Pa hogen and Ci cadian Con olled 1 (PCC1) P o ein Is
Ancho ed o he Plasma Memb ane and In e ac s wi h
Subuni 5 o COP9 Signalosome in
A abidopsis
Rica do Mi
¤
, Jose
´Leo
´n*
Ins i u o de Biologı
´a Molecula y Celula de Plan as, Consejo Supe io de In es igaciones Cien ı
´ icas-Uni e sidad Poli e
´cnica de Valencia, Valencia, Spain
Abs ac
The Pa hogen and Ci cadian Con olled 1 (PCC1) gene, p e iously iden i ied and u he cha ac e ized as in ol ed in de ense
o pa hogens and s ess-induced lowe ing, codes o an 81-amino acid p o ein wi h a cys eine- ich C- e minal domain. This
domain is essen ial o homodime iza ion and ancho ing o he plasma memb ane. T ansgenic plan s wi h he ß-
glucu onidase (GUS) epo e gene unde he con ol o 1.1 kb p omo e sequence o PCC1 gene display a dual pa e n o
exp ession. A ea ly pos -ge mina ion, PCC1 is exp essed only in he oo ascula u e and in he s oma a gua d cells o
co yledons. Du ing he ansi ion om ege a i e o ep oduc i e de elopmen , PCC1 is s ongly exp essed in he ascula
issue o pe ioles and basal pa o he lea , and i u he sp eads o he whole limb in ully expanded lea es. This
de elopmen al pa e n o exp ession oge he wi h he la e lowe ing pheno ype o long-day g own RNA in e e ence
(iPCC1) plan s wi h educed PCC1 exp ession poin ed o a egula o y ole o PCC1 in he pho ope iod-dependen lowe ing
pa hway. iPCC1 plan s a e de ec i e in ligh pe cep ion and signaling bu a e no impai ed in he unc ion o he co e CO-FT
module o he pho ope iod-dependen pa hway. The egula o y e ec exe ed by PCC1 on he ansi ion o lowe ing as
well as on o he epo ed pheno ypes migh be explained by a mechanism in ol ing he in e ac ion wi h he subuni 5 o
he COP9 signalosome (CSN).
Ci a ion: Mi R, Leo
´n J (2014) Pa hogen and Ci cadian Con olled 1 (PCC1) P o ein Is Ancho ed o he Plasma Memb ane and In e ac s wi h Subuni 5 o COP9
Signalosome in A abidopsis. PLoS ONE 9(1): e87216. doi:10.1371/jou nal.pone.0087216
Edi o : Keqiang Wu, Na ional Taiwan Uni e si y, Taiwan
Recei ed Augus 27, 2013; Accep ed Decembe 25, 2013; Published Janua y 27, 2014
Copy igh : ß2014 Mi , Leo
´n. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which pe mi s un es ic ed
use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed.
Funding: This wo k was unded by g an s BIO2008-00839, BIO2011-27526 and CSD2007-0057 om Minis e io de Ciencia e Inno acio
´n o Spain o J.L. A
ellowship/con ac o he FPU p og am o he Minis e io de Educacio
´n y Ciencia (Spain) unded R.M. wo k. The unde s had no ole in s udy design, da a
collec ion and analysis, decision o publish, o p epa a ion o he manusc ip .
Compe ing In e es s: The au ho s ha e decla ed ha no compe ing in e es s exis .
* E-mail: [email p o ec ed]s
¤ Cu en add ess: Depa men o Bo any and Plan Sciences and Cen e o Plan Cell Biology, Uni e si y o Cali o nia, Ri e side, Cali o nia, Uni ed S a es o
Ame ica
In oduc ion
The Pa hogen and Ci cadian Con olled 1 (PCC1) gene in A abidopsis
was o iginally iden i ied as a Pseudomonas sy ingae-induced gene wi h
a ci cadian con olled pa e n o exp ession [1]. Fu he wo k
e ealed PCC1 as a salicylic acid (SA)-induced gene wi h a
po en ial unc ion in con olling lowe ing ime unde UV-C ligh
s ess condi ions and also unde non-s essed condi ions [2]. Based
on bioin o ma ic p edic ions, PCC1 has been cha ac e ized as one
o he so-called Cys eine- ich T ansmemb ane (CYSTM) domain-
con aining amily o p o eins [3]. Since plan s wi h educed PCC1
exp ession by means o an RNAi app oach (iPCC1 ansgenic
lines) a e la e lowe ing [2] and PCC1 gene exp ession is po en ially
con olled by he ci cadian clock [1], i seems likely ha PCC1 is
connec ed o ligh signaling. In plan s, de elopmen om seed
ge mina ion o he ep oduc i e s age is igh ly con olled by ligh .
