Unraveling of Borrelia burgdorferi sensu lato genospecies diversity in Portugal towards the development of more efficient diagnostic tools for Lyme disease

Unraveling of Borrelia burgdorferi sensu lato genospecies diversity in Portugal towards the development of more efficient diagnostic tools for Lyme disease Mónica Susana Claudino Nunes December, 2016 Universidade Nova de Lisboa Instituto de Higiene e Medicina Tropical Thesis presented to obtain the Ph.D. Degree in Biomedical Sciences, specialization Microbiology Unraveling of Borrelia burgdorferi sensu lato genospecies diversity in Portugal towards the development of more efficient diagnostic tools for Lyme disease Author: Mónica Susana Claudino Nunes Supervisor: Investigadora Doutora Maria Luísa Jorge Vieira Co-supervisors: Professsor Doutor António Paulo Gouveia de Almeida Professor Doutor João José Inácio Silva Tutorial Commission: Investigadora Doutora Maria Luísa Jorge Vieira Professor Doutor Celso Vladimiro Ferreira de Abreu Cunha Investigadora Doutora Maria Sofia Cobra Lince Núncio Soares Thesis presented in fulfillment of the necessary requirements to obtain the Ph.D. degree in Biomedical Sciences, specialization Microbiology Financial support to this work was provided by Fundação para a Ciência e a Tecnologia (FCT), through the scholarship SFRH/BD/78325/2011. Universidade Nova de Lisboa Instituto de Higiene e Medicina Tropical Bibliographic elements Papers in peer-reviewed international scientific journals directly related with the work presented in this thesis: Pereira A, Parreira R, Nunes M, Casadinho A, Vieira ML, Campino L, Maia C. 2016. Molecular detection of tick-borne-bacteria and protozoa in cervids and wild boars from Portugal, Parasites & Vectors, 9: 251. Doi: 10.1186/s13071-016-1535-0; Nunes M, Parreira R, Maia C, Lopes N, Fingerle V, Vieira ML. 2016. Molecular identification of Borrelia genus in questing hard ticks from Portugal: phylogenetic characterization of two novel Relapsing Fever-like Borrelia sp. Infection, Genetics and Evolution, 40: 266–274. Doi: 10.1016/j.meegid.2016.03.008; Nunes M, Parreira R, Lopes N, Maia C, Carreira T, Sousa C, Faria S, Vieira ML. 2015. Molecular identification of Borrelia miyamotoi in Ixodes ricinus from Portugal. VectorBorne and Zoonotic Diseases, 15 (8): 515-517. Doi: 10.1089/vbz.2014.1765; Maia C, Almeida B, Coimbra M, Fernandes MC, Critovão JM, Ramos C, Martins A, Martinho F, Silva P, Neves N, Nunes M, Vieira ML, Cardoso L, Campino L. 2015. Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & Vectors, 8 (138): 759. Doi: 10.1186/s13071-015-0759-8; Faria AS, Paiva-Cardoso MN, Nunes M, Carreira T, Vale-Gonçalves HM, Veloso O, Coelho C, Cabral JA, Vieira-Pinto M, Vieira ML. 2015. First Detection of Borrelia burgdorferi sensu lato DNA in Serum of the Wild Boar (Sus scrofa) in Northern Portugal by Nested-PCR. EcoHealth, 12(1): 183-187. Doi:10.1007/s10393-014-0973-4; Maia C, Ramos C, Coimbra M, Bastos F, Martins A, Pinto P, Nunes M, Vieira ML, Cardoso L, Campino L. 2014. Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasite & Vectors, 7 (115): 2 – 8. Doi: 10.1186/1756-3305-7-115; Maia C, Ferreira A, Nunes M, Vieira ML, Campino L, Cardoso L. 2014. Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal. Ticks and Tickborne Diseases, 5(4): 409-14. Doi: 10.1016/j.ttbdis.2014.01.009; Papers in peer-reviewed international scientific journals directly related with the work presented in this thesis (submitted or in preparation): Nunes M, Lopes N, Maia C, Almeida JP, Vieira ML. 2016. Characterization and distribution of ixodids in nine districts of mainland Portugal where I. ricinus presence was previously reported: Borrelia burgdorferi s.l. prevalence (in submission); Nunes M, Carreira T, Inácio J, Vieira ML. 2016. Development and evaluation of a twostep multiplex TaqMan real-time PCR assay for detection of Borrelia burgdorferi s.l. genospecies (in submission); Nunes M, Nascimento M, Carreira T, Inácio J, Vieira ML. 2016. Development of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection of Borrelia burgdorferi s.l. genospecies DNA in tick samples (in preparation). Other papers published during the preparation of this thesis: Pereira A, Figueira L, Nunes M, Esteves A, Maia C, Cotão AJ, Vieira ML, Campino L, Parreira R. 2016. Multiple phlebovirus (Bunyaviridae) genetic groups detected in Rhipicephalus, Hyalomma and Dermacentor ticks from southern Portugal. Ticks and Tick-borne Diseases, 8 (1):45-52. Doi: 10.1016/j.ttbdis.2016.09.015; Gonçalves DD, R Moura RA, Nunes M, Carreira T, Vidotto O, Freitas JC, Vieira ML. 2015. Borrelia burgdorferi sensu lato in humans in a rural área of Parana State, Brazil. Brazilian Journal of Microbiology, 46 (2): 571-575. Doi: 10.1590/S1517838246220140097; Gonçalves DD, Carreira T, Nunes M, Benitez A, Lopes-Mori FM, Vidotto O, de Freitas JC, Vieira ML. 2014. First record of Borrelia burgdorferi B31 strain in Dermacentor nitens ticks in the northern region of Parana (Brazil). Brazilian Journal of Microbiology, 44(3): 883-7. Doi: 10.1590/S1517-83822013000300035; Cortes S, Maurício I, Kuhls K, Nunes M, Lopes C, Marcos M, Cardoso L, Schonian G, Campino L. 2014. Genetic diversity evaluation on Portuguese Leishmania infantum strains by Multilocus Microsatellite Typing. Infection, Genetics and Evolution, 26: 2031. Doi: 10.1016/j.meegid.2014.04.023; Maia C, Nunes M, Marques M, Henriques S, Rolão N, Campino L. 2013. In vitro susceptibility of Leishmania infantum isolated from humans and dogs. Experimental Parasitology, 135 (1): 36-41. Doi: doi: 10.1016/j.exppara.2013.05.015. The work developed during this thesis was presented in nine (9) oral communications and twelve (12) posters at national and international conferences: Oral communications Pereira A, Parreira R, Nunes M, Casadinho A, Vieira ML, Campino L, Maia C. 2016. Molecular detection of tick-borne-bacteria and protozoa in cervids and wild boars from Portugal. XI International Symposium on Vector-Borne Diseases. 9-13 Maio. Miami, Estados Unidos da América. [OC last author]; Nascimento M, Nunes M, Vieira ML. 2015. “Otimização de uma técnica de amplificação isotérmica associada a sondas moleculares para identificação das espécies de Borrelia burgdorferi sensu lato mais prevalentes em Portugal”. 3º Congresso Nacional de Medicina Tropical / 1º Congresso Lusófono de Doenças Transmitidas por Vetores, IHMT/UNL, 20 e 21 Abril, Lisboa. [OC 1st autor]; Nunes M, Vieira ML, Inácio J, Nascimento M, Parreira R. 2014. “Otimização da técnica LAMP para a identificação de genoespécies de Borrelia burgdorferi s.l.”. V Jornadas Científicas do IHMT, 12 Dezembro, IHMT/UNL, Lisboa. [OC 1st autor]; Faria AS, Paiva-Cardoso M, Nunes M, Carreira T, Vale-Gonçalves HM, Veloso O, Coelho C, Cabral JA, Vieira-Pinto M, Vieira ML. 2014. “Primeira deteção de DNA de Borrelia burgdorferi sensu lato em soro de javali”. VIII Jornadas de Biologia da Universidade de Trás-os-Montes e Alto-Douro, 22 e 23 de Outubro, Vila-Real. [OC 1st autor]; Nunes M. 2014. “Identification of Lyme Disease agents in the Portuguese ixodofauna.” Seminar: “Arthropoda – Vectors of human and animal Pathogens: from epidemiology to control.” Faculdade de Medicina Veterinária, Universidade de Lisboa, 7 de Julho, Lisboa. [Invited Speaker]; Maia C, Ramos C, Coimbra M, Bastos F, Martins A, Pinto P, Nunes M, Vieira ML, Cardoso L, Campino L. 2014. Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. IX International Symposium on Vector-Borne Diseases, 22-25 Março. Lisboa. [OC 1st autor]; Nunes M, Lopes N, Carreira T, Almeida P, Inácio J, Vieira ML. 2013. “Presença dos agentes da Doença de Lyme na ixodofauna portuguesa: determinação de taxa de infeção”. IV Jornadas Científicas do IHMT, 13 Dezembro, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa, Lisboa. [OC 1st autor]; Nunes M, Lopes N, Inácio J, Vieira ML. 2013. “Development of real-time PCR assays targeting the flagellin gene for the identification of Borrelia burgdorferi sensu lato genospecies”. MicroBiotec’13, 6 – 8 Dezembro, Universidade de Aveiro, Aveiro (flash presentation). [OC 1st autor]; Nunes M, Vieira ML. 2013. “Borreliose de Lyme como zoonose emergente e seu impacte na saúde pública: a realidade portuguesa”. Seminário no âmbito do Mestrado Integrado em Medicina Veterinária. 21 Maio, Universidade de Trás-os-Montes e Alto Douro, Vila Real [Invited Speaker]; Posters Nunes M, Parreira R, Carreira T, Vieira ML. 2015. “Molecular Identification of two Tick-borne Relapsing Fever-like Borrelia sp. in hard ticks from Portugal”. Microbiotec’15, 10 a 12 Dezembro, Universidade de Évora; Nascimento M, Nunes M, Vieira ML. 2015. “Optimization of an isothermal amplification technique (LAMP) for the identification of the major species of Borrelia burgdorferi s.l. in Portugal”. Microbiotec’15, 10 a 12 Dezembro, Universidade de Évora; Nunes M, Carreira T, Inácio J, Vieira ML. 2015. “Development of a quadruplex realtime PCR for Borrelia burgdorferi s.l. species identification.” ICLB - 14th International Conference on Lyme Borreliosis and other Tick-Borne Diseases, 27 a 30 Setembro, Viena, Áustria; Nunes M, Maia C, Carreira T, Almeida AP, Campino L, Vieira ML. 2015. “Doença de Lyme no sul de Portugal: avaliação da relação entre hospedeiros domésticos (caninos e felinos) e vetor”. 3º Congresso Nacional de Medicina Tropical / 1º Congresso Lusófono de Doenças Transmitidas por Vetores, IHMT/UNL, 20 e 21 Abril, Lisboa; Nunes M, Lopes N, Carreira T, Maia C, Almeida AP, Vieira ML. 2014. “First molecular detection of human relapsing fever spirochete Borrelia miyamotoi in Ixodes ricinus from Portugal”. IMED – international Meeting on Emerging Diseases and Surveillance, 31 Outubro a 3 Novembro, Viena, Austria; Nunes M, Lopes N, Maia C, Carreira T, Inácio J, Vieira ML. 2014. “Presence of Lyme disease agents in the Portuguese ixodofauna: development of real-time PCR assays for the identification of Borrelia burgdorferi genospecies”. 24th European Congress of Clinical Microbiology and Infectious Diseases, 10 a 13 Maio, Barcelona, Espanha. [eposter]; Nunes M, Lopes N, Inácio J, Vieira ML. 2013. “Development of real-time PCR assays targeting the flagellin gene for the identification of Borrelia burgdorferi sensu lato genospecies”. MicroBiotec’13, 6 a 8 Dezembro, Universidade de Aveiro, Aveiro; Lopes N, Nunes M, Almeida AP, Vieira ML. 2013. “Warning: Ticks alert!!! Find out which ticks surround us and their relationship with Lyme Borreliosis”. MicroBiotec’13, 6 a 8 Dezembro, Universidade de Aveiro, Aveiro; Nunes M, Lopes N, Almeida AP, Vieira ML. 2013. “Find out which ticks surround us and their relationship with Lyme Borreliosis”. MicroBiotec’13, 6 a 8 Dezembro, Universidade de Aveiro, Aveiro; Faria AS, Paiva-Cardoso MN, Nunes MS, Carreira T, Vale-Gonçalves H, Veloso O, Coelho C, Cabral JA, Vieira-Pinto M, Vieira ML. 2013. “Deteção de DNA de Borrelia burgdorferi sensu lato em soro de Javali (sus scrofa) no norte de Portugal por nestedPCR”. III Jornadas de Saúde Pública, 2 de Novembro, Universidade de Trás-os-Montes e Alto-Douro, Vila-Real; Faria AS, Paiva-Cardoso MN, Nunes MS, Carreira T, Vale-Gonçalves H, Veloso O, Coelho C, Cabral JA, Vieira-Pinto M, Vieira ML. 2013. “Pesquisa de DNA de Borrelia burgdorferi sensu lato em ixodídeos parasitas de Javali (sus scrofa) no norte de Portugal por nested-PCR”. III Jornadas de Saúde Pública, 2 de Novembro, Universidade de Trásos-Montes e Alto-Douro, Vila-Real; Nunes M, Lopes N, Inácio J, Almeida AP, Vieira ML. 2012. “Avaliação da distribuição das genospécies de Borrelia burgdorferi s.l. em Portugal, através do desenvolvimento de novas técnicas moleculares”. III Jornadas Científicas do IHMT, 12 Dezembro, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa, Lisboa. Resumo xv Resumo Ixodídeos (carraças de corpo-duro), são importantes vetores de agentes patogénicos, responsáveis por doenças emergentes como a doença de Lyme (DL). Esta zoonose é causada por espiroquetas do complexo Borrelia burgdorferi sensu lato (s.l.) transmitidas por carraças da espécie Ixodes ricinus, o principal vetor na Europa. A DL é uma doença multisistémica com diversas apresentações clínicas e diagnóstico complexo. Em Portugal é ainda pouco diagnosticada e a notificação, apesar de obrigatória, é escassa. A presente investigação teve como principal objetivo desenvolver ferramentas moleculares, nomeadamente um algoritmo de PCR em tempo real e uma amplificação isotérmica, para identificar as espécies de B. burgdorferi s.l. mais prevalentes em Portugal. O desenvolvimento deste objetivo permitiu também avaliar as características bioecológicas da ixodofauna presente em nove distritos do país (norte, centro e sul) nos quais o vetor I. ricinus havia sido anteriormente reportado, e ainda determinar a taxa de infeção por B. burgdorferi s.l. no vetor e hospedeiros. Os resultados obtidos são apresentados sob a forma de artigos científicos (dez), dos quais sete estão publicados, dois em submissão e um em preparação. Do conjunto dos resultados alcançados, importa realçar as variações observadas na distribuição das carraças para possivelmente para novas regiões, provavelmente relacionadas com alterações ao nível da paisagem, clima e vegetação, às quais as carraças são muito sensíveis. Acresce o facto de várias espécies de B. burgdorferi s.l. terem sido detetadas em carraças que não aquelas até agora reconhecidas como vetores. A espécie B. lusitaniae foi a mais prevalente no vetor, estando este presente em seis dos nove distritos selecionados. Surpreendentemente no decurso deste estudo, identificaram-se três espécies do complexo Borrelia recorrente em carraças da vegetação, nomeadamente, B. miyamotoi numa ninfa I. ricinus, e duas possíveis ‘novas’ espécies do complexo Borrelia recorrente em carraças da espécie Haemaphysalis punctata e Rhipicephalus sanguineus. Paralelamente, foi identificado DNA de B. burgdorferi s.l. em amostras biológicas de animais de estimação (cães e gatos) e de animais silváticos (javalis), confirmando a importância destes animais, principalmente os de estimação, enquanto sentinela para uma deteção precoce xvi da DL, ajudando na determinação do risco de transmissão das espiroquetas de B. burgdorferi s.l. a humanos e outros animais com importância económica (ex. bovinos), em áreas geográficas restritas. Foi também possível otimizar dois protocolos moleculares para o diagnóstico laboratorial da DL, um dos quais, um algoritmo de PCR em tempo real que permite a identificação de quatro das espécies de B. burgdorferi s.l. mais prevalentes em Portugal, apresentando elevada sensibilidade e especificidade e contribuindo para um diagnóstico mais preciso da DL. Alguns dos aspetos introduzidos e explorados nesta tese necessitam ainda de uma investigação mais detalhada. No entanto, este trabalho alerta para a introdução de possíveis ‘novas’ espécies do complexo de Borrelia recorrente em carraças de corpo-duro da vegetação, cuja patogenicidade é ainda desconhecida, mas que poderão tornar-se um risco para a saúde pública; contribui para a atualização espacial de áreas importantes na ecoepidemiologia da DL em Portugal; e inova no diagnóstico molecular desta zoonose, constituindo um valioso suporte para os clínicos, permitindo uma terapêutica mais direcionada dos doentes. Palavras-chave: Eco-epidemiologia de B. burgdorferi s.l., B. miyamotoi, ‘novas’ espécies de Borrelia do complexo da Febre Recorrente; diagnóstico molecular da DL. List of abbreviations xvii List of Abbreviations ACA – Acrodermatitis Chronica Atrophicans ARS – Administração Regional de Saúde bDNA – branched DNA bdr gene – Borrelia direct repeat gene BmpA – laminin-binding protein BSK II – Barbour–Stoenner–Kelly-II medium BSK-H – Barbour–Stoenner–Kelly modified medium CDC – Centers of Disease Control and Prevention CEVDI – Centro de Vectores e Doenças Infecciosas, INSA (= Centre for Vectors and Infectious Diseases Research, INSA) CL – Control Line CO2 – Carbon dioxide COXII – Cytochrome c oxidase subunit II CSF – Cerebrospinal Fluid CWD – Cell wall deficient DEET - N,N-diethl-meta-toluamide DGS –Direção-Geral de Saúde (=Directorate-General of Health) DL – d-loop dLAMP – Duplex LAMP DNA – Deoxyribonucleic Acid DraI – Restriction enzyme from Deinococcus radiophilus Ds – Double-stranded EIA – Enzyme Immunoassay ELISA - Enzyme-Linked Immunosorbent Assay EM – Erythema migrans EUCALB – European Concerted Action on Lyme Borreliosis FDA – USA Food and Drug Administration Fe – Iron FRET – Fluorescence Resonance Energy Transfer IDSA – Infectious Diseases Society of America List of abbreviations xviii List of Abbreviations (Cont.) IFA – Indirect Immunofluorescence Assay IgG – Immunoglobulin G IgM – Immunoglobulin M INSA – Instituto Nacional de Saúde Dr. Ricardo Jorge (= National Health Institute Doutor Ricardo Jorge) LAMP – Loop-Mediated isothermal Amplification LAR – Lymphangitis-Associated Rickettsiosis LB – Lyme borreliosis LCR – ligase chain reaction LD – Lyme disease LFS – Lateral Flow Strip LNB – Lyme neuroborreliosis LTV – Lisboa Tagus Valley MGB – Minor Groove Binder MKP – Kelly–Pettenkofer medium MLST – Multilocus Sequence Tying Mn – Manganese MseI – Restriction enzyme from Micrococcus sp. NAATs – Nucleic Acid Amplification Tests NIAID – National Institute of Allergy and Infectious Diseases Osp – Outer surface proteins OspA – Outer surface protein A OspC – Outer surface protein C p66 gene – Borrelia burgdorferi integrin ligand gene PCR – Polymerase Chain Reaction qPCR – quantitative real-time PCR rDNA – Ribossomal DNA RecA – Recombinase essential for the repair and maintenance of DNA REP – Reptile-associated Borrelia RF – Relapsing Fever RFB – Relapsing Fever Borrelia List of abbreviations xix List of Abbreviations (Cont.) RFLP – Restriction Fragment Length Polymorphism RML – Rocky Mountain Laboratories rpoB gene – RNA polymerase gene RT – Reverse Transcriptase Salp15 – Soluble cysteine-rich tick saliva protein s.l. – sensu lato SNPs – Single Nucleotide Polymorphisms s.s. – sensu stricto STTT – Standardized 2-tier testing Taq – Thermus aquaticus TBRF – Tick-Borne Relapsing Fever Th1 – T-helper type 1 Th2 – T-helper type 2 TIBOLA – Tick-borne lymphadenopathy TL – Test Line TLRs – Toll-Like Receptors TOT – Transovarial Transmission TROSPA – Tick Receptor for Outer Surface Protein A USA – United States of America VlsE – Vmp (variable membrane protein)-like sequence, Expressed WB – Western Blot WCS – Whole-Cell Sonicate WHO – Word Health Organization Table of contents xxi Table of contents Abstract ……………………………………………………………………………….. xiii Resumo ………………………………………………………………………..………. xv List of abbreviations ………………………………………………………………… xvii Table of contents ……………………………………………………………….. xxi Index of Figures ……………………………………………………………………… xxix Index of Tables ……………………………………………………………………….. xxxv Chapter 1 - State of the art 1.1 – Lyme disease: historical review …………...……………………………... 3 1.2 – Borrelia spirochetes and Lyme Disease…...……………………………… 5 1.2.1 – Biology, Morphology and Growth ………..……………………..……. 5 1.2.2 – Classification and taxonomy ………………………..………..………... 9 Relapsing Fever Borrelia (RFB) complex ……………..….………………... 9 Reptile-associated Borrelia (REP) complex …………..……………..……... 11 Borrelia burgdorferi s.l. complex ……………………..…………….…….… 12 1.2.3 – Epidemiology and geographic distribution of LD..…………………... 13 Lyme disease in Portugal ……………………….…...…….…………………. 18 1.3 – The tick vector ………………………………………………………...……… 20 1.3.1 – Classification and taxonomy …………………………...……………... 20 1.3.2 – Hard-ticks morphology ………………………………..……………… 23 1.3.3 – Hard-ticks species in Portugal ……………………..…………………. 24 1.3.4 – Geographic distribution of Ixodes vector …………………………….. 27 1.3.5 – Life cycle of I. ricinus vector ……………………………...………….. 29 Table of contents xxii 1.3.6 – Transmission and Pathogenesis ………………………….…………… 31 1.4 – Reservoirs and hosts of Borrelia spirochetes ………………………..…... 35 1.4.1 - Companion animals and Lyme disease ………………………..……… 38 1.5 – Lyme disease clinical manifestations, diagnosis and treatment………..… 40 1.5.1 – Human clinical manifestations …………………………...…………... 40 1.5.2 – Laboratory diagnosis – Conventional methodologies …………….... 43 Direct methods ………………...……………………………………………… 45 Indirect methods ………………..……………………………………………. 49 1.5.3 – Molecular-based strategies for the assessment of the B. burgdorferi s.l. species ……………………...……………………………………………… 51 DNA amplification-based assays …...………………………………………. 52 Isothermal DNA amplification …………...…………………………………. 57 Immunochromatographic assays …………...……………………………….. 60 1.5.4 – Prevention, Control and Treatment …………...………………………. 62 1.6 – Objectives and thesis plan …………………...……………………………… 65 1.7 – References ………………………………………………...…………………... 67 Chapter 2 - Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 2.1 – Characterization and distribution of hard-ticks in nine districts of mainland Portugal where I. ricinus presence was previously reported: Borrelia burgdorferi s.l. prevalence ………...……………………………………... 93 Abstract ……………………………………...………………………………….. 94 Introduction ………………………………...…………………………………... 95 Material and Methods ……………………...…………………………………... 97 Table of contents xxiii Results …………………………………...……………………………………… 104 Discussion ………………………………………………………………………. 122 Acknowledgements ……………………...…………………………………….. 128 References ………………………………...……………………………………. 129 Supplementary Data ……………………...……………………………………. 135 Chapter 3 - Distribution and diversity of Borrelia spirochetes and other tick-borne agents in questing and host-ticks 3.1 - Molecular identification of Borrelia genus in questing hard ticks from Portugal: phylogenetic characterization of two novel Relapsing Feverlike Borrelia sp. …………………………...………………………………………. 143 Abstract ………………………………...……………………………………….. 143 Introduction …………………………...………………………………………... 143 Material and Methods ………………...………………………………………... 144 Results …………………………………...……………………………………… 147 Discussion ………………………………...…………………………………….. 148 Acknowledgements ……………………...…………………………………….. 149 References ………………………………...……………………………………. 149 Supplementary Data ……………………...……………………………………. 152 3.2 - Molecular identification of Borrelia miyamotoi in Ixodes ricinus from Portugal ………………………...…………………………………………………… 161 Abstract …………………...…………………………………………………….. 161 Introduction ……………...……………………………………………………... 161 Material and Methods …...……………………………………………………... 161 Results ……………………...…………………………………………………… 162 Table of contents xxiv Discussion ………………………………………………………………………. 162 Acknowledgements ……….…………………………………………………… 163 Author Discloser Statement ……...……………………………………………. 163 References …………………………...…………………………………………. 163 3.3 - Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal …….………………………………………………………………… 165 Abstract …………………………...…………………………………………….. 165 Introduction ………………………...…………………………………………... 165 Material and Methods ………………...………………………………………... 166 Results …………………………………...……………………………………… 167 Discussion ………………………………………………………………………. 167 Acknowledgements …………………...……………………………………….. 169 References ……………………………...………………………………………. 169 Chapter 4 - Distribution and diversity of Borrelia spirochetes and other tick-borne agents in the hosts 4.1 - Molecular detection of tick-borne bacteria and protozoa in cervids and wild boars from Portugal ………...…………….....…………………………. 175 Abstract …………………………...…………………………………………….. 175 Background ……………………...……………………………………………... 175 Methods ………………………………...………………………………………. 176 Results …………………………...……………………………………………… 178 Discussion ………………………………………………………………………. 181 Conclusion ……………………………………...………………………………. 181 Competing interests ………………………...………………………………….. 181 Index of Figures xxxi Figure 7 - Questing tick species average density and standard deviation in South region during the two years of collections, in spring and summer seasons ……... 119 Figure 8 - Box-plot analysis depicting the distribution of (A) H. punctata, (B) Hy. lusitanicum and (C) I. ricinus within each region. Y axis represent ticks/mincollector ……………………………..………………………………………………… 111 Figure 9 - Box-plot analysis depicting the densities of I. ricinus in each of the surveyed seasons. Y axis represent ticks/min-collector …………………………… 112 Figure 10 - Tick average density per host, for each collected species by season, year and district ……………………………………………………………………….. 114 Figure 11 - Tick species average density and standard deviation per host in North region during the two years of collections, in spring, summer, autumn and winter seasons ………………………………………………………………………… 116 Figure 12 - Tick species average density and standard deviation per host in Lisboa and Tagus Valley region during the two years of collections, in spring, autumn and winter seasons …………...…………………………………………….. 117 Figure 13 - Hosts tick species average density and standard deviation in South region during the two years of collections, in spring, summer, autumn and winter seasons ……………….…………………………………….………………………….. 118 Figure 14 - Box-plot analysis depicting the distribution of total tick density in A) each season and B) per host type ……………..………………………………….. 119 Figure 15 - Box-plot analysis demonstrating the distribution of A) I. ricinus and B) R. sanguineus within each region ………………...……………………………… 120 Index of Figures xxxii Chapter 3 3.1 - Molecular identification of Borrelia genus in questing hard ticks from Portugal: phylogenetic characterization of two novel Relapsing Fever-like Borrelia sp. Figure 1 - Map of Portugal showing the total number of hard ticks collected by flagging per districts (Braga, Vila Real, Aveiro, Lisboa, Setúbal, Évora and Faro) …………………………………………………………………………………… 145 Figure 2 - Detection of RFB (Relapsing Fever Borreliae) DNA in extracts prepared from field-collected ticks …………………..……………………………… 147 Figure 3 - Phylogenetic analysis of Relapsing Fever Borrelia flaB (A), 16S rRNA (B), and glpQ (C) sequences …………………………………………………. 147 Figure 4 - glpQ and flaB genetic distance analysis calculated using the TamuraNei as implemented in the Mega 6.0 software ……………………………………… 148 Supplementary Figure 1 - Complete phylogenetic analysis of Relapsing Fever Borrelia flaB (A), 16S rRNA (B), and glpQ (C) sequences (partial trees are shown in Fig. 3) ……………………………………………………………………….. 152 Supplementary Figure 2 - Maximum Clade Probability Trees based on the analysis of Relapsing Fever Borrelia flaB (A), 16S rRNA (B), and glpQ (C) sequences ……………………………………………………………………………… 155 Supplementary Figure 3 - Complete phylogenetic analysis of Relapsing Fever Borrelia 16S rRNA (A) and flaB (B), sequences with the introduction of Leptospira interrogans as an outgroup ……………………...……………………… 158 3.2 - Molecular identification of Borrelia miyamotoi in Ixodes ricinus from Portugal Figure 1 - Phylogenetic analysis of Borrelia fla nucleotide sequences …..……… 163 3.3 - Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal Figure 1 – Map of Portugal depicting the 4 districts from where ticks were collected ……………………………………………………………………………….. 166 Index of Figures xxxiii Chapter 4 4.1 – Molecular detection of tick-borne bacteria and protozoa in cervids and wild boars from Portugal Figure 1 - Phylogenetic tree of Anaplasma spp. based on the analysis of msp4 sequences ……………………………………………………………………………… 178 Figure 2 - Phylogenetic tree of Theileria spp. based on 18S rRNA gene sequences ……………………………………………………………………………… 179 4.2 - First Detection of Borrelia burgdorferi sensu lato DNA in Serum of the Wild Boar (Sus scrofa) in Northern Portugal by Nested-PCR Figure 1 - (a) - DNA amplification results of wild boar serum samples obtained by nested-PCR analysis targeting the fla gene; (b) - Geographical distribution of the hunts (filled circle) attended during the 2011/2012 wild boar hunting season in the Trás-os-Montes region (Northern Portugal) and the number of wild boars shot in each hunt ……………………………...