega i e con ols (wi h PCR g ade wa e ) we e included in each un o ule ou he possibili y o c oss-con amina ion. The mal cycling, luo escen da a collec ion, and da a analysis we e pe o med in a 7500 Fas eal- ime PCR Sys em (Applied Biosys ems), acco ding o he manu ac u e ’s ins uc ions. Analy ical speci ici y and sensi i i y To in es iga e whe he he p obes and espec i e lanking p ime s de ec hei speci ic a ge s, DNA om B. bu gdo e i s.l., om o he spi oche es (Lep ospi a in e ogans and T eponema paliddum) and om o he s ick-bo ne pa hogens (Theile ia sp. and Babesia sp.), we e used as empla es in eal ime PCR. To es ima e he de ec ion h eshold o he assays (analy ical sensi i i y), indi idually and as duplex and e aplex eal- ime PCR, a s anda d cu e was cons uc ed using 10- old se ial dilu ions o DNA ex ac ed om B. alaisiana, B. ba a iensis, B. bu gdo e i s.s., B. a zelii, B. ga inii and B. lusi aniae s ains. The DNA dilu ions o B. bu gdo e i s.l. co esponded o 10 – 106 genome equi alen s (GE), acco ding o he Na ional Re e ence Cen e o Bo elia (NRZ uni s: 50 g/µl=10GE). Fo each s ain and concen a ion he PCR assays we e pe o med in iplica e. The end-poin co esponded o he dilu ion a which he assay could de ec he espec i e DNA a ge s in all h ee eplica es. Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 218 To ob ain an indica ion i he eal- ime PCR assays can be used wi h clinical samples, i.e., ma e ial o pa ien s in ec ed by B. bu gdo e i s.l., se a we e mixed wi h a 10- old se ial dilu ion o B. bu gdo e i s.l. DNA (mix u e o B. bu gdo e i s.s., B. a zelii, B. ga inii and B. lusi aniae) anging om 10 o 106 NRZ uni s o GE. Bo elia DNA was e-ex ac ed om his mix u e using Gen a Pu egene comme cial ki om QIAGEN®, acco ding o he manu ac u e ’s p o ocol. These pa ien samples expe imen ally inocula ed we e sc eened acco dingly wi h he eal ime PCR assay. B. bu gdo e i s.l. e e ence s ains B. bu gdo e i s.s. (B31), B. a zelii (PGau), B. ga inii (PBi) isola ed om Japan, B. lusi aniae (PoHL1), B. ba a iensis (PBi) and B. alaisiana (VS116) esh cul u es om he labo a o y o Lep ospi osis and Lyme Bo eliosis G oup om Ins i u o de Higiene e Medicina T opical (IHMT)/UNL, we e cul u ed in BSK-H medium, incuba ed a 34ºC and obse ed wi h a da k- ield mic oscope e e y o he day. When he cul u es a chi ed he loga i hmic phase, he bac e ia we e ha es ed by cen i uga ion a a speed o 14000g, and genomic DNA ex ac ion was pe o med wi h Gen a Pu egene comme cial ki om QIAGEN®, acco ding o he manu ac u e ’s p o ocol. A e ex ac ion he DNA concen a ion and pu i y om each B. bu gdo e i s.l. genospecies we e es ima ed by measu ing he abso bance a 260 nm (A260) and by A260/A280 and A260/A230 a ios, using a NanoD op 1000 spec opho ome e (NanoD opTM). The DNA concen a ion was adjus ed o 106 GE o he six B. bu gdo e i s.l. genospecies and dilu ions om 10 o 106 GE we e p epa ed. E alua ion o eal- ime PCR wi h ield-collec ed icks and clinical samples Fo he e alua ion o he wo-s ep mul iplex eal- ime PCR iden i ica ion assay, a panel o DNA samples, p e iously posi i e o nega i e o B. bu gdo e i s.l., we e ob ained om (i) se a (n= 20) and ce eb ospinal luid (CSF) (n= 10) samples om human pa ien s a ailable a Lep ospi osis and Lyme Bo eliosis G oup ( om 2012 o 2015) and (ii) ques ing nymphs and adul s o Ixodes icinus species (n=50) collec ed ac oss Po ugal in p e ious s udies (Nunes e Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 219 al., 2015; Nunes e al., 2016). The p esence o B. bu gdo e i s.l. DNA was o me ly e alua ed by wo nes ed-PCR a ge ing he genes encoding he 5S-23S in e genic space egion (Rijpkema e al., 1995) and he laB gene (Wodecka e al., 2010). Nes ed-PCR ampli ica ion p oduc s om ick samples, we e also p e iously sequenced o he iden i ica ion o B. bu gdo e i s.l. genospecies. S a is ical analysis Fo measu ing he ag eemen be ween he esul s o he ou inely pe o med molecula iden i ica ion o clinical and ick samples, and he eal- ime PCR assay, kappa coe icien was used. This coe icien , wi h con idence in e als, was de e mined wi h BioEs a 5.0. Resul s Analy ical speci ici y and sensi i i y The wo eal- ime PCR assays only de ec ed B. bu gdo e i s.l. DNA and did no p oduce any non-speci ic ampli ica ion p oduc s in epea ed expe imen s. In addi ion, he e we e no alse posi i es due o c oss- eac ion be ween luo opho e signals wi hin each assay. Fo he e alua ion o he sensi i i y, he assay was es ed using DNA ex ac ed om B. bu gdo e i s.l. cul u es as empla e. In he i s s ep, dilu ions om 10 o 106 GE o B. bu gdo e i s.l. genospecies DNA we e es ed one by one and in a mix u e wi h he six genospecies DNA, along wi h he in e nal con ols; in he second s ep dilu ions om 10 o 106 GE o DNA om B. bu gdo e i s.s., B. a zelii, B. ga inii and B. lusi aniae we e es ed indi idually and in e aplex (Figu e 3). The esul s o he analy ical sensi i i y we e as ollows: The i s duplex eac ion could de ec he p esence o B. bu gdo e i s.l. un il he dilu ion con aining 50 g/µL = 10 GE o DNA empla e, ega dless he genospecies es ed. The s anda d cu e o DNA mix u e showed a co ela ion coe icien (R2) o 0.98 and a slope o – 3.2, indica ing a good e iciency (106%) o PCR ampli ica ion (Figu e 2). Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 220 Figu e 2 – Illus a ion o he duplex eal- ime PCR ampli ica ion cu e ob ained o each DNA concen a ion. (A) B. bu gdo e i s.l. DNA dilu ions om 10 o 106 GE; (B) espec i e linea ela ionship be ween he loga i hm o he s a ing concen a ion o DNA and he ampli ica ion C alues; Neg – eal- ime PCR nega i e con ol using DNase ee wa e as empla e; C - in e cep ion in he minimum h eshold (10 GE); RFU - Rela i e Fluo escence Uni s. Fo he e aplex eac ion a ge ing he laB gene o he ou genospecies o B. bu gdo e i s.l., when each p obe was indi idually es ed, he de ec ion limi was 50 g/µl = 10 GE o B. a zelii (C ≈ 37), B. ga inii (C ≈ 37) and B. lusi aniae (C ≈ 37) and 0.5pg/µl = 102 GE o B. bu gdo e i s.s. (C ≈ 36), (Figu e 3 A,B,C and D); when es ed in e aplex he de ec ion limi was 0.5pg/µl o B. a zelii (C ≈ 32), B. ga inii (C ≈ 35), B. lusi aniae (C ≈ 35) and B. bu gdo e i s.s. (C ≈ 35), (Figu e 3E). The s anda d cu es o he e aplex eac ion showed co ela ion coe icien s (R2) anging om 0.929 o 0.997 and slopes o -2.296 o -3.377 (Figu e 3F). 