Ligh pe cep ion and downs eam signaling unc ionally in e ac s
wi h di e en ho mone signaling pa hways in con olling mos o
he de elopmen al ansi ions [4]. Gibbe ellins (GAs) a e key
ho mones in many ligh -d i en ansi ions [5] including seed
ge mina ion [6], hypoco yl elonga ion du ing sko omo phogenesis
[7,8] and lowe ing ime [9]. The con ol exe ed by he combined
s imuli o ligh and GAs on di e se de elopmen al p ocesses is
based on mul iple egula o y le els om gene ansc ip ion [10] o
pos - ansc ip ional [11] and pos - ansla ional [12] p ocesses. In
he model plan A abidopsis haliana, ansc ip ion ac o s o he
bHLH amily a e key ansc ip ional egula o s in con olling he
elonga ion o hypoco yls in close connec ion wi h ep esso
p o eins o he GA- ela ed DELLA amily [7,8]. I is also well
documen ed ha DELLA p o eins a e subs a es o he pos -
ansla ional modi ica ion based on ubiqui ina ion o lysine
esidues media ed by he E3 ubiqui in ligase SCF
SLY1
complex
[13,14]. The ubiqui ina ing ac i i y o he SCF complexes is
dependen on he unc ion o hei ou componen s (RBX1, Skp1-
like, Cullin and F-box-p o eins). Mo eo e , cullin mus be pos -
ansla ionally modi ied by binding he RUB/NEDD8 ubiqui in-
like p o ein o SCF complexes o be assembled and ully ac i e
[15]. This ubiqui ina ion machine y is nega i ely con olled by he
unc ion o an eigh -subuni p o ein complex so-called COP9
signalosome (CSN), which has RUB isopep idase ac i i y ha
emo es RUB modi ica ion om cullin p o eins [16]. The
de ubyla ion eac ion is media ed by he subuni CSN5, a zinc
me allop o ease, al hough de ec i e unc ion o any o he subuni s
make CSN unable in de ubyla ion [17] and cause se e e
de elopmen al [18] and de ense esponses [19].
PLOS ONE | www.plosone.o g 1 Janua y 2014 | Volume 9 | Issue 1 | e87216
He e we p esen mul iple lines o expe imen al e idence o he
plasma memb ane localiza ion o PCC1 p o ein and i s homo-
dime iza ion. We ound ha he cys eine- ich C- e minus is
esponsible o bo h, ancho ing o he plasma memb ane and
dime iza ion. PCC1 gene displays a changeable pa e n o
exp ession h oughou de elopmen , which is consis en wi h
po en ial egula o y oles in bo h de elopmen and de ense.
Besides, PCC1 in e ac s wi h subuni s 5a and 5b o CSN a he
plasma memb ane, which could explain he wide ange o al e ed
pheno ypes obse ed in plan s wi h al e ed PCC1 ansc ip le els.
Ma e ials and Me hods
Plan Ma e ial and G ow h Condi ions
A abidopsis haliana seeds o wild ype Col-0, pho o ecep o
mu an s phyA,phyB (kindly dona ed by Miguel Bla´zquez, IBMCP,
Valencia, Spain), c y1,c y2 and c y1c y2 (kindly dona ed by Jose
Ja illo, CBGP, Mad id, Spain), co-10 mu an s and dexame asone-
induced o e exp ession lines oxCO-GR (kindly dona ed by
Fede ico Val e de, IBVF, Se illa, Spain), o ansgenic lines
exp essing RNAi cons uc s o PCC1 gene p e iously desc ibed
[2] we e su ace s e ilized wi h 30% bleach and 0.01% Tween 20,
washed ex ensi ely wi h miliQ s e ile wa e , and sown in
Mu ashige and Skoog medium supplemen ed wi h 0.8% aga
and 1% suc ose. A e 3 d o s a i ica ion a 4uC on Pe i MS-
con aining pla es, seeds we e ans e ed o a g ow h chambe
unde whi e luo escen whi e ligh ( luence a e o 70 mmol m
22
s
21
) wi h a 16 h-ligh /8 h-da k pho ope iod and a con olled
empe a u e o 19–23uC. Nico iana ben hamina seeds we e sown in
soil and g own in g een-house unde a 16-hligh / 8-h-da k
pho ope iod and a con olled empe a u e o 19–23uC.
Quan i a i e RT-PCR Analysis and GUS S aining
To quan i y ansc ip le els, o al RNAs om wild ype and
iPCC1 seedlings, ha es ed a 12 hou s a e dawn, we e
ex ac ed, pu i ied wi h he RNeasy ki (QIAGEN), and analyzed
by quan i a i e RT-PCR echniques as desc ibed p e iously [20].
P ime s used o qPCR a e included in Table 1. GUS s aining was
pe o med in samples ha es ed a 12 hou s a e dawn wi h X-
Gluc in he p esence o 5 mM e ycianide/ e ocyanide edox
bu e .
Ho mone T ea men s and Hypoco yl Elonga ion Tes s
Imbibed seeds om wild ype Col-0 and h ee independen
iPCC1 ansgenic lines we e s a i ied a 4uC o 4 days, hen
successi ely ans e ed o whi e ligh a 21uC o 6 h, and o
da kness o addi ional 18 h be o e being incuba ed o 4
addi ional days unde di e en ligh quali ies supplied by LED
ligh s in a Pe ci al g ow h chambe . Fluence a es o 70 mmol m
22
s
21
o whi e ligh ; 5 mmol m
22
s
21
o a - ed ligh ; 30 mmol m
22
s
21
o ed ligh and 10 mmol m
22
s
21
o blue ligh we e used.
A e di e en ligh quali y incuba ion, hypoco yls o seedlings
we e laid on ace a e shee s, scanned and he leng h measu ed by
using ImageJ so wa e. A ound 20 seedlings pe geno ype and
condi ion we e measu ed in each o he h ee eplica e expe i-
men s pe o med and he mean alue calcula ed. The esul s a e
exp essed as he mean o h ee eplica es 6SD. When indica ed
he ac i e gibbe ellin GA3 o he gibbe ellins biosyn hesis inhibi o
paclobu azol (PAC) we e added o he g ow h media a he
indica ed concen a ions. T ea men s wi h SA we e pe o med by
adding he indica ed concen a ions o liquid media supplemen ed
wi h 0.02% Tween-20 as su ac an .