………………………………………. 187 Chapter 5 5.1 – Development and evaluation of a two-step multiplex TaqMan realtime PCR assay for detection of Borrelia burgdorferi s.l. genospecies Figure 1 - Representation of the real-time PCR algorithm for identification of B. burgdorferi s.l. genospecies …………………………………….……………… 216 Figure 2 - Illustration of the duplex real-time PCR amplification curve obtained for each DNA concentration …………………………………………...……………. 220 Figure 3 - Illustration of the tetraplex real-time PCR amplification curves obtained for each probe individually (A, B, C and D) and in tetraplex (E) for each DNA concentration …………………………..………………………………… 221 5.2 - Development of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection of Borrelia burgdorferi s.l. genospecies DNA in tick samples Index of Figures xxxiv Figure 1 - Partial sequence of flaB gene for B. lusitaniae, and location of the complementary regions used to design LAMP primers [F3, B3, FIP (F1c-F2), BIP (B1c-B2)], including loop primers (LF, LB) ……………………………..…… 237 Figure 2 - LAMP products visualization …………………………………………… 240 Figure 3 - LAMP assay optimization by testing: different FIP/BIP and F3/B3 concentrations ratio (A); different concentrations of Bst polymerase (B); and different temperatures of reaction (C) ………………………………………………. 241 Figure 4 - Sensitivity optimization of LAMP assay with the B. lusitaniae primers set for the four B. burgdorferi s.l. genospecies DNA serial dilutions, and visualization of amplification products by naked eye, by adding SYBR-Green under natural and UV light, and by electrophoresis in agarose gel ………..……… 243 Index of Tables xxxv Index of Tables Chapter 1 Table 1 - Relapsing Fever Borrelia species, geographic distribution and first report 10 Table 2 - Borrelia burgdorferi s.l. species, geographic distribution and first report 13 Table 3 - More important biologic characteristics of ticks …...……………………… 22 Table 4 - Hard-ticks genera, respective species present in Portugal …………...……. 25 Table 5 - Etiologic agents transmitted by Ixodids present, or at emerging risk, in Portugal …………………………………………………………...……………………… 26 Table 6 - The three stages of Lyme disease and examples of some clinical manifestations …………………………………………………………………………… 42 Table 7 - Case definition from Centers for Disease Control and Prevention (CDC), for surveillance purpose …………..…………………………………………………….. 44 Chapter 2 Table 1 - Characterization of each surveyed district regarding the area, climate and counties ………………………………………...………………………………………… 99 Table 2 - Total questing tick species by stage collected in each district ……………. 106 Table 3 - Total ticks collected on hosts, per tick species and stage, collected in each district ………………………………………………………………………………. 115 Table 4 - Borrelia burgdorferi s.l. infection rate in questing ticks from the three surveyed regions (North, LTV and South) …………………………………………….. 121 Table 5 - Borrelia burgdorferi s.l. infection rate in ticks collected from the hosts in the two surveyed regions (LTV and South) ………………………………………… 122 Index of Tables xxxvi Chapter 3 3.1 - Molecular identification of Borrelia genus in questing hard ticks from Portugal: phylogenetic characterization of two novel Relapsing Fever-like Borrelia sp.. Table 1 - Species, stage, gender and number of collected ticks, analyzed for the presence of B. burgdorferi s.l. and Relapsing Fever Borrelia (RFB) spirochetes DNA ……………………………………………………………………………………… 146 Table 2 - Primers used in this study for the specific analysis of Relapsing Fever Borrelia ………………………………………………………………………………… 146 3.2 - Molecular identification of Borrelia miyamotoi in Ixodes ricinus from Portugal Table 1 - District, stage and number of Ixodes ricinus ticks collected in Portugal analyzed for the presence of Borrelia miyamotoi and B. burgdorferi sensu lato …… 162 3.3 - Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal Table 1 - Primer sets and PCR conditions for DNA amplification and sequencing of pathogens in ticks …………………………………………………………………….. 167 Table 2 - Numbers of ticks collected in the districts of Guarda, Lisboa, Setúbal and Faro ………………………………………………………………………………… 168 Table 3 - Pathogens detected by PCR and DNA sequencing in ticks from Portugal according to geographic region and vertebrate host, with DNA Data Bank of Japan (DDBJ) accession numbers ……………………………………………………………. 168 Index of Tables xxxvii Chapter 4 4.1 – Molecular detection of tick-borne bacteria and protozoa in cervids and wild boars from Portugal Table 1 - Sequences of the oligonucleotide primers used ………………………...…. 177 Table 2 - Prevalence of tick-borne pathogens as detected by PCR in 76 cervids and 65 wild boars from Centre and southern Portugal ……………...………………… 180 4.3 – Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal Table 1 - Prevalence of vector-borne pathogen species, gender or complex as detected by PCR in 1,010 dogs from southern Portugal ……………………………… 193 Table 2 - Primers sets for PCR amplification of CVBD agents …………………… 194 Table 3 - Single and mixed PCR-positivity to species, genera and/or complex of CVBD agents in 1,010 dogs from southern Portugal ………………………………... 194 4.4 - Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal Table 1 - Comparison of prevalence of FVBD pathogens in different groups of cats from southern Portugal …………………………………………………………… 201 Table 2 - Primer sets for PCR amplification of FVBD agents ………………………. 202 Table 3 - Single and mixed PCR-positivity to genera (Anaplasma/Ehrlichia, Babesia, Bartonella, Hepatozoon and Leishmania) and/or complex (B. burgdorferi s.l.) of FVBD agents in 649 cats from southern Portugal …………………………….. 203 Index of Tables xxxviii Chapter 5 5.1 - Development and evaluation of a two-step multiplex TaqMan real-time PCR assay for detection of Borrelia burgdorferi s.l. genospecies Table 1 - Sequences of primers and probes designed in this study …………………. 215 Table 2 - Comparison of duplex and tetraplex real-time PCR’s positive samples with results from previous sequencing for tick samples ……………………………… 223 5.2 - Development of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection of Borrelia burgdorferi s.l. genospecies DNA in tick samples Table 1 - LAMP primers designed targeting the four B. burgdorferi s.l. genospecies ……………………………………………………………………………… 236 Table 2 - Sensitivities obtained for the detection of B. burgdorferi s.l. genospecies with different molecular approaches ………………………………………………… 244 Chapter 1 State of the art Chapter 1 State of the art 9 1.2.2 – Classification and taxonomy The spirochetes are one of the few major bacterial groups whose natural phylogenetic relationships are evident at the level of gross phenotypic characteristics (Wang et al., 1999). These organisms belongs to Spirochaetes phylum containing only Spirochaetes class that comprises a single order Spirochaetales. This order includes three families: Brachyspiraceae, Leptospiraceae and Spirochaeteceae (Karami, 2012), where the Spirochaeteceae family comprises Borrelia and Treponema genus, this last responsible for syphilis, a sexually transmitted disease (Wang et al., 1999; Heymann & Ellis, 2012; Karami, 2012). The genus Borrelia represents a tight phylogenetic cluster, which is differentiated from other spirochetal phylogenetic groups by base signature analysis of rrs gene (Wang et al., 1999). More than 30 species have been identified within the genus so far (Baptista, 2006; Norris, 2012). These Borrelia species, based on the differences between their ecological and genetic characteristics (Barbour & Hayes, 1986), are usually categorized into three major categories, the relapsing-fever borreliae, whose members cause relapsing fever worldwide; the LB borreliae, whose members cause Lyme disease throughout the Northern Hemisphere, and the reptile-associated borreliae, whose members infect reptiles but are not known to cause disease in humans (Huang et al., 2015).  Relapsing Fever Borrelia (RFB) complex The Relapsing Fever (RF) complex includes species mostly found in soft ticks belonging to the Argasidae family, considered rapid-feeding ticks where their bites may go unnoticed. However, RF has also been reported in several hard ticks (ixodids), and in lice. The taxonomic position of RF spirochetes is a matter of controversy, since some studies have suggested phylogenetic clustering based on geographic differences (Old World versus New World), and other studies found RF spirochetes in hard ticks, (including B. miyamotoi, B. theileri, and B. lonestari), which clustered together phylogenetically suggesting this to be a separate group within the RF complex (Barbour et al., 2009; (McCoy et al., 2014; Cutler 2015; Nunes et al., 2015). There are now at least 23 validated Chapter 1 State of the art 10 RF Borrelia species (Morais et al., 2007), although others are waiting sufficient data to achieve such status (Table 1). Table 1 - Relapsing Fever Borrelia species: geographic distribution and first report. RF Borrelia species Geographic distribution Reference B. anserina Worldwide Sakharoff, 1891 B. baltazardii Iran Karimi et al., 1983 B. brasiliensis Brazil Davis, 1952 B. caucasica Russia Kandelaki, 1945 B. coriaceae USA Jonhson et al., 1987 B. crocidurae West Africa Leger, 1971 B. dugesii Mexico Mazzotii, 1949 B. duttonii Africa (Central Eastern) Novy & Knapp, 1906 B. graingeri East Africa Heisch, 1953 B. harveyi East Africa Garnham, 1947 B. hermsii Canada, Western USA Davis, 1942 B. hispanica Algeria, Morocco, Portugal Spain, Tunisia de Buen, 1926 B. japonica Japan Kawabata et al., 1994 B. latyschewii Central Asia, Iran, Iraq Sofiev, 1941 B. mazzottii Southern USA, Mexico, Guatemala Davis, 1956 B. merionesi North Africa Blanc & Maurice, 1948 B. microti Africa, Iran Smith & Kilborne, 1893 B. miyamotoi Japan Fukunaga et al., 1995 B. parkeri Western USA Davis, 1942 B. persica Asia, Middles East Dschunkowsky, 1913 B. sinica China Masuzawa et al., 2001 B. tanukii Japan Fukunaga et al., 1997 B. theileri America, Africa, Australia, Europe Laveran, 1903 B. tillae Cape Verde Zumpt & Organ 1961 B. turicatae USA, Mexico Brumpt, 1933 B. venezuelensis Central & South America Brumpt, 1921 B. recurrentis Worldwide Lebert, 1874 Chapter 1 State of the art 11 However, at least two categories of RF are known to affect humans: i) the louse-borne relapsing fever (also known as urban or epidemic RF) caused by B. recurrentis, and transmitted by the body louse Pediculus humanus humanus. Historically, massive outbreaks have occurred in Eurasia and Africa, especially during wartime, when people were highly parasitized with body lice (Barbour & Hayes, 1986). Currently, the disease is found only in Ethiopia and neighboring countries (Cutler 2010); ii) and the tick-borne relapsing fever caused by Borrelia species transmitted by infected soft ticks of the genus Ornithodoros, like for example B. hispanica transmitted by O. erraticus, and found primarily in Africa, Spain, Saudi Arabia, Asia, and certain areas of Canada and the western United States (Cutler 2015, Palma et al., 2012). In the last years, several novel species have been described, including B. myumii in ticks from Tanzania (Mitani et al., 2004), B. microti and other species from Iran (Naddaf et al., 2015), B. turicatae-like in bat ticks from the United States (Schwan et al., 2009), and as of yet unnamed species from penguins in South Africa (Yabsley et al., 2012), although the species status and potential virulence of these agents for humans remain unknown.  Reptile-associated Borrelia (REP) complex The epidemiologic role of reptiles has received increasing attention, in the last years, mainly due to the international pet trade of animals originating from the wilderness (Burridge, 2011). Frequently, the imported reptiles are harboring various tick species that facilitate the introduction of nonnative tick-borne pathogens, thus significantly increasing the risk to public health (Burridge, 2011). Various emerging and/or zoonotic pathogens have been isolated and characterized from reptiles or their associated ticks (Takano et al., 2010; Pastiu et al., 2012). The reptile-associated Borrelia spp (REP) have been recently discovered in reptiles and their associated hard ticks, genera Amblyomma and Hyalomma (Takano et al., 2010). B. turcica, a member of the REP borreliae group, was described in Hyalomma aegyptium ticks related with Mediterranean tortoises in Turkey (Guner, 2004). B. turcica has been Chapter 1 State of the art 12 demonstrated to form a distinct monophyletic group showing a relationship with both RF and LB groups. Reptile-associated Borrelia (Borrelia sp.) spirochetes were also isolated from Amblyomma geoemydae ticks and they clustered with RFB based on another phylogenetic analysis (Takano et al., 2011). The natural cycle of Tick-Borne Relapsing Fever (TBRF) spirochetes involve a diversity of small mammals and their tick vectors (Schwan et al., 2012). They are a neglected cause of zoonotic diseases which can result in illness and even death of the hosts (Kalmar et al., 2015).  Borrelia burgdorferi s.l. complex Ultrastructure of B. burgdorferi has been the subject of several investigations in the USA and Europe, its description varies, differences in morphological criteria, such as end shape and the number of endoflagella, among isolates of diverse origins have led to the speculation that additional spirochetal species may be involve in etiology of LD (Hayes & Burgdorfer, 1993). A major effort has been done to analyze the phenotypic and genotypic diversity of B. burgdorferi isolates, using Polymerase Chain Reaction (PCR) techniques, targeting 16S and 23S ribosomal DNA, flagellin, Outer surface protein A (OspA), and Borrelia direct repeat (bdr) genes, as well as intergenic spacers (Guy & Stanek, 1991; Johnson et al., 1992; Postic et al., 1994; Le Fleche et al., 1997; Rijpkerna et al., 1997; Iyer et al., 2003). It is now apparent that B. burgdorferi is genetically diverse, and belongs to a B. burgdorferi s.l. genospecies complex composed of 20 different species (Ružić-Sabljić & Cerar, 2016), (Table 2). Evolutionary changes, mutation, genetic drift, migration, and natural selection created macro evolutionary divergence of species. The prevailing data suggest that B. burgdorferi s.l. was once a wide-ranging species in the Northern Hemisphere that rapidly separated into the current known species (Dykhuizen & Brisson, 2010). Chapter 1 State of the art 13 Table 2 – Borrelia burgdorferi s.l. species: geographic distribution and first report. Note: the underline species have been found in/or isolated from human patients, while the others species have not been associated to humans. 1.2.3 – Epidemiology and geographic distribution of LD Lyme disease is the world's fastest growing vector-borne zoonotic disease with cases reported in over 60 countries and endemic foci in North America, Europe, and Asia (WHO, 2013). It occurs normally in temperate areas, with the ideal climate and general conditions for the survival and maintenance of the vector life cycle involved in B. burgdorferi s.l. species transmission. B. burgdorferi s.l. species Geographic distribution Reference B. burgdorferi s.s. USA; Eurasia Johnson et al., 1984 B. garinii Eurasia Baranton et al., 1992 B. afzelii Eurasia Canica et al., 1993 B. japonica Japan Kawabata et al., 1993 B. andersonii USA Marconi et al., 1995 B. tanukii Japan Fukunaga et al., 1996 B. turdi Japan Fukunaga et al., 1996 B. valaisiana Eurasia Wang et al., 1997 B. lusitaniae Europe, USA Le Fleche et al., 1997 B. bissettii USA Postic, 1998 B. sinica China Masuzawa et al.,2001 B. spielmanii Europe Richter et al., 2004 B. californiensis USA Postic et al., 2007 B. Yangtzee China Chu et al., 2008 B. americana USA Rudenko et al., 2009 B. bavariensis Europe Margos et al., 2009 B. carolinensis USA Rudenko et al., 2010 B. kurtenbachii USA, Europe (?) Margos et al., 2010 B. finlandensis Europe Casjens et al., 2011 B. chilensis Chile Ivanova et al., 2014 Chapter 1 State of the art 14 The geographic distribution of LD is increasing, resulting in a significant risk, for public health (Rizzoli et al., 2011). The northeastern United States is traditionally defined as the endemic global region for LD and the public health risk is highest in this area, where annually about 16 000 to 25 000 new cases occur (Figure 4). However, the CDC estimates that only 10% of LD cases are being recorded which translates into approximately 300,000 estimated cases in the United States each year, only between 1995 and 2013 Lyme cases has increased about 130% from 11.700 to 27.200 (CDC). Figure 4 - Graphical representation of Lyme disease confirmed and probable annual cases in USA, from 1995 to 2014. (Source: http://www.cdc.gov/lyme/stats/graphs.html). A majority (95 %) have been concentrated in the northeast, yet cases have been reported in every state and in many countries around the world and their geospatial analysis reveals that LD has extended well beyond traditionally defined endemic areas (CDC, 2014; DiukWasser et al., 2012). Lyme disease rates have been increasing exponentially at the global scale while in the United States it has become the main human vector-borne disease (Abbott, 2006; Piesman & Eisen, 2008). This increase is due to a variety of influences like climate change resulting in the expansion of the Ixodes tick territory including expansion to higher elevations, changes in small mammals and deer populations, changes Chapter 1 State of the art 15 in deforestation and development, and improved reporting and aware (Lindgren et al., 2000; Qiu et al., 2008; Gray et al., 2009; Gilbert et al., 2014). LD can also be found throughout Europe, Russia, and Asia (Figure 5). The highest reported frequencies of the disease are in central Europe and Scandinavia, particularly in Germany, Austria, Slovenia, the Baltic coastline of Sweden, and some Estonian and Finnish islands, where reported incidence rates are greater than 100 cases per 100,000 inhabitants (Lindgren & Jaenson, 2006; Rizzoli et al., 2011). Seroprevalence studies conducted in individual countries in recent years, including Germany, Denmark, and Sweden, have typically found positive rates less than 10%, although rates as high as 47.9% were recorded in high-risk groups (e.g., farmers and forestry workers) in Poland (Lindgren & Jaenson, 2006; Dessau et al., 2010; Dehnert et al., 2012). Figure 5 - World distribution of Lyme disease. In red are indicated the “hot zones”. (Source: World Health Organization). In Europe several species of B. burgdorferi s.l. complex have been identified being LD mostly associated to one of three species: B. burgdorferi s.s., B. afzelii and B. garinii (Assous et al., 1993; van Dam et al., 1993; Richter et al., 2004). However, other species of B. burgdorferi s.l. have already been associated to human cases, like B. bissettii, B. valaisiana, B. lusitaniae, and B. spielmanii (Picken et al., 1996; Rijpkerna et al., 1997; Chapter 1 State of the art 16 Collares-Pereira et al., 2004; Fingerle et al., 2008). In contrast, in the USA, despite the presence of several other genospecies (B. americana, B. andersonii, B. californiensis, B. carolinensis, B. bissettii and B. kurtenbachii), only B. burgdorferi s.s is recognized as causing LD (Murray & Shapiro, 2010). Moreover, a new B. burgdorferi s.l. genospecies (candidatus Borrelia mayonii) was recently identified among patients and in I. scapularis ticks from the upper Midwestern USA (Pritt et al., 2016). The distribution and prevalence B. burgdorferi s.l. species varies on a local and regional scale, both temporally and spatially (Rauter & Hartung 2005; Estrada-Peña et al., 2011), with a higher biodiversity of species between 4º W and 20º E coordinates, where there is a higher prevalence of ticks infected with Borrelia (Estrada-Peña et al., 2011). The species B. burgdorferi s.s. is reported more frequently in east, while B. afzelii is more common in the North of Europe, B. valaisiana is mainly present in low temperature regions with undergrowth vegetation like Scandinavian coast, Scotland or Alpine regions, and B. lusitaniae and B. garinii are predominantly found in the Mediterranean region, southeast and west (Figure 6) (Franke et al., 2013). Figure 6 – Global distribution of the Lyme disease species. The shaded areas show the distribution of tick vectors. Seven species are found in North America, eight species in Europe, and eight species in Asia. (Source: Margos et al., 2011). Chapter 1 State of the art 17 According to Stanek and Reiter (2011), some investigators recognize that the multiplicity of B. burgdorferi s.l. species existents in Europe may indicate these spirochetes as responsible for Lyme while emergency disease in this continent. However, other studies showed the existence of a more close relationship between the European Borrelia species than the ones from North America, suggesting that LD was introduced in Europe from the American continent (Stanek & Reiter, 2011). The heterogeneity of B. burgdorferi s.l. species in Asia is similar to those in Europe, six pathogenic species and five ‘potential’ pathogenic have been identified in Asian continent. Almost all European species can be found in Central and Eastern Asia, yet B. lusitaniae is mainly found in western Asia ticks (Franke et al., 2013). B. burgdorferi s.s. seems absent in most Asiatic regions, being rarely reported in Thailand and South China (Franke et al., 2013), while B. garinii and B. afzelii are the main species involved in LD cases in this continent (Schotthoefer & Frost, 2015). In North Africa several Borrelia species can be found particularly in the most humid and temperate regions like Tunisia, Egypt, Morocco, and Algeria. B. lusitaniae is the predominant species in these regions, although B. garinii, B. burgdorferi s.s. and B. valaisiana have been occasionally reported (Franke et al., 2013). B. lusitaniae isolates from North Africa suggests that they may be originate from a Portuguese clone (Stanek et al., 2012). In Australia there are no concrete evidences of LD existence, since the bacteria as never been isolated from the tick vector, however, it has been associated to Ixodes holocyclus or I. cornuatus (Mayne et al., 2014). The majority of reported human cases are based in serologic tests, yet in 2011 DNA from B. burgdorferi s.l. spirochetes was detected in eight Australian patients by PCR analysis, whereas only one of the patients had left the country (Franke et al., 2013). More recently in South America, particularly in Brazil LD, known as Brazilian Lymelike disease or Baggio-Yoshinari syndrome, has been poorly studied (Yoshinari et al., 2010), its epidemiology and the prevalent genospecies are still not well defined (DantasTorres et al., 2008). However, some cases of this disease have been reported in humans and animals by serologic methods and/or by clinical symptoms in the northern (Amazonas Chapter 1 State of the art 18 and Tocantins States) (Abel et al., 2000; Carranza-Tamayo et al., 2012), midwestern (Mato Grosso do Sul State) (Naka et al., 2008; Carranza-Tamayo et al., 2012), southeastern (Espírito Santo, Rio de Janeiro and São Paulo States) (Azulay et al., 1991; Yoshinari et al., 2003; Passos et al., 2009) and southern (Parana State) (Gonçalves et al., 2014; 2015) regions of Brazil. Most of these cases were detected in inhabitants of rural areas, where due to the close proximity of humans to the animal population often parasitized by ticks, results in a high incidence of this zoonosis. Nonetheless, some recent studies have molecularly identified Borrelia DNA in three peripheral blood samples collected from humans with clinical symptoms of borreliosis and report of tick exposure (Mantovani et al., 2012), and also in two Dermacentor nitens tick species (Gonçalves et al., 2014). More recently, B. garinii and B. burgdorferi s.s. were reported for the first time in residents of rural areas, who were directly or indirectly exposed to wild and/or domestic animals and ticks in the northern region of Parana State, confirming the presence of these genospecies in Brazil (Gonçalves et al., 2015).  Lyme disease in Portugal In Portugal the first human case of LD was identified in 1989 by David Morais and collaborators in Évora region. In this work the authors suggested, either new vectors could be implicated in the transmission of B. burgdorferi s.l., since I. ricinus species was considered uncommon in that region, or the potential existence of a new Borrelia strain in the country. Subsequent studies in the same Portuguese region confirmed the presence of more seropositive cases, some of them with confirmed clinical signs of LD (Filipe et al., 1990, Núncio et al. 1992; David de Morais & Henriques, 1999). Ten years later this zoonosis was considered a notifiable disease to the Portuguese Health Authorities (Portaria 1071/98, A69.2). The first isolated strains of B. burgdorferi s.l. were obtain from ticks collected in the South of Portugal, where a new species was identified firstly as PoTi B1, and later designated as B. lusitaniae (Núncio et al., 1993). Further studies confirmed the presence of others species of B. burgdorferi s.l. in ticks (B. afzelii, B. garinii, B. valaisiana and B. burgdorferi s.s.) with different prevalence rates from 11.9% in several regions, to 31.2% Chapter 1 State of the art 25 Table 4 - Hard-tick genera and respective species present in Portugal. Tick genera Ticks species Reference Specimen example (original photos by Mónica Nunes) Dermacentor (n=2) marginatus Sulzer, 1776 reticulatus Fabricius, 1794 Haemaphysalis (n=3) hispanica Gil Collado, 1938 inermis Birula, 1895 punctata Canestrini & Fanzago, 1878 Hyalomma (n=2) lusitanicum Koch, 1844 marginatum Koch, 1844 Ixodes (n=10) acuminatus Neumann, 1901 arboricola Schulze & Schlottke, 1930 bivari Dias, 1990 canisuga Johnston, 1849 frontalis Panzer, 1798 hexagonus Leach, 1815 ricinus Linnaeus, 1758 simplex Neumann, 1906 ventalloi Gil Collado, 1936 vespertilionis Koch, 1844 Rhipicephalus (n=4) boophilus annulatus Say, 1821 bursa Canestrini & Fanzago, 1878 pusillus Gil Collado, 1938 sanguineus Latreille, 1806 Regarding Rhipicephalus genera, the species R. turanicus had been previously reported in mainland Portugal (Papadopoulos et al., 1992; Dias et al., 1994; Caeiro, 1999; EstradaPeña et al., 2004; Santos-Silva et al. 2006) , although, its presence on the Mediterranean Chapter 1 State of the art 26 area has been questioned. According to the opinion of Walker and collaborators (2000), about the genus Rhipicephalus, and together with the recent molecular data analysis from Santos-Silva and collaborators, based on three mitochondrial genes [12S rDNA, cytochrome c oxidase subunit II (COXII) and the control region or d-loop (DL)] and one nuclear gene (28S rDNA), the ticks commonly called R. turanicus in Portugal by morphological analysis are genetically indistinguishable from R. sanguineus, pointing towards to the occurrence of a single species in Portugal, R. sanguineus, characterized by a high level of morphological polymorphism (Santos-Silva et al., 2011). These different tick species can transmit a large variety of pathogenic agents able of causing disease in humans, with an emergent risk in Portugal (Table 5). Table 5 - Etiologic agents transmitted by Ixodids present, or at emerging risk, in Portugal. (Source: adapted from Núncio & Alves, 2014). Pathogenic agent Disease Ixodid species Anaplasma phagocytophilum Human anaplasmosis Ixodes ricinus, I. ventalloi Babesia divergens Babesiosis Ixodes spp. Borrelia burgdorferi s.l. Lyme borreliosis Ixodes ricinus Coxiella burnetii Q Fever Several species Francisella tularensis Tularemia Several including Ixodes ricinus and Dermacentor reticulatus Rickettsia aeschlimannii without nomination Hyalomma marginatum R. conorii Mediterranean Spotted Fever Rhipicephalus sanguineus R. helvetica without nomination Ixodes ricinus R. massiliae without nomination Rhipicephalus sanguineus R. monacensis without nomination Ixodes ricinus R. sibirica mongolotimonae LAR* Hyalomma sp., Rhipicephalus pusillus R. slovaca TIBOLA** Dermacentor marginatus, D. reticulatus Crimean-Congo hemorrhagic fever virus Hemorrhagic fever Hyalomma marginatum, Haemaphysalis punctata, Ixodes ricinus, Dermacentor spp. Rhipicephalus spp. Eyach virus without nomination Ixodes ricinus, Ixodes ventalloi Tick-Borne Encephalitis virus Encephalitis Ixodes ricinus, Haemaphysalis punctata * LAR - Lymphangitis-associated rickettsiosis; ** TIBOLA - Tick-borne lymphadenopathy Chapter 1 State of the art 27 Lyme disease agents have been isolated and identified from different hard-tick genera, although some ticks constitute a greater risk of transmitting these agents to humans than others (Silva et al., 2006; Franke et al., 2013). These spirochetes are carried mainly by ticks belonging to Ixodes genus from the Ixodidae family (Parola & Raoult, 2001), currently comprehending four predominant species, I. scapularis, I. pacificus, I. ricinus, and I. persulcatus (Piesman & Gern, 2004; Stanek et al., 2012). Many, if not all, species of this complex are important vectors of other pathogens that cause human and livestock diseases, including tick-borne encephalitis, anaplasmosis and babesiosis. Therefore, throughout this study, emphasis will be given to tick’s representative of Ixodes genus, classified as competent vectors, and more directly involved in B. burgdorferi s.l. species transmission. 