106 105 104 102 10 Neg B. bu gdo e i s.l. A B 103 Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 221 Figu e 3 - Illus a ion o he e aplex eal- ime PCR ampli ica ion cu es ob ained o each p obe indi idually (A, B, C and D) and in e aplex (E) o each DNA concen a ion; and espec i e linea ela ionship be ween he loga i hm o he s a ing concen a ion o DNA and he ampli ica ion C alues (F). A – eal- ime PCR o B. a zelii (dilu ions om 10 – 106 GE); B – eal- ime PCR o B. ga inii (dilu ions om 106 – 10 GE); C – eal- ime PCR o B. lusi aniae (dilu ions om 106 – 10 GE); D – eal- ime PCR o B. bu gdo e i s.s. (dilu ions om 106 – 102 GE); E – e aplex eal- ime PCR o he dilu ion o 106 GE; Neg – eal- ime PCR nega i e con ol using DNase ee wa e as empla e; C - in e cep ion in he minimum h eshold; RFU - Rela i e Fluo escence Uni s. Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 222 Expe imen al inocula ed se um samples Sc eening o dilu ion se ies o DNA pu i ied om pa ien ’s se a samples spiked wi h B. bu gdo e i s.l. DNA, e ealed no di e ences in he sensi i i y o he duplex assay o he used ma e ial, since i was possible o ob ained ampli ica ion signal un il he dilu ion o 10 GE wi h a C alue o 35. Rega ding he e aplex assay, he ou genospecies es ed did no show majo di e ences in he sensi i i y, since i was possible o ob ain ampli ica ion signal un il o dilu ion o 102 GE wi h C alues o : 32 o B. a zelii and B. bu gdo e i s.s., 35 o B. ga inii, and 34 o B. lusi aniae. E alua ion o eal- ime PCR wi h ield-collec ed icks and clinical samples F om he 50 ick samples es ed, 24 (48%) p e iously posi i e o he wo nes ed-PCR’s, we e also posi i e o he duplex eal- ime PCR, howe e , o he e aplex eal- ime PCR jus 23 (46%, es k= 0.96) samples we e posi i e (Table 2). The genospecies o B. bu gdo e i s.l. iden i ied in his assay, we e in ag eemen wi h he p e iously sequencing esul s (Table 2). Conce ning he clinical samples es ed (n=30), om he 11 samples (40%) p e iously posi i e o he wo nes ed-PCR, 11 (37%,), we e also posi i e o he duplex eal- ime PCR, bu only h ee (10%), we e posi i e o he e aplex assay, whe e he genospecies ob ained we e iden i ied as: B. a zelii; B. ga inii and B. lusi aniae (Table 2) and he K alue was 0.93 and 0.32 o he duplex and e aplex eal- ime PCR, espec i ely. Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 223 Table 2 – Compa ison o duplex and e aplex eal- ime PCR’s posi i e samples wi h esul s om p e ious sequencing o ick samples. I. icinus samples (n=50) Samples (Nes ed-PCR’s posi i e o nega i e) Sequencing esul s Duplex eal – ime PCR Te aplex eal- ime PCR 1 B. a zelii 1 posi i e (C  17) 1 B. a zelii (C  21) 3 B. bu gdo e i s.s. 3 posi i es 2 B. bu gdo e i s.s. (C  33; C  36) 1 nega i e 8 B. ga inii 8 posi i es (C  17 o C  19) 8 B. ga inii (C  16 o C  33) 12 B. lusi aniae 12 posi i es (C  18 o C  26) 12 B. lusi aniae (C  20 o C  35) 26 nega i es ------- 26 nega i es 26 nega i es Clinical samples (n= 30) Samples (Nes ed-PCR’s posi i e o nega i e) Sequencing esul s Duplex eal – ime PCR Te aplex eal- ime PCR 5 se a 6 CSF (posi i e) ------- ------- 11 posi i es (C  17 o C  36) 1 se um as B. a zelii (C  29) 1 se um as B. ga inii (C  30) 1 se um as B. lusi aniae (C  32) 8 nega i es (2 se a; 6 CSF) 15 se a; 4 CSF (nega i es) ------- 19 nega i es 19 nega i es Discussion Acco ding o Eu opean Cen e o disease P e en ion and Con ol (ECDC) he diagnosis o Bo elia spp. in ec ion should be based mainly on clinical symp oms, he pa ien ’s medical his o y and an e alua ion o he isk o exposu e o in ec ed icks, along wi h diagnos ic es s including he assessmen o an ibodies o Bo elia spp. class IgM and IgG (Bil-Lula e al., 2015). Howe e , he se ologic es s based in an ibodies sea ch ha e some p oblems conce ning he la ge amoun o alse nega i e esul s, p obably due o he “window pe iod” in which IgM an ibodies a e no ye p oduced. Consequen ly, molecula app oaches as eal- ime PCR assays would be help ul in es ing pa ien s ea ly in he disease, be o e an an ibody esponse de elops, and in pa ien s p esen ing non classic symp oms. I is also known ha di e en Bo elia genospecies a e associa ed wi h di e se biological o igins (B. a zelii wi h small mammals, B. ga inii wi h bi ds and B. lusi aniae wi h liza ds) Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 224 (Ku enbach e al., 2002; Mannelli e al., 2012) , di e en clinical mani es a ions (B. ga inii wi h neu ological mani es a ion, B. a zelii wi h skin mani es a ions) ( an Dam e al., 1993), se e i y o disease (B. bu gdo e i s.s. is mo e se e e han B. a zelii) (Jungnick e al., 2015), and geog aphic dis ibu ion o species (B. a zelii, B. ga inii and B. lusi aniae in Eu ope and B. bu gdo e i s.s. in No h Ame ica) ( an Dam e al., 1993; S anek e al., 2002; S anek & S le, 2003) Consequen ly, ha ing he capaci y o iden i ying he Bo elia genospecies in ol ed in an in ec ion, whe he in he ec o o in he hos , is becoming inc easingly impo an since i also p o ides in o ma ion on he ecological cha ac e is ics o indi idual species, allows a be e p ognosis and ea men s a egy, and is needed o gene ic analysis (Mukhache a & Ko ale , 2014). Quan i a i e eal- ime PCR o di ec molecula de ec ion and quan i ica ion o pa hogens is a widely used echnology nowadays o clinical applica ion, being also aluable o con i ming a diagnosis based on less clea mani es a ions o LD o o in es iga ing con o e sial disease synd omes a ibu ed o in ec ion wi h B. bu gdo e i s.l.. Se e al eal ime PCR assays o he de ec ion o B. bu gdo e i s.l. ha e been epo ed p e iously, howe e , ew ha e included an in e nal con ol (Ge me e al., 1999; Gooskens e al., 2006), no has a quan i a i e e aplex PCR s udy o ou o he mos p e alen Bo elia genospecies in Eu ope been published o da e. The e o e, in his s udy, we p esen a combined mul iplex TaqMan eal- ime PCR s a egy o in e he p esence o B. bu gdo e i s.l. genospecies in clinical and ec o samples. In he i s s ep we e alua ed i a sample is in ec ed wi h Bo elia bu gdo e i s.l. by a ge ing he laB gene. The laB gene encodes a 41-kDa lagellin p o ein and is loca ed on a single-copy in he linea ch omosome (Wang e al., 1999). In his s ep he inclusion o an in e nal con ol allowed success ul DNA ex ac ion o be moni o ed. The second s ep iden i ies simul aneously ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Eu ope, namely B. a zelii, B. ga inii, B. bu gdo e i s.s. and B. lusi aniae. Al hough i a ge s he same gene as he p e ious s ep, he p ime s we e designed in a di e en mo e a iable egion, esul ing in a agmen wi h su icien polymo phisms ha allowed o design he ou speci ic p obes o each genospecies. In he duplex eal- ime PCR, DNA om each B. bu gdo e i s.l. genospecies, a ailable a Lep ospi osis and Lyme Bo eliosis labo a o y, IHMT/UNL, was es ed indi idually and in a Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 225 mix u e con aining he same DNA concen a ion o he six genospecies (B. a zelii, B. ga inii, B. lusi aniae, B. bu gdo e i s.s., B. alaisiana and B. ba a iensis). Whe he he DNA is es ed indi idually o simul aneously, all genospecies