T ansien and S able T ans o ma ion o Nico iana and
A abidopsis wi h GFP- agged Ve sions o PCC1
The PCC1 coding sequence was mobilized om en y Ga eway
plasmids by ecombina ion o des ina ion bina y pGWB5 and
pGWB6 ec o s [21] o gene a e cons uc s o C- and N- e minal
PCC1 usion o GFP. A con ol GFP-s op-PCC1 cons uc
exp essing ee GFP and a GFP-D177PCC1 cons uc exp essing
a unca ed e sion con aining he i s 177 nucleo ides and
excluding he 39-end coding o he C- e minus we e also
mobilized om en y ec o s o he co esponding des ina ion
bina y ec o s using Ga eway echnology. pGWB5 was also used
o gene a e a GFP- agged CSN5B subuni o COP9 signalosome.
Nico iana lea es we e ansien ly ans o med by in il a ion wi h
Ag obac e ium ume aciens C58 s ain co- ans o med (1:1) wi h he
co esponding plasmids and he P19 supp esso o silencing.
Plasmids exp essing he whole PCC1 p o ein wi h C- e minal
usions o GFP we e also used o s ably ans o med A abidopsis
haliana by lo al dipping in suspensions o Ag obac e ium ume aciens
C58 s ain ans o med wi h he co esponding plasmids. P ima y
ans o man s we e selec ed in kanamycin-supplemen ed media
and homozygous T3 seeds we e used h oughou his wo k.
Yeas Two-Hyb id (Y2H) Sc eening o PCC1 In e ac o s
A unca ed e sion o PCC1 con aining he i s 59 amino acids
was cloned in o pB66 as a C- e minal usion o Gal4 DNA-binding
domain (N-Gal4-PCC1(1-59)-C) and used as a bai o sc een a
andom-p imed 7-day old A. haliana seedlings cDNA lib a y
con aining 98.8 million cDNA clones cloned in o pP6 ec o .
pB66 and pP6 a e de i ed om pAS2DD and pGADGH plasmids,
espec i ely [22]. Sc eening was pe o med by using a ma ing
app oach wi h Y187 (ma a) and CG1945 (ma a) yeas s ains as
p e iously desc ibed [22]. A o al o 31 His+colonies we e selec ed
on minimal medium lacking yp ophan, leucine and his idine.
The p ey agmen s o he posi i e clones we e ampli ied by PCR
and sequenced a hei 59and 39junc ions. The esul ing
Table 1. Oligonucleo ides used o qRT-PCR in his wo k.
P ime name Sequence (59 o 39) Re e ence
qACT2-D g ccagccc cg g [20]
qACT2-R g c cg gga ccagcag [20]
qPCC1-2D gc ccagcc c g aca ca [2]
qPCC1-2R cgac c g c ca ca gc ga [2]
qFT-D caaccc cacc ccgagaa a [2]
qFT-R gccaaagg g ccag g [2]
qCO-D aacgaca agg ag ggagagaacaac [2]
qCO-R gcagaa c gca ggcaa aca [2]
qGID1a-F g gacgg agagaccgcga [20]
qGID1a-R ccc cggg aaaaacgc [20]
qGID1b-F acgg caaggaac cggc [20]
qGID1b-R cgccc gacgg c c [20]
qGID1c-F cggc caaa c cga c gg [20]
qGID1c-R ggca gcagggac c [20]
qRGA-F ac cgacggg acgcaga [20]
qRGA-R g cg caccg cg cc [20]
qGAI-3UTR-F aa gaa ga c g gaaccgg [20]
qGAI-3UTR-R ggc cgg cggaaa c a c [20]
doi:10.1371/jou nal.pone.0087216. 001
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 2 Janua y 2014 | Volume 9 | Issue 1 | e87216
sequences we e used o iden i y he co esponding in e ac ing
p o eins in he GenBank da abase (NCBI).
P o ein-P o ein In e ac ion Tes s Based on Y2H, BiFC and
IP-based Pull-down
P o ein in e ac ions we e es ed in yeas by subcloning bai s and
p eys used o he DNA binding (DB) and ac i a ion (AD) domains
o GAL4 and he e e se op ion in pDBLeu and pPC86 ec o s
(In i ogen). Selec ion was pe o med by pla ing se ial dilu ions o
ans o med yeas s in minimal medium –T p-Leu-His supple-
men ed wi h inc easing concen a ions o 3-amino iazole. In
plan a in e ac ions be ween p o eins we e es ed by Bi unc ional
Fluo escence Complemen a ion (BiFC) ough ansien co- ans-
o ma ion o Nico iana lea es by ag oin il a ion wi h pai o
p o eins each used o hal o he YFP molecule in pYFC43 and
pYFN43 ec o s [23]. Recons i u ion o YFP-based luo escence
was isualized by a TCS SL Leica con ocal mic oscope. Finally,
e sions o PCC1 used o GFP, HA and c-myc ags and GFP-
agged e sions o GFP-D177PCC1 and CSN5B subuni o COP9
signalosome we e co- ans o med in Nico iana lea es in he
p esence o he P19 supp esso o silencing. To al p o ein ex ac s
we e ob ained by g inding lea issue in liquid ni ogen and
ex ac ion wi h TBS bu e supplemen ed wi h p o ease inhibi o
cock ail (Sigma) and de e gen as indica ed. Immunop ecipi a ion
o o al p o ein ex ac s was pe o med wi h magne ic beads
co e ed wi h polyclonal abbi an ibodies agains HA o GFP ags
(Mil eny). Pulled-down p o eins we e u he analyzed by Wes e n
blo wi h p ima y an ibodies agains HA (polyclonal om Abcam),
GFP (monoclonal om Clon ech) o c-myc (polyclonal coupled o
HRP om Sigma) and seconda y an i- abbi o an i-mouse
an ibodies coupled o ho se adish pe oxidase (GE Heal hca e).