1.3.4 – Geographic distribution of Ixodes vector There are four predominant species of Ixodes ticks associated to spirochetes transmission to humans, including I. scapularis in the eastern United States and Canada, I. pacificus in the western USA, I. ricinus in Europe and Asia, and I. persulcatus in Asia (Figure 12) (Piesman & Gern, 2004; Stanek et al., 2012). Figure 12 – Geographical distribution of Ixodes species, vectors of Lyme disease agents. (Source: Stanek et al., 2012). Chapter 1 State of the art 28 The European tick, I. ricinus species, also known as sheep tick or Castor bean tick, presents a wide geographic distribution across Europe, due to abiotic and biotic factors such as specific microclimate, biotopes, and host dynamics (Movila et al., 2012), and transmits an even greater array of pathogens than its “sister” in North America, the species I. scapularis (Lindgren & Jaenson, 2006; Gray et al., 2009). I. ricinus tick has a high affinity for humans, making it the most important bridging vector in Europe (Guiguen & Degeilh, 2001; Parola & Raoult, 2001). In the last decades the global warming influenced the distribution and abundance of this vector, being present from the Faroe Islands in the west (Jaenson & Jensen, 2007) to the European section of the Russian Federation in the east (Korenberg et al., 2002), and from North Africa (Zhioua et al., 1999) to the Northern Scandinavia (Lindgren et al., 2000), (Figure 13). Figure 13 - Geographical distribution of Ixodes ricinus in Europe. (Source: ECDC, 2016). This tick has the particularity of questing to the tip of low vegetation to meet its hosts. During this questing, ticks often have to face desiccating conditions, quitting their questing place and moving to the liter/mat layer where they regain lost body water (Randolph & Storey, 1999; Gern et al., 2008). Ixodes ricinus moves preferentially when desiccation risk is the lowest in nature, at sundown (Gern et al., 2008). If high desiccating conditions are lasting too long, tick mortality is increased resulting in questing tick Chapter 1 State of the art 29 population decrease (Perret et al., 2004). This tick is sensitive to climatic conditions, requiring a relative humidity of at least 80% to survive during its off-host periods, being therefore restricted to areas of moderate to high rainfall with vegetation that retains a high humidity (Medlock et al., 2013). Recently, this tick species has expand in terms of altitude and latitude, mainly due to climatic changes, leading to the colonization of new habits and modifications in the seasonality patterns (Santos-Silva et al., 2011). In Portugal I. ricinus species can be found across the country, being most predominant in areas of deciduous woodland and mixed forest with mild temperatures, where relative humidity levels are high (Silva et al., 2006). In unfavorable conditions (absence of vegetation and high temperature), the vitality of each stage can be compromised, leading them to find suitable refuges to their survival, and to use survival strategies such as diapause (Schwarz et al., 2012; Stanek et al., 2012). 1.3.5 – Life cycle of Ixodes ricinus The tick I. ricinus is a triphasic (three hosts), exophilic (finds its host in an open environment) and telotrophic species (the immature stages feed in different hosts, including those where the adults feed), that can take about three years to complete its life cycle. This tick, like all hard-body ticks, has three postembryonic development stages - larva, nymph, and adult (Figure 14). Figure 14 - Ixodes ricinus life stages. (Source: adapted from http://www.alleskatten.nl/gezondheid/pathologie-en-farmacologie/). adult female adult male nymph larva Chapter 1 State of the art 30 Their activity occurs during all year, however, it presents a specific seasonality, being adults more active between autumn (October) and spring (March), while larvae and nymphs are more active, in the host and also in the vegetation, between spring and summer (April to July). The duration of the life cycle depends of important factors as climate and host availability (Estrada-Peña et al., 2004; Stanek et al., 2012; Handeland et al., 2013). The immature stages (larva and nymph) remain mainly in low vegetation, where larva feed primarily on small mammals (rodents and rabbits), and nymphs are found in hosts of medium size like birds and reptile, the adults feed on a variety of large animals (Figure 15). With the exception of the adult male that takes small blood meals and do not engorge, each life stage requires a blood meal from a vertebrate host. Both genders can also be found in high vegetation, where they expect potential hosts. Only one blood meal is made in each evolutional stage of the tick (Mannelli et al., 2012; Movila et al., 2012). Figure 15 - Life cycle of Ixodes ricinus ticks. (Source: adapted from http://tickapp.tamu.edu/tickbiology.php) All stages of I. ricinus species use the same technique to hold on to the host, they normally climb to the top of the vegetation and when the host passes the tick grabs to the fur or Chapter 1 State of the art 31 skin through its questing legs, and then bites using its specialized mouthparts. After it has finished its blood meal, which can last several days (3-4 days to larvae, 4-8 days to nymphs and 5-20 days to adult females), contributing to their geographical spread along with the movement of the host (Wilske, 2005), it loosen up from the host to the soil, and molt to the next stage. The life cycle of I. ricinus ends with the mating, where the female tick after fully engorged produces eggs and deposited them in the soil (oviposition). After the posture of the eggs (approximately 2000), the female dies (Estrada-Peña et al., 2004; Stanek et al., 2012; Medlock et al., 2013). 1.3.6 – Transmission and Pathogenesis Borrelia burgdorferi s.l. spirochetes can be transmitted to the tick by three possible ways: i) through the blood meal in an infected host (the most common way); ii) by transovarial transmission (TOT) and/or iii) by transstadial transmission (Figure 16). Figure 16 – Schematic representation of transovarial and transstadial transmission of pathogenic agents in Ixodes ticks. (Source: https://en.wikipedia.org/). The transovarial transmission of spirochetes is rare, however, this hypothesis has been explored by many tick-borne pathogens for maintenance in natural environment and reported to occur in both ixodid and argasid ticks (Rollend et al., 2013). Although studies carried out both in the USA and Europe have shown B. burgdorferi s.l. in I. scapularis and I. ricinus larvae (Rijpkema et al., 1994; Hubálek & Halouzka, 1998), this seems to Chapter 1 State of the art 32 occur at a very low rate. For this reason, TOT does not seem to play any significant role for the natural maintenance of B. burgdorferi s.l. and a consequent minimal contribution to the dynamics of infection in adult ticks of the next generation is expected (Nefedova et al., 2004). Ticks transmit the spirochetes by cutaneous inoculation of infected saliva. After the tick attaches, the spirochetes disseminate from the skin, to other tissues, organs or systems, through the blood flow. If the tick has been attached less than 24h, the risk of infection is low (Piesman, 1993), since the transmission of Borrelia is more efficient as greater is fixation time of the tick to the host, being necessary an attachment of 48-72h for a successful transmission of the spirochete. However, several authors verified that the attachment time to the host depends on the Borrelia species and also on the vector (Stanek et al., 2012). For example, the spirochete of B. burgdorferi s.s. is not transmitted before 48h of attachment, while B. afzelii can be transmitted in less than 24h. Also, I. ricinus can transmitted the spirochetes faster than I. scapularis and I. pacificus (Marques, 2010; Wood & Lafferty, 2013). During the attachment, ticks injects a complex mixture of bioactive chemicals into the host, like histamine binders and cytokine inhibitors to mediate the host response, complement inhibitors to suppress the host immune response, and anticoagulants to facilitate the blood meal (Müller-Doblies & Wikel, 2005). This results in a painless “bite” and usually prevents an inflammatory response. Spirochetes disseminate, along with the blood meal, from the infected host to the tick, and colonize the midgut. They remain in the midgut multiplying until the next blood meal, when a fraction of the spirochetes from the midgut invade the salivary glands. While spirochetes are in the midgut, they express high levels of OspA, since its presence is a requirement for survival in the tick by facilitating adhesion of the spirochete to the midgut wall (Pal et al., 2000), biding to a receptor TROSPA (tick receptor for outer surface protein A), essential for spirochete colonization. OspA protein is then downregulated, while the tick prepares for the blood meal, the spirochetes passes from the midgut to the salivary glands and from there to the host. Simultaneously, Outer surface protein C (OspC) is upregulated (Schwan et al., 1995; Schwan & Piesman, 2002). The role of this protein is not clear, since it may have multifactorial activity including helping in host infection, invasion and dissemination, (Tilly et al., 2013). OspC expression and infectivity increases during some days once the Chapter 1 State of the art 33 spirochetes have invaded host tissues by biding to the tick salivary protein, Salp15 (Pal et al., 2004; Pal & Fikrig, 2010) (Figure 17). Though being antigenic, it is eventually downregulated to minimize host antibody response. Figure 17 - Tick salivary protein (Salp15) that binds and protects Borrelia burgdorferi s.l. spirochetes. (Source: Rosa, 2005). A major factor in the OspA/OspC complementary expression is the temperature. When a tick finds a host and starts to feed, it moves from ambient temperature to the temperature at the surface of mammalian host skin. This rapid temperature change influences the spirochete population and induces OspC expression (Schwan & Piesman, 2002). This can be important for Borrelia spirochetes transmission time from tick to host. Tick blood feeding behavior includes engagement, the adherence to the host; exploration, the search for a suitable site for attachment; and penetration, where the tick inserts the mouthparts in the host for feeding (Cook, 2015). During the process of tick exploration, temperature rise will activate OspA/OspC regulation and the process of increased motility and infectivity begins. Exploration time will be highly variable, since it depends on how Chapter 1 State of the art 34 quickly the tick migrates to an optimal site. This time could vary with several factors as host animal size, competing ticks presence, or rejection of an unsuitable site (Cook, 2015). In addition to ticks acquiring infections directly from an infected blood meal, as stated earlier, they can also get infected by a process known as cofeeding transmission. In this mode of transmission, uninfected ticks acquire infections from infected ticks that are feeding in close proximity to them on the same host. This phenomenon has been demonstrated in transmission of B. burgdorferi s.s. spirochetes by I. scapularis (Patrican, 1997; Piesman & Happ, 2001) and I. ricinus (Gern & Rais, 1996), B. afzelii by I. ricinus (Crippa et al., 2002), and B. garinii by I. persulcatus (Sato & Nakao, 1997). The significance of cofeeding transmission to the epidemiology of LD is poorly understood; however, it seems to be more efficient in the European “system” of B. afzelii and I. ricinus than the North American “system” of B. burgdorferi s.s. and I. scapularis (Voordouw, 2015). The importance is related to the potential for nymph-to-larva cofeeding events, which depends on the synchrony of larval and nymphal host searching and questing activity. In Europe, the two stages of immature ticks are active during the same times of the year from spring to autumn, whereas in North America, the peak activity of these stages may occur during different times of year (Kurtenbach et al., 2006; Barbour et al., 2009). Because deer and other large cervids may carry all stages of ticks simultaneously, these hosts may play an important role in providing a platform for cofeeding transmission to occur even though they are not infected themselves (Voordouw, 2015). The host response to B. burgdorferi s.l spirochetes can also play a key role in disease pathogenesis. These bacteria does not produce toxins or proteases that are directly responsible for tissue damage upon colonization. In contrast, the bacterium produces multiple molecules that activate host responses and can lead to localized and generalized inflammatory pathogenic responses. Most of these host responses normally function to contain or clear infections and are components of the innate defense and/or inflammatory response (Benhnia et al. 2005; Behera et al., 2006; Oosting et al., 2010). Although their purpose is to clear infection, if continually activated, they lead to lesion development and disease. One of these multiple molecules, are lipoproteins that activate Toll-like receptors (TLRs) 1 and 2 in a CD14-dependent manner (Hirschfeld et al., 1999), and also induces type I Chapter 1 State of the art 41 of diameter, with lymphoreticular proliferation in the dermis and/or subcutis (Mullegger, 2004);  infection of the central nervous system (CNS) with the common manifestations of Lyme neuroborreliosis (LNB) including lymphocytic meningoradiculoneuritis – Bannwarth’s syndrome, acute facial nerve palsy (Bell’s palsy), which consists in a paralysis or weakness of muscles on one or both sides of the face (Table 6), and lymphocytic meningitis (Stanek & Strle, 2008; Mygland et al., 2010). LNB is an infectious disorder and the most frequent syndrome of disseminated infection on Europe, however, is becoming an more common symptom in North American LB patients (Garcia-Monco & Benach, 1998; Mygland et al., 2010);  severe muscle pain or numbness in the arms and legs, being common pain or swelling in the knees, shoulders, elbows and other large joints. All these symptoms contribute to Lyme arthritis (Table 6) (Hu, 2005);  a wide range of clinical cardiac complications, including palpitations and dizziness, atrioventricular block, pericarditis, myocarditis to more rare cardiomyopathy also known as Lyme carditis (Lelovas et al., 2008); Chapter 1 State of the art 42 Table 6 - The three stages of Lyme disease and examples of some clinical manifestations. Stage of disease Timing Common manifestations Examples of clinical manifestations Early Localized Days to weeks A solid red or bull’s eye lesion (erythema migrans - EM); regional Lymphadenopathy. EM Early disseminated Weeks Most commonly multiple rashes, Bell’s palsy and meningitis; rarely carditis with varying degrees of heart block; also joint pain, headaches, stiff neck, lymphadenopathy, vision alterations. Bell’s palsy Late Weeks to months Recurrent arthritis; Acrodermatitis Chronica Atrophicans - ACA; neurological disorders; peripheral neuropathy. ACA Chonic Late LD – Persistent infection (stage 3) – normally occurs months to years after the tick bite, with chronic manifestations of arthritis, acrodermatitis chronica atrophicans (ACA) (Table 6) and late neuroborreliosis manifestations including several degree of encephalopathy and encephalomyelitis, besides various neuropsychiatric symptoms. ACA is associated to B. afzelii and usually begins on the extensor sites of the members extremities, on the lower leg with initial involvement of one foot, and it does not heal spontaneously (Stanek et al., 2002), being more common in Europe and Asia but not frequent in North American patients. Chapter 1 State of the art 43 This diversity of symptoms, can be explain in part, by the different species of Borrelia responsible for LD in several geographic areas, and also possibly by genetic differences among the affected populations (Reed, 2002). For example in Europe LNB is most often caused by B. garinii, and skin complications are usually associated to B. afzelii, however, regarding the articular complications these can be due to several species like B. garinii, B. afzelii and B. burgdorferi s.s.. Meanwhile, in USA B. burgdorferi s.s. is the species responsible for cases of Lyme arthritis (Strle & Stanek, 2009), and the novel identified B. burgdorferi s.l. genospecies – B. mayonii – also causes Lyme borreliosis, but with substantially elevated spirochaetaemia and clinical features distinct from other recognized B. burgdorferi s.l. species (Pritt et al., 2016). Therefore, the clinical manifestations are distinct in North America and in Europe, reflecting the global distribution of the different spirochetes species and ever genotypes as further will be explain (Wang et al., 1999). Furthermore, in Europe LD occurs in similar frequencies in both genders, with exception to ACA that is more common in women. Early LNB cases showed a bimodal age distribution with a lower frequency in the age range of 20 to 29 years old, while ACA occurs mostly in older patients (Wilske, 2005). 1.5.2 – Laboratory diagnosis – Conventional methodologies Lyme disease diagnosis is mainly clinical, based in signs and symptoms, the patient’s history of tick bite or exposure, anamnesis, and complemented by epidemiological data. In most cases the clinical diagnosis should be followed by laboratory tests, due to the unspecific nature of the clinical manifestations. The possibility that LD agents can be involve in other disorders, makes necessary for a laboratory response unequivocal, through sensitives and specific tests (Stanek et al., 2011). Unfortunately, there are no standardized diagnostic criteria for LD, which has led to both over and under diagnosis of the disease. CDC has published case definitions for surveillance purposes, despite emphasizes that these are not intended as diagnostic criteria (Table 7) (CDC, 2011). Chapter 1 State of the art 44 Table 7 - Case definition from Centers for Disease Control and Prevention (CDC), for surveillance purpose. (Font: adapted from Borchers et al., 2014). Case definition CDC Erythema migrans A skin lesion that typically begins as a red maculate or papule and expands over a period of days to weeks to form a large round lesion, often with central clearing. The largest diameter must reach a size ≥ 5 cm; The diagnosis must be made by a physician: Laboratory confirmation is recommend for person without known exposure. Neuroborreliosis Any of the following manifestations (alone or in combination): Lymphocytic meningitis; Cranial neuritis, particularly facial palsy (may be bilateral); Radiculoneuropathy; Encephalomyelitis; Encephalomyelitis must be confirmed by B. burgdorferi -specific antibody production in CSF. Musculoskeletal system Recurrent brief attacks of objective joint swelling in one or a few joints, sometimes followed by chronic arthritis in one or a few joints. Cardiovascular system Acute onset of high-grade (2nd or 3rd degree) atrioventricular conduction defects that resolve in days to weeks and are sometimes associated with myocarditis. Suspected A case of EM without known exposure (defined as having been ≤ 30 days before the onset of EM in wooded, brushy, or grassy areas in a county in which Lyme disease is endemic); A case with laboratory evidence of infection but without available clinical information; Probable Any other case of physician-diagnosed Lyme disease that has laboratory evidence of infection; Chapter 1 State of the art 45 (Cont. Table 7) Confirmed A case of EM with a known exposure; A case of EM with laboratory evidence of infection and without a known exposure; A case with at least one late manifestation that has laboratory evidence of infection; Laboratory evidence Positive culture for Borrelia burgdorferi or Two-tier testing (for specific antibodies) interpreted using established criteria, where Positive IgM is sufficient during the first 30 days from symptoms onset; Positive IgG is sufficient at any point during illness; Single-tier IgG immunoblot seropositivity using established criteria; CSF antibody positive for B. burgdorferi s.l. by enzyme immunoassay (EIA), or indirect immunofluorescence assay (IFA), when the titer is higher than it was in serum. Also the EUCALB (European Concerted Action on Lyme Borreliosis), has proposed clinical case definitions for use in clinical settings and epidemiological investigations (Stanek et al., 2011; Borchers et al., 2014). Except for EM, LD manifestations are not specific, having a variety of causes. Therefore, it is important to obtain a detailed patients history in order to establish probable exposure to Ixodes ticks in an endemic area at an appropriate time of the year, and to obtain appropriated and definitive laboratory confirmation. Laboratory test have improved a lot in the last decades and clinicians have now available a range of options of methods that can be classified in two types: Direct methods (culture and molecular approaches), and Indirect methods (immunologic and serological approaches).  