showed e y good eac i i y, since no di e ences we e ob ained ega ding he sensi i i y (10 GE). Simila esul s we e ob ained o B. bu gdo e i s.l. in p e iously s udies, whose sensi i i y’s ange om 1 o 10 GE (Gooskens e al., 2006; O’Rou ke e al., 2013; Venczel e al., 2015). Fu he mo e, he assay is highly speci ic, as i ailed o de ec he laB gene o o he mic obial species. Fo he e aplex assay he sensi i i y o he assay dec eases om 10 GE o 102 GE o B. ga inii, B. a zelii and B. lusi aniae bu emains he same o B. bu gdo e i s.s., when he ou p obes a e es ed simul aneously. This loss o sensi i i y is no mal when passing om a singleplex o a mul iplex eal- ime PCR, and is ela ed wi h he compe i ion be ween he a ge s, since we a e using he same pai o p ime s o he ou a ge s, being he di e ences only ound in he p obes. When he assay was applied o ield ick samples, he duplex s ep p esen ed a e y good pe o mance, since i ga e he same esul s ega ding he posi i e and nega i e samples ob ained p e iously by he wo nes ed-PCR a ge ing he laB gene and he IGS egion. Also o he e aplex assay only one o he posi i e ick samples yielded a nega i e esul , p obably due o he de ec ion limi o he assay, since i is lowe han he de ec ion limi o he duplex assay. Mo eo e , he B. bu gdo e i s.l. genospecies iden i ied by he e aplex we e 100% equal as hose ob ained om he sequencing esul s. The assays sensi i i y is c ucial when analyzing ick samples, since hey ha e he capaci y o ha bo ing complex mic obial popula ions (T e en & Sjås ad, 2011). The di e se bac e ial con en in icks could be esponsible o a low amoun o Bo elia spi oche es, due o he na u al size o he icks, and also o he en i onmen al compe i ion be ween bac e ial species (Hibbing e al., 2010). Rega ding he es ing o clinical samples (se a and CSF) wi h he duplex assay, a 100% ag eemen was achie ed wi h he esul s p e iously ob ained wi h he nes ed-PCR’s p o ocols. Howe e , in he e aplex assay only h ee samples we e posi i e, and iden i ied as B. a zelii, B. ga inii and B. lusi aniae; he emainde eigh nes ed-PCR-posi i e samples we e nega i e wi h his assay, including all he CSF samples es ed. This ac is ela ed wi h he loss o sensi i i y when he ou p obes a e used simul aneously. Howe e , p e iously s udies showed Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 226 ha Bo elia coun s in CSF a e e y low, a ound 20 bac e ia pe 100µL CSF lysed ( Noc on e al., 1996; Schwaige e al., 2001; Gooskens e al., 2006; Bil-Lula e al., 2015), which is below he e aplex sensi i i y, bu in he same baseline o he duplex assay de eloped in ou s udy. Nume ous PCR assays ha e been desc ibed o he de ec ion o B. bu gdo e i s.l. DNA in CSF, bu he sensi i i ies a ied om 12% o 100% (Kelle e al., 1992; Lebech & Hansen, 1992; Ei e e al., 1995; Noc on e al., 1996; Lebech e al., 2000; Schwaige e al., 2001). These esul s a e di icul o in e p e because o he use o small sample sizes, he selec ion di e ences o clinical specimens, he es ing o poo ly de ined pa ien ca ego ies, and he equen lack o an in e nal con ol o moni o PCR inhibi ion. In ou case, bo h nega i e and posi i e con ols and an in e nal con ol (mammals-β-ac in gene) we e included in each un o de e mine whe he o no inhibi o y subs ances we e p esen in he pa ien ’s clinical sample, o whe he alse posi i e esul s could appea du ing ampli ica ions. Thus he possibili y o low es sensi i i y due o he p esence o PCR inhibi o s in CSF samples is excluded. Howe e , o a be e e alua ion o his combined mul iplex TaqMan eal- ime PCR, u he in es iga ion using o he clinical samples is equi ed. In conclusion, his wo-s ep mul iplex TaqMan eal- ime PCR assay a ge ing he laB locus, p o ed o be an e icien me hod when sc eening o Bo elia in ec ion in ick samples, and a p omising ool o ea ly diagnos ic pu poses on clinical samples. Mo eo e , he abili y o de ec ou o he mos p e alen B. bu gdo e i s.l. genospecies in Eu ope, in a single- un is a ime- sa ing ac o , and cos educ ion when compa ed wi h he con en ional PCR and sequencing me hods. Acknowledgmen s This wo k was suppo ed by Minis y o Educa ion and Science o Po ugal, Fundação pa a a Ciência e a Tecnologia, h ough a PhD g an (SFRH/BD/78325/2011), and Funds om GHTM – UID/Mul i/04413/2013. Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 233 ampli ica ion p oduc s can be obse ed by naked eye. The e o e, his echnique may ha e i s ole as a ool in low- esou ce labo a o ies o he diagnosis o LD in an ea ly s age o in ec ion. In oduc ion Bo elia bu gdo e i sensu la o (B. bu gdo e i s.l.) complex is a g oup o se e al genospecies o spi oche es esponsible o Lyme disease (LD), he wo ld's as es g owing ec o -bo ne zoono ic disease wi h cases epo ed in o e 60 coun ies and endemic oci in No h Ame ica, Eu ope, and Asia (WHO, 2013). This complex is ep esen ed by 20 genospecies, se e al o which can cause LD in humans. These genospecies a y in hei geog aphic dis ibu ion, hos speci ici y and abili y o cause disease in humans. Clinically he di e en pa hogenic Bo elia spp. a e o in e es as hey ha e been associa ed wi h di e en disease symp oms which may be obse ed in he la e s ages o he condi ion (Ma gos e al., 2011). In Eu ope LD is mos ly associa ed o one o h ee genospecies: B. bu gdo e i s.s., B. a zelii and B. ga inii (Assous e al., 1993; an Dam e al., 1993; Rich e e al., 2004). B bu gdo e i s.s. is no mally associa ed wi h a h i is, B. ga inii wi h neu ological e ec s (musculoskele al and ne ous sys ems), and B. a zelii wi h skin complica ions, like Ac ode ma i is Ch onica A ophicans (ACA) ( an Dam e al., 1993). The labo a o y diagnosis is based mainly on se ological and molecula biology me hods. Se ological me hods includes sc eening es s such as enzyme-linked immunoso ben assays (ELISA), indi ec immuno luo escence assays (IFA), and con i ma ion es s such as Wes e n blo (Robe son e al., 2000; S ee e e al., 2008; Hin e sehe e al., 2012; Liu e al., 2013). Rega ding he molecula app oaches, se e al PCR-based me hods ha e been de eloped o de ec B. bu gdo e i s.l. DNA, such as con en ional PCR, nes ed PCR, and eal- ime PCR based in speci ic gene de ec ion, o se e al ma ke s such as, ospA, s, - l in e genic space , g oEL, ecA, hbb, la, and o he s (Picken e al., 1996; P iem e al., 1997; Ague o- Rosen eld e al., 2005; Kond usik e al., 2007; Wang e al., 2010; Wodecka e al., 2010; Wodecka 2011; de Leeuw e al., 2014). Ne e heless, mos o hese molecula app oaches ha e se e al disad an ages: ime-consuming, a iable sensi i i y and equi es speci ic Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 234 expensi e ins umen s o he ampli ica ion eac ion, which is di icul in low incoming coun ies. The e o e, apid, simple, low-cos , and