The Enhanced Chemiluniscence (ECL) de ec ion ki (GE
Heal hca e) was used o expose Fuji ilm.
Gene a ion o Double iPCC1/35S::GR-CO T ansgenic
Plan s and Quan i ica ion o Flowe ing Time
iPCC1 plan s wi h ex emely educed le els o PCC1 ansc ip
because o he o e -exp ession o an RNAi cons uc o PCC1 [2]
we e c ossed o co-2 mu an plan s ans o med o o e exp ess CO
used o he Glucoco icoid Recep o (35S::CO-GR/co-2) ha
makes CO unc ional in he nucleus only upon ea men wi h a
GR ligand such as dexame hasone (DEX) [24]. A PCR-based
geno yping p ocedu e using speci ic p ime s o CO (59-GCA-
GAATCTGCATGGCAATGGCAATACA-39) and PCC1 (59-
CGCTTACTCTGATGTACAGA -39) and common p ime s
(5’-GCTCCTACAAATGCCATCA-3’) om 35S p omo e se-
quence was used. Flowe ing ime was quan i ied by coun ing
ose e plus cauline lea es upon bol ing as p e iously epo ed
[25].
Resul s
PCC1 is a Small P o ein Ancho ed o he Plasma
Memb ane
Pa hogen and Ci cadian Con olled 1 (PCC1) was o iginally iden i ied
as an ea ly ac i a ed gene upon in ec ion wi h he bac e ial
pa hogen Pseudomonas sy ingae A Rp 2 ha shows an exp ession
pa e n con olled by he ci cadian clock [1]. La e on PCC1 was
iden i ied in a compa a i e ansc ip omic analysis o SA-de icien
e sus wild ype plan s as a SA- and UV-C ligh -induced gene ha
codes o a po en ial ac i a o o s ess-s imula ed lowe ing in
A abidopsis [2]. PCC1 is a small gene ha codes o an 81 amino
acids p o ein wi h a molecula mass o 8.4 kDa. Despi e i s low
hyd ophobici y, es ima ed by i s GRAVY index [26] o –0.129,
much lowe ha he one obse ed o mos o he memb ane
p o eins so a epo ed, PCC1 has been iden i ied in wo p e ious
epo s sea ching o plasma memb ane associa ed p o eins in
A abidopsis [27,28]. Fu he in silico analysis o PCC1 sequence
wi h he memb ane speci ic TMP ed ool [29] p edic s a
ansmemb ane helix in he C- e minus (be ween amino acids
60 and 78) o he p o ein (Fig. 1A), which coincides wi h i s mos
hyd ophobic egion acco ding o i s GRAVY index alue, which is
sligh ly o e 1.5 be ween he amino acids 65 and 75. Howe e , he
use o di e en bioin o ma ic ools o he p edic ion o he cellula
localiza ion o p o eins yields unequal esul s om ex acellula o
cy oplasmic, nuclea o e en chlo oplas ic localiza ion. This
disc epancy in he p edic ions p omp ed us o check he
subcellula localiza ion o PCC1 h ough se e al molecula
expe imen al app oaches. Fi s , we gene a ed cons uc s o
ansien ly exp ess ecombinan e sions o PCC1 p o ein used
in i s N- and C- e minus o GFP unde he 35S p omo e in
Nico iana ben hamiana. Figu e 1B shows he le els o PCC1-GFP
p o ein ex ac ed wi h ei he TBS bu e o TBS bu e
supplemen ed wi h di e en de e gen s. Only in he p esence o
de e gen s, PCC1-GFP p o ein was e icien ly ex ac ed as
demons a ed by Wes e n blo using an i-GFP an ibody (Fig.
1B). A con ocal mic oscopy analysis o Nico iana lea es ansien ly
ans o med wi h he 36 kDa usion p o eins PCC1-GFP, GFP-
PCC1 and a con ol GFP-s op-PCC1 cons uc , which exp esses
ee 28 kDa GFP, poin ed o luo escence associa ed o he plasma
memb ane o bo h PCC1-GFP and GFP-PCC1 usion p o eins,
in con as o he localiza ion o ee GFP in he cy osol and
nucleus (Fig. 1C). To demons a e ha he memb ane localiza ion
was dependen on he hyd ophobic C- e minus egion being
ancho ed o he plasma memb ane, we gene a ed a C- e minal
usion o GFP o he unca ed e sion GFP-D177PCC1 exp ess-
ing he i s 177 bp o he coding sequence and hus lacking he C-
e minus. We i s checked ha he di e en cons uc s exp essed
p o eins o 36 kDa, 33 kDa and 28 kDa co esponding o GFP
usions o he ull PCC1 p o ein, he unca ed e sion and ee
GFP, espec i ely (Fig. 1D). The ypical luo escence associa ed o
he plasma memb ane o he PCC1-GFP p o ein was changed o
cy oplasmic and nuclea localiza ion o he unca ed e sion
lacking he C- e minus (Fig. 1D), hus con i ming he essen ial ole
o he C- e minus o be ancho ed o he plasma memb ane.
These da a we e u he con i med by co-localiza ion s udies o
luo escence associa ed o GFP and o he memb ane-speci ic
s aining wi h luo opho e FM4-64 in Nico iana lea es ans o med
wi h PCC1-GFP and D177PCC1-GFP. We ound co-localiza ion
in he plasma memb ane o PCC1-GFP bu no o he unca ed
e sion (Fig. S1). To check he possibili y ha PCC1 is associa ed
o he cell wall, p o oplas s we e isola ed om Nico iana ben hamiana
ansien ly ans o med wi h 35S::PCC1-GFP and 35S::GFP-PCC1
cons uc s as men ioned abo e. Figu e 1E shows ha luo escence
associa ed o GFP was loca ed a he pe iphe y o cell wall- ee
p o oplas , hus con i ming ha PCC1 is nei he loca ed in he cell
wall no in he lea apoplas . Finally, we also checked whe he
luo escence associa ed o PCC1-GFP exp ession was s ill es ic -
ed o he plasma memb ane in plasmolysed cells o Nico iana
lea es ans o med wi h 35S::PCC1-GFP cons uc . Figu e S2
shows ha GFP luo escence was de ec ed in he wo plasma
memb anes o adjacen cells and no luo escence was de ec ed
ei he in he apoplas o cell walls o plasmolysed cells.
To ule ou he possibili y ha ansien exp ession o
A abidopsis PCC1 in Nico iana ben hamiana causes abe an p o ein
localiza ion on PM, ansgenic A abidopsis lines s ably exp essing
he 35S::PCC1-GFP cons uc we e gene a ed. Figu e 2A shows
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 3 Janua y 2014 | Volume 9 | Issue 1 | e87216
Figu e 1. Plasma memb ane localiza ion o PCC1 p o ein. (A) Bioin o ma ic p edic ion o ansmemb ane po en ial o PCC1 using TMP ed
ool. The C- e minal domain wi h posi i e po en ial is w i en in blue in he amino acid sequence below he plo . (B) Ex ac ion o PCC1 p o ein om
Nico iana ben hamina lea es ansien ly ans o med wi h 35S::PCC1-GFP cons uc was assessed by using TBS bu e supplemen ed o no wi h
di e en de e gen s as indica ed, and u he de ec ed by Wes e n blo wi h an i-GFP an ibodies. Ponceau S-s ained Rubisco is shown as loading
con ol. (C) Exp ession o GFP- agged e sions o PCC1 in i s C- (PCC1-GFP) and N- e minus (GFP-PCC1) as wells as he ee GFP con ol (GFP-s op-
PCC1) was analyzed by Wes e n blo wi h an i-GFP an ibodies and con ocal mic oscopy. (D) Exp ession o a GFP- agged unca ed PCC1 e sion
(D177-PCC1-GFP) wi hou he po en ial C- e minal memb ane-associa ed domain leads o cy oplasmic localiza ion ins ead o he memb ane
localiza ion o he whole GFP-PCC1 p o ein. (E) Isola ion o p o oplas s om ansien ly ans o med Nico iana ben hamina lea es con i med he
plasma memb ane associa ion o PCC1 and allowed o ule ou cell wall localiza ion.
doi:10.1371/jou nal.pone.0087216.g001
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 4 Janua y 2014 | Volume 9 | Issue 1 | e87216
ha independen ansgenic lines o e exp essing PCC1-GFP
displayed a plasma memb ane-associa ed luo escence pa e n
simila o ha desc ibed abo e in ansien expe imen s in
Nico iana (Fig. 1). Mo eo e , ansgenic lines exp essing
35S::D177PCC1-GFP cons uc showed luo escence in he cy o-
plasm and he nuclei (Fig. 2B), hus con i ming ha PCC1 lacking
he C- e minal domain is no ancho ed o he plasma memb ane.
Because some algo i hms p edic ed plas id subcellula localiza-
ion o PCC1, we ocused ou a en ion on hese o ganelles. We
ound ha PCC1 was clea ly excluded om chlo oplas s in
epide mal lea cells as well as in he gua d cells o s oma a (Fig. S3),
hus allowing o ule ou a unc ional associa ion o PCC1 wi h
plas ids.
PCC1 Homodime iza ion and Ancho ing o he Plasma
Memb ane equi e i s C- e minus
To check whe he PCC1 may in e ac wi h i sel , we i s
conduc ed a yeas wo hyb id (Y2H) app oach. PCC1 p o ein
used o he ac i a ion domain (AD) o GAL4 was exp essed in
Ma 203 s ain o Saccha omyces ce e isiae as demons a ed by
Wes e n blo wi h an an ibody agains he AD (Fig. 3A).
Concomi an ly, only yeas ans o med wi h bo h AD-PCC1 and
PCC1 used o he binding domain o GAL4 (BD-PCC1) we e able
o g ow in His- ee selec i e medium (Fig. 3A), hus sugges ing ha
PCC1 in e ac s wi h i sel o o m dime s o highe o de
oligome s in yeas . To con i m he in e ac ion in plan a we used
Bimolecula Fluo escence Complemen a ion (BiFC) assays in
Nico iana ben hamiana. Fluo escence was only obse ed when
Nico iana lea es we e ans o med wi h bo h CYFP-PCC1 and
NYFP-PCC1 cons uc s leading o YFP econs uc ion in he
plasma memb ane (Fig. 3B), hus con i ming bo h he memb ane
localiza ion and he in e molecula in e ac ion o PCC1. In e -
es ingly, he complemen ed luo escence was de ec ed in bo h
plasma memb ane and associa ed esicle-like o ma ions (Fig. 3B).
The in e ac ion was u he con i med by immunop ecipi a ion
(IP)-based pull-down assays ollowed by Wes e n blo . Nico iana
lea es we e co- ans o med wi h PCC1-HA and each o he
ollowing cons uc s exp essing PCC1 used o he indica ed ags:
PCC1-GFP, GFP-PCC1, GFP-s op-PCC1 and PCC1-myc. A e
IP wi h an i-HA, we de ec ed 36 kDa PCC1-GFP and GFP-PCC1
by Wes e n blo wi h an i-GFP an ibody, as well as 24 kDa PCC1-
myc in he co esponding immunop ecipi a ed p o eins (Fig. 3C).