Direct methods Laboratory tests for direct detection of Borrelia are generally limited by the low number of spirochetes in clinical samples, also the lack of sensitivity of direct tests is one of the main challenges in the diagnosis of LD. Although direct tests for B. burgdorferi can be very helpful, none are usually required for the diagnosis of the disease (Marque, 2015). Chapter 1 State of the art 46 The main direct test modalities used are culture and PCR for Borrelia DNA detection. Histopathology has limited utility, being used mostly to exclude other diseases, and in the evaluation of suspected cases of borrelial lymphocytoma and ACA (Müllegger & Glatz, 2008; Zajkowska et al., 2011). Detection of B. burgdorferi is difficult and time consuming because of the extreme scarcity of organisms (Duray, 1989; de Koning et al., 1995). Culture Culture is not a typically available diagnostic method for the diagnosis of LD in clinical practice, due to its relatively low sensitivity, long incubation time, requires special media and expertise. However, the ability to isolate and to maintain B. burgdorferi s.l. cultures is essential in research, and culture remains the gold standard to confirm the diagnosis. Methods that would improve sensitivity and simplify the procedure are needed to allow it to be adopted more extensively. Since B. burgdorferi s.l. has a limited metabolic capacity, a complex growth medium for cultivation is essential. The Barbour-StoennerKelly medium (BSK) (Pollack et al., 1993) and the modified Kelly-Pettenkofer medium (MKP) (Ružić-Sabljić et al., 2006) are the most used medias for B. burgdorferi s.l. cultures. The BSK medium has the particularity of changing color, from orange to yellow, when the spirochetes growth, due to its acidification (Figure 20). Cultures can be examined using dark-field microscopy or fluorescent microscopy (Liveris et al., 2011). The spirochetes of B. burgdorferi s.l. species has a slow reproduction rate and cultures are maintained under anaerobic or microaerophilic conditions with a temperature ranging from 30-34ºC, during at least 8 to 12 weeks before being considered negative (Liveris et al., 2011). Figure 20 - Cultures of B. burgdorferi s.l. in selective medium BSK. The changing of the medium color, from orange to yellow, shows the spirochetes growth. (Source: Original photo by Mónica Nunes). Chapter 1 State of the art 47 The success of culturing B. burgdorferi s.l. depends of the specimen, the biological sample (e.g. fluids or biopsies), the evolution of the disease, and the expertise of the laboratory staff. It may also depend of the genotype (Xu et al., 2013). Also, if the patient was subjected to an antibiotic therapy with effective drugs against B. burgdorferi s.l. (even a single dose) the culture sucess rate is significantly affected (Nadelman et al., 1993; Picken et al., 1997). Culture of skin biopsies from EM has a sensitivity of 40% to 60% (Liveris et al., 2012; Ogrinc et al., 2013; Ružić-Sabljić et al., 2014). In the USA, where disease is caused by B. burgdorferi s.s., positive cultures are associated with shorter duration of the disease and smaller lesions (Liveris et al., 2002; Li et al., 2011). In central Europe, positive skin biopsy cultures (mostly isolates were B. afzelii) were associated with larger lesions (up to about 15 cm in diameter) and increased duration (up to 30 days) (Strle et al., 2013). These findings are probably related with the different Borrelia species and the host immune response that eventually controls the infection. Culture is moderately successful in skin biopsies of ACA lesions (Picken et al., 1997). Culture of plasma samples from untreated patients with early disseminated infection has a sensitivity of around 40%, which can be increased to 75% by frequent testing culture aliquots with a sensitive PCR. Blood cultures are more likely to be positive in patients with multiple EM (Liveris et al., 2011). B. burgdorferi s.l. is rarely cultured from the blood of LD patients with later manifestations (Nowakowski et al., 2009; Maraspin et al., 2011). Isolation of B. burgdorferi s.l. from other origins, as CSF and synovial fluid is uncommon and the isolation rate is very low reflecting the small number of viable organisms present in those locations (Wormser et al., 2012). Microscopy The spirochetes can be directly detected in biologic samples such as blood, tick tissues and skin biopsies by dark-field microscopy, staining with appropriate stains, and by histochemical techniques. However, due to the low number of spirochetes in samples and to the limitations of microscopy observation, this approach is rarely used (Baptista, 2006). Chapter 1 State of the art 48 Polymerase chain reaction (PCR) In the last decades, many laboratories have started to give more attention to the molecular assays, with the aim to increase the sensitivity and specificity of LD diagnosis, and reduce the time consuming of the conventional techniques. The detection of Borrelia DNA carried through PCR presents a variable sensitivity, ranging from 10-30% (in case of CSF samples), to 50-70% for blood, skin biopsy and synovial fluid samples (Bratton et al., 2008; Stanek et al., 2011). These variation is due to the methodology, gene targets and primer sets used (Picken et al., 1997; Glins et al., 2008). Conventional PCR or nested-PCR can be used, yet nested-PCR in more specific and sensitive since it uses two steps of amplification, with one set of primers each, instead of the single step and single pair of primers involve in the classical PCR. Several targets have been used for the amplification of B. burgdorferi s.l. DNA, such as 5S/23S rDNA intergenic region, 16S genes, flagellin and p66 chromossomal genes or the ospA and ospB genes (Priem et al., 1997; Schmidt, 1997; Wilske et al., 2007). The targets carried on plasmids (opsA, ospB, opsC and vlsE) are present in multiple copies within each bacterium, and assays with these targets presents a greater sensitivity than those using single-copy chromosomal targets such as flagellin, recA, rpoB, 16S and 23S rDNA, and intergenic spacers. Restriction Fragment Length Polymorphism-PCR (RFLP-PCR), is a derivation of the PCR, and it is normally used for genotyping B. burgdorferi s.l. species, being the most used target the intergenic region 23S (rrl) – 5S (rrf) of the rDNA, were the amplification product is then digested by an endonuclease (MseI or DraI), and an pattern of products with different sizes is obtained, allowing to differentiate between Borrelia genospecies (Postic et al., 1994). Other PCR-based techniques can be used for the direct diagnosis of LD, such as Multiplex Real-Time PCR and Reverse Transcriptase PCR (RT-PCR) (Limbach et al., 1999; Courtney et al., 2004), however, a standardized PCR protocol is yet to be defined (Wilske et al., 2007). A negative result in a PCR test cannot be interpreted as an exclusion of LD. Since the number of spirochetes in infected tissues or in body fluids of patients are very low, and appropriated procedures for sample collection, transport and DNA extraction are critical Chapter 1 State of the art 49 for reliable and consistent PCR results (Wang et al., 2010). The false positive results is one of the limitation of nucleic acids amplification methods, due to contaminations, which can be very troublesome in assays set for maximum sensitivity, a requirement for LD diagnosis (Schmidt, 1997).  Indirect methods The host immune response to B. burgdorferi s.l. can be detected by indirect methods, based on the presence/absence of antibodies in serum against the spirochetes. Only the antibody-based assays are approved and recommended for Lyme disease testing by the USA Food and Drug Administration (FDA) (Marques, 2015). In USA about 3.4 million of Lyme serologic tests are done per year, almost 1000x more than the estimated number of 300,000 cases of LD, and a major problem of these laboratory tests is its inappropriate use. Most likely these tests are being used in conditions for which they are not recommended, including ruling out LD in populations with a low probability of having the disease. The predictive value of a test is determined by its sensitivity, specificity, and the prevalence of LD in the tested population. Therefore in a patient with a low probability of LD, a negative tests rules out the disease, whereas a positive result is more likely to be a false-positive (Marques, 2015). Already in 1995 the CDC recommended for LD test performance and interpretation a standardized 2-tier testing (STTT) approach to improve the specificity of serologic tests in USA (Figure 21) (CDC, 1995). Figure 21 - Current CDC recommendations of serologic diagnosis of Lyme disease. (Source: Adapted from Marques, 2015). Chapter 1 State of the art 50 The serum samples should be tested with a sensitive first-tier EIA, or IFA, and if the result is borderline or positive, an IgM and IgG Western blot (WB; also called immunoblot) is applied as second step (Marques, 2015; Schriefer, 2015). Later on it was stipulated that IgM WB should only be applied to patients in an early phase of the disease, with a duration of 30 days or less. The WB is interpreted by a standardized criteria that requires at least two or three antigenic fractions (signature bands) for a positive IgM WB (p21 [OspC], p39 [BmpA], and p41 [flagellin B] (Engstrom et al., 1995), and five to ten antigens for a positive IgG WB (p18, p21 [OspC], p28, p30, p39 [BmpA], p41 [flagellin B], p45, p58, p66, p93 (Dressler et al., 1993). The 2-tier approach algorithm has a good performance when used as recommended, however, there’s still many improvements to be done, including the situations of low sensitivity during early infection, subjective interpretation of bands, and difficulty of health care providers in interpreting the results (Marques, 2015). The majority of indirect assays is based on whole-cell sonicate (WCS) from B. burgdorferi s.l. cultures, however, a significant number of false-positive results can occur, due to cross-reactive antigens (Gomes-Solecki et al., 2000). Moreover, some antigen expression can differ from culture to in vivo, for example the expressed VlsE lipoprotein that causes a strong humoral response during infection, has a minimal expression in cultured B. burgdorferi s.l.. The addition of this lipoprotein to the 2-tier approach has improved its performance (Branda et al., 2010). Also, tests that use C6 peptide (26-amino acid peptide from conserved region 6 of VlsE has a sensitivity similar to WCS-based EIAs, with significantly improved specificity (Branda et al., 2011; Wormser et al., 2013). Several others recombinant and synthetic antigens have been evaluated in serodiagnosis of LD, including antigens combining portions of different proteins (Arnaboldi et al., 2013). Antibody-based test sensitivity increases with the evolution of the infection, and there is a lag from initial infection until the time when there are sufficient levels of antibodies to be detected. Patients who present very early symptoms are more likely to have a negative result for LD. Less than 50% of patients with EM are seropositive at presentation, and these patients should receive treatment based mainly on the clinical diagnosis. Chapter 1 State of the art 57 been investigated using a variety of targets from both types of DNA (Schmidt, 1997; Aguero-Rosenfeld et al., 2005). Assays designed to target plasmid-borne genes, such as ospA, ospC, or vlsE, are more sensitive than those targeting chromosomal, flagellin or 16s rDNA genes (Persing et al., 1994; Zore et al., 2002), most likely because of the finding that Borrelia often shed plasmid-containing blebs, which allows for higher concentrations of plasmid than chromosomal DNA. However, it is now well recognized that these blebs disassociate from the spirochete and may persist in tissues and body fluids (Persing et al., 1994). Therefore the detection of plasmid DNA from these nonviable blebs may elicit falsepositive results that do not necessarily reflect ongoing LD. Chromosomal targets usually occur as single copies; although targeting these genes may result in lower analytical sensitivity, they may be a better predictor of organism viability (Liveris et al., 1999). Several studies show that some matrices are better than others for the direct detection of Borrelia DNA from clinical specimens. The performance of these specimens in NAATs depends on the stage of infection at the time of patient presentation. Although these assays have demonstrated high specificity, sensitivity has been lacking, probably due to the absence of a true gold standard assay, or a standardized approach for comparison of the various methods under development. However, NAATs can serve as an adjunct diagnostic modality alongside with clinical findings and serologic testing (Swanson et al., 2006; Maraspin et al., 2011).  Isothermal DNA amplification In the last decade, it has been observed a huge rise in the abundance and availability of nucleic acid information, allowing the use of DNA and RNA amplification techniques for specific detection, harnessing the complexity inherent in genetic material for the purpose of targeted identification. Molecular diagnostic techniques using nucleic acids were pioneered through use of PCR, which remains the predominant method in the field due to its robustness, sensitivity and familiarity. However, the growing use of these molecular diagnostic methods has emphasized speed and simplicity as key criteria for adoption in point-of-care and field applications, and isothermal amplification techniques are wellsuited for these uses. Due to their nature, isothermal amplification methods require only Chapter 1 State of the art 58 a single temperature, avoiding the need of costly thermal cycling equipment and potentially even electrical power, depending on incubation temperature and heating (Tanner & Evans, 2014). Moreover, by constant incubation and amplification, no temporal restrictions from defined cycles are implied, resulting in amplification reactions as rapid as fifteen minutes (Fang et al., 2010; Wang et al., 2011). The most widespread isothermal method is loop-mediated isothermal amplification (LAMP), where since its first publication in 2000 by Notomi and collaborators, these technique has been applied to diagnostic detection of hundreds of pathogens in clinical, plant, food and animal samples (Arai et al., 2015; Ferrara et al., 2015; Palacio-Bielsa et al., 2015). This methodology presents a simple, robust and flexible platform for molecular diagnostics. The LAMP reaction employs a DNA polymerase with strand displacement activity and four or six specially designed primers that recognize six distinct sequences on the target DNA under isothermal conditions (60-65°C), where a denatured template is not required. Normally, the reaction runs for about 60 minutes, showing an extremely high specificity (Nagamine et al., 2002; Mori & Notomi, 2009). Also, LAMP method has a high amplification efficiency that allows the synthesis of large amounts of DNA in a short time. Its detection limit is a few copies per reaction and therefore is comparable to PCR (Mori & Notomi, 2009). For the assay performance, only a heating block at a constant temperature or a water bath is necessary. To perform the reaction, a set of two specially designed inner and outer primer pairs and a DNA polymerase with strand displacement activity are required for the DNA synthesis. The initial reaction steps are illustrated in Figure 23. DNA regions F3 and R3 are complementary to F3c and R3c on the template, respectively. The F2 region in the forward inner primer FIP is complementary to the F2c region followed by the F1c complementary to F1 of the target DNA. The same principle is used to design the backward primer. As a result, these four primers recognize six distinct sequences which ensure high specificity for target amplification. Moreover, these primers enable generation of a stem-loop DNA for subsequent complex LAMP cycling including self-priming reactions. In the initial steps of the LAMP reaction all four primers are employed, but in the later cycling steps, only the inner primers are used for strand Chapter 1 State of the art 59 displacement DNA synthesis. The final products is a mixture of stem loop DNAs with several inverted repeats of the target and cauliflower-like structures with multiple loops formed by annealing between alternately inverted repeats in the same strand (Notomi et al., 2000; Tomita et al., 2008). The reaction can be accelerated by using two extra loop primers. Figure 23 - Schematic representation of Loop-mediated isothermal amplification assay. LAMP is characterized by the use of four primers (F3, B3, FIP and BIP), in an isothermal (60–65ºC) auto-cycling strand displacement reaction. (Source:http://what-whenhow.com/tropical-medicine/novel-molecular-diagnostic-platform-for-tropical-infectious-diseases-othertropical-infectious-and-non-infectious-conditions-part-1). LAMP amplification products can be detected either by gel electrophoresis, real-time monitoring of turbidity with a turbidimeter (Mori et al., 2001; Mori et al., 2004), or simply with the naked eye. During the reaction, a large amount of DNA is synthesized, yielding a large pyrophosphate ion by-product. It was observed that pyrophosphate forms an insoluble, observable white precipitate with divalent metallic ions (Mori et al., 2001). Another visual detection method based on the formation of pyrophosphate can be accomplished by using the fluorescent metal indicator calcein, which binds free calcium ions. Calcein has been used for the real-time detection of DNA formation during LAMP (Tomita et al., 2008). Further methods apply intercalating DNA dyes such as SYBR Chapter 1 State of the art 60 Green I (Soliman & El-Matbouli, 2005), FDR (Yoda et al., 2007), or oligonucleotide probes labeled with different fluorescent markers, as well as low molecular weight cationic polymers such as polyethylenimine (Mori et al., 2006). There are several works reporting the use of this technology to detect pathogenic organisms, however, for Borrelia this approach is still hardly applied, existing so far only two published studies (Yang et al., 2013; Zhang et al., 2015). It’s important to employ LAMP technique on large scale in resourced-limited laboratories in developing countries, where many fatal tropical diseases are endemic. Also in the near future, LAMP testing kits on readymade microchips are to be used by both developed and developing countries.  Immunochromatographic assays In the late 1960s immunochromatographic assays were first described, being originally developed to assess the presence of serum proteins (Kohn, 1968; Peruski et al., 2003). However, over the past decade many other applications have been developed for immunochromatographic assays, including the detection of bacterial pathogens (van Dommelen et al., 2008; Preechakasedkit et al., 2012; Widiyanti et al., 2013). The instantaneous examination of changes in one’s own physical symptoms or health status is increasingly preferred. Self-tests performed at home will definitely be an integral part of future health care systems (Price, 2001). In fact, the market expansion of homeversion diagnostic kits in developed countries, typically in the United States, far exceeds the average for overall in vitro diagnostic products. The first commercially successful kit was the pregnancy test based on the rapid detection of human chorionic gonadotropin in urine by simply adding urine to the test kit (Butler et al., 2001). The most common immunochromatographic assays are the known lateral flow strips that have been a commonly used technology for some time. Lateral flow strips offer a number of various benefits including user friendly format, very short test time, long term stability, and they are producible at low costs. These features make the lateral flow strip tests ideal for home testing, rapid point of care testing and for field testing applications. Chapter 1 State of the art 61 A lateral flow strip (LFS) presents four main sections made of different materials, as shown in Figure 24: sample pad, made of cellulose, where the sample is dropped; conjugate pad, made of glass fiber, impregnated with the bioconjugates solution (the label particle and a receptor for the analyte); detection pad, a nitrocellulose (Ahmad et al., 2009) where test line (TL) and control line (CL) are printed; and absorption pad, also made of cellulose. Figure 24 - Schematic representation of a LFS (lateral flow strip) and movement of analytes and label particles across it. (Source: Adapted from Quesada-González & Merkoçi, 2015). Other additional parts can be integrated on LFS as blood filters, substituting the sample pad, to retain big particles like red blood cells and avoiding their hemolysis. Another example of material which can be integrated on LFS is carbon nanotubes paper, with high conductive properties to connect LFS to electronic devices (Zhu et al., 2014). The principle of an assay with a LFS is simple: the sample is added on the sample pad and then the liquid will start flowing to the conjugate pad where the analyte, if present on the sample, will be linked to the transducers (the label particles), previously conjugated Chapter 1 State of the art 62 with a bioreceptor specific to the analyte. The conjugate, rehydrated by the liquid, will flow by capillarity forces across the detection pad to the absorbent pad, passing through the TL, where it will be captured only if the conjugate has the analyte attached (positive response), and to the CL, being always captured, evidencing that the assay worked (Figure 24) (Quesada-González & Merkoçi, 2015). LFSs can be used to detect a large range of biomarkers that may include not only proteins, but also nucleic acids and even whole cells, among other biocompounds. Furthermore, LFSs are not limited only to biomolecules detection; several publications have appeared in the last years about the detection of pollutants such as metallic ions, pesticides, etc. The range of LFSs applications is including detection of hazardous (Shyu et al., 2002), heavy metals in drinking waters (López-Marzo et al., 2013), allergens and pathogens in food (Berlina et al., 2013), pesticides (Wang et al., 2009), drugs screening (Inoue et al., 2007), etc. These tests are, therefore, of great value in situations where health professionals need to make decisions and take immediate measures. Lateral-flow assays were also previously described for the diagnosis of LD (Lerner et al., 2013). 1.5.4 – Prevention, Control and Treatment Given the increasing threat of LD, the need for effective methods to protect against this disease has never been greater (Ogden et al., 2013). The options for this purpose are limited, since there are no licensed human vaccines against Lyme disease and also an area-wide and centrally organized tick control programs are lacking (Poland, 2011). However, exposure to ticks and B. burgdorferi s.l. can be controlled, usually at the individual person or individual property level, with several relatively simple interventions (Poland, 2001; Corapi et al., 2007; Piesman & Eisen, 2008):  Avoiding areas where ticks that transmit B. burgdorferi s.l. occur, at times that the ticks are active;  Applying personal protective measures, such as wearing appropriate clothing, using tick repellents and clothing treatments, and removing ticks before they can attach and transmit B. burgdorferi s.l.; Chapter 1 State of the art 63  Reducing environmental risk by controlling ticks and tick infections with pesticide applications; reservoir-targeted interventions (e.g., bait boxes); and landscape management;  Using prophylactic antibiotics in an appropriate manner after a tick bite to prevent transmitted B. burgdorferi s.l. from evolution to clinical LD. A simple rule for LD is: “if you don’t get a tick, you don’t get sick.” Previously this rule could be achieved just by avoiding the areas where LD occurs, however, the range expansion of Ixodes species and LD in USA and Europe has changed this, and these ticks are now found in more regions and have also moved into more densely populated areas, including on or close to private/residential properties (Stanek & Reiter, 2011; Li et al., 2012; Medlock et al., 2013; Vollmer et al., 2013). Nonetheless, avoidance can be a viable risk-reduction approach, at least in some locations and situations. If it’s not possible to avoid the tick habitats, then risk reduction relies on preventing bites or remove attached ticks before they have time to transmit Borrelia. This can be accomplished by wearing appropriate clothing, like light-colored and long-sleeve shirts, socks, and full trousers; or use approved, topical repellents like DEET (N,N-diethl-metatoluamide) and permethrin based products, on skin or wear insecticide-treated clothing; do tick checks at least once a day and remove any ticks that are found with fine-tipped, stiff, and angled forceps (tweezers) placed around the head of the tick as near as possible to the skin, followed by a steady, upward pulling movement (Figure 25) (Piesman & Dolan, 2002; Duscher et al., 2012); finally bath or shower soon after leaving tick habitat, within the two following hours. Figure 25 - Scheme showing how to remove a tick. (Source: adapted from http://www.health.harvard.edu/blog/matchless-strategy-for-tick-removal-6-stepsto-avoid-tick-bites 201306076360). Chapter 1 State of the art 64 LD vaccination is still a problem, since there is no licensed human vaccine. Although, some studies defend that this disease can be prevented by vaccination with the OspA (Edelman et al., 1999; Rahn, 2001). A vaccine targeting LB (LYMErix) based on OspA from B. burgdorferi s.l. was tested, and show to be effective, being available in the USA from 1998 to 2000 (Golde et al., 1995; Steere et al., 1998). However, the duration of this vaccine was relatively short, and it was removed from the market by its manufacturer in 2002. Currently, efforts are being made towards the development of a broadly protective LB vaccine. Several proteins have been assessed as potential vaccine candidates. (Marconi & Earnhart, 2010; Comstedt et al., 2015). Regarding the treatment of LD, this is routinely with antibiotics; therapy hastens the resolution and largely prevents the development of other disease manifestations. The classes of antibiotics that have shown the greatest effectiveness against Borrelia spirochetes are b-lactams (in particular cephalosporins) tetracyclines and, to a lesser extent, macrolides. The best treatment approach, in particular the duration of therapy, is a matter of ongoing debate. It is quite evident that not all patients, and most certainly not all species or strains of Borrelia respond equally to the antibiotics most commonly used in the treatment of LD (Preac-Mursic et al., 1996). Based on the available evidence from randomized controlled trials, treatment recommendations have been published by the Infectious Diseases Society of America (IDSA) (Wormser et al., 2006), the American Academy of Pediatrics, and by a variety of national and supranational associations in Europe (Mygland et al., 2010; EUCALB). Both guidelines published by the IDSA and the EUCALB, are similar on both sides of the Atlantic regarding the approaches to therapy, yet there are some differences in the recommended dosage and treatment duration. 1.6 – Objectives and thesis plan In Portugal LD still remains underdiagnosed and underreported. Despite the existence of the vector in the country and the identification and isolation of several genospecies of B. burgdorferi s.l. from patient samples and from the vector, the true prevalence of the Chapter 1 State of the art 65 disease is still unknown. However, an increase importance has been given to this disease worldwide, which is currently considered an emerging disease. The diagnosis it is mainly clinic, although the laboratory information based in serologic or molecular assays, is a fundamental support contributing for an adequate and timely treatment, and at the same time, helping to limit the risk of resistances to treatments or the evolution of the infection to a chronic situation, resulting in high costs for the patient and for the community. Objectives The main goals of the present study were to evaluate the prevalence of LD agents in the Portuguese ixodofauna, mainly in I. ricinus vector and in sylvatic and domestic hosts; and to develop two new molecular methodologies for the identification of four of the most prevalent genospecies of B. burgdorferi s.l. in Europe. Thus, this thesis was divided into four main parts: 1) To evaluate the bio-ecological characteristics of the ixodids collected in the select districts from Portugal; 2) To analyze vector-pathogen-host relationships as they happen in nature, therefore gaining insight into the diversity and prevalence of B. burgdorferi s.l. organisms in different hosts and tick species; 3) To develop and optimize a real-time PCR assay for the identification and quantification of four of the most prevalent genospecies of B. burgdorferi s.l. in Europe/Portugal; 4) To develop two duplex Loop-Mediated Isothermal DNA Amplification Assays (dLAMP) coupled with colorimetric lateral flow devices, for the identification of four of the most prevalent genospecies of B. burgdorferi s.l. in Europe/Portugal; Thesis plan This dissertation is organized into six chapters. In chapter 1, a general theoretical introduction embracing the subject under study is presented, with emphasis to the topics regarding the major characteristics of the B. burgdorferi s.l. complex members, and its laboratory diagnosis; chapter 2 characterize bio-ecologically the ticks as vectors, Chapter 1 State of the art 66 collected from the vegetation and hosts in previously selected districts from mainland Portugal, and determined the infection rate by B. burgdorferi s.l.; in chapter 3 the vectorpathogen relationships in nature are analyzed; in chapter 4 the pathogen-host relationship is evaluated; in chapter 5 the development of a rapid identification real-time PCR algorithm for B. burgdorferi s.l. complex species using specific dual-labelled hydrolysis probes in a multiplex format are described, and also two duplex Loop-Mediated Isothermal DNA Amplification assay (dLAMP) coupled with colorimetric lateral flow devices, for the identification of four of the most prevalent genospecies of B. burgdorferi s.l.. Finally, in chapter 6, considerations about the work presented and the main results that were achieved are highlighted, as long as suggestions for future work. Chapter 1 State of the art 73 PCR: Effects of dye concentration and sequence composition on DNA amplification and melting temperature. Nucleic Acids Research, 35(19): 1–8. doi: 10.1093/nar/gkm671; Guiguen C and Degeilh B. (2001). Les tiques d’intérêt médical : rôle vecteur et diagnose de laboratoire. Revue Française des Laboratoires, 338: 49–57. doi:10.1016/S0338-9898(01)803516; Guner ES, Watanabe M, Hashimoto N, et al. (2004). Borrelia turcica sp. nov., isolated from the hard tick Hyalomma aegyptium in Turkey. International Journal of Systematic and Evolutionary Microbiology, 54(5): 1649–1652. doi: 10.1099/ijs.0.03050-0; Guy EC and Stanek G. (1991). Detection of Borrelia burgdorferi in patients with Lyme disease by the polymerase chain reaction. Journal of Clinical Pathology, 44(7): 610–1. Hamer SA, Tsao JI, Walker ED, et al. (2009). Use of tick surveys and serosurveys to evaluate pet dogs as a sentinel species for emerging Lyme disease. American Journal of Veterinary Research, 70(1): 49–56. doi: 10.2460/ajvr.70.1.49; Handeland K, Qviller L, Vikøren T, et al. (2013). Ixodes ricinus infestation in free-ranging cervids in Norway-a study based upon ear examinations of hunted animals. Veterinary Parasitology, 195(1-2): 142–9. doi: 10.1016/j.vetpar.2013.02.012; Hanincová K, Schäfer SM and Etti S. (2003). Association of Borrelia afzelii with rodents in Europe. Parasitology, 126: 11–20; Hayes SF and Burgdorfer W. (1993). Ultrastructure of Borrelia burgdorferi. Weber K, Burgdorfer W, Schierz G, editors. In: Aspects of Lyme Borreliosis, Springer-V, p.29–43; Heyman P, Cochez C, Hofhuis A, et al. (2010). A clear and present danger: tick-borne diseases in Europe. Expert Review of Anti-Infective Therapy, 8(1): 33–50. doi: 10.1586/eri.09.118; Heymann WR and Ellis DL. (2012). Borrelia burgdorferi Infections in the United States. The Journal of Clinical and Aesthetic Dermatology, 5(8): 18–28; Higuchi R, Dollinger G, Walsh PS et al. (1992). Simultaneous amplification and detection of specific DNA sequences. Biotechnology (Nature Publishing Company), 10(4): 413–7; Hirschfeld M, Kirschning CJ, Schwandner R, et al. (1999). Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by toll-like receptor 2. Journal of Immunology, 163(5): 2382–2386; Hu L. (2005). Lyme arthritis. Infectious Disease Clinics of North America, 19(4): 947–961. doi: 10.1016/j.idc.2005.07.007; Huang W, Ojaimi C, Fallon JT, et al. (2015). Genome Sequence of Borrelia chilensis VA1, a South American Member of the Lyme Borreliosis Group. Genome Aannouncements, 3(1): e01535-14. doi: 10.1128/genomeA.01535-14; Hubálek Z and Halouzka J. (1998). Prevalence rates of Borrelia burgdorferi sensu lato in hostseeking Ixodes ricinus ticks in Europe. Parasitology Research, 84(3): 167–72; Humair PF, Turrian N, Aeschilimann A et al. (1993). Borrelia burgdorferi in a focus of Lyme borreliosis: epizootiologic contribution of small mammals. Folia Parasitologica, 40(1): 65–70; Inoue K, Ferrante P, Hirano Y, et al. (2007). A competitive immunochromatographic assay for testosterone based on electrochemical detection. Talanta, 73(5): 886–892. Chapter 1 State of the art 74 doi:10.1016/j.talanta.2007.05.008; Ishiguro T, Saitoh J, Yawata H, et al. (1995). Homogeneous quantitative assay of hepatitis C virus RNA by polymerase chain reaction in the presence of a fluorescent intercalater. Analytical Biochemistry, 229(2): 207–13. doi:10.1006/abio.1995.1404; Ivacic L, Reed KD, Mitchell PD. (2007). A LightCycler TaqMan assay for detection of Borrelia burgdorferi sensu lato in clinical samples. Diagnostic Microbiology and Infectious Disease, 57(2): 137–143. doi:10.1016/j.diagmicrobio.2006.08.005; Iyer R, Kalu O, Purser J, et al. (2003). Linear and circular plasmid content in Borrelia burgdorferi clinical isolates. Infection and Immunity, 71(7): 3699–3706. doi: 10.1128/IAI.71.7.36993706.2003; Jaenson TGT and Jensen J. (2007). Records of ticks (Acari, Ixodidae) from the Faroe Islands. Agriculture, 54: 11–15; Johnson BJ, Happ CM, Mayer LW et al. (1992). Detection of Borrelia burgdorferi in ticks by species-specific amplification of the flagellin gene. The American Journal of Tropical Medicine and Hygiene, 47(6): 730–41; Johnson RC, Schmid GP, Hyde FW, et al. (1984). Borrelia burgdorferi sp. nov.: Etiologic Agent of Lyme Disease. International Journal of Systematic Bacteriology, 34(4): 496–497; Kalish RA, McHugh G, Granquist J, et al. (2001). Persistence of immunoglobulin M or immunoglobulin G antibody responses to Borrelia burgdorferi 10-20 years after active Lyme disease. Clinical infectious diseases, 33(6): 780–5. doi: 10.1086/322669; Kalmar Z, Cozma V, Sprong H, et al. (2015). Transstadial transmission of Borrelia turcica in Hyalomma aegyptium ticks. PLoS ONE, 10(2): 1–9. doi: 10.1371/journal.pone.0115520; Kaltenboeck B and Wang C. (2005). Advances in Real-Time PCR: Application to Clinical Laboratory Diagnostics. Advances in Clinical Chemistry, 40(05): 219–259; Karami A. (2012). Molecular Biology of Borrelia burgdorferi. Karami editor. In: Lyme Disease. InTech, p. 1–26; Kohn J. (1968). An immunochromatographic technique. Immunology, 6: 863-865; Korenberg E, Gorelova N and Kovalevskii Y. (2002). Ecology of Borrelia burgdorferi sensu lato in Russia. Gray JS, Kahl O, Lane RS, Stanek G, editors. In: Lyme borreliosis: biology, epidemiology and control. CABI Book, p. 175. doi:10.1079/9780851996325.0000; Krupka I and Straubinger RK. (2010). Lyme Borreliosis in Dogs and Cats: Background, Diagnosis, Treatment and Prevention of Infections with Borrelia burgdorferi sensu stricto. Veterinary Clinics of North America - Small Animal Practice, 40(6): 1103–1119. doi: 10.1016/j.cvsm.2010.07.011; Krupka M, Raska M, Belakova J, et al. (2007). Biological aspects of Lyme disease spirochetes: unique bacteria of the Borrelia burgdorferi species group. Biomedical papers of the Medical Faculty of the University Palack,Olomouc, Czechoslovakia, 151(2): 175–186; Kurtenbach K, Carey D, Hoodless AN, et al. (1998). Competence of pheasants as reservoirs for Lyme disease spirochetes. Journal of Medical Entomology, 35: 77–81; Kurtenbach K, Hanincová K, Tsao JI, et al. (2006). Fundamental processes in the evolutionary Chapter 1 State of the art 75 ecology of Lyme borreliosis. Nature reviews. Microbiology, 4(9): 660–669. doi:10.1038/nrmicro1475; Kurtenbach K, Kampen H, Dizij A, et al. (1995). Infestation of rodents with larval Ixodes ricinus (Acari: Ixodidae) is an important factor in the transmission cycle of Borrelia burgdorferi s.l. in German woodlands. Journal of Medical Entomology, 32(6): 807–817; Le Fleche A, Postic D, Girardet K, et al. (1997). Characterization of Borrelia lusitaniae sp. nov. by 16S ribosomal DNA sequence analysis. International Journal of Systematic Bacteriology, 47(4): 921–925; Lelovas P, Dontas I, Bassiakou E et al. (2008). Cardiac implications of Lyme disease, diagnosis and therapeutic approach. International Journal of Cardiology, 129(1): 15–21. doi: 10.1016/j.ijcard.2008.01.044; Lerner MB, Dailey J, Goldsmith BR, et al. (2013). Detecting Lyme disease using antibodyfunctionalized single-walled carbon nanotube transistors. Biosensors and Bioelectronics, 45: 163–167. doi: 10.1016/j.bios.2013.01.035; Levy SA and Magnarelli LA. (1992). Relationship between development of antibodies to Borrelia burgdorferi in dogs and the subsequent development of limb/joint borreliosis. Journal of the American Veterinary Medical Association, 200(3): 344–347; Leydet BF and Liang FT. (2014). Detection of Lyme Borrelia in questing Ixodes scapularis (Acari: Ixodidae) and small mammals in Louisiana. Journal of Medical Entomology, 51(1): 278– 82. doi: 10.1603/ME12273; Li S, Hartemink N, Speybroeck N, et al. (2012). Consequences of Landscape Fragmentation on Lyme Disease Risk: A Cellular Automata Approach. PLoS ONE, 7(6): e39612. doi: 10.1371/journal.pone.0039612; Li X, McHugh GA, Damle N, et al. (2011). Burden and viability of Borrelia burgdorferi in skin and joints of patients with erythema migrans or lyme arthritis. Arthritis and Rheumatism, 63(8): 2238–2247. doi: 10.1002/art.30384; Limbach FX, Jaulhac B, Piémont Y, et al. (1999). One-step reverse transcriptase PCR method for detection of Borrelia burgdorferi mRNA in mouse lyme arthritis tissue samples. Journal of Clinical Microbiology, 37(6): 2037–2039; Lindgren E and Jaenson TGT. (2006). Lyme borreliosis in Europe: influences of climate and climate change, epidemiology, ecology and adaptation measures. Copenhagen: World Health Organization Regional Office for Europe, p.35: Lindgren E, Tälleklint L and Polfeldt T. (2000). Impact of climatic change on the northern latitude limit and population density of the disease-transmitting European tick Ixodes ricinus. Environmental Health Perspectives, 108(2): 119–23; Liveris D, Schwartz I, Bittker S, et al. (2011). Improving the yield of blood cultures from patients with early Lyme disease. Journal of Clinical Microbiology, 49(6): 2166–2168. doi: 10.1128/JCM.00350-11; Liveris D, Schwartz I, McKenna D, et al. (2012). Comparison of five diagnostic modalities for direct detection of Borrelia burgdorferi in patients with early Lyme disease. Diagnostic Microbiology and Infectious Disease, 73(3): 243–5. doi: 10.1016/j.diagmicrobio.2012.03.026; Chapter 1 State of the art 76 Liveris D, Varde S, Iyer R, et al. (1999). Genetic diversity of Borrelia burgdorferi in lyme disease patients as determined by culture versus direct PCR with clinical specimens. Journal of Clinical Microbiology 37(3): 565–9; Liveris D, Wang G, Girao G, et al. (2002). Quantitative detection of Borrelia burgdorferi in 2millimeter skin samples of erythema migrans lesions: correlation of results with clinical and laboratory findings. Journal of Clinical Microbiology 40(4): 1249–53. doi: 10.1128/JCM.40.4.1249-1253.2002; Longo MC, Berninger MS and Hartley JL. (1990). Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene, 93(1): 125–128; Lopes de Carvalho I and Núncio MS. (2006). Laboratory diagnosis of Lyme borreliosis at the Portuguese National Institute of Health (1990-2004). Euro surveillance : European Communicable Disease Bulletin, 11(10): 257–60; López.Marzo AM, Pons J, Blake DA et al. (2013). All-integrated and highly sensitive paper based device with sample treatment platform for Cd2+ immunodetection in drinking/tap waters. Analytical Chemistry, 85(7): 3532–3538. doi: 10.1021/ac3034536; Malloy DC, Nauman RK and Paxton H. (1990). Detection of Borrelia burgdorferi using the polymerase chain reaction. Journal of Clinical Microbiology, 28(6): 1089–1093. Mannelli A, Bertolotti L, Gern L et al. (2012). Ecology of Borrelia burgdorferi sensu lato in Europe: transmission dynamics in multi-host systems, influence of molecular processes and effects of climate change. FEMS Microbiology Reviews, 36(4): 837–861. doi: 10.1111/j.15746976.2011.00312.x; Mantovani E, Marangoni RG, Gauditano G, et al. (2012). Amplification of the flgE gene provides evidence for the existence of a Brazilian borreliosis. Revista do Instituto de Medicina Tropical de São Paulo, 54(3): 153–7. Doi: 10.1590/S0036-46652012000300007; Mao F, Leung WY and Xin X. (2007) Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnology, 7: 76. doi: 10.1186/1472-6750-7-76; Marconi RT and Earnhart CG. (2010). Lyme Disease Vaccines. In: Samuels DS and Radolf JD, editors. Borrelia: Molecular Biology, Host Interaction and Pathogenesis, Norfolk, UK: Caister Academic Press, p. 467–486; Maraspin V, Ogrinc K, Ružić-Sabljić E, et al. (2011). Isolation of Borrelia burgdorferi sensu lato from blood of adult patients with borrelial lymphocytoma, Lyme neuroborreliosis, Lyme arthritis and acrodermatitis chronica atrophicans. Infection, 39(1): 35–40. doi: 10.1007/s15010-010-00628; Margos G, Vollmer SA, Cornet M, et al (2009). A new Borrelia species defined by multilocus sequence analysis of housekeeping genes. Applied and Environmental Microbiology, 75(16): 5410–5416. doi: 10.1128/AEM.00116-09; Margos G, Vollmer SA, Ogden NH, et al. (2011). Population genetics, taxonomy, phylogeny and evolution of Borrelia burgdorferi sensu lato. Infection, Genetics and Evolution, 11: 1545-1563. doi: 10.1016/j.meegid.2011.07.022 Marques AR. (2010). Lyme Disease: A Review. Current Allergy Asthma Reports, 10: 13–20. doi: 10.1007/s11882-009-0077-3; Chapter 1 State of the art 77 Marques AR. (2015). Laboratory Diagnosis of Lyme Disease: adavances and chalenges. Infectious Disease Clinics of North America, 29(2): 295–307. doi: 10.1016/j.idc.2015.02.005; Márquez-Jiménez FJ, Hidalgo-Pontiveros A, Contreras-Chova F, et al. (2005). Ticks (Acarina: Ixodidae) as vectors and reservoirs of pathogen microorganisms in Spain. Enfermedades Infecciosas y Microbiología Clínica, 23(2): 94–102; Mattman HL. (2001). Cell Wall Deficient Forms, Third Edition: Stealth Pathogens. CRC Press. pp. 405; Mayne P, Song S, Shao R et al. (2014). Evidence for Ixodes holocyclus (Acarina: Ixodidae) as a Vector for Human Lyme Borreliosis Infection in Australia. Journal of Insect Science, 14(1): 271– 271. doi: 10.1093/jisesa/ieu133; McCoy BN, Maïga O and Schwan TG. (2014). Detection of Borrelia theileri in Rhipicephalus geigyi from Mali. Ticks and Tick-Borne Diseases, 5(4): 401–3. doi: 10.1016/j.ttbdis.2014.01.007; Medlock JM, Hansford KM, Bormane A. (2013). Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasites & Vectors, 6(1): 1. doi: 10.1186/17563305-6-1; Mitani H, Talbert A and Fukunaga M. (2004). New World relapsing fever Borrelia found in Ornithodoros porcinus ticks in central Tanzania. Microbiology and Immunology, 48 (7): 501– 505. doi: 10.1111/j.1348-0421.2004.tb03545.x; Monis PT and Giglio S. (2006). Nucleic acid amplification-based techniques for pathogen detection and identification. Infection, Genetics and Evolution, 6(1): 2–12. doi:10.1016/j.meegid.2005.08.004; Monis PT, Giglio S and Saint CP. (2005). Comparison of SYTO9 and SYBR Green I for realtime polymerase chain reaction and investigation of the effect of dye concentration on amplification and DNA melting curve analysis. Analytical Biochemistry, 340(1): 24–34; Mori Y, Nagamine K, Tomita N et al. (2001). Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochemical and Biophysical Research Communications, 289(1): 150–154. doi:10.1006/bbrc.2001.5921; Mori Y, Hirano T and Notomi T. (2006). Sequence specific visual detection of LAMP reactions by addition of cationic polymers. BMC biotechnology, 6: 3. doi: 10.1186/1472-6750-6-3; Mori Y, Kitao M, Tomita N et al. (2004). Real-time turbidimetry of LAMP reaction for quantifying template DNA. Journal of Biochemical and Biophysical Methods, 59(2): 145–157. doi:10.1016/j.jbbm.2003.12.005; Mori Y and Notomi T. (2009). Loop-mediated isothermal amplification (LAMP): A rapid, accurate, and cost-effective diagnostic method for infectious diseases. Journal of Infection and Chemotherapy ,15(2): 62–69. Doi: 10.1007/s10156-009-0669-9; Mothershed EA and Whitney AM. (2006). Nucleic acid-based methods for the detection of bacterial pathogens: present and future considerations for the clinical laboratory. Clinical Chimica Acta: International Journal of Clinical Chemistry, 363(1-2): 206–220. doi:10.1016/j.cccn.2005.05.050; Movila A, Toderas I and Dubinina H. (2012). Zoonotic Peculiarities of Borrelia burgdorferi s .l.: Chapter 1 State of the art 78 Vectors Competence and Vertebrate Host Specificity. Karami editor. In: Lyme Disease, pp. 27– 54; doi: 10.5772/32690; Müllegger R and Glatz M. (2008). Skin manifestations of lyme borreliosis: diagnosis and management. American Journal of Clinical Dermatology, 9(6): 355–68. doi: 10.2165/0128071200809060-00002; Mullegger RR. (2004). Dermatological manifestations of Lyme borreliosis. European -journal of Dermatology, 14(5): 296–309; Müller-Doblies U and Wikel S. (2005). The human reaction to ticks (Washington). In: Goodman J, Dennis D and and Sonenshine D, editors. In: Tick-Borne Diseases of Humans. ASM Press, pp. 440. doi:10.3201/eid1111.051160; Müller-Doblies U, Maxwell SS, Boppana VD, et al. (2007). Feeding by the tick, Ixodes scapularis, causes CD4+ T cells responding to cognate antigen to develop the capacity to express IL-4. Parasite Immunology, 29(10): 485–499. Doi: 10.1111/j.1365-3024.2007.00966.x; Murray PR, Rosenthal KS, and Pfaller MA. (2008). Medical Microbiology, (6th edition). Mosby Elsevier, pp. 848; Mygland Å, Ljøstad U, Fingerle V, et al. (2010). EFNS guidelines on the diagnosis and management of European lyme neuroborreliosis. European Journal of Neurology, 17(1): 8–16. doi: 10.1111/j.1468-1331.2009.02862.x; Naddaf S, Ghazinezhad BSM. (2015). Tickborne relapsing fever in southern Iran, 2011–2013. Emerging Infectious Diseases, 21: 1078–1080. doi: http://dx.doi.org/10.3201/eid2106.141715; Nadelman RB, Nowakowski J, Forseter G, et al. (1993). Failure to isolate Borrelia burgdorferi after antimicrobial therapy in culture-documented Lyme borreliosis associated with erythema migrans: report of a prospective study. The American Journal of Medicine, 94(6): 583–588; Nagamine K, Hase T and Notomi T. (2002). Accelerated reaction by loop-mediated isothermal amplification using loop primers. Molecular and Cellular Probes, 16(3): 223–229. doi:10.1006/mcpr.2002.0415; Nagamine K, Watanabe K, Ohtsuka K, et al. (2001). Loop-mediated Isothermal Amplification Reaction Using a Nondenatured Template. Clinical Chemistry, 47(9): 1742–1743; Naka E, Costa I, Arão C, et al. (2008). Pesquisa de anticorpos anti-Borrelia e anti-Babesia em soro de crianças com manifestações clínicas e epidemiologia compatíveis com a doença de LymeSimile no Estado de Mato Grosso do Sul. Revista Brasileira de Reumatologia, 48(2): 74-85. doi: 10.1590/S0482-50042008000200003; Navarro E, Serrano-Heras G, Castaño MJ, et al. (2014). Real-time PCR detection chemistry. Clinica Chimica Acta, 439: 231-250. doi: 10.1016/j.cca.2014.10.017; Nefedova VV, Korenberg EI, Gorelova NB et al. (2004). Studies on the transovarial transmission of Borrelia burgdorferi sensu lato in the taiga tick Ixodes persulcatus. Folia Parasitologica, 51(1): 67–71; Nolte O. (2012). Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro) borreliosis - Lost in the Jungle of Methods, Targets, and Assays? The Open Neurology Journal, 6: 129–39. doi: 10.2174/1874205X01206010129; Norris SJ. (2012.) How do lyme borrelia organisms cause disease? The quest for virulence Chapter 1 State of the art 79 determinants. The Open Neurology Journal, 6: 119–23. doi: 10.2174/1874205X01206010119; Notomi T, Okayama H, Masubuchi H, et al. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12): E63; Nowakowski J, McKenna D, Nadelman RB, et al. (2009). Blood cultures for patients with extracutaneous manifestations of Lyme disease in the United States. Clinical infectious diseases, 49(11): 1733–1735. doi: 10.1086/648076; Núncio MS, and Alves MJ. (2014). Doenças associadas a artrópodes vetores e roedores. Instituto Nacional de Saúde Dr. Ricardo Jorge, IP. Guide – Artes Gráficas, Lda, pp. 183; Núncio MS, Péter O, Alves M, Bacellar F et al. (1993). Isolamento e caracterização de borrélias de Ixodes ricinus em Portugal. Revista Portuguesa de Doenças Infecciosas, 16: 175–179; Núncio MS, David de Morais JA and Filipe AR. (1992). Pesquisa de anticorpos anti-Borrelia burgdorferi numa população do distrito de Évora. Revista Portuguesa de Doenças Infecciosas, 15: 173–176. Nunes M, Parreira R, Lopes N, et al. (2015). Molecular Identification of Borrelia miyamotoi in Ixodes ricinus from Portugal. Vector-Borne and Zoonotic Diseases, 15(8): 515–517. doi: 10.1089/vbz.2014.1765; Ogden NH, Lindsay LR and Leighton PA. (2013). Predicting the rate of invasion of the agent of Lyme disease Borrelia burgdorferi. Journal of Applied Ecology, 50(2): 510–518. doi: 10.1111/1365-2664.12050; Ogrinc K, Lotrič-Furlan S, Maraspin V, et al. (2013). Suspected early Lyme neuroborreliosis in patients with erythema migrans. Clinical Infectious Diseases, 57(4): 501–509. doi: 10.1093/cid/cit317; Oliver JH. (1989). Biology and systematics of ticks (Acari:Ixodida). Annual Review of Ecology and Systematics, 20(1): 397–430. Olson PE, Kallen AJ, Bjorneby JM, et al. (2000). Canines as sentinels for Lyme disease in San Diego County, California. Journal of Veterinary Diagnostic Investigation, 12(2): 126–9; Oosting M, Berende A, Sturm P, al. (2010). Recognition of Borrelia burgdorferi by NOD2 is central for the induction of an inflammatory reaction. The Journal of Infectious Diseases, 201(12): 1849–1858. doi: 10.1086/652871; Ornstein K, Berglund J, Bergström S, et al. (2002). Three major Lyme Borrelia genospecies (Borrelia burgdorferi sensu stricto, B. afzelii and B. garinii) identified by PCR in cerebrospinal fluid from patients with neuroborreliosis in Sweden. Scandinavian Journal of Infectious Diseases, 34(5): 341–346. doi: 10.1080/00365540110080313; Pal U and Fikrig E. (2010). Ticks Interactions. Samuels S, and Radolf J, editors. In: Borrelia: Molecular Biology, Host Interaction and Pathogenesis. Caister Academic Press, pp. 279–298. Pal U, Li X, Wang T, et al. (2004). TROSPA, an Ixodes scapularis receptor for Borrelia burgdorferi. Cell, 119(4): 457–468. doi:10.1016/j.cell.2004.10.027; Pal U, de Silva AM, Montgomery RR, et al. (2000). Attachment of Borrelia burgdorferi within Ixodes scapularis mediated by outer surface protein A. The Journal of Clinical Investigation, 106(4): 561–9; Chapter 1 State of the art 80 Palacio-Bielsa A, López-Soriano P, Bühlmann A, et al. (2015). Evaluation of a real-time PCR and a loop-mediated isothermal amplification for detection of Xanthomonas arboricola pv. pruni in plant tissue samples. Journal of Microbiological Methods, 112: 36–39. doi:10.1016/j.mimet.2015.03.005; Palma M, Lopes de Carvalho I, Figueiredo M, et al. (2012). Borrelia hispanica in Ornithodoros erraticus, Portugal. Clinical Microbiology and Infection, 18(7): 696–701. doi: 10.1111/j.14690691.2011.03623.x; Papadopoulos B, Nuncio M and Filipe A. (1992). The occurrence of Rhipicephalus turanicus Pomerantzev, Matiskasvili & Lototzky, 1940, a species of Rhipicephalus sanguineus group, in Portugal. Acarologia, 33: 331–333; Parola P and Raoult D. (2001). Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clinical Infectious Diseases, 32(6): 897–928. Passos S, Gazeta R and Latorre M. (2009). Características clínico-epidemiológicas da doença de Lyme-símile em crianças. Revista da Associação Medica Brasileira, 55(2): 139–144; Paștiu AI, Matei IA, Mihalca AD, et al. (2012). Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: evidence for host-switching behaviour in ticks? Parasites & vectors, 5: 301. doi: 10.1186/1756-3305-5-301; Patrican LA. (1997). Acquisition of Lyme disease spirochetes by cofeeding Ixodes scapularis ticks. American Journal of Tropical Medicine and Hygiene, 57(5): 589–593; Peltomaa M, McHugh G and Steere AC. (2003). Persistence of the antibody response to the VlsE sixth invariant region (IR6) peptide of Borrelia burgdorferi after successful antibiotic treatment of Lyme disease. The Journal of Infectious Diseases, 187(8): 1178–1186. doi: 10.1086/374376; Peruski AH and Perusk, LF Jr. (2003). Immunological methods for detection and identification of infectious disease and biological warfare agents. Clinical and Diagnostic Laboratory Immunology, 10: 506-13. Perret J-L, Rais O and Gern L. (2004). Influence of Climate on the Proportion of Ixodes ricinus Nymphs and Adults Questing in a Tick Population. Journal of Medical Entomology 41(3): 361– 365. doi:10.1603/0022-2585-41.3.361; Persing DH, Rutledge BJ, Rys PN, et al. (1994). Target imbalance: disparity of Borrelia burgdorferi genetic material in synovial fluid from Lyme arthritis patients. Journal of Infectious Diseases, 169(3): 668–672; Petzke MM, Brooks A, Krupna MA, et al. (2009). Recognition of Borrelia burgdorferi, the Lyme disease spirochete, by TLR7 and TLR9 induces a type I IFN response by human immune cells. Journal of Immunology, 183(8): 5279–5292. doi: 10.4049/jimmunol.0901390; Picken MM, Picken RN, Han D, et al. (1997). A two year prospective study to compare culture and polymerase chain reaction amplification for the detection and diagnosis of Lyme borreliosis. Journal of Clinical Pathology, 50: 186–193; Picken MM, Picken RN, Han D, et al. (1996). Single-tube nested polymerase chain reaction assay based on Flagellin gene sequences for detection of Borrelia burgdorferi sensu lato. European Journal of Clinical Microbiology & Infectious Diseases, 15(6): 489–98; Piesman J. (1993). Standard System for Infecting Ticks (Acari: Ixodidae) with the Lyme Disease Chapter 1 State of the art 81 Spirochete, Borrelia burgdorferi. Journal of Medical Entomology, 30(1): 199–203; Piesman J and Dolan MC. (2002). Protection against lyme disease spirochete transmission provided by prompt removal of nymphal Ixodes scapularis (Acari: Ixodidae). Journal of Medical Entomology, 39(3): 509–512. Piesman J and Eisen L. (2008) Prevention of Tick-Borne Diseases. Annual Reviews of Entomology, 53: 323–43. doi: 10.1146/annurev.ento.53.103106.093429; Piesman J and Gern L. (2004). Lyme borreliosis in Europe and North America. Parasitology, 129: 191-220; Piesman J and Happ CM. (2001). The efficacy of co-feeding as a means of maintaining Borrelia burgdorferi: a North American model system. Journal of Vector Ecology, 26(2): 216–20; Poland GA. (2001). Prevention of Lyme disease: a review of the evidence. Mayo Clinic proceedings, 76(7): 713–24. doi:10.4065/76.7.713; Poland GA. (2011). Vaccines against Lyme disease: What happened and what lessons can we learn? Clinical Infectious Diseases, 52(3): 253–258. doi: 10.1093/cid/ciq116; Pollack RJ, Telford SR and Spielman A. (1993). Standardization of medium for culturing Lyme disease spirochetes. Journal of Clinical Microbiology, 31(5): 1251–5; Posey JE and Gherardini FC. (2000). Lack of a role for iron in the Lyme disease pathogen. Science, 288(5471): 1651–1653. Postic D, Assous MV, Grimont PA. (1994). Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)-rrl (23S) intergenic spacer amplicons. International Journal of Systematic Bacteriology, 44(4): 743–752; Preac Mursic V, Wanner G, Reinhardt S, et al. (1996). Formation and cultivation of borrelia burgdorferi spheroplast-L-form variants. Infection, 24(3): 218–226; Preechakasedkit P, Pinwattana K, Dungchai W. (2012). Development of a one-step immunochromatographic strip test using gold nanoparticles for the rapid detection of Salmonella typhi in human serum. Biosensors & bioelectronics, 31(1): 562–6. doi: 10.1016/j.bios.2011.10.031; Price CP. (2001). Point of care testing. BMJ, 322: 1285–1288. doi: 10.1136/bmj.322.7297.1285 Priem S, Rittig MG, Kamradt T, et al. (1997). An optimized PCR leads to rapid and highly sensitive detection of Borrelia burgdorferi in patients with Lyme borreliosis. Journal of Clinical Microbiology 35(3): 685–90; Pritt BS, Mead PS, Johnson DKH, et al. (2016). Identification of a novel pathogenic Borrelia species causing Lyme borreliosis with unusually high spirochaetaemia: a descriptive study. The Lancet Infectious Diseases, 3099(15): 1–9. doi: 10.1016/S1473-3099(15)00464-8; Qiu W-G, Bruno JF, McCaig WD, et al. (2008). Wide distribution of a high-virulence Borrelia burgdorferi clone in Europe and North America. Emerging Infectious Diseases, 14: 1097–1104. doi: 10.3201/eid1407.070880; Quesada-González D and Merkoçi A. (2015). Nanoparticle-based lateral flow biosensors. Biosensors and Bioelectronics, 73: 47–63. doi:10.1016/j.bios.2015.05.050; Radolf JD, Caimano MJ, Stevenson B et al. (2012). Of ticks, mice and men: understanding the Chapter 1 State of the art 82 dual-host lifestyle of Lyme disease spirochaetes. Nature Reviews Microbiology, 87–99. doi: 10.1038/nrmicro2714; Rahn DW. (2001). Lyme Vaccine: Issues and Controversies. Infectious Disease Clinics of North America, 15: 171-187; doi:10.1016/S0891-5520(05)70274-9; Randolph SE and Craine NG. (1995). General framework for comparative quantitative studies on transmission of tick-borne diseases using Lyme borreliosis in Europe as an example. Journal of Medical Entomology, 32(6): 765–777; Randolph SE and Storey K. (1999). Impact of microclimate on Immature Tick-Rodent Host Interactions (Acari: Ixodidae): Implications for Parasite Transmission. Journal of Medical Entomology, 36(6): 741–748; Ranka R, Bormane A, Salmina K et al. (2004). Identification of three clinically relevant Borrelia burgdorferi sensu lato genospecies by PCR-restriction fragment length polymorphism analysis of 16S-23S ribosomal DNA spacer amplicons. Journal of Clinical Microbiology, 42(4): 1444–9. doi: 10.1128/JCM.42.4.1444-1449.2004; Rauter C and Hartung T. (2005) Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: a metaanalysis. Applied and Environmental Microbiology, 71(11): 7203–16. doi: 10.1128/AEM.71.11.7203-7216.2005; Rauter C, Oehme R, Diterich I, et al. (2002). Distribution of clinically relevant Borrelia genospecies in ticks assessed by a novel, single-run, real-time PCR. Journal of Clinical Microbiology, 40(1): 36–43. doi: 10.1128/JCM.40.1.36-43.2002; Reed KD. (2002). Laboratory testing for Lyme disease: possibilities and practicalities. Journal of Clinical Microbiology, 40(2): 319–24. doi: 10.1128/JCM.40.2.319-324.2002; Richter D, Schlee DB, Allgöwer R et al. (2004). Relationships of a novel Lyme disease spirochete, Borrelia spielmani sp. nov., with its hosts in Central Europe. Applied and Environmental Microbiology, 70: 6414–6419. doi: 10.1128/AEM.70.11.6414-6419.2004; Richter D, Schröder B, Hartmann NK et al. (2013). Spatial stratification of various Lyme disease spirochetes in a Central European site. FEMS Microbiology Ecology, 83(3): 738–744. doi: 10.1111/1574-6941.12029; Rijpkema S, Nieuwenhuijs J, Franssen FFJ et al. (1994). Infection rates of Borrelia burgdorferi in different instars of lxodes ricinus ticks from the Dutch North Sea Island of Ameland. Experimental & Applied Acarology, 18: 531–542; Rijpkerna SGT, Taxelaar D, Molkenboer MCH, et al. (1997). Detection of Borrelia afzelii, B burgdorferi ss, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema migrans and acrodermatitis chronica atrophicans. Clinical Microbiology and Infection, 3: 109–116; Ririe KM, Rasmussen RP and Wittwer CT. (1997). Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical biochemistry, 245(2): 154–60; Rizzoli A, Hauffe HC, Carpi G, et al. (2011). Lyme borreliosis in Europe. Eurosurveillance, 16(27): 1–8; Rollend L, Fish D and Childs J. (2013). Transovarial transmission of Borrelia spirochetes by Ixodes scapularis: A summary of the literature and recent observations. Ticks and Tick-Borne Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 91 2. Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection Ticks are obligate parasites, considered to be second worldwide to mosquitoes as vectors of human diseases, but they are the most important vectors of disease-causing pathogens in domestic and wild animals. The important role that ticks play in maintaining and transmitting tick-borne pathogens in Portugal, reinforces the need to offer an up to date summary of the information on ticks, their biology, ecology and associations with vertebrate hosts. Also, a better knowledge of B. burgdorferi s.l. infection rate in these arthropods, mainly in the vector Ixodes ricinus, is important in order to determinate possible risk areas for human and veterinary health. Therefore, this chapter the distribution and characterization of ixodids will be addressed in nine districts of Portugal, previously selected, alongside with their infection rate by B. burgdorferi s.l. using two nested-PCR. This chapter is based on the research paper: Nunes M, Vieira ML, Lopes N, Maia C, Almeida APG. 2016. Characterization and distribution of hard-ticks in nine districts of mainland Portugal where I. ricinus presence was previously reported: Borrelia burgdorferi s.l. prevalence. (in submission) Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 93 2.1 Characterization and distribution of hard-ticks in nine districts of mainland Portugal where I. ricinus presence was previously reported: Borrelia burgdorferi s.l. prevalence Mónica Nunes1,2, Mª. Luísa Vieira1,2, Nádia Lopes1, Carla Maia2,3, A. Paulo G. Almeida2,3,4 1Unidade de Microbiologia Médica, Instituto de Higiene e Medicina Tropical, IHMT, Universidade Nova de Lisboa, UNL, Lisboa, Portugal; 2Global Health and Tropical Medicine, GHTM, IHMT, UNL; 3Unidade de Parasitologia Médica, IHMT, UNL; 4Zoonosis Research Unit, Department of Medical Virology, Faculty of Health Sciences, University of Pretoria, Pretoria, South Africa. Correspondence should be addressed to: Mónica Nunes Grupo de Leptospirose e Borreliose de Lyme, Unidade de Microbiologia Médica, Global Health and Tropical Medicine, GHTM, Instituto de Higiene e Medicina Tropical, HMT, Universidade Nova de Lisboa, UNL Rua da Junqueira, nº100 1349-008 Lisboa, Portugal Phone: +351 213652600; Fax: +351 213632105 (E-mail: [email protected]) Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 94 Abstract Several changes in spatial distribution and abundance of tick species and their associated pathogens have occurred in the last years, due to climate change, habitat modifications and globalization of human activities. Consequently, it’s increasingly important to update tick distribution, biology, ecology and association with hosts and pathogens. In Portugal, there are favorable climatic conditions to the maintenance of ticks and their pathogenic agents. An example of that are the spirochetes of B. burgdorferi s.l. complex, Lyme disease (LB) agents, whose main vector in Europe is the tick Ixodes ricinus. Although this disease is underdiagnosed and underreported, several studies have confirmed the circulation of these spirochetes in tick populations from different areas of Portugal. Thus, the aim of this study was to collect and identify ticks from hosts and vegetation, in nine districts of Portugal, previously identified as areas with both the vector and the pathogen, and to determine B. burgdorferi s.l. infection rate, contributing to update tick’s fauna and LB epidemiology. Questing ticks were collected in seven of the surveyed districts, being Rhipicephalus sanguineus the most widespread species, although, in Lisboa Ixodes ricinus immature were the most abundant species. Regarding the hosts, pets (dogs and cats), sylvatic (cervids and wild boars), and livestock (cattle, sheep and donkeys) animals were surveyed, from seven districts, and again R. sanguineus was the most widespread species, except in Lisboa and Évora districts, where I. ricinus and R. bursa were the most abundant species, respectively. Regarding B. burgdorferi s.l. infection rate, 8% and 1% of the collected ticks were positive, at vegetation and host level, respectively. Borrelia burgdorferi s.l. positive ticks were collected in Braga, Vila Real, Lisboa, Setúbal, Évora and Faro, six of the nine surveyed districts, showing that this pathogen presents a general distribution throughout the country. Changes in the distribution of ticks and their invasion into new regions were observed in this study, possibly related to changes in the landscape, climate and vegetation, to which ticks are very sensitive. Also the frequent large-scale movements of humans and their animals may be speeding up the introduction of novel tick species and their associated pathogens that can have severe consequences in human and animal health. Therefore, more studies concerning Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 95 tick distribution and behavior should be carried out in order to understand the biological mechanisms underlying successful tick invasions and adaptation to new local conditions leading to a successful establishment. Introduction Ticks (Ixodida) are obligate hematophagous arthropod ectoparasites with a worldwide distribution, and responsible for transmitting pathogens that cause diseases in humans and animals (de La Fuente & Contreras, 2015), leading to public health issues and economical losses in livestock production (Parola & Raoult, 2001). The incidence of tick-borne diseases (TBDs) is increasing worldwide, since ticks are capable of transmitting disease-causing protozoa, bacteria and viruses. For instance, more than 250 000 human cases of Lyme disease were reported in the last decade in the USA (http://www.cdc.gov/lyme/), and in Europe about 50 000 cases are reported each year in humans (Piesman and Eisen, 2008). This is due to the continuous human exploitation of environmental resources and to the increase of human outdoor activities that allow contact with ticks normally present in natural habitats (de La Fuente & Contreras, 2015). Furthermore, the expansion of tick populations due to climate changes and human interventions that affect reservoir hosts mobility and human contact with infected ticks, is a growing problem (Gray et al., 2009; Estrada-Peña et al., 2012; Otranto et al., 2015; Ostfeld & Brunner, 2015). These arthropods extend from the tropics to subarctic areas and are well adapted to living in strict and diversified habitats, seeking hosts to feed upon, digesting blood meals, and developing through different life stages to adulthood, and further reproducing (Magnarelli, 2009). Although most ticks have close relationships with vertebrate animals, some species have limited host preferences, while others have broad host ranges. Several studies have been carried out to understand tick species distribution, bio-ecological preferences and host-vector-pathogen relationships in different settings. Faunistic studies across several regions, namely the Mediterranean region, are of great importance and interest to characterize the distribution and composition of tick species affecting livestock, as a preliminary step to the knowledge of the pathogens they may transmit, and the economic Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 96 effects of these on animal production, and in public health (Papadopoulos et al., 1996; Bouattour, 1999; Estrada-Peña & Santos-Silva, 2005). Portugal, the westernmost country in continental Europe, presents a total of 92 090 km2 of land surface, 3.4 million hectares correspond to forested areas, mainly localized in the North of the Tagus river, with agroforestry and forest grazing areas localized in the South of the country (Figure 1). Figure 1 - Schematic representation of Atlantic Ocean and Mediterranean Sea influence in the Portuguese climate (A) and the Portuguese districts rate of forestation (B). (Source: de Macedo, 1997). According to Koeppen-Geiger classification, Portugal has a temperate continental climate, Type C, checking the subtype Cs (a temperate climate with dry summer) and the following varieties: Csa, temperate climate with warm summer and dry in the interior regions of the Douro Valley (part of the district of Bragança), as well as in South regions of the mountain system Montejunto-Estrela (except on the west coast of Alentejo and Algarve); Csb, temperate climate with dry and mild summer, in almost all regions of the Northern mountain system Montejunto-Estrela and the regions of the west coast of Alentejo and Algarve. In a small region of Alentejo, in the district of Beja, is Arid Climate - Type B Subtype BS (steppe climate), BSK variety (cold steppe climate of mid-latitude). Atlantic Climate Mediterranean Climate AtlanticMediterranean Climate A Atlantic Ocean Spain Km B Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 97 The ecological, climatic and environmental conditions of Portugal are favorable to the development and maintenance of several hard-tick species that can transmit a large variety of pathogenic agents able of causing diseases in humans and animals, with an emergent risk in the country. For example, the tick Ixodes ricinus, competent vector of B. burgdorferi s.l. agents, is present in several regions within the country with different climate types and land cover (Núncio et al., 1993; Baptista et al., 2004; Estrada-Peña & Santos-Silva, 2005; Baptista, 2006). In this study nine districts representative of North, Lisboa Tagus Valley (LTV), and South regions of mainland Portugal were selected for tick collections, based on data from previous studies, where I. ricinus presence was registered (Baptista, 2006; Santos-Silva et al., 2011). Also, the collected ticks were surveyed for B. burgdorferi s.l. DNA, to further characterize the infection rate with this pathogenic agent across the country. Material and Methods Characterization and location of sampling sites A total of nine districts were selected: Braga, Vila Real, Aveiro, Guarda, (considered North region for comparison purposes), Santarém, Lisboa (considered Lisboa and Tagus ValleyLTV), and Évora, Setúbal and Faro (considered South region), (Figure 2). Ticks were collected from the vegetation and from several hosts present in the chosen areas. Figure 2 – Map of mainland Portugal showing the districts where tick collections were performed (in green). Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 98 In the different districts, collections of questing ticks in the vegetation was carried out in several habitats (Figure 3), and more emphasis was given to the forest areas with biotic factors (hosts) and abiotic factors (vegetation and habitat types), humidity, temperature, elevation and distance to waterline) favorable to the development of Ixodes ricinus. The characterization of each district is presented in Table 1. Figure 3 – Examples of habitats where ticks were collected: A – Amares (Braga); B – Mondim de Basto (Vila Real); C – Dunas de São Jacinto (Aveiro); D – Guarda; E – Santarem; F – Tapada Nacional de Mafra (Lisboa); G –Grandola (Setúbal); H – Alcaçovas (Évora); I – Serra de Monchique (Faro). A B C D E F G H I Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 105 Figure 4 – Questing tick species average density for each collected species by season, year and district. (Dm – Dermacentor marginatus, Dr – Dermacentor reticulatus, Hp – Haemaphysalis punctata, Hi – Haemaphysalis inermis, Hyl – Hyalomma lusitanicum, Hym – Hyalomma marginatum, Ir – Ixodes ricinus, Ih – Ixodes hexagonus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bursa). Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 106 Table 2 – Total questing tick species by stage collected in each district. Ticks collected from the vegetation Stage Districts Tick species Larvae Nymphs Females Males TOTAL Braga Dermacentor marginatus 26 15 41 Dermacentor reticulatus 2 3 5 Haemaphysalis punctata 1 2 3 6 Hyalomma marginatum 1 0 1 Ixodes ricinus 4 0 4 Ixodes hexagonus 3 0 3 Rhipicephalus sanguineus 77 73 150 Total 1 115 94 210 Vila Real Dermacentor marginatus 3 1 4 Ixodes ricinus 1 7 8 16 Rhipicephalus bursa 1 1 Rhipicephalus sanguineus 2 65 44 111 Total 3 75 54 132 Aveiro Ixodes ricinus 3 3 Rhipicephalus sanguineus 141 95 236 Total 141 98 239 Lisboa Dermacentor marginatus 7 1 8 Haemaphysalis inermis 1 26 16 43 Haemaphysalis punctata 259 76 22 39 396 Hyalomma lusitanicum 8 21 107 56 192 Hyalomma marginatum 1 35 36 Ixodes ricinus 490 1011 43 60 1604 Rhipicephalus boophilus 1 1 2 4 Rhipicephalus bursa 38 33 71 Rhipicephalus sanguineus 271 1 6 2 280 Total 1030 1109 251 244 2634 Setúbal Dermacentor marginatus 65 35 100 Haemaphysalis punctata 1 1 Ixodes ricinus 12 7 19 Rhipicephalus sanguineus 165 130 295 Total 242 173 415 Évora Rhipicephalus sanguineus 83 64 147 Total 83 64 147 Faro Dermacentor marginatus 13 6 19 Haemaphysalis punctata 1 1 Ixodes ricinus 17 18 35 Rhipicephalus bursa 1 1 Rhipicephalus sanguineus 28 5 200 185 418 Total 28 5 231 210 474 TOTAL 1058 1118 1138 937 4251 Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 107 Questing Ticks in the North region In the North region (Figure 5), R. sanguineus was the most prevalent species, during the two years of collections, particularly in the spring. The species D. reticulatus was only collected in this region (Braga district) during summer of 2012 and spring of 2013 and 2014, being always collected in the same site, which was a hunting area with wild boars nearby. Also, I. hexagonus was only collected in Vila Real during the 2012 autumn in a site with high elevation, situated in the natural park of Alvão. Regarding Aveiro district the collections were only made once in the spring of 2013 near the seaside at Dunas de São Jacinto, where R. sanguineus was the most abundant species. Figure 5 – Questing tick species average density and standard deviation in the North region during the two years of collections, in spring, summer and autumn seasons. (Dm – Dermacentor marginatus, Dr – Dermacentor reticulatus, Hp – Haemaphysalis punctata, Hym – Hyalomma marginatum, Ir – Ixodes ricinus, Ih – Ixodes hexagonus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bursa). Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 108 Questing ticks in Lisboa and Tagus Valley (LTV) region In this region the majority of the collections were made in TNM, where I. ricinus immature stages were the most collected species and stage in the Springs of 2012, 2013 and 2014, while in summer immature stages of H. punctata and R. sanguineus where obtained (Figure 6). Adult ticks from I. ricinus, H. punctata and Hy. lusitanicum were also collected but with a low density during the Autumn of each year. In TNM during the coldest days of Autumn H. inermis, also known as the winter tick, was collected. Curiously, no adult R. sanguineus was ever collected from the vegetation in this site, although the immature stages were present. Figure 6 – Questing tick species average density and standard deviation in Lisboa and Tagus Valley region during the two years of collections, in spring, summer and autumn seasons. (Dm – Dermacentor marginatus, Dr – Dermacentor reticulatus, Hp – Haemaphysalis punctata, Hi – Haemaphysalis inermis, Hyl – Hyalomma lusitanicum, Hym – Hyalomma marginatum, Ir – Ixodes ricinus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bursa). Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 109 Questing ticks in the South region In the South region the collections were carried out only during Spring (Figure 7), although a collection was made in the Setúbal district in the Summer of 2013, but no ticks were collected, since the land had been plowed. Regarding tick species R. sanguineus was the most abundant species in the three districts, although I. ricinus and D. marginatus were also collected but with a lower density, particularly in one of the collection sites in Setúbal district which was a hunting area with wild boars. Figure 7 – Questing tick species average density and standard deviation in South region during the two years of collections, in spring and summer seasons. (Dm – Dermacentor marginatus, Dr – Dermacentor reticulatus, Hp – Haemaphysalis punctata, Ir – Ixodes ricinus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bursa). Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 110 Bioecological analysis of ticks collected from the vegetation Total tick density, and the most abundant species were analysed according to environmental variables regarding the collecting sites. Total tick densities were significantly different according to: 1) region of the collections, among LTV and North region, being higher in LTV (KW = 20.614, P < 0.0001); 2) season, higher in Spring than Summer (KW = 8.716, P = 0.01); 3) elevation, being higher below 100m than above 200m (KW = 20.302, P < 0.0001); 4) the three types of vegetation although the P value was near 0.05 (KW = 6.047, P < 0.049), resulting in no differences in pairwise comparisons. No differences were obtained for the habitats. Total tick density showed a significant negative correlation with the temperature (Spearman’s’s rhô = -0.462, P = 0.001) and the distance to waterline (Spearman’s’s rhô = - 0.479, P = 0.001), but no correlation with relative atmospheric humidity. Identical analysis was performed for the five more representative tick species in the three regions, namely D. marginatus, H. punctata, Hy. lusitanicum, I. ricinus and R. sanguineus. Concerning the regions, H. punctata, Hy. lusitanicum and I. ricinus, were more abundant in LTV (KW = 17.543, P < 0.0001), in comparison to the North and the South regions (Figure 8), while R. sanguineus was higher in South than LTV (KW = 14.579, P = 0.001). No differences were obtained for D. marginatus (P > 0.05). Regarding the seasons, I. ricinus was the species with the higher differences between seasons, namely it was more abundant in autumn than in either spring or summer (KW = 11.767, P = 0.003), (Figure 9); R. sanguineus was more abundant in Spring than in autumn (KW = 22.254, P < 0.0001); H. punctata in autumn than in Spring (KW = 8.981, P = 0.01); and D. marginatus in spring than in summer (KW = 9.046, P = 0.01). No differences were obtained for Hy. lusitanicum (P > 0.05). Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 111 Figure 8 – Box-plot analysis depicting the distribution of (A) H. punctata, (B) Hy. lusitanicum and (C) I. ricinus within each region. Y axis represent ticks/min-collector. A B C Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 112 Figure 9 – Box-plot analysis depicting the densities of I. ricinus in each of the surveyed seasons. Y axis represent ticks/min-collector. For the elevation I. ricinus, Hy. lusitanicum and D. marginatus were more abundant in elevations below 100m than in 100-200m or above 200m (KW = 11.173, P = 0.004), while H. punctata was more abudant in elevations between 100-200m (KW = 26.965, P < 0.0001). No differences were obtained for R. sanguineus (P > 0.05). Concerning the vegetation only I. ricinus and H. punctata reveled to be more abundant in shrubland vegetation than in pasture and forest vegetations (KW = 15.643, P < 0.0001). In relastionship to the habitat, I. ricinus was more abundant in hunting & forest areas than in pasture & agriculture and peri-urban & public parks (KW = 7.000, P = 0.03); and for H. punctata, differences were obtained between the habitats (KW = 7.858, P = 0.02), however, the pairwise comparisions showed the same distribution in the three habitats. Finally H. puntacta and I. ricinus had a negative correlation with the temperature (Spearman’s rhô = -0.327, P = 0.02; Spearman’s’s rhô = -0.475, P = 0.001, respectively) and Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 113 the distance to the waterline (Spearman’s rhô = -0.629, P < 0.0001; Spearman’s rhô = -0.562, P < 0.0001), although I. ricinus presented a positive correlation with the humidity (Spearman’s rhô = 0.334, P = 0.02), and Hy. lusitanicum showed a negative correlation with the distance to waterline (Spearman’s’s rhô = -0.343, P = 0.02). Ticks collected from hosts A total of 2171 ticks were removed from seven different host species (n=112), distributed along seven districts from North to South Portugal, during the two-year period. Although the majority of ticks were collected from sylvatic hosts, namely cervids, the “pets” hosts were the most surveyed, especially dogs. Tick distribution according to stage was: 1 larvae (0.04%), 36 nymphs (1.7%), 1256 females (57.9%) and 878 males (40.4%), (Table 3). Five tick genera were identified, including nine species, being R. sanguineus the most collected and widespread tick (858, 39.5%), followed by I. ricinus (743, 34.2%), R. bursa (278, 12.8%), H. punctata (148, 6.8%), Hy. marginatum (85, 3.9%), Hy. lusitanicum (35, 1.6%), D. marginatus (19, 0.9%), I. hexagonus (3, 0.1%) and H. inermis (2, 0.1%) (Table 3). Concerning the distribution of ticks in the several districts, the majority of ticks were obtained from Lisboa district (1053, 48.5%), followed by Évora (350, 16.1%), Faro (341, 15.7%), Setúbal (213, 9.8%), Vila Real (115, 5.3%), Guarda (65, 3%) and Santarém (34, 1.6%), (Table 3). Densities of the several tick species collected in each year, district and season are represented in Figure 10, being R. sanguineus the most abundant species collected in all districts, except in Lisboa, which was I. ricinus species. For a more accurate analysis the distribution of tick species was analyzed by regions, being the graphics in different scales for a better comprehension of tick densities. Chapter 2 Distribution and bio-ecological characterization of ixodids in selected areas of Portugal: Borrelia burgdorferi s.l. infection 114 Figure 10 – Tick average density per host, for each collected species by season, year and district. Dm – Dermacentor marginatus, Hp – Haemaphysalis punctata, Hi – Haemaphysalis inermis, Hyl – Hyalomma lusitanicum, Hym – Hyalomma marginatum, Ir – Ixodes ricinus, Ih – Ixodes hexagonus, Rbo – Rhipicephalus boophilus, Rs – Rhipicephalus sanguineus, Rb – Rhipicephalus bursa. Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 217 Duplex real-time PCR reactions were carried out in a total volume of 20 μl containing 1× SensiFAST™ (Bioline), 0.3 μM of each primer (F_Bbsl, R_Bbsl; F_18S rRNA, r_18S rRNA or F_β-actin, R_ β-actin), 0.25 μM of each TaqMan probe (P_Bbsl; P_18S rRNA or P_ βactin), DNase free water (Bioline) and 2 μl of the extracted DNA template. The thermal cycling conditions were: 1 cycle at 95 °C for 1 min, followed by 40 cycles at 95 °C for 10 s and 60 °C for 45 s. The tetraplex real-time PCR reactions used 1× SensiFAST™ (Bioline), 0.3 μM of F_Bspp, R_Bspp primers, 0.25 μM of P_Bafz, P_Bgar, P_Bbss and 0.15 μM of P_Blus TaqMan probes, DNase free water (Bioline), and 2 µl of the extracted DNA template, in a total volume of 20 μl. The thermal cycling conditions were: 1 cycle at 95 °C for 5 min, followed by 45 cycles at 95 °C for 10 s and 60 °C for 30 s. All positive samples were retested for confirmation. Non-template negative controls (with PCR grade water) were included in each run to rule out the possibility of cross-contamination. Thermal cycling, fluorescent data collection, and data analysis were performed in a 7500 Fast real-time PCR System (Applied Biosystems), according to the manufacturer’s instructions. Analytical specificity and sensitivity To investigate whether the probes and respective flanking primers detect their specific targets, DNA from B. burgdorferi s.l., from other spirochetes (Leptospira interrogans and Treponema paliddum) and from others tick-borne pathogens (Theileria sp. and Babesia sp.), were used as templates in real time PCR. To estimate the detection threshold of the assays (analytical sensitivity), individually and as duplex and tetraplex real-time PCR, a standard curve was constructed using 10-fold serial dilutions of DNA extracted from B. valaisiana, B. bavariensis, B. burgdorferi s.s., B. afzelii, B. garinii and B. lusitaniae strains. The DNA dilutions for B. burgdorferi s.l. corresponded to 10 – 106 genome equivalents (GE), according to the National Reference Centre for Borrelia (NRZ units: 50fg/µl=10GE). For each strain and concentration the PCR assays were performed in triplicate. The end-point corresponded to the dilution at which the assay could detect the respective DNA targets in all three replicates. Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 218 To obtain an indication if the real-time PCR assays can be used with clinical samples, i.e., material of patients infected by B. burgdorferi s.l., sera were mixed with a 10-fold serial dilution of B. burgdorferi s.l. DNA (mixture of B. burgdorferi s.s., B. afzelii, B. garinii and B. lusitaniae) ranging from 10 to 106 NRZ units of GE. Borrelia DNA was re-extracted from this mixture using Gentra Puregene commercial kit from QIAGEN®, according to the manufacturer’s protocol. These patient samples experimentally inoculated were screened accordingly with the real time PCR assay. B. burgdorferi s.l. reference strains B. burgdorferi s.s. (B31), B. afzelii (PGau), B. garinii (PBi) isolated from Japan, B. lusitaniae (PoHL1), B. bavariensis (PBi) and B. valaisiana (VS116) fresh cultures from the laboratory of Leptospirosis and Lyme Borreliosis Group from Instituto de Higiene e Medicina Tropical (IHMT)/UNL, were cultured in BSK-H medium, incubated at 34ºC and observed with a darkfield microscope every other day. When the cultures archived the logarithmic phase, the bacteria were harvested by centrifugation at a speed of 14000g, and genomic DNA extraction was performed with Gentra Puregene commercial kit from QIAGEN®, according to the manufacturer’s protocol. After extraction the DNA concentration and purity from each B. burgdorferi s.l. genospecies were estimated by measuring the absorbance at 260 nm (A260) and by A260/A280 and A260/A230 ratios, using a NanoDrop 1000 spectrophotometer (NanoDropTM). The DNA concentration was adjusted to 106 GE for the six B. burgdorferi s.l. genospecies and dilutions from 10 to 106 GE were prepared. Evaluation of real-time PCR with field-collected ticks and clinical samples For the evaluation of the two-step multiplex real-time PCR identification assay, a panel of DNA samples, previously positive or negative for B. burgdorferi s.l., were obtained from (i) sera (n= 20) and cerebrospinal fluid (CSF) (n= 10) samples from human patients available at Leptospirosis and Lyme Borreliosis Group (from 2012 to 2015) and (ii) questing nymphs and adults of Ixodes ricinus species (n=50) collected across Portugal in previous studies (Nunes et Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 219 al., 2015; Nunes et al., 2016). The presence of B. burgdorferi s.l. DNA was formerly evaluated by two nested-PCR targeting the genes encoding the 5S-23S intergenic spacer region (Rijpkema et al., 1995) and the flaB gene (Wodecka et al., 2010). Nested-PCR amplification products from tick samples, were also previously sequenced for the identification of B. burgdorferi s.l. genospecies. Statistical analysis For measuring the agreement between the results of the routinely performed molecular identification of clinical and tick samples, and the real-time PCR assay, kappa coefficient was used. This coefficient, with confidence intervals, was determined with BioEstat 5.0. Results Analytical specificity and sensitivity The two real-time PCR assays only detected B. burgdorferi s.l. DNA and did not produce any non-specific amplification products in repeated experiments. In addition, there were no false positives due to cross-reaction between fluorophore signals within each assay. For the evaluation of the sensitivity, the assay was tested using DNA extracted from B. burgdorferi s.l. cultures as template. In the first step, dilutions from 10 to 106 GE of B. burgdorferi s.l. genospecies DNA were tested one by one and in a mixture with the six genospecies DNA, along with the internal controls; in the second step dilutions from 10 to 106 GE of DNA from B. burgdorferi s.s., B. afzelii, B. garinii and B. lusitaniae were tested individually and in tetraplex (Figure 3). The results of the analytical sensitivity were as follows: The first duplex reaction could detect the presence of B. burgdorferi s.l. until the dilution containing 50 fg/µL = 10 GE of DNA template, regardless the genospecies tested. The standard curve for DNA mixture showed a correlation coefficient (R2) of 0.98 and a slope of – 3.2, indicating a good efficiency (106%) of PCR amplification (Figure 2). Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 220 Figure 2 – Illustration of the duplex real-time PCR amplification curve obtained for each DNA concentration. (A) B. burgdorferi s.l. DNA dilutions from 10 to 106 GE; (B) respective linear relationship between the logarithm of the starting concentration of DNA and the amplification Ct values; Neg – real-time PCR negative control using DNase free water as template; Ct - interception in the minimum threshold (10 GE); RFU - Relative Fluorescence Units. For the tetraplex reaction targeting the flaB gene of the four genospecies of B. burgdorferi s.l., when each probe was individually tested, the detection limit was 50 fg/µl = 10 GE for B. afzelii (Ct ≈ 37), B. garinii (Ct ≈ 37) and B. lusitaniae (Ct ≈ 37) and 0.5pg/µl = 102 GE for B. burgdorferi s.s. (Ct ≈ 36), (Figure 3 A,B,C and D); when tested in tetraplex the detection limit was 0.5pg/µl for B. afzelii (Ct ≈ 32), B. garinii (Ct ≈ 35), B. lusitaniae (Ct ≈ 35) and B. burgdorferi s.s. (Ct ≈ 35), (Figure 3E). The standard curves for the tetraplex reaction showed correlation coefficients (R2) ranging from 0.929 to 0.997 and slopes of -2.296 to -3.377 (Figure 3F). 106 105 104 102 10 Neg B. burgdorferi s.l. A B 103 Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 221 Figure 3 - Illustration of the tetraplex real-time PCR amplification curves obtained for each probe individually (A, B, C and D) and in tetraplex (E) for each DNA concentration; and respective linear relationship between the logarithm of the starting concentration of DNA and the amplification Ct values (F). A – real-time PCR for B. afzelii (dilutions from 10 – 106 GE); B – real-time PCR for B. garinii (dilutions from 106 – 10 GE); C – real-time PCR for B. lusitaniae (dilutions from 106 – 10 GE); D – real-time PCR for B. burgdorferi s.s. (dilutions from 106 – 102 GE); E – tetraplex real-time PCR for the dilution of 106 GE; Neg – real-time PCR negative control using DNase free water as template; Ct - interception in the minimum threshold; RFU - Relative Fluorescence Units. Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 222 Experimental inoculated serum samples Screening of dilution series of DNA purified from patient’s sera samples spiked with B. burgdorferi s.l. DNA, revealed no differences in the sensitivity of the duplex assay for the used material, since it was possible to obtained amplification signal until the dilution of 10 GE with a Ct value of 35. Regarding the tetraplex assay, the four genospecies tested did not show major differences in the sensitivity, since it was possible to obtain amplification signal until to dilution of 102 GE with Ct values of: 32 for B. afzelii and B. burgdorferi s.s., 35 to B. garinii, and 34 for B. lusitaniae. Evaluation of real-time PCR with field-collected ticks and clinical samples From the 50 tick samples tested, 24 (48%) previously positive for the two nested-PCR’s, were also positive for the duplex real-time PCR, however, for the tetraplex real-time PCR just 23 (46%, test k= 0.96) samples were positive (Table 2). The genospecies of B. burgdorferi s.l. identified in this assay, were in agreement with the previously sequencing results (Table 2). Concerning the clinical samples tested (n=30), from the 11 samples (40%) previously positive for the two nested-PCR, 11 (37%,), were also positive for the duplex real-time PCR, but only three (10%), were positive for the tetraplex assay, where the genospecies obtained were identified as: B. afzelii; B. garinii and B. lusitaniae (Table 2) and the K value was 0.93 and 0.32 for the duplex and tetraplex real-time PCR, respectively. Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 223 Table 2 – Comparison of duplex and tetraplex real-time PCR’s positive samples with results from previous sequencing for tick samples. I. ricinus samples (n=50) Samples (Nested-PCR’s positive or negative) Sequencing results Duplex real – time PCR Tetraplex real-time PCR 1 B. afzelii 1 positive (Ct  17) 1 B. afzelii (Ct  21) 3 B. burgdorferi s.s. 3 positives 2 B. burgdorferi s.s. (Ct  33; Ct  36) 1 negative 8 B. garinii 8 positives (Ct  17 to Ct  19) 8 B. garinii (Ct  16 to Ct  33) 12 B. lusitaniae 12 positives (Ct  18 to Ct  26) 12 B. lusitaniae (Ct  20 to Ct  35) 26 negatives ------- 26 negatives 26 negatives Clinical samples (n= 30) Samples (Nested-PCR’s positive or negative) Sequencing results Duplex real – time PCR Tetraplex real-time PCR 5 sera 6 CSF (positive) ------- ------- 11 positives (Ct  17 to Ct  36) 1 serum as B. afzelii (Ct  29) 1 serum as B. garinii (Ct  30) 1 serum as B. lusitaniae (Ct  32) 8 negatives (2 sera; 6 CSF) 15 sera; 4 CSF (negatives) ------- 19 negatives 19 negatives Discussion According to European Center for disease Prevention and Control (ECDC) the diagnosis of Borrelia spp. infection should be based mainly on clinical symptoms, the patient’s medical history and an evaluation of the risk of exposure to infected ticks, along with diagnostic tests including the assessment of antibodies to Borrelia spp. class IgM and IgG (Bil-Lula et al., 2015). However, the serologic tests based in antibodies search have some problems concerning the large amount of false negative results, probably due to the “window period” in which IgM antibodies are not yet produced. Consequently, molecular approaches as real-time PCR assays would be helpful in testing patients early in the disease, before an antibody response develops, and in patients presenting non classic symptoms. It is also known that different Borrelia genospecies are associated with diverse biological origins (B. afzelii with small mammals, B. garinii with birds and B. lusitaniae with lizards) Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 224 (Kurtenbach et al., 2002; Mannelli et al., 2012) , different clinical manifestations (B. garinii with neurological manifestation, B. afzelii with skin manifestations) (van Dam et al., 1993), severity of disease (B. burgdorferi s.s. is more severe than B. afzelii) (Jungnick et al., 2015), and geographic distribution of species (B. afzelii, B. garinii and B. lusitaniae in Europe and B. burgdorferi s.s. in North America) (van Dam et al., 1993; Stanek et al., 2002; Stanek & Strle, 2003) Consequently, having the capacity of identifying the Borrelia genospecies involved in an infection, whether in the vector or in the host, is becoming increasingly important since it also provides information on the ecological characteristics of individual species, allows a better prognosis and treatment strategy, and is needed for genetic analysis (Mukhacheva & Kovalev, 2014). Quantitative real-time PCR for direct molecular detection and quantification of pathogens is a widely used technology nowadays for clinical application, being also valuable for confirming a diagnosis based on less clear manifestations of LD or for investigating controversial disease syndromes attributed to infection with B. burgdorferi s.l.. Several real time PCR assays for the detection of B. burgdorferi s.l. have been reported previously, however, few have included an internal control (Germer et al., 1999; Gooskens et al., 2006), nor has a quantitative tetraplex PCR study for four of the most prevalent Borrelia genospecies in Europe been published to date. Therefore, in this study, we present a combined multiplex TaqMan real-time PCR strategy to infer the presence of B. burgdorferi s.l. genospecies in clinical and vector samples. In the first step we evaluated if a sample is infected with Borrelia burgdorferi s.l. by targeting the flaB gene. The flaB gene encodes a 41-kDa flagellin protein and is located on a single-copy in the linear chromosome (Wang et al., 1999). In this step the inclusion of an internal control allowed successful DNA extraction to be monitored. The second step identifies simultaneously four of the most prevalent genospecies of B. burgdorferi s.l. in Europe, namely B. afzelii, B. garinii, B. burgdorferi s.s. and B. lusitaniae. Although it targets the same gene as the previous step, the primers were designed in a different more variable region, resulting in a fragment with sufficient polymorphisms that allowed to design the four specific probes for each genospecies. In the duplex real-time PCR, DNA from each B. burgdorferi s.l. genospecies, available at Leptospirosis and Lyme Borreliosis laboratory, IHMT/UNL, was tested individually and in a Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 225 mixture containing the same DNA concentration of the six genospecies (B. afzelii, B. garinii, B. lusitaniae, B. burgdorferi s.s., B. valaisiana and B. bavariensis). Whether the DNA is tested individually or simultaneously, all genospecies showed very good reactivity, since no differences were obtained regarding the sensitivity (10 GE). Similar results were obtained for B. burgdorferi s.l. in previously studies, whose sensitivity’s range from 1 to 10 GE (Gooskens et al., 2006; O’Rourke et al., 2013; Venczel et al., 2015). Furthermore, the assay is highly specific, as it failed to detect the flaB gene of other microbial species. For the tetraplex assay the sensitivity of the assay decreases from 10 GE to 102 GE for B. garinii, B. afzelii and B. lusitaniae but remains the same for B. burgdorferi s.s., when the four probes are tested simultaneously. This loss of sensitivity is normal when passing from a singleplex to a multiplex real-time PCR, and is related with the competition between the targets, since we are using the same pair of primers for the four targets, being the differences only found in the probes. When the assay was applied to field tick samples, the duplex step presented a very good performance, since it gave the same results regarding the positive and negative samples obtained previously by the two nested-PCR targeting the flaB gene and the IGS region. Also for the tetraplex assay only one of the positive tick samples yielded a negative result, probably due to the detection limit of the assay, since it is lower than the detection limit of the duplex assay. Moreover, the B. burgdorferi s.l. genospecies identified by the tetraplex were 100% equal as those obtained from the sequencing results. The assays sensitivity is crucial when analyzing tick samples, since they have the capacity of harboring complex microbial populations (Tveten & Sjåstad, 2011). The diverse bacterial content in ticks could be responsible for a low amount of Borrelia spirochetes, due to the natural size of the ticks, and also to the environmental competition between bacterial species (Hibbing et al., 2010). Regarding the testing of clinical samples (sera and CSF) with the duplex assay, a 100% agreement was achieved with the results previously obtained with the nested-PCR’s protocols. However, in the tetraplex assay only three samples were positive, and identified as B. afzelii, B. garinii and B. lusitaniae; the remainder eight nested-PCR-positive samples were negative with this assay, including all the CSF samples tested. This fact is related with the loss of sensitivity when the four probes are used simultaneously. However, previously studies showed Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 226 that Borrelia counts in CSF are very low, around 20 bacteria per 100µL CSF lysed ( Nocton et al., 1996; Schwaiger et al., 2001; Gooskens et al., 2006; Bil-Lula et al., 2015), which is below the tetraplex sensitivity, but in the same baseline of the duplex assay developed in our study. Numerous PCR assays have been described for the detection of B. burgdorferi s.l. DNA in CSF, but the sensitivities varied from 12% to 100% (Keller et al., 1992; Lebech & Hansen, 1992; Eiffert et al., 1995; Nocton et al., 1996; Lebech et al., 2000; Schwaiger et al., 2001). These results are difficult to interpret because of the use of small sample sizes, the selection differences of clinical specimens, the testing of poorly defined patient categories, and the frequent lack of an internal control to monitor PCR inhibition. In our case, both negative and positive controls and an internal control (mammals-β-actin gene) were included in each run to determine whether or not inhibitory substances were present in the patient’s clinical sample, or whether false positive results could appear during amplifications. Thus the possibility of low test sensitivity due to the presence of PCR inhibitors in CSF samples is excluded. However, for a better evaluation of this combined multiplex TaqMan real-time PCR, further investigation using other clinical samples is required. In conclusion, this two-step multiplex TaqMan real-time PCR assay targeting the flaB locus, proved to be an efficient method when screening for Borrelia infection in tick samples, and a promising tool for early diagnostic purposes on clinical samples. Moreover, the ability to detect four of the most prevalent B. burgdorferi s.l. genospecies in Europe, in a single-run is a timesaving factor, and cost reduction when compared with the conventional PCR and sequencing methods. Acknowledgments This work was supported by Ministry of Education and Science of Portugal, Fundação para a Ciência e a Tecnologia, through a PhD grant (SFRH/BD/78325/2011), and Funds from GHTM – UID/Multi/04413/2013. Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 233 amplification products can be observed by naked eye. Therefore, this technique may have its role as a tool in low-resource laboratories for the diagnosis of LD in an early stage of infection. Introduction Borrelia burgdorferi sensu lato (B. burgdorferi s.l.) complex is a group of several genospecies of spirochetes responsible for Lyme disease (LD), the world's fastest growing vector-borne zoonotic disease with cases reported in over 60 countries and endemic foci in North America, Europe, and Asia (WHO, 2013). This complex is represented by 20 genospecies, several of which can cause LD in humans. These genospecies vary in their geographic distribution, host specificity and ability to cause disease in humans. Clinically the different pathogenic Borrelia spp. are of interest as they have been associated with different disease symptoms which may be observed in the late stages of the condition (Margos et al., 2011). In Europe LD is mostly associated to one of three genospecies: B. burgdorferi s.s., B. afzelii and B. garinii (Assous et al., 1993; van Dam et al., 1993; Richter et al., 2004). B burgdorferi s.s. is normally associated with arthritis, B. garinii with neurological effects (musculoskeletal and nervous systems), and B. afzelii with skin complications, like Acrodermatitis Chronica Atrophicans (ACA) (van Dam et al., 1993). The laboratory diagnosis is based mainly on serological and molecular biology methods. Serological methods includes screening tests such as enzyme-linked immunosorbent assays (ELISA), indirect immunofluorescence assays (IFA), and confirmation tests such as Western blot (Robertson et al., 2000; Steere et al., 2008; Hinterseher et al., 2012; Liu et al., 2013). Regarding the molecular approaches, several PCR-based methods have been developed to detect B. burgdorferi s.l. DNA, such as conventional PCR, nested PCR, and real-time PCR based in specific gene detection, for several markers such as, ospA, rrs, rrf-rrl intergenic spacer, groEL, recA, hbb, fla, and others (Picken et al., 1996; Priem et al., 1997; AgueroRosenfeld et al., 2005; Kondrusik et al., 2007; Wang et al., 2010; Wodecka et al., 2010; Wodecka 2011; de Leeuw et al., 2014). Nevertheless, most of these molecular approaches have several disadvantages: time-consuming, variable sensitivity and requires specific Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 234 expensive instruments for the amplification reaction, which is difficult in low incoming countries. Therefore, rapid, simple, low-cost, and effective diagnostic methods are urgently required. Loop-mediated isothermal amplification (LAMP) was first reported in 2000 by Notomi (Notomi, 2000), and since then the number of studies performed for the detection of a wide range of viruses, parasites and bacteria, using this technology is increasing every year (Pooja et al., 2014; Fallahi et al., 2015; Gao et al., 2015; Jung et al., 2015; Wang et al., 2015a). The principle of this technology relies on an autocycling strand displacement DNA synthesis by a DNA polymerase with high strand displacement activity (Bst), superseding thermal denaturation steps (Notomi, 2000). The research and development efforts on LAMP technology, in the last years, have been focused on its practical application in clinical settings including the improvement of existing assays. The most distinctive characteristics of LAMP are its simplicity and its rapidity, representing its major advantages over the PCR-based technique (Mori et al., 2013; Notomi et al., 2015). Because this technology is an isothermal method, LAMP can be performed just by using an inexpensive heater like a block heater or a water bath, allowing, this way, for LAMP to be conducted in any time and any setting. Moreover, besides the conventional methods to analyze LAMP products, such as agarose gel electrophoresis, visual inspection of the increase turbidity, or colour change of the reaction mixture (Mori et al., 2001), this technology can be attached to other devices such as lateralflow devices (LFDs) for the detection of labels incorporated into the amplification products. LFD tests have a number of advantages for use in the field, and specific LFD immunoassays have been particularly successful in areas of point-of-care and on-site testing (Assadollahi et al., 2009; Baumert & Tran, 2015; Sajid et al., 2015). There are LFD generic test commercially available, like chromatographic strips that can detect biotin-labelled DNA fragments hybridized with complementary FITC-labelled probes. FITC is detected in the strips by the formation of complexes with gold-conjugated anti-FITC antibodies. The aim of this study was to develop and evaluate two duplex LAMP assays (dLAMP) based on flaB gene, combined with a LFD technology, to implement a rapid, simple and sensitive Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 235 assay for the identification of four of the most prevalent genospecies of B. burgdorferi s.l. complex (B. afzelii, B. garinii, B. burgdorferi sensu stricto (s.s.) and B. lusitaniae). Material and methods Borrelia burgdorferi s.l. strains B. burgdorferi s.s. (B31), B. afzelii (PGau), B. garinii (PBi), and B. lusitaniae (PoHL1), fresh cultures available at the Group of Leptospirosis and Lyme Borreliosis (GLBL) from Instituto de Higiene e Medicina Tropical (IHMT)/UNL, were incubated for one week in BSK-H medium at 34ºC. The growth was detected by examining the culture using a dark-field microscope and collection of the spirochetes was done in the log-phase (approximately 108 – 109 bacteria/ml). DNA extraction Total genomic DNA extraction from B. burgdorferi s.l. cultures was performed with Gentra Puregene commercial kit from QIAGEN®, according to the manufacturer’s protocol. After extraction the DNA concentration and purity were estimated by measuring the absorbance at 260 nm (A260) and by A260⁄A280 and A260/A230 ratios, using a NanoDrop 1000 spectrophotometer (NanoDrop™). The DNA concentration was adjusted to 106 genome equivalents (GE)  5 ng/µl of DNA, according to the National Reference Centre for Borrelia (NRZ units), for the four B. burgdorferi s.l. genospecies and dilutions from 10 to 106 GE were prepared. Design of LAMP primers A multiple alignment of flagellin (flaB) sequences retrieved from GenBank was created in Mega 6 (Kumar et al., 2008), and a Flagellin sequence consensus for each genospecies was selected: B. burgdorferi s.s. (accession number X15661.1), B. garinii (accession number DQ650333.1), B. afzelii (accession number DQ016619.1), and B. lusitaniae (accession Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 236 number D82856.1). The primer sets for each LAMP were designed using PrimerExplorer V4 software (http:// primerexplorer.jp/elamp4.0.0/index.html). This primer set included two outer primers (F3 and B3) and two inner primers (FIP and BIP) for each Borrelia genospecies. To reduce the reaction times, we also designed two loop primers (LF and LB) for each species (Figure 1). The primer sequences are shown in Table 1. All primers were synthesized and HPLC-purified by StabVida Lda, Portugal. Table 1 – LAMP primers designed targeting the four B. burgdorferi s.l. genospecies. Genospecies Primers Sequence B. afzelii Forward Inner Primer (FIPBa) 5’-TTCATCTTGATTTGCTCCCACATGAACACACCAGCATCACTTTC-3’ Backward Inner Primer (BIPBa) 5’-AGCTAATGTTGCAAATCTTTTTGCTCTTCTTCTTGAGCACCCTC-3’ Forward 3 (F3Ba) 5’-AGCTGAAGAGCTTGGAATG-3’ Backward 3 (B3Ba) 5’-TTGAGTAGGTGCTGTAGC-3’ Loop Forward (LFBa) 5’-AGTCCAAGAAGCTTGAGATCCT-3’ Loop Backward (LBBa) 5’-GGAGCTCAAGCTGCTCAGGC-3’ B. burgdorferi s.s. Forward Inner Primer (FIPBb) 5’- GGTTGCTCCAACATGAACTCTTAAAACACACCAGCATCACTTTC - 3’ Backward Inner Primer (BIPBb) 5’-GCAGCTAATGTTGCAAATCTTTTCTGAACACCCTCTTGAACCG-3’ Forward 3 (F3Bb) 5’-AGCTGAAGAGCTTGGAATG-3’ Backward 3 (B3Bb) 5’-GTTGAGCTCCTTCCTGTT-3’ Loop Forward (LFBb) 5’-CCAAGACGCTTGAGACCCT-3’ Loop Backward (LBBb) 5´-GAGGGAGCTCAAACTGCTCAGG-3´ B. garinii Forward Inner Primer (FIPBg) 5’-TCACCAGAGAATAGATTTGCAACATGAGCAAATCAAGATGAAGCG-3’ Backward Inner Primer (BIPBg) 5’-ACCTGTTCAAGAAGGAGCTCAAATTAACTCCACCCTGAGAA-3’ Forward 3 (F3Bg) 5’-TCTTGGACCTTAAGAGTTCA-3’ Backward 3 (B3Bg) 5’-GATGTATTAGCGTCAACTGTG-3’ Loop Forward (LFBg) 5’-TTAAGGTCCAAGAAGCTTGAGATC-3’ Loop Backward (LBBg) 5’-TCTGGTGAAGGAGCTCAGGCT-3’ B. lusitaniae Forward Inner Primer (FIPBl) 5’-ATCTTGATTTGCTCCCACATGAACTCACCAGCATCACTTTCAGG-3’ Backward Inner Primer (BIPBl) 5’-ATGTTGCAAATCTGTTTTCTGGT - GGCTCCTTCTTGTTGAACAC-3’ Forward 3 (F3Bl) 5’-AGCTTGGAATGCAACCTG-3’ Backward 3 (B3Bl) 5’-CTTGAGAAGGCGCTGTAG-3’ Loop Forward (LFBl) 5’-CTCAAAGTCCAAGAAGCTTGAGAT-3’ Loop Backward (LBBl) 5’-GGGAGCTCAAGTTGCTCAGACTG-3’ Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 237 Figure 1 – Partial sequence of flaB gene for B. lusitaniae, and location of the complementary regions used to design LAMP primers [F3, B3, FIP (F1c-F2), BIP (B1c-B2)], including loop primers (LF, LB). Arrows indicate the direction of extension. Optimization of LAMP reaction Based on the initial conditions of the LAMP reaction adopted from Notomi et al., (2000), three Mg2+ concentrations (2 mM, 8mM, and 10 mM), three Bst DNA polymerase concentrations (2.0 U, 4.0 U, and 8.0 U), two concentration ratios between inner to outer primers (4:1 and 8:1) and two betaine concentrations (0.80 M and 1.0M) were tested in 10 µL reaction mixtures, while the concentrations of all the other components remained constant. The temperature of LAMP reaction was also optimized by testing four temperatures (66, 67, 68 and 69ºC), and also two incubation periods (45 and 60 min). These conditions were first tested only with B. lusitaniae LAMP assay, and after optimization the final Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 238 conditions were applied to the remaining three LAMP assays targeting B. afzelii, B. garinii and B. burgdorferi s.s.. Analytical specificity and sensitivity of LAMP assays The specificity of the LAMP assays for detecting B. burgdorferi s.l. DNA was determined using genomic DNA of B. burgdorferi s.s. (B31), B. afzelii (PGau), B. garinii (PBi), and B. lusitaniae (PoHL1) reference strains, and DNA from other microorganisms namely other spirochetes like Leptospira interrogans (Serovar Icterohaemorrhagiae) and Treponema pallidum; and other tick-borne pathogens like Theileria sp. and Babesia sp.. The sensitivity of LAMP reaction was determined by using 10-fold serial dilutions of DNA extracted from B. burgdorferi s.l. cultures, corresponding to 10 – 106 GE. Nested-PCR protocols and real-time PCR The serial dilutions of B. burgdorferi s.l. cultures were also used to evaluate the sensitivity of two nested-PCR protocols and one real-time PCR, in order to compare them with the sensitivity of LAMP assays. One of the nested-PCR targeted the intergenic spacer region (IGS), located between the 5S and 23S rRNA, using the 23SN1 and 23SC1 external primers (which amplify a 320 bp DNA fragment), and the 23SN2 and 5SC inner primers (which amplify a 280 bp DNA fragment), as described by Rijpkema et al., 1995. The second nested-PCR protocol used, targeted the flagellin gene (flaB) (Wodecka et al., 2010). This included a first amplification reaction based on the use of outer primers 123f and 905r (which amplify a 774 bp DNA fragment), with a second amplification step using the inner primers 220f and 824r (yielding an amplification product of 605 bp). PCR protocols were done in a separate vertical laminar flow bench using a different set of micropipettes, for PCR use-only as well filtered tips and sterilized material to ensure a contamination-free environment. B. garinii DNA was used as positive control and ultrapure water as negative control. Products were detected by electrophoresis in 1.5% Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 239 agarose gels stained with GreenSafe Premium (NZYTech), and visualized under UV light, using a Dolphin-1D Gel Image Analysis Software (Wealtec®) equipment. Regarding the real-time PCR protocol, it consisted in a duplex reaction targeting the flaB gene for B.burgdorferi s.l. and the internal control 18S rDNA for hard-tick samples. This real-time PCR protocol was developed and optimized by our laboratory (data submitted). The PCR reaction was carried out in a total volume of 20 μl containing 1× SensiFAST™ (Bioline), 0.3 μM of each primer (F_Bbsl, R_Bbsl), 0.25 μM of each TaqMan probe (P_Bbsl), DNase free water (Bioline) and 2 μl of the extracted DNA template. The thermal cycling conditions were: 1 cycle at 95 °C for 1 min, followed by 40 cycles at 95 °C for 10 s and 60 °C for 45 s. Thermal cycling, fluorescent data collection, and data analysis were performed in a 7500 Fast real-time PCR System (Applied Biosystems), according to the manufacturer’s instructions. LAMP product detection LAMP reaction was performed in a final volume of 25 µl, containing 1× LAMP buffer (BioLabs®), 8 mM MgSO4, 1 M Betaine (Sigma®), 0.4 mM dNTP, 1.6 µM of FIP and BIP primers, 0.2 µM of F3 and B3 primers, 0.4 µM of LF and LB primers, 8 U Bst 2.0 WarmStart® DNA polymerase (New England BioLabs® Inc., USA) and 2.5 µl of extracted DNA. The reaction mixture was incubated in an automatic thermocycler (Mycylcer, BioRad) at 68ºC for 45 min, and then inactivated at 80 ºC for 5 min. LAMP products were detected by: i) assessment of turbidity by the naked eye resulting from the magnesium pyrophosphate (Mg2P2O7), precipitation (Figure 2A); ii) color change at naked eye and under UV by adding 1.0 μl of 1/10-diluted original SYBR Green I (Invitrogen™), where samples that turned yellowish green were considered positive, while those remained orange were assumed to be negative (Figure 2B1 and B2); iii) by UV transillumination (Dolphin-Doc Plus Gel Image system, Wealtec® equipment) in a 2.5% agarose gel following electrophoresis in Tris-Acetate-EDTA (TAE) buffer stained with 2μl of GreenSafe Premium (NZYTech) (Figure 2C). Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 240 Figure 2 – LAMP products visualization, by naked eye through the observation of the turbidity (A), 1 and 2 - positive samples, 3 - negative control; by intercalating dyes like SYBR-Green under natural light (B1) and UV light (B2), 1 and 2 - positive samples, 3 negative control; by electrophoresis in a 2.5% agarose gel (C), 1,2 and 3 – positive samples, 4 – negative control. Lateral Flow Device strips For detection of LAMP products by LFD, the adequate FITC-labeled probe should be added to the LAMP products. The protocol include a first step of hybridization at 65 ºC for 5 min, and then 8 µl of the hybridized product is added to 100 µl assay buffer in a new tube. An LFD strip is dipped into the mixture for 2 min. Commercial universal LFD devices for the detection of labelled LAMP products were purchased from Milenia Biotec (HybriDetect 2T) and used according to the instructions of the manufacturer. Statistical analysis The results were analyzed by the Chi-square test using BioEstat 5.0. A difference was considered statistically significant at P < 0.05. Results Optimization of LAMP reaction When the concentration of Mg2+ was evaluated, we observed that together with the increase of the temperature from 66 to 69ºC, the best concentration was 8 mM, since that at 2 mM the A B2 B1 C 1 2 3 1 2 3 1 2 3 1 2 3 4 Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 241 detection limit of the reaction decreased and at 10 mM LAMP reaction was inhibited. Regarding the ratio of inner to outer primers more intense ladder-like bands were obtained at the concentration ratio 8:1 (Figure 3A), also the amplification improved obviously as the dosage of Bst DNA polymerase increased from 2.0 U to 8.0 U, as evidenced by brighter bands on agarose gels (Figure 3B). From the temperature and time of reaction variation, the detection limit was greater with higher temperatures (68ºC) and less time of reaction (45 min), since no unspecific results appeared (Figure 3C). Therefore the above results demonstrated that the optimized LAMP reaction consisted of using Mg2+ at a concentration of 8 mM, the ratio of inner to outer primers at 8:1, and the concentration of Bst DNA polymerase at 8.0 U. Also, LAMP assay was easy to conduct, although some measures concerning the prevention of contamination were necessary. Precautions such as changing gloves between every LAMP assay and different work areas for different parts of the experiment were taken into account. Figure 3 – LAMP assay optimization by testing: different FIP/BIP and F3/B3 concentrations ratio (A); different concentrations of Bst polymerase (B); and different temperatures of reaction (C). A B C 4x 8x 2U 4U 8U 68oC 66 oC 65 oC Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 242 Analytical specificity of LAMP assay LAMP reaction specificity was evaluated and results showed that only the four B. burgdorferi s.l. genospecies produced a typical ladder of multiple bands on the agarose gel, while other DNA samples or negative control did not produce such bands. However, when each LAMP set was tested with DNA from the respective B. burgdorferi s.l. genospecies, the specificity obtained was not the expected, since each of the four sets amplified not only the respective B. burgdorferi s.l. genospecies but also one or more of the others B. burgdorferi s.l. genospecies. For example LAMP set for B. garinii amplified B. garinii DNA but also B. afzelii DNA, and LAMP set for B. lusitaniae amplified B. lusitaniae DNA but also the others three genospecies DNA, B. garinii, B. burgdorferi s.s. and B. afzelii. Therefore each LAMP set was specific for B. burgdorferi s.l. genera but not for each genospecies. This lack of specificity led us to continue the work with only the B. lusitaniae LAMP primers set since it was able to amplify DNA templates of all four genospecies. This way we decided to develop a LAMP assay targeting the four of the most prevalent species of B. burgdorferi s.l. complex. Analytical sensitivity Since there was no specificity of LAMP sets for each genospecies, the analytical sensitivity of LAMP reaction was evaluated only with the B. lusitaniae primers set, since it amplified the four most important genospecies. The results showed that the detection limit was 0.5 ng/µl  104 GE for B. afzelii, 2.5 ng/µl  103 GE for B. garinii, 1 ng/µl  103 GE for B. burgdorferi s.s. and 2.5 pg/µl  102 GE for B. lusitaniae (Figure 4). Regarding the nested-PCR protocol for flaB gene, the detection limit was 5 pg/µl 103 GE for B. afzelii, 0.5 pg/µl  102 GE for B. lusitaniae, and 0.05 pg/µl  10 GE for B. burgdorferi s.s and B. garinii. The nested-PCR protocol for IGS, presented a detection limit of 5 pg/µL 103 GE for B. afzelii, B. burgdorferi s.s and B. garinii, and 0.5 pg/µl 102 GE for B. lusitaniae. These results suggest that LAMP sensitivity was similar to that of the IGS targeted nested-PCR protocol, except for B. afzelii which was lower. Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 249 Assous MV, Postic D, Paul G, Névot P and Baranton G. (1993). Western blot analysis of sera from Lyme borreliosis patients according to the genomic species of the Borrelia strains used as antigens. European Journal of Clinical Microbiology & Infectious diseases, 12(4): 261–8; Baumert JL and Tran DH. (2015). Lateral flow devices for detecting allergens in food. Handbook of Food Allergen Detection and Control, 219–228. doi:10.1533/9781782420217.2.219; de Leeuw BH, Maraha B, Hollemans L, et al. (2014). Evaluation of Borrelia real time PCR DNA targeting OspA, FlaB and 5S–23S IGS and Borrelia 16S rRNA RT-qPCR. Journal of Microbiological Methods, 107: 41–46. doi: 10.1016/j.mimet.2014.09.001; Fallahi S, Mazar ZA, Ghasemian M, et al. (2015). Challenging loop-mediated isothermal amplification (LAMP) technique for molecular detection of Toxoplasma gondii. Asian Pacific Journal of Tropical Medicine, 8(5): 366–372. doi: 10.1016/S1995-7645(14)60345-X; Gao C, Ding D, Wang J, et al. (2015). Development of a LAMP assay for detection of Leishmania infantum infection in dogs using conjunctival swab samples. Parasites & Vectors, 8: 370. doi: 10.1186/s13071-015-0991-2; Hinterseher I, Gäbel G, Corvinus F, et al. (2012). Presence of Borrelia burgdorferi sensu lato antibodies in the serum of patients with abdominal aortic aneurysms. European Journal of Clinical Microbiology & Infectious Diseases , 31(5): 781–9. doi: 10.1007/s10096-011-1375-y; Jung JH, Park BH, Oh SJ, et al. (2015). Integrated centrifugal reverse transcriptase loop-mediated isothermal amplification microdevice for influenza A virus detection. Biosensors and Bioelectronics, 68: 218–224. doi: 10.1039/c4lc01033g; Kondrusik M, Grygorczuk S, Skotarczak B, et al. (2007). Molecular and serological diagnosis of Borrelia burgdorferi infection among patients with diagnosed Erythema migrans. Annals of Agricultural and Environmental Medicine : AAEM, 14(2): 209–213; Kumar S, Nei M, Dudley J, et al. (2008). MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Briefings in Bioinformatics, 9(4): 299–306. doi: 10.1093/bib/bbn017; Liu ZY, Hao Q, Hou XX, et al. (2013). A study of the technique of western blot for diagnosis of lyme disease caused by Borrelia afzelii in China. Biomedical and Environmental Sciences : BES, 26(3): 190–200. doi: 10.3967/0895-3988.2013.03.006; Margos G, Vollmer SA, Ogden NH et al. (2011). Population genetics, taxonomy, phylogeny and evolution of Borrelia burgdorferi sensu lato. Infection, Genetics and Evolution, 11(7): 1545–1563. doi: 10.1016/j.meegid.2011.07.022; Mori Y, Hirano T and Notomi T. (2006). Sequence specific visual detection of LAMP reactions by addition of cationic polymers. BMC biotechnology, 6: 3. doi: 10.1186/1472-6750-6-3; Mori Y, Kanda H and Notomi T. (2013). Loop-mediated isothermal amplification (LAMP): recent progress in research and development. Journal of Infection and Chemotherapy, 19(3): 404–411. doi: 10.1007/s10156-013-0590-0; Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 250 Mori Y, Nagamine K, Tomita N, et al. (2001). Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochemical and Biophysical Research Communications, 289(1): 150–154. doi:10.1006/bbrc.2001.5921; Norte AC, Alves da Silva A, Alves J, et al. (2015). The importance of lizards and small mammals as reservoirs for Borrelia lusitaniae in Portugal. Environmental Microbiology Reports, 7(2): 188–193. doi: 10.1111/1758-2229.12218; Notomi T. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12): 63e–63; Notomi T, Mori Y, Tomita N, et al. (2015). Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. Journal of Microbiology, 53(1): 1–5. doi: 10-1007/s12275015-4656-9; Notomi T, Okayama H, Masubuchi H, et al. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12): E63. doi: 10.1093/nar/28.12.e63; Picken MM, Picken RN, Han D, et al. (1996). Single-tube nested polymerase chain reaction assay based on Flagellin gene sequences for detection of Borrelia burgdorferi sensu lato. European Journal of Clinical mMicrobiology & Infectious Diseases, 15(6): 489–98; Pooja S, Sudesh D, Poonam K, et al. (2014). Loop-mediated isothermal amplification (LAMP) based detection of bacteria: A Review. African Journal of Biotechnology. 13(19): 1920–1928. doi: 10.1007/s00253-014-5531-z; Priem S, Rittig MG, Kamradt T, et al. (1997). An optimized PCR leads to rapid and highly sensitive detection of Borrelia burgdorferi in patients with Lyme borreliosis. Journal of Clinical Microbiology, 35(3): 685–90; Rauter C, Oehme R, Diterich I, et al. (2002). Distribution of clinically relevant Borrelia genospecies in ticks assessed by a novel, single-run, real-time PCR. Journal of Clinical Microbiology. 40(1): 36– 43. doi: 10.1128/JCM.40.1.36-43.2002; Richter D, Schlee DB, Allgöwer R, et al. (2004). Relationships of a novel Lyme disease spirochete, Borrelia spielmani sp. nov., with its hosts in Central Europe. Applied and Environmental Microbiology, 70: 6414–6419. doi: 10.1128/AEM.70.11.6414-6419.2004; Rijpkema SGT, Molkenboer MJCH, Schouls LM, et al. (1995). Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. Journal of Clinical Microbiology, 33(12): 3091–3095; Robertson J, Guy E, Andrews N, et al. (2000). A European multicenter study of immunoblotting in serodiagnosis of Lyme borreliosis. Journal of Clinical Microbiology, 38(6): 2097–2102; Sajid M, Kawde AN and Daud M. (2015). Designs, formats and applications of lateral flow assay: A literature review. Journal of Saudi Chemical Society, 19(6): 689–705. doi:10.1016/j.jscs.2014.09.001; Chapter 5 Development of new molecular tools for the identification of Borrelia burgdorferi s.l. genospecies to improve Lyme disease diagnosis 251 Shih CM and Chao LL. (2002). Genetic analysis of the outer surface protein C gene of Lyme disease spirochaetes (Borrelia burgdorferi sensu lato) isolated from rodents in Taiwan. Journal of Medical Microbiology, 51(4): 318–325. doi: 10.1099/0022-1317-51-4-318; Steere AC, McHugh G, Damle N, et al. (2008). Prospective study of serologic tests for Lyme disease. Clinical Infectious Diseases, 47(2): 188–195. doi:10.1086/589242; Stunzner D, Hubalek Z, Halouzka J, et al. (1998). Prevalence of Borrelia burgdorferi s.I. in Ixodes ricinus ticks from Styria (Austria) and species identification by PCR-RFLP analysis. Zentralblatt für Bakteriologie, 288(4): 471–478; Van Dam AP, Kuiper H, Vos K, et al. (1993). Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clinical Infectious Diseases, 17(4): 708–717. doi: 10.1093/clinids/17.4.708; Wang DG, Wang Y, Xiao F, et al. (2015a). A comparison of in-house real-time LAMP assays with a commercial assay for the detection of pathogenic bacteria. Molecules, 20(6): 9487–9495. doi: 10.3390/molecules20069487; Wang DG, Brewster JD, Paul M et al. (2015b). Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification. Molecules, 20(4): 6048–6059. doi: 10.3390/molecules20046048; Wang G, Aguero-Rosenfeld A, Wormser G et al. (2010). Detection of Borrelia burgdorferi. Samuels D and Radolf J, editors. In: Borrelia. Molecular Biology, Host Interaction, and Pathogenesis. Caister Academic Press, 279–298; Wodecka B. (2011). flaB gene as a molecular marker for distinct identification of Borrelia species in environmental samples by the PCR-restriction fragment length polymorphism method. Applied and Environmental Microbiology, 77(19): 7088–7092. doi: 10.1128/AEM.05437-11; Wodecka B, Leońska A and Skotarczak B. (2010). A comparative analysis of molecular markers for the detection and identification of Borrelia spirochaetes in Ixodes ricinus. Journal of Medical Microbiology, 59: 309–314. doi: 10.1099/jmm.0.013508-0; Yang J, Guan G, Niu Q, et al. (2013). Development and application of a loop-mediated isothermal amplification assay for rapid detection of Borrelia burgdorferi s. l. in ticks. Transboundary and Emerging Diseases, 60(3): 238–44. doi: 10.1111/j.1865-1682.2012.01335.x; Zhang LL, Hou XX, Geng Z, et al. (2015). Combination of Loop-Mediated Isothermal Amplification Assay and Nested PCR for Detection of Borrelia burgdorferi sensu lato in Human Serum Samples. Biomedical and Environmental Sciences : BES, 28(4): 312–5. doi: 10.3967/bes2015.044; Zhou D, Guo J, Xu L, et al. (2014). Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane. Scientific Reports, 4: 4912. Doi: 10-1038/srep04912; Chapter 6 Concluding remarks and perspectives Chapter 6 Concluding remarks and perspectives 255 6. Concluding remarks and perspectives Lyme disease is increasing rapidly in many parts of the world and is the most commonly occurring vector-borne disease in Europe and the USA. In Portugal, despite LD has been identified twenty five years ago, this zoonosis still remains underdiagnosed and underreported, being often assigned by our physicians as a pathology only present in USA. Moreover a gold standard test with standardized diagnostic criteria for LD diagnosis, is not yet establish, existing a variety of direct and indirect approaches, most of them used incorrectly and inadequate to the evolution stage of the disease. Thus, the studies developed in the present thesis aimed to contribute to:  a bio-ecological characterization of the ixodofauna in nine districts across mainland Portugal, where the presence of I. ricinus ticks were previously reported, and to determinate B. burgdorferi s.l. infection rate in the collected ticks;  a better knowledge of the eco-epidemiology of B. burgdorferi s.l. genospecies and Relapsing Fever Borrelia at the vector and animal hosts level;  a more improved molecular diagnosis of LD, by the development and evaluation of two molecular tools namely a TaqMan real-time PCR algorithm and a isothermal amplification protocol for the identification of four of the most prevalent genospecies of B. burgdorferi s.l. in Portugal. In the captures carried out in the nine districts, several tick species were possible to collect from the vegetation (n = 4251) as well as from the hosts (n = 2171). The most widespread tick species was R. sanguineus regarding the vegetation and the animal hosts, although we could not cover all Portuguese districts, an possible expansion of tick species into new regions was noticed namely D. reticulatus in Braga district and I. ricinus in Aveiro district, since there are not records of the presence of these species in the two districts. This fact may have numerous consequences, including modifications in their ecological characteristics, impacts on the dynamic of local host populations, and also important implications when considering the tick-borne pathogens that could affect humans and other animal species. Also Chapter 6 Concluding remarks and perspectives 256 B. burgdorferi s.l. infection rate was firstly determined by two nested-PCR targeting the flaB gene and the intergenic space region 5S-23S, being I. ricinus nymphs the more infected stage, although, other tick species were also infected by these pathogenic agents. The positive ticks were sequenced and the tick samples that were not identified as B. burgdorferi s.l. species, were subjected to two other PCR protocols targeting the glpQ gene, and the 16S rDNA gene. The sequencing results revealed that B. lusitaniae was the most prevalent species in I. ricinus tick from Vila-Real, Lisboa, Setúbal and Faro districts. Moreover, B. garinii, B. burgdorferi s.s., B. valaisiana and B. afzelii DNA were also identified in several ticks species rather than I. ricinus, namely D. marginatus from Braga district, R. sanguineus from Braga, Vila-Real, and Évora districts and Hy. lusitanicum and H. punctata from Lisboa district. These results confirm previous reports indicating a countrywide distribution of B. burgdorferi s.l. genospecies in questing ticks, being B. lusitaniae the most prevalent species at the vector level. Unexpectedly, B. miyamotoi DNA was identified for the first time in the country, in a questing I. ricinus nymph from Lisboa district, although no human cases have been identified so far in the country, this species has been associated to human disease in others countries from Europe. Despite this species belongs to Relapsing Fever Borrelia group, whose spirochetes are usually transmitted by soft-body ticks, B. miyamotoi has been found in hardbody ticks from America, Europe and Asia continents, mainly in Ixodes genus, revealing an extensive geographic distribution. Therefore, further studies involving more collections in other districts are needed, to better understand the possible spread of B. miyamotoi in Portugal, contributing to the determination of the human risk of exposure to the vector and the bacteria. Additionally, DNA from two possible new Relapsing Fever like Borrelia species were also identified, one in five pools of questing larvae and one questing nymph of H. punctata tick from Lisboa district, and the other in two questing R. sanguineus females from Braga and Évora districts. By phylogenetic analysis of 16S rRNA, flaB and glpQ sequences, these two novel species form two independent clusters placed in a larger subgroup of Relapsing Fever Borrelia that included B. theileri, B. lonestari and a number of unclassified spirochetes. Due Chapter 6 Concluding remarks and perspectives 257 to the small number of positive samples it is not clear if these bacteria are restricted to tick species or to the area where they have been found, therefore isolation of these spirochetes in vitro, their characterization and the role in human and veterinary disease, will be the focus in a future research, associated to a more widespread collection of ticks across the country. Concerning the ticks collected from the hosts, it was possible to identify DNA from several pathogens, namely Anaplasma spp., Babesia spp., B. burgdorferi s.l., Cercopithifilaria spp., Hepatozoon spp., and Ricketsia spp., in ticks collected from dogs and cats that belonged to Guarda, Lisboa, Setúbal and Faro districts. Ri. massiliae DNA was amplified for the first time in ticks collected from cats, although there is no evidence that it can cause illness or that the animal can play a role in the transmission of this bacterium to humans. Also, Cercopithifilaria spp. was detected for the first time in a R. sanguineus collected from a dog. Regarding DNA from B. burgdorferi s.l., it was possible to identify it in only one tick sample from R. sanguineus species collected from a dog in Setúbal district. This study was the first in the country that revealed the presence of protozoa and nematodes with veterinary medical importance, in ticks collected from domestic animals, suggesting a risk of emergence of these tick-borne diseases in domestic animals and in humans. Consequently, more studies on these and other tick-borne agents should be performed in more districts across the country, to better understand its epidemiological and clinical importance. The studies regarding the research of several tick-borne pathogens in biological samples collected from several wildlife hosts, revealed for the first time the presence of Anaplasma spp. and Theileria spp. DNA, among red deer, fallow deer and wild boars in central/southern Portugal, however the ability of Anaplasma platys, the species identified in red deer and wild boars, to cause disease in these animals has not been established yet. Also, B. afzelii DNA, was identified by the first time in serum samples from wild boars from Trás-os-Montes region, indicating that the wild boar hunting dogs may act as a link between the wild and the domestic Borrelia transmission cycle, by carrying ticks into the hunter’s households, exposing them to a higher risk of tick-borne diseases. These findings point to the importance of wildlife hosts in maintaining several tick-borne pathogens, representing a risk to veterinary and human health, since the interaction of Chapter 6 Concluding remarks and perspectives 258 different pathogens within the vertebrate host might lead to increased susceptibility to other infections, or to modifications of the pathogenesis of each agent, resulting in high risks to wildlife and human health. Therefore, further epidemiological studies concerning Borrelia, Anaplasma and Theileria species, infecting wild ungulates, are required for a proper infection risk assessment across the country. This approach is important to develop future strategies of prevention and disease control rooted in a multidisciplinary approach that encompasses both human and animal health. For biological samples collected from domestic animals such as dogs and cats from the southern region of Portugal, DNA from several feline and canine vector-borne diseases agents were identified. Feline samples were positive for Leishmania spp., Hepatozoon spp., Babesia spp., Anaplasma spp./Ehrlichia spp., Bartonella spp., and B. burgdorferi s.l., while the canine samples were positive for Anaplasma spp./Ehrlichia spp., B. burgdorferi s.l., Hepatozoon spp, and Leishmania infantum. The identification of feline and canine vectorborne diseases agents in domestic animals from southern Portugal, some of them of zoonotic concern, reinforces the importance to alert the veterinary authorities for the risk of transmission of these vector-borne agents to other vertebrate hosts, including humans. The use of ectoparasiticides against arthropods and education and awareness of the population must be done, to prevent and avoid the dissemination of these pathogens to other hosts. Regarding the studies concerning the development and optimization of two molecular techniques for the identification of four of the most prevalent genospecies of B. burgdorferi s.l. in Portugal, the two-step multiplex TaqMan real-time PCR assay targeting the flaB locus, proved to be an efficient method when screening for Borrelia infection in tick samples, and a promising tool for early diagnostic purposes on clinical samples. Moreover, the ability to detect four of the most prevalent B. burgdorferi s.l. genospecies in Europe, in a single-run is a time-saving factor, besides the cost reduction when compared with the conventional PCR and sequencing methods. Concerning the LAMP technique some problems occurred during its optimization, since the designed primers were not specific for each B. burgdorferi s.l. genospecies, but only for the complex, and also the presence of unspecific amplifications at the negative controls level. For a better result, this technique will be enhanced in the future,