e ec i e diagnos ic me hods a e u gen ly equi ed. Loop-media ed iso he mal ampli ica ion (LAMP) was i s epo ed in 2000 by No omi (No omi, 2000), and since hen he numbe o s udies pe o med o he de ec ion o a wide ange o i uses, pa asi es and bac e ia, using his echnology is inc easing e e y yea (Pooja e al., 2014; Fallahi e al., 2015; Gao e al., 2015; Jung e al., 2015; Wang e al., 2015a). The p inciple o his echnology elies on an au ocycling s and displacemen DNA syn hesis by a DNA polyme ase wi h high s and displacemen ac i i y (Bs ), supe seding he mal dena u a ion s eps (No omi, 2000). The esea ch and de elopmen e o s on LAMP echnology, in he las yea s, ha e been ocused on i s p ac ical applica ion in clinical se ings including he imp o emen o exis ing assays. The mos dis inc i e cha ac e is ics o LAMP a e i s simplici y and i s apidi y, ep esen ing i s majo ad an ages o e he PCR-based echnique (Mo i e al., 2013; No omi e al., 2015). Because his echnology is an iso he mal me hod, LAMP can be pe o med jus by using an inexpensi e hea e like a block hea e o a wa e ba h, allowing, his way, o LAMP o be conduc ed in any ime and any se ing. Mo eo e , besides he con en ional me hods o analyze LAMP p oduc s, such as aga ose gel elec opho esis, isual inspec ion o he inc ease u bidi y, o colou change o he eac ion mix u e (Mo i e al., 2001), his echnology can be a ached o o he de ices such as la e al- low de ices (LFDs) o he de ec ion o labels inco po a ed in o he ampli ica ion p oduc s. LFD es s ha e a numbe o ad an ages o use in he ield, and speci ic LFD immunoassays ha e been pa icula ly success ul in a eas o poin -o -ca e and on-si e es ing (Assadollahi e al., 2009; Baume & T an, 2015; Sajid e al., 2015). The e a e LFD gene ic es comme cially a ailable, like ch oma og aphic s ips ha can de ec bio in-labelled DNA agmen s hyb idized wi h complemen a y FITC-labelled p obes. FITC is de ec ed in he s ips by he o ma ion o complexes wi h gold-conjuga ed an i-FITC an ibodies. The aim o his s udy was o de elop and e alua e wo duplex LAMP assays (dLAMP) based on laB gene, combined wi h a LFD echnology, o implemen a apid, simple and sensi i e Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 235 assay o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l. complex (B. a zelii, B. ga inii, B. bu gdo e i sensu s ic o (s.s.) and B. lusi aniae). Ma e ial and me hods Bo elia bu gdo e i s.l. s ains B. bu gdo e i s.s. (B31), B. a zelii (PGau), B. ga inii (PBi), and B. lusi aniae (PoHL1), esh cul u es a ailable a he G oup o Lep ospi osis and Lyme Bo eliosis (GLBL) om Ins i u o de Higiene e Medicina T opical (IHMT)/UNL, we e incuba ed o one week in BSK-H medium a 34ºC. The g ow h was de ec ed by examining he cul u e using a da k- ield mic oscope and collec ion o he spi oche es was done in he log-phase (app oxima ely 108 – 109 bac e ia/ml). DNA ex ac ion To al genomic DNA ex ac ion om B. bu gdo e i s.l. cul u es was pe o med wi h Gen a Pu egene comme cial ki om QIAGEN®, acco ding o he manu ac u e ’s p o ocol. A e ex ac ion he DNA concen a ion and pu i y we e es ima ed by measu ing he abso bance a 260 nm (A260) and by A260⁄A280 and A260/A230 a ios, using a NanoD op 1000 spec opho ome e (NanoD op™). The DNA concen a ion was adjus ed o 106 genome equi alen s (GE)  5 ng/µl o DNA, acco ding o he Na ional Re e ence Cen e o Bo elia (NRZ uni s), o he ou B. bu gdo e i s.l. genospecies and dilu ions om 10 o 106 GE we e p epa ed. Design o LAMP p ime s A mul iple alignmen o lagellin ( laB) sequences e ie ed om GenBank was c ea ed in Mega 6 (Kuma e al., 2008), and a Flagellin sequence consensus o each genospecies was selec ed: B. bu gdo e i s.s. (accession numbe X15661.1), B. ga inii (accession numbe DQ650333.1), B. a zelii (accession numbe DQ016619.1), and B. lusi aniae (accession Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 236 numbe D82856.1). The p ime se s o each LAMP we e designed using P ime Explo e V4 so wa e (h p:// p ime explo e .jp/elamp4.0.0/index.h ml). This p ime se included wo ou e p ime s (F3 and B3) and wo inne p ime s (FIP and BIP) o each Bo elia genospecies. To educe he eac ion imes, we also designed wo loop p ime s (LF and LB) o each species (Figu e 1). The p ime sequences a e shown in Table 1. All p ime s we e syn hesized and HPLC-pu i ied by S abVida Lda, Po ugal. Table 1 – LAMP p ime s designed a ge ing he ou B. bu gdo e i s.l. genospecies. Genospecies P ime s Sequence B. a zelii Fo wa d Inne P ime (FIPBa) 5’-TTCATCTTGATTTGCTCCCACATG- AACACACCAGCATCACTTTC-3’ Backwa d Inne P ime (BIPBa) 5’-AGCTAATGTTGCAAATCTTTTTGCT- CTTCTTCTTGAGCACCCTC-3’ Fo wa d 3 (F3Ba) 5’-AGCTGAAGAGCTTGGAATG-3’ Backwa d 3 (B3Ba) 5’-TTGAGTAGGTGCTGTAGC-3’ Loop Fo wa d (LFBa) 5’-AGTCCAAGAAGCTTGAGATCCT-3’ Loop Backwa d (LBBa) 5’-GGAGCTCAAGCTGCTCAGGC-3’ B. bu gdo e i s.s. Fo wa d Inne P ime (FIPBb) 5’- GGTTGCTCCAACATGAACTCTTAA- AACACACCAGCATCACTTTC - 3’ Backwa d Inne P ime (BIPBb) 5’-GCAGCTAATGTTGCAAATCTTTT- CTGAACACCCTCTTGAACCG-3’ Fo wa d 3 (F3Bb) 5’-AGCTGAAGAGCTTGGAATG-3’ Backwa d 3 (B3Bb) 5’-GTTGAGCTCCTTCCTGTT-3’ Loop Fo wa d (LFBb) 5’-CCAAGACGCTTGAGACCCT-3’ Loop Backwa d (LBBb) 5´-GAGGGAGCTCAAACTGCTCAGG-3´ B. ga inii Fo wa d Inne P ime (FIPBg) 5’-TCACCAGAGAATAGATTTGCAA- CATGAGCAAATCAAGATGAAGCG-3’ Backwa d Inne P ime (BIPBg) 5’-ACCTGTTCAAGAAGGAGCTCA- AATTAACTCCACCCTGAGAA-3’ Fo wa d 3 (F3Bg) 5’-TCTTGGACCTTAAGAGTTCA-3’ Backwa d 3 (B3Bg) 5’-GATGTATTAGCGTCAACTGTG-3’ Loop Fo wa d (LFBg) 5’-TTAAGGTCCAAGAAGCTTGAGATC-3’ Loop Backwa d (LBBg) 5’-TCTGGTGAAGGAGCTCAGGCT-3’ B. lusi aniae Fo wa d Inne P ime (FIPBl) 5’-ATCTTGATTTGCTCCCACATG- AACTCACCAGCATCACTTTCAGG-3’ Backwa d Inne P ime (BIPBl) 5’-ATGTTGCAAATCTGTTTTCTGGT - GGCTCCTTCTTGTTGAACAC-3’ Fo wa d 3 (F3Bl) 5’-AGCTTGGAATGCAACCTG-3’ Backwa d 3 (B3Bl) 5’-CTTGAGAAGGCGCTGTAG-3’ Loop Fo wa d (LFBl) 5’-CTCAAAGTCCAAGAAGCTTGAGAT-3’ Loop Backwa d (LBBl) 5’-GGGAGCTCAAGTTGCTCAGACTG-3’ Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 237 Figu e 1 – Pa ial sequence o laB gene o B. lusi aniae, and loca ion o he complemen a y egions used o design LAMP p ime s [F3, B3, FIP (F1c-F2), BIP (B1c-B2)], including loop p ime s (LF, LB). A ows indica e he di ec ion o ex ension. Op imiza ion o LAMP eac ion Based on he ini ial condi ions o he LAMP eac ion adop ed om No omi e al., (2000), h ee Mg2+ concen a ions (2 mM, 8mM, and 10 mM), h ee Bs DNA polyme ase concen a ions (2.0 U, 4.0 U, and 8.0 U), wo concen a ion a ios be ween inne o ou e p ime s (4:1 and 8:1) and wo be aine concen a ions (0.80 M and 1.0M) we e es ed in 10 µL eac ion mix u es, while he concen a ions o all he o he componen s emained cons an . The empe a u e o LAMP eac ion was also op imized by es ing ou empe a u es (66, 67, 68 and 69ºC), and also wo incuba ion pe iods (45 and 60 min). These condi ions we e i s es ed only wi h B. lusi aniae LAMP assay, and a e op imiza ion he inal Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 238 condi ions we e applied o he emaining h ee LAMP assays a ge ing B. a zelii, B. ga inii and B. bu gdo e i s.s.. Analy ical speci ici y and sensi i i y o LAMP assays The speci ici y o he LAMP assays o de ec ing B. bu gdo e i s.l. DNA was de e mined using genomic DNA o B. bu gdo e i s.s. (B31), B. a zelii (PGau), B. ga inii (PBi), and B. lusi aniae (PoHL1) e e ence s ains, and DNA om o he mic oo ganisms namely o he spi oche es like Lep ospi a in e ogans (Se o a Ic e ohaemo hagiae) and T eponema pallidum; and o he ick-bo ne pa hogens like Theile ia sp. and Babesia sp.. The sensi i i y o LAMP eac ion was de e mined by using 10- old se ial dilu ions o DNA ex ac ed om B. bu gdo e i s.l. cul u es, co esponding o 10 – 106 GE. Nes ed-PCR p o ocols and eal- ime PCR The se ial dilu ions o B. bu gdo e i s.l. cul u es we e also used o e alua e he sensi i i y o wo nes ed-PCR p o ocols and one eal- ime PCR, in o de o compa e hem wi h he sensi i i y o LAMP assays. One o he nes ed-PCR a ge ed he in e genic space egion (IGS), loca ed be ween he 5S and 23S RNA, using he 23SN1 and 23SC1 ex e nal p ime s (which ampli y a 320 bp DNA agmen ), and he 23SN2 and 5SC inne p ime s (which ampli y a 280 bp DNA agmen ), as desc ibed by Rijpkema e al., 1995. The second nes ed-PCR p o ocol used, a ge ed he lagellin gene ( laB) (Wodecka e al., 2010). This included a i s ampli ica ion eac ion based on he use o ou e p ime s 123 and 905 (which ampli y a 774 bp DNA agmen ), wi h a second ampli ica ion s ep using he inne p ime s 220 and 824 (yielding an ampli ica ion p oduc o 605 bp). PCR p o ocols we e done in a sepa a e e ical lamina low bench using a di e en se o mic opipe es, o PCR use-only as well il e ed ips and s e ilized ma e ial o ensu e a con amina ion- ee en i onmen . B. ga inii DNA was used as posi i e con ol and ul apu e wa e as nega i e con ol. P oduc s we e de ec ed by elec opho esis in 1.5% Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 239 aga ose gels s ained wi h G eenSa e P emium (NZYTech), and isualized unde UV ligh , using a Dolphin-1D Gel Image Analysis So wa e (Weal ec®) equipmen . Rega ding he eal- ime PCR p o ocol, i consis ed in a duplex eac ion a ge ing he laB gene o B.bu gdo e i s.l. and he in e nal con ol 18S DNA o ha d- ick samples. This eal- ime PCR p o ocol was de eloped and op imized by ou labo a o y (da a submi ed). The PCR eac ion was ca ied ou in a o al olume o 20 μl con aining 1× SensiFAST™ (Bioline), 0.3 μM o each p ime (F_Bbsl, R_Bbsl), 0.25 μM o each TaqMan p obe (P_Bbsl), DNase ee wa e (Bioline) and 2 μl o he ex ac ed DNA empla e. The he mal cycling condi ions we e: 1 cycle a 95 °C o 1 min, ollowed by 40 cycles a 95 °C o 10 s and 60 °C o 45 s. The mal cycling, luo escen da a collec ion, and da a analysis we e pe o med in a 7500 Fas eal- ime PCR Sys em (Applied Biosys ems), acco ding o he manu ac u e ’s ins uc ions. LAMP p oduc de ec ion LAMP eac ion was pe o med in a inal olume o 25 µl, con aining 1× LAMP bu e (BioLabs®), 8 mM MgSO4, 1 M Be aine (Sigma®), 0.4 mM dNTP, 1.6 µM o FIP and BIP p ime s, 0.2 µM o F3 and B3 p ime s, 0.4 µM o LF and LB p ime s, 8 U Bs 2.0 Wa mS a ® DNA polyme ase (New England BioLabs® Inc., USA) and 2.5 µl o ex ac ed DNA. The eac ion mix u e was incuba ed in an au oma ic he mocycle (Mycylce , BioRad) a 68ºC o 45 min, and hen inac i a ed a 80 ºC o 5 min. LAMP p oduc s we e de ec ed by: i) assessmen o u bidi y by he naked eye esul ing om he magnesium py ophospha e (Mg2P2O7), p ecipi a ion (Figu e 2A); ii) colo change a naked eye and unde UV by adding 1.0 μl o 1/10-dilu ed o iginal SYBR G een I (In i ogen™), whe e samples ha u ned yellowish g een we e conside ed posi i e, while hose emained o ange we e assumed o be nega i e (Figu e 2B1 and B2); iii) by UV ansillumina ion (Dolphin-Doc Plus Gel Image sys em, Weal ec® equipmen ) in a 2.5% aga ose gel ollowing elec opho esis in T is-Ace a e-EDTA (TAE) bu e s ained wi h 2μl o G eenSa e P emium (NZYTech) (Figu e 2C). Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 240 Figu e 2 – LAMP p oduc s isualiza ion, by naked eye h ough he obse a ion o he u bidi y (A), 1 and 2 - posi i e samples, 3 - nega i e con ol; by in e cala ing dyes like SYBR-G een unde na u al ligh (B1) and UV ligh (B2), 1 and 2 - posi i e samples, 3 nega i e con ol; by elec opho esis in a 2.5% aga ose gel (C), 1,2 and 3 – posi i e samples, 4 – nega i e con ol. La e al Flow De ice s ips Fo de ec ion o LAMP p oduc s by LFD, he adequa e FITC-labeled p obe should be added o he LAMP p oduc s. The p o ocol include a i s s ep o hyb idiza ion a 65 ºC o 5 min, and hen 8 µl o he hyb idized p oduc is added o 100 µl assay bu e in a new ube. An LFD s ip is dipped in o he mix u e o 2 min. Comme cial uni e sal LFD de ices o he de ec ion o labelled LAMP p oduc s we e pu chased om Milenia Bio ec (Hyb iDe ec 2T) and used acco ding o he ins uc ions o he manu ac u e . S a is ical analysis The esul s we e analyzed by he Chi-squa e es using BioEs a 5.0. A di e ence was conside ed s a is ically signi ican a P < 0.05. Resul s Op imiza ion o LAMP eac ion When he concen a ion o Mg2+ was e alua ed, we obse ed ha oge he wi h he inc ease o he empe a u e om 66 o 69ºC, he bes concen a ion was 8 mM, since ha a 2 mM he A B2 B1 C 1 2 3 1 2 3 1 2 3 1 2 3 4 Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 241 de ec ion limi o he eac ion dec eased and a 10 mM LAMP eac ion was inhibi ed. Rega ding he a io o inne o ou e p ime s mo e in ense ladde -like bands we e ob ained a he concen a ion a io 8:1 (Figu e 3A), also he ampli ica ion imp o ed ob iously as he dosage o Bs DNA polyme ase inc eased om 2.0 U o 8.0 U, as e idenced by b igh e bands on aga ose gels (Figu e 3B). F om he empe a u e and ime o eac ion a ia ion, he de ec ion limi was g ea e wi h highe empe a u es (68ºC) and less ime o eac ion (45 min), since no unspeci ic esul s appea ed (Figu e 3C). The e o e he abo e esul s demons a ed ha he op imized LAMP eac ion consis ed o using Mg2+ a a concen a ion o 8 mM, he a io o inne o ou e p ime s a 8:1, and he concen a ion o Bs DNA polyme ase a 8.0 U. Also, LAMP assay was easy o conduc , al hough some measu es conce ning he p e en ion o con amina ion we e necessa y. P ecau ions such as changing glo es be ween e e y LAMP assay and di e en wo k a eas o di e en pa s o he expe imen we e aken in o accoun . Figu e 3 – LAMP assay op imiza ion by es ing: di e en FIP/BIP and F3/B3 concen a ions a io (A); di e en concen a ions o Bs polyme ase (B); and di e en empe a u es o eac ion (C). A B C 4x 8x 2U 4U 8U 68oC 66 oC 65 oC Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 242 Analy ical speci ici y o LAMP assay LAMP eac ion speci ici y was e alua ed and esul s showed ha only he ou B. bu gdo e i s.l. genospecies p oduced a ypical ladde o mul iple bands on he aga ose gel, while o he DNA samples o nega i e con ol did no p oduce such bands. Howe e , when each LAMP se was es ed wi h DNA om he espec i e B. bu gdo e i s.l. genospecies, he speci ici y ob ained was no he expec ed, since each o he ou se s ampli ied no only he espec i e B. bu gdo e i s.l. genospecies bu also one o mo e o he o he s B. bu gdo e i s.l. genospecies. Fo example LAMP se o B. ga inii ampli ied B. ga inii DNA bu also B. a zelii DNA, and LAMP se o B. lusi aniae ampli ied B. lusi aniae DNA bu also he o he s h ee genospecies DNA, B. ga inii, B. bu gdo e i s.s. and B. a zelii. The e o e each LAMP se was speci ic o B. bu gdo e i s.l. gene a bu no o each genospecies. This lack o speci ici y led us o con inue he wo k wi h only he B. lusi aniae LAMP p ime s se since i was able o ampli y DNA empla es o all ou genospecies. This way we decided o de elop a LAMP assay a ge ing he ou o he mos p e alen species o B. bu gdo e i s.l. complex. Analy ical sensi i i y Since he e was no speci ici y o LAMP se s o each genospecies, he analy ical sensi i i y o LAMP eac ion was e alua ed only wi h he B. lusi aniae p ime s se , since i ampli ied he ou mos impo an genospecies. The esul s showed ha he de ec ion limi was 0.5 ng/µl  104 GE o B. a zelii, 2.5 ng/µl  103 GE o B. ga inii, 1 ng/µl  103 GE o B. bu gdo e i s.s. and 2.5 pg/µl  102 GE o B. lusi aniae (Figu e 4). Rega ding he nes ed-PCR p o ocol o laB gene, he de ec ion limi was 5 pg/µl 103 GE o B. a zelii, 0.5 pg/µl  102 GE o B. lusi aniae, and 0.05 pg/µl  10 GE o B. bu gdo e i s.s and B. ga inii. The nes ed-PCR p o ocol o IGS, p esen ed a de ec ion limi o 5 pg/µL 103 GE o B. a zelii, B. bu gdo e i s.s and B. ga inii, and 0.5 pg/µl 102 GE o B. lusi aniae. These esul s sugges ha LAMP sensi i i y was simila o ha o he IGS a ge ed nes ed-PCR p o ocol, excep o B. a zelii which was lowe . Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 249 Assous MV, Pos ic D, Paul G, Né o P and Ba an on G. (1993). Wes e n blo analysis o se a om Lyme bo eliosis pa ien s acco ding o he genomic species o he Bo elia s ains used as an igens. Eu opean Jou nal o Clinical Mic obiology & In ec ious diseases, 12(4): 261–8; Baume JL and T an DH. (2015). La e al low de ices o de ec ing alle gens in ood. Handbook o Food Alle gen De ec ion and Con ol, 219–228. doi:10.1533/9781782420217.2.219; de Leeuw BH, Ma aha B, Hollemans L, e al. (2014). E alua ion o Bo elia eal ime PCR DNA a ge ing OspA, FlaB and 5S–23S IGS and Bo elia 16S RNA RT-qPCR. Jou nal o Mic obiological Me hods, 107: 41–46. doi: 10.1016/j.mime .2014.09.001; Fallahi S, Maza ZA, Ghasemian M, e al. (2015). Challenging loop-media ed iso he mal ampli ica ion (LAMP) echnique o molecula de ec ion o Toxoplasma gondii. Asian Paci ic Jou nal o T opical Medicine, 8(5): 366–372. doi: 10.1016/S1995-7645(14)60345-X; Gao C, Ding D, Wang J, e al. (2015). De elopmen o a LAMP assay o de ec ion o Leishmania in an um in ec ion in dogs using conjunc i al swab samples. Pa asi es & Vec o s, 8: 370. doi: 10.1186/s13071-015-0991-2; Hin e sehe I, Gäbel G, Co inus F, e al. (2012). P esence o Bo elia bu gdo e i sensu la o an ibodies in he se um o pa ien s wi h abdominal ao ic aneu ysms. Eu opean Jou nal o Clinical Mic obiology & In ec ious Diseases , 31(5): 781–9. doi: 10.1007/s10096-011-1375-y; Jung JH, Pa k BH, Oh SJ, e al. (2015). In eg a ed cen i ugal e e se ansc ip ase loop-media ed iso he mal ampli ica ion mic ode ice o in luenza A i us de ec ion. Biosenso s and Bioelec onics, 68: 218–224. doi: 10.1039/c4lc01033g; Kond usik M, G ygo czuk S, Sko a czak B, e al. (2007). Molecula and se ological diagnosis o Bo elia bu gdo e i in ec ion among pa ien s wi h diagnosed E y hema mig ans. Annals o Ag icul u al and En i onmen al Medicine : AAEM, 14(2): 209–213; Kuma S, Nei M, Dudley J, e al. (2008). MEGA: A biologis -cen ic so wa e o e olu iona y analysis o DNA and p o ein sequences. B ie ings in Bioin o ma ics, 9(4): 299–306. doi: 10.1093/bib/bbn017; Liu ZY, Hao Q, Hou XX, e al. (2013). A s udy o he echnique o wes e n blo o diagnosis o lyme disease caused by Bo elia a zelii in China. Biomedical and En i onmen al Sciences : BES, 26(3): 190–200. doi: 10.3967/0895-3988.2013.03.006; Ma gos G, Vollme SA, Ogden NH e al. (2011). Popula ion gene ics, axonomy, phylogeny and e olu ion o Bo elia bu gdo e i sensu la o. In ec ion, Gene ics and E olu ion, 11(7): 1545–1563. doi: 10.1016/j.meegid.2011.07.022; Mo i Y, Hi ano T and No omi T. (2006). Sequence speci ic isual de ec ion o LAMP eac ions by addi ion o ca ionic polyme s. BMC bio echnology, 6: 3. doi: 10.1186/1472-6750-6-3; Mo i Y, Kanda H and No omi T. (2013). Loop-media ed iso he mal ampli ica ion (LAMP): ecen p og ess in esea ch and de elopmen . Jou nal o In ec ion and Chemo he apy, 19(3): 404–411. doi: 10.1007/s10156-013-0590-0; Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 250 Mo i Y, Nagamine K, Tomi a N, e al. (2001). De ec ion o loop-media ed iso he mal ampli ica ion eac ion by u bidi y de i ed om magnesium py ophospha e o ma ion. Biochemical and Biophysical Resea ch Communica ions, 289(1): 150–154. doi:10.1006/bb c.2001.5921; No e AC, Al es da Sil a A, Al es J, e al. (2015). The impo ance o liza ds and small mammals as ese oi s o Bo elia lusi aniae in Po ugal. En i onmen al Mic obiology Repo s, 7(2): 188–193. doi: 10.1111/1758-2229.12218; No omi T. (2000). Loop-media ed iso he mal ampli ica ion o DNA. Nucleic Acids Resea ch, 28(12): 63e–63; No omi T, Mo i Y, Tomi a N, e al. (2015). Loop-media ed iso he mal ampli ica ion (LAMP): p inciple, ea u es, and u u e p ospec s. Jou nal o Mic obiology, 53(1): 1–5. doi: 10-1007/s12275- 015-4656-9; No omi T, Okayama H, Masubuchi H, e al. (2000). Loop-media ed iso he mal ampli ica ion o DNA. Nucleic Acids Resea ch, 28(12): E63. doi: 10.1093/na /28.12.e63; Picken MM, Picken RN, Han D, e al. (1996). Single- ube nes ed polyme ase chain eac ion assay based on Flagellin gene sequences o de ec ion o Bo elia bu gdo e i sensu la o. Eu opean Jou nal o Clinical mMic obiology & In ec ious Diseases, 15(6): 489–98; Pooja S, Sudesh D, Poonam K, e al. (2014). Loop-media ed iso he mal ampli ica ion (LAMP) based de ec ion o bac e ia: A Re iew. A ican Jou nal o Bio echnology. 13(19): 1920–1928. doi: 10.1007/s00253-014-5531-z; P iem S, Ri ig MG, Kam ad T, e al. (1997). An op imized PCR leads o apid and highly sensi i e de ec ion o Bo elia bu gdo e i in pa ien s wi h Lyme bo eliosis. Jou nal o Clinical Mic obiology, 35(3): 685–90; Rau e C, Oehme R, Di e ich I, e al. (2002). Dis ibu ion o clinically ele an Bo elia genospecies in icks assessed by a no el, single- un, eal- ime PCR. Jou nal o Clinical Mic obiology. 40(1): 36– 43. doi: 10.1128/JCM.40.1.36-43.2002; Rich e D, Schlee DB, Allgöwe R, e al. (2004). Rela ionships o a no el Lyme disease spi oche e, Bo elia spielmani sp. no ., wi h i s hos s in Cen al Eu ope. Applied and En i onmen al Mic obiology, 70: 6414–6419. doi: 10.1128/AEM.70.11.6414-6419.2004; Rijpkema SGT, Molkenboe MJCH, Schouls LM, e al. (1995). Simul aneous de ec ion and geno yping o h ee genomic g oups o Bo elia bu gdo e i sensu la o in Du ch Ixodes icinus icks by cha ac e iza ion o he ampli ied in e genic space egion be ween 5S and 23S RNA genes. Jou nal o Clinical Mic obiology, 33(12): 3091–3095; Robe son J, Guy E, And ews N, e al. (2000). A Eu opean mul icen e s udy o immunoblo ing in se odiagnosis o Lyme bo eliosis. Jou nal o Clinical Mic obiology, 38(6): 2097–2102; Sajid M, Kawde AN and Daud M. (2015). Designs, o ma s and applica ions o la e al low assay: A li e a u e e iew. Jou nal o Saudi Chemical Socie y, 19(6): 689–705. doi:10.1016/j.jscs.2014.09.001; Chap e 5 De elopmen o new molecula ools o he iden i ica ion o Bo elia bu gdo e i s.l. genospecies o imp o e Lyme disease diagnosis 251 Shih CM and Chao LL. (2002). Gene ic analysis o he ou e su ace p o ein C gene o Lyme disease spi ochae es (Bo elia bu gdo e i sensu la o) isola ed om oden s in Taiwan. Jou nal o Medical Mic obiology, 51(4): 318–325. doi: 10.1099/0022-1317-51-4-318; S ee e AC, McHugh G, Damle N, e al. (2008). P ospec i e s udy o se ologic es s o Lyme disease. Clinical In ec ious Diseases, 47(2): 188–195. doi:10.1086/589242; S unzne D, Hubalek Z, Halouzka J, e al. (1998). P e alence o Bo elia bu gdo e i s.I. in Ixodes icinus icks om S y ia (Aus ia) and species iden i ica ion by PCR-RFLP analysis. Zen albla ü Bak e iologie, 288(4): 471–478; Van Dam AP, Kuipe H, Vos K, e al. (1993). Di e en genospecies o Bo elia bu gdo e i a e associa ed wi h dis inc clinical mani es a ions o Lyme bo eliosis. Clinical In ec ious Diseases, 17(4): 708–717. doi: 10.1093/clinids/17.4.708; Wang DG, Wang Y, Xiao F, e al. (2015a). A compa ison o in-house eal- ime LAMP assays wi h a comme cial assay o he de ec ion o pa hogenic bac e ia. Molecules, 20(6): 9487–9495. doi: 10.3390/molecules20069487; Wang DG, B ews e JD, Paul M e al. (2015b). Two me hods o inc eased speci ici y and sensi i i y in loop-media ed iso he mal ampli ica ion. Molecules, 20(4): 6048–6059. doi: 10.3390/molecules20046048; Wang G, Ague o-Rosen eld A, Wo mse G e al. (2010). De ec ion o Bo elia bu gdo e i. Samuels D and Radol J, edi o s. In: Bo elia. Molecula Biology, Hos In e ac ion, and Pa hogenesis. Cais e Academic P ess, 279–298; Wodecka B. (2011). laB gene as a molecula ma ke o dis inc iden i ica ion o Bo elia species in en i onmen al samples by he PCR- es ic ion agmen leng h polymo phism me hod. Applied and En i onmen al Mic obiology, 77(19): 7088–7092. doi: 10.1128/AEM.05437-11; Wodecka B, Leońska A and Sko a czak B. (2010). A compa a i e analysis o molecula ma ke s o he de ec ion and iden i ica ion o Bo elia spi ochae es in Ixodes icinus. Jou nal o Medical Mic obiology, 59: 309–314. doi: 10.1099/jmm.0.013508-0; Yang J, Guan G, Niu Q, e al. (2013). De elopmen and applica ion o a loop-media ed iso he mal ampli ica ion assay o apid de ec ion o Bo elia bu gdo e i s. l. in icks. T ansbounda y and Eme ging Diseases, 60(3): 238–44. doi: 10.1111/j.1865-1682.2012.01335.x; Zhang LL, Hou XX, Geng Z, e al. (2015). Combina ion o Loop-Media ed Iso he mal Amplifica ion Assay and Nes ed PCR o De ec ion o Bo elia bu gdo e i sensu la o in Human Se um Samples. Biomedical and En i onmen al Sciences : BES, 28(4): 312–5. doi: 10.3967/bes2015.044; Zhou D, Guo J, Xu L, e al. (2014). Es ablishmen and applica ion o a loop-media ed iso he mal ampli ica ion (LAMP) sys em o de ec ion o c y1Ac ansgenic suga cane. Scien i ic Repo s, 4: 4912. Doi: 10-1038/s ep04912; Chap e 6 Concluding ema ks and pe spec i es Chap e 6 Concluding ema ks and pe spec i es 255 6. Concluding ema ks and pe spec i es Lyme disease is inc easing apidly in many pa s o he wo ld and is he mos commonly occu ing ec o -bo ne disease in Eu ope and he USA. In Po ugal, despi e LD has been iden i ied wen y i e yea s ago, his zoonosis s ill emains unde diagnosed and unde epo ed, being o en assigned by ou physicians as a pa hology only p esen in USA. Mo eo e a gold s anda d es wi h s anda dized diagnos ic c i e ia o LD diagnosis, is no ye es ablish, exis ing a a ie y o di ec and indi ec app oaches, mos o hem used inco ec ly and inadequa e o he e olu ion s age o he disease. Thus, he s udies de eloped in he p esen hesis aimed o con ibu e o:  a bio-ecological cha ac e iza ion o he ixodo auna in nine dis ic s ac oss mainland Po ugal, whe e he p esence o I. icinus icks we e p e iously epo ed, and o de e mina e B. bu gdo e i s.l. in ec ion a e in he collec ed icks;  a be e knowledge o he eco-epidemiology o B. bu gdo e i s.l. genospecies and Relapsing Fe e Bo elia a he ec o and animal hos s le el;  a mo e imp o ed molecula diagnosis o LD, by he de elopmen and e alua ion o wo molecula ools namely a TaqMan eal- ime PCR algo i hm and a iso he mal ampli ica ion p o ocol o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Po ugal. In he cap u es ca ied ou in he nine dis ic s, se e al ick species we e possible o collec om he ege a ion (n = 4251) as well as om he hos s (n = 2171). The mos widesp ead ick species was R. sanguineus ega ding he ege a ion and he animal hos s, al hough we could no co e all Po uguese dis ic s, an possible expansion o ick species in o new egions was no iced namely D. e icula us in B aga dis ic and I. icinus in A ei o dis ic , since he e a e no eco ds o he p esence o hese species in he wo dis ic s. This ac may ha e nume ous consequences, including modi ica ions in hei ecological cha ac e is ics, impac s on he dynamic o local hos popula ions, and also impo an implica ions when conside ing he ick-bo ne pa hogens ha could a ec humans and o he animal species. Also Chap e 6 Concluding ema ks and pe spec i es 256 B. bu gdo e i s.l. in ec ion a e was i s ly de e mined by wo nes ed-PCR a ge ing he laB gene and he in e genic space egion 5S-23S, being I. icinus nymphs he mo e in ec ed s age, al hough, o he ick species we e also in ec ed by hese pa hogenic agen s. The posi i e icks we e sequenced and he ick samples ha we e no iden i ied as B. bu gdo e i s.l. species, we e subjec ed o wo o he PCR p o ocols a ge ing he glpQ gene, and he 16S DNA gene. The sequencing esul s e ealed ha B. lusi aniae was he mos p e alen species in I. icinus ick om Vila-Real, Lisboa, Se úbal and Fa o dis ic s. Mo eo e , B. ga inii, B. bu gdo e i s.s., B. alaisiana and B. a zelii DNA we e also iden i ied in se e al icks species a he han I. icinus, namely D. ma gina us om B aga dis ic , R. sanguineus om B aga, Vila-Real, and É o a dis ic s and Hy. lusi anicum and H. punc a a om Lisboa dis ic . These esul s con i m p e ious epo s indica ing a coun ywide dis ibu ion o B. bu gdo e i s.l. genospecies in ques ing icks, being B. lusi aniae he mos p e alen species a he ec o le el. Unexpec edly, B. miyamo oi DNA was iden i ied o he i s ime in he coun y, in a ques ing I. icinus nymph om Lisboa dis ic , al hough no human cases ha e been iden i ied so a in he coun y, his species has been associa ed o human disease in o he s coun ies om Eu ope. Despi e his species belongs o Relapsing Fe e Bo elia g oup, whose spi oche es a e usually ansmi ed by so -body icks, B. miyamo oi has been ound in ha d- body icks om Ame ica, Eu ope and Asia con inen s, mainly in Ixodes genus, e ealing an ex ensi e geog aphic dis ibu ion. The e o e, u he s udies in ol ing mo e collec ions in o he dis ic s a e needed, o be e unde s and he possible sp ead o B. miyamo oi in Po ugal, con ibu ing o he de e mina ion o he human isk o exposu e o he ec o and he bac e ia. Addi ionally, DNA om wo possible new Relapsing Fe e like Bo elia species we e also iden i ied, one in i e pools o ques ing la ae and one ques ing nymph o H. punc a a ick om Lisboa dis ic , and he o he in wo ques ing R. sanguineus emales om B aga and É o a dis ic s. By phylogene ic analysis o 16S RNA, laB and glpQ sequences, hese wo no el species o m wo independen clus e s placed in a la ge subg oup o Relapsing Fe e Bo elia ha included B. heile i, B. lones a i and a numbe o unclassi ied spi oche es. Due Chap e 6 Concluding ema ks and pe spec i es 257 o he small numbe o posi i e samples i is no clea i hese bac e ia a e es ic ed o ick species o o he a ea whe e hey ha e been ound, he e o e isola ion o hese spi oche es in i o, hei cha ac e iza ion and he ole in human and e e ina y disease, will be he ocus in a u u e esea ch, associa ed o a mo e widesp ead collec ion o icks ac oss he coun y. Conce ning he icks collec ed om he hos s, i was possible o iden i y DNA om se e al pa hogens, namely Anaplasma spp., Babesia spp., B. bu gdo e i s.l., Ce copi hi ila ia spp., Hepa ozoon spp., and Ricke sia spp., in icks collec ed om dogs and ca s ha belonged o Gua da, Lisboa, Se úbal and Fa o dis ic s. Ri. massiliae DNA was ampli ied o he i s ime in icks collec ed om ca s, al hough he e is no e idence ha i can cause illness o ha he animal can play a ole in he ansmission o his bac e ium o humans. Also, Ce copi hi ila ia spp. was de ec ed o he i s ime in a R. sanguineus collec ed om a dog. Rega ding DNA om B. bu gdo e i s.l., i was possible o iden i y i in only one ick sample om R. sanguineus species collec ed om a dog in Se úbal dis ic . This s udy was he i s in he coun y ha e ealed he p esence o p o ozoa and nema odes wi h e e ina y medical impo ance, in icks collec ed om domes ic animals, sugges ing a isk o eme gence o hese ick-bo ne diseases in domes ic animals and in humans. Consequen ly, mo e s udies on hese and o he ick-bo ne agen s should be pe o med in mo e dis ic s ac oss he coun y, o be e unde s and i s epidemiological and clinical impo ance. The s udies ega ding he esea ch o se e al ick-bo ne pa hogens in biological samples collec ed om se e al wildli e hos s, e ealed o he i s ime he p esence o Anaplasma spp. and Theile ia spp. DNA, among ed dee , allow dee and wild boa s in cen al/sou he n Po ugal, howe e he abili y o Anaplasma pla ys, he species iden i ied in ed dee and wild boa s, o cause disease in hese animals has no been es ablished ye . Also, B. a zelii DNA, was iden i ied by he i s ime in se um samples om wild boa s om T ás-os-Mon es egion, indica ing ha he wild boa hun ing dogs may ac as a link be ween he wild and he domes ic Bo elia ansmission cycle, by ca ying icks in o he hun e ’s households, exposing hem o a highe isk o ick-bo ne diseases. These indings poin o he impo ance o wildli e hos s in main aining se e al ick-bo ne pa hogens, ep esen ing a isk o e e ina y and human heal h, since he in e ac ion o Chap e 6 Concluding ema ks and pe spec i es 258 di e en pa hogens wi hin he e eb a e hos migh lead o inc eased suscep ibili y o o he in ec ions, o o modi ica ions o he pa hogenesis o each agen , esul ing in high isks o wildli e and human heal h. The e o e, u he epidemiological s udies conce ning Bo elia, Anaplasma and Theile ia species, in ec ing wild ungula es, a e equi ed o a p ope in ec ion isk assessmen ac oss he coun y. This app oach is impo an o de elop u u e s a egies o p e en ion and disease con ol oo ed in a mul idisciplina y app oach ha encompasses bo h human and animal heal h. Fo biological samples collec ed om domes ic animals such as dogs and ca s om he sou he n egion o Po ugal, DNA om se e al eline and canine ec o -bo ne diseases agen s we e iden i ied. Feline samples we e posi i e o Leishmania spp., Hepa ozoon spp., Babesia spp., Anaplasma spp./Eh lichia spp., Ba onella spp., and B. bu gdo e i s.l., while he canine samples we e posi i e o Anaplasma spp./Eh lichia spp., B. bu gdo e i s.l., Hepa ozoon spp, and Leishmania in an um. The iden i ica ion o eline and canine ec o - bo ne diseases agen s in domes ic animals om sou he n Po ugal, some o hem o zoono ic conce n, ein o ces he impo ance o ale he e e ina y au ho i ies o he isk o ansmission o hese ec o -bo ne agen s o o he e eb a e hos s, including humans. The use o ec opa asi icides agains a h opods and educa ion and awa eness o he popula ion mus be done, o p e en and a oid he dissemina ion o hese pa hogens o o he hos s. Rega ding he s udies conce ning he de elopmen and op imiza ion o wo molecula echniques o he iden i ica ion o ou o he mos p e alen genospecies o B. bu gdo e i s.l. in Po ugal, he wo-s ep mul iplex TaqMan eal- ime PCR assay a ge ing he laB locus, p o ed o be an e icien me hod when sc eening o Bo elia in ec ion in ick samples, and a p omising ool o ea ly diagnos ic pu poses on clinical samples. Mo eo e , he abili y o de ec ou o he mos p e alen B. bu gdo e i s.l. genospecies in Eu ope, in a single- un is a ime-sa ing ac o , besides he cos educ ion when compa ed wi h he con en ional PCR and sequencing me hods. Conce ning he LAMP echnique some p oblems occu ed du ing i s op imiza ion, since he designed p ime s we e no speci ic o each B. bu gdo e i s.l. genospecies, bu only o he complex, and also he p esence o unspeci ic ampli ica ions a he nega i e con ols le el. Fo a be e esul , his echnique will be enhanced in he u u e,