As a nega i e con ol, no GFP- agged p o ein was pulled down in
lea es co- ans o med wi h PCC1-HA and GFP-s op-PCC1
cons uc , which exp esses ee GFP (Fig. 3C), sugges ing ha
in e ac ion based on pull-down echniques was speci ic. By using a
simila pull-down app oach wi h lea es co- ans o med wi h
PCC1-HA and he GFP used o he PCC1 e sion unca ed in
i s C- e minus (GFP-D177PCC1) we u he demons a ed ha
homodime iza ion o PCC1 equi ed he cys eine- ich C- e minus
o he p o ein. Figu e 3D shows ha GFP- used p o ein was
de ec ed in he an i-HA-immunop ecipi a ed p o eins om lea es
ans o med wi h PCC1-GFP bu no in lea es ans o med wi h
GFP-s op-PCC1 o GFP-D177PCC1. The e e se IP wi h an i-
GFP an ibodies, which pulled down all h ee GFP, GFP-
D177PCC1 and ull size PCC1-GFP p o eins, only allowed
de ec ing he HA- agged p o ein in he IP om PCC1-GFP co-
ans o med lea es (Fig. 3D). Toge he ou indings demons a e
ha PCC1 in e ac s wi h i sel h ough i s C- e minal domain ich
in cys eine esidues, which, as shown abo e, is also essen ial o
being ancho ed o he plasma memb ane.
De elopmen al Pa e n o PCC1 Exp ession
We ha e p e iously epo ed ha PCC1 gene exp ession
changes h oughou pos -ge mina ion de elopmen , wi h low
le els be o e he ansi ion o lowe ing and shi ing o high le els
du ing ha de elopmen al ansi ion [2]. A 1.1 kb p omo e
sequence ups eam he PCC1 ini ia ion codon was used o he ß-
glucu onidase (GUS) epo e gene and he esul ing cons uc was
used o ans o m A abidopsis plan s. We hen selec ed h ee
independen homozygous p1100PCC1:GUS ansgenic lines, which
we e used o check he PCC1-di ec ed exp ession in di e en
o gans and a di e en imes a e ge mina ion. In
p1100PCC1:GUS lines, he pa e n o exp ession was es ic ed o
he ascula issue in oo s, hypoco yls and co yledons, as well as o
he s oma a in co yledons be o e he ansi ion om ege a i e o
ep oduc i e shoo apical me is em (Fig. 4A-C, F). Howe e , PCC1
exp ession dec eased p og essi ely in co yledons as he ansi ion
o ep oduc i e apical me is em app oached (Fig. 4O), which
unde ou expe imen al condi ions occu s a ound 9 days a e seed
ge mina ion [2]. By 8 days a e ge mina ion, lowe exp ession was
de ec ed in s oma a and ascula bundles (Fig. 4C). By day 10,
GUS s aining was s ong in he pe ioles o he i s pai o lea es
and expanded o he basal pa o lea es and subsequen ly o he
es o he lea h ough he ascula issue and mesophyll (Fig. 4D,
G). A longe imes a e ge mina ion, he GUS s aining was
sp ead all o e he lea blade and ascula u e (Fig. 4E). No
exp ession was de ec ed ei he in lowe s (Fig. 4M), siliques (Fig.
4N) o he elonga ion zone o he oo s (Fig. 4K). GUS s aining
Figu e 2. Plasma memb ane localiza ion o PCC1 in ansgenic
35S::PCC1-GFP
A abidopsis plan s. (A) Le els o PCC1-GFP p o ein in
h ee independen homozygous lines and con ol C non- ans o med
plan s we e analyzed by Wes e n blo wi h an i-GFP an ibodies.
PonceauS-s ained Rubisco is shown as loading con ol. T ansgenic lines
1.6 and 3.8 wi h maximal PCC1 exp ession showed GFP-associa ed
luo escence by con ocal mic oscopy in he plasma memb ane. (B)
Memb ane-associa ed localiza ion o PCC1-GFP con as s wi h
D177PCC1-GFP ha localizes in bo h he cy oplasm and nucleus. The
second ow o images o e e y geno ype shows magni ica ion o
s oma a gua d cells.
doi:10.1371/jou nal.pone.0087216.g002
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 5 Janua y 2014 | Volume 9 | Issue 1 | e87216
was de ec ed in he oo cap (Fig. 4K, L). The p e iously
cha ac e ized SA-induced pa e n o PCC1 exp ession [2] was also
con i med in p1100PCC1:GUS plan s wi h s onge s aining all
o e SA- ea ed seedling compa ed o un ea ed ones (Fig. 4H-I).
PCC1 and he Pho ope iod-Dependen Flowe ing
Pa hway
The pa e n o exp ession obse ed o PCC1 du ing he e en s
in ol ed in con olling he ansi ion o lowe ing unde induc i e
Figu e 3. Homodime iza ion o PCC1. (A) The usion o PCC1 wi h he ac i a ion domain (AD) o GAL4 is exp essed in Ma 203 yeas s ain as
shown by Wes e n blo wi h an i-AD an ibodies. A nega i e con ol E and he non- ans o med yeas a e also shown ( op panel). G ow h o yeas s co-
ans o med wi h AD-PCC1 and PCC1 used o he DNA binding domain o GAL4 (BD-PCC1) bu no wi h AD-PCC1 and he emp y BD ec o in
minimal media –Leu – T p –His is indica i e o sel -in e ac ion o PCC1 in yeas wo-hyb id. (B) Bimolecula luo escence complemen a ion (BiFC)-
based demons a ion o PCC1-homodime iza ion and localiza ion o dime s in he plasma memb ane o Nico iana ben hamiana lea es ansien ly co-
ans o med wi h he indica ed cons uc s. (C) Con i ma ion o PCC1 homodime iza ion by pull-down assays in Nico iana ben hamiana lea es
ansien ly co- ans o med wi h PCC1-HA and GFP- and c-myc- agged e sions o PCC1 as indica ed. Immunop ecipi a ion (IP) was pe o med wi h
an i-HA and pulled-down p o eins de ec ed by Wes e n blo wi h he polyclonal an ibodies indica ed. (D) Homodime iza ion o PCC1 equi ed he
ansmemb ane C- e minal domain as demons a ed by pull-down assays in Nico iana ben hamiana lea es ansien ly co- ans o med wi h PCC1-HA
and GFP- agged e sions o comple e and unca ed PCC1 molecules. IPs using an i-HA and an i-GFP ollowed by WB using he indica ed an ibodies
a e shown a he le .
doi:10.1371/jou nal.pone.0087216.g003
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 6 Janua y 2014 | Volume 9 | Issue 1 | e87216
long days sugges s ha PCC1 migh be connec ed o o e en
pa icipa e in he signaling pa hway con olling he pho ope iod-
dependen lowe ing. CONSTANS (CO) and FLOWERING
LOCUS T (FT) a e essen ial egula o s in he pho ope iod-
dependen lowe ing pa hway [30] and FT has been cha ac e ized
as a mobile signal ansloca ed om lea es h ough he ascula
issue o he shoo apical me is em (SAM) o ac i a e lowe ing
upon in e ac ion wi h FD ansc ip ion ac o [31,32]. The ac
ha PCC1 exp ession p og esses om SAM o lea es and, in u n,
FT is expo ed om lea es o SAM, migh be ela ed o se e al
al e na i e hypo hesis: PCC1 migh in e e e wi h CO ac i a ing
FT; o PCC1 migh physically in e ac wi h ei he CO o FT hus
modula ing hei localiza ions/ unc ions; o migh in e e e wi h
FT ansloca ion o SAM and i s u he in e ac ion wi h FD
ansc ip ion ac o . To es he i s hypo hesis, iPCC1/35S::CO-
GR/co-2 plan s we e gene a ed by c ossing iPCC1 plan s wi h
ex emely educed le els h ough an RNAi app oach [2] o co-2
mu an plan s ans o med o o e exp ess CO used o he
Figu e 4. Spa ial pa e n o
PCC1
exp ession analyzed wi h
pPCC1::GUS
ansgenic plan s. GUS-s ained seedlings o (A) 4 days a e sowing
(d.a.s.); (B) 6 d.a.s.; (C) 8 d.a.s.; (D) 10 d.a.s.; (E) 14 d.a.s. (F) De ail o GUS-s ained gua d cells o seedling shown in (A). (G) Lea showing showing s aining
om he pe iole o he dis al pa s. (H) and (I) Con ol un ea ed and 0.1 mM SA- ea ed 14-day old seedlings, espec i ely. (J) Vascula issue s ained
in he uppe pa o oo s. (K) Absence o GUS s aining in he elonga ion zone and ip o oo s. (L) De ail o s ained calyp a. (M) and (N) Absence o
exp ession in lowe and siliques, espec i ely. (O) Time-cou se o GUS s aining in co yledons a di e en imes a e ge mina ion showing he
s oma a- and ascula issue-associa ed pa e ns. The gene a ion o pPCC1::GUS ansgenic lines and he p o ocols used o GUS s aining we e
p e iously epo ed [33].
doi:10.1371/jou nal.pone.0087216.g004
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 7 Janua y 2014 | Volume 9 | Issue 1 | e87216
Glucoco icoid Recep o . Because bo h cons uc s con ained
esis ance o kanamycin as selec ion ma ke , we de eloped a
PCR-based geno yping p ocedu e using speci ic p ime s o CO
and PCC1 and common p ime s om 35S p omo e sequence. We
con i med by qRT-PCR ha homozygous double ansgenic
plan s o e exp essed CO while showing s ongly educed PCC1
le els (Fig. 5A). Mo eo e , FT exp ession was ac i a ed upon Dex
ea men by inducing CO nuclea ansloca ion (Fig. 5A). We
obse ed ha despi e he s ong down- egula ion o PCC1, double
ansgenic plan s only lowe ed ea lie in he p esence o Dex, his
is, when FT was ac i a ed (Fig. 5B). These da a suppo ha PCC1
is no equi ed o he ac i a ion o FT by CO and he subsequen
lo al ansi ion.
To es whe he PCC1 migh in e ac in plan a wi h CO o FT,
BiFC was used in Nico iana ben hamiana lea es co- ans o med wi h
he co esponding p o eins used o N- and C- e minal pa s o
YFP. Nei he co- ans o ma ion wi h CO and PCC1 o FT and
PCC1 we e able o econs uc GFP luo escence (Fig. 5C). As a
posi i e con ol, he p e iously epo ed in e ac ion o FT and FD
was obse ed in he nuclei (Fig. 5C).
In ol emen o PCC1 in Ligh -Regula ed De elopmen
PCC1 egula es lowe ing ime, as demons a ed by he la e
lowe ing pheno ype obse ed in iPCC1 plan s g own unde long
day pho ope iodic condi ions [2]. Howe e , his seems o be no
ela ed o in e e ence wi h he unc ion o he well cha ac e ized
egula o s o he pho ope iod-dependen lowe ing pa hway as
demons a ed abo e. Al e na i ely, PCC1 con ol o his de elop-
men al ansi ion migh be ela ed o o he key ac o such as ligh
pe cep ion ope a ing in his pa hway. Nex , we checked whe he
iPCC1 plan s migh display o he ligh - ela ed pheno ypes. The
pho omo phogenic inhibi ion o hypoco yl elonga ion, co yledon
opening and acquisi ion o pho osyn he ic compe ence is con-
olled h ough ligh pe cep ion and downs eam signaling
in ol ing Phy och ome In e ac ing Fac o s (PIFs) as well as
gibbe ellin- ela ed DELLA p o eins [7,8]. We analyzed whe he
iPCC1 seedlings displayed di e en ial hypoco yl elonga ion
pheno ypes compa ed o wild ype seedlings unde di e en
quali ies o ligh . Figu e 6A shows ha iPCC1 hypoco yls g ew
longe han hose o wild ype seedlings unde blue, ed and a - ed
ligh s. Whe eas iPCC1 hypoco yls we e also longe han wild ype
ones unde whi e ligh (Fig. 6C and Fig. S4), iPCC1 hypoco yls
we e no signi ican ly longe han wild ype unde da kness (Fig.
S4). Longe hypoco yls in a ed, ed, o blue ligh s migh be
ela ed o de iciency in he pe cep ion o hose quali ies o ligh s
h ough phy och omes and c yp och omes, espec i ely. Howe e ,
based on compa a i e ansc ip ome analysis o iPCC1 s wild
ype seedlings [33], no s a is ically signi ican change in he
ansc ip le els o he phy och ome and c yp och ome encoding
genes was de ec ed (Table S1). Because iPCC1 hypoco yls we e
no as long as hose om phyA mu an unde a ed ligh , phyB
mu an unde ed ligh o as hose om c y1c y2 double mu an
unde blue ligh , we belie e ha iPCC1 seedlings a e somehow
pa ially blind o ligh in gene al, o possibly de ec i e in
downs eam componen s o ligh signaling cascades ha a e
common o di e en ligh quali ies. Rega ding his, he le els o
PCC1 ansc ip a e up- egula ed in he phyB mu an and, in u n,
down- egula ed in c y1,c y2 and c y1c y2 mu an s when compa ed
o wild ype plan s (Fig. 6B) sugges ing ha ed and blue ligh
signaling exe s nega i e and posi i e modula ion, espec i ely, on
PCC1 gene exp ession. Since GAs p omo e hypoco yl elonga ion,
we es ed whe he iPCC1 and wild ype seedlings esponded
simila ly o exogenous GAs unde whi e ligh . Figu e 6C shows
ha iPCC1 hypoco yls we e as esponsi e as wild ypes o 4 mM
GA
3
ea men . By con as , a 15 mMGA
3
wild ype hypoco yls
we e s ill esponsi e o GAs bu iPCC1 hypoco yls we e no
esponsi e anymo e (Fig. 6C). We also checked he e ec o he
GA syn hesis inhibi o paclobu azol (PAC) on hypoco yl elonga-
ion unde di e en ligh quali ies. The s ong hypoco yl
sho ening e ec exe ed by PAC was obse ed in bo h wild ype
and iPCC1 hypoco yls g own unde blue, ed and a - ed ligh s,
bu iPCC1 hypoco yls we e s ill signi ican ly longe han wild ypes
in e e y condi ion es ed (Fig. 6D). Because GA signaling is a key
egula o y ac o in he con ol o hypoco yl elonga ion, we es ed
by qRT-PCR he ansc ip le els o GA ecep o and DELLA
Figu e 5. PCC1 does no in e e e wi h pho ope iod dependen
lo al ansi ion pa hway no in e ac s wi h i s egula o y
componen s. (A) PCC1,CO and FT ansc ip le els in wild ype, double
ansgenics iPCC1/35S::CO-GR and hei pa en al plan s in he absence
and p esence o 10 mM o he GR ligand dexame hasone (DEX). (B)
Flowe ing ime quan i ied by coun ing o al ( ose e plus cauline) lea es
in long day-g own plan s o he geno ypes desc ibed in (A) ea ed o
no wi h DEX. * ep esen s s a is ically signi ican (p,0.05 in S uden s -
es ) di e en alues in DEX- ea ed compa ed o un ea ed (Mock)
seedlings. (C) Analysis o po en ial in e ac ions be ween PCC1 and CO
o FT by BiFC. The in e ac ion be ween FT and FD in nuclei is shown as
posi i e con ol.
doi:10.1371/jou nal.pone.0087216.g005
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 8 Janua y 2014 | Volume 9 | Issue 1 | e87216
encoding genes in wild ype and iPCC1 seedlings. Figu e 6E shows
ha genes coding o he GA ecep o s, GID1a,GID1b and GID1c,
we e all sligh ly bu signi ican ly down- egula ed in iPCC1
seedlings, hus suppo ing ha GA pe cep ion migh be al e ed
in iPCC1 plan s. Nei he RGA no GAI gene ansc ip s we e
signi ican ly al e ed in iPCC1 seedlings (Fig. 6E). Whe he
de icien gibbe ellins pe cep ion migh be esponsible o he
delayed lowe ing obse ed in iPCC1 plan s will equi e u he
wo k. In summa y, he pa ial sko omo phogenic pheno ype unde
di e en ligh quali ies and he al e ed sensi i i y o GAs in iPCC1
plan s as well as he opposi e egula ion exe ed by PHYB and
CRY pho o ecep o s on PCC1 exp ession, poin o PCC1 as an
impo an egula o y node in pho omo phogenic esponses.
Y2H-based Sc eening Re eals he In e ac ion be ween
PCC1 and he Subuni 5 o he COP9 Signalosome
To cla i y he way PCC1 may exe egula ion on ligh -
egula ed de elopmen we conduc ed a Y2H sc eening o p o ein
in e ac o s o PCC1. Fo ha pu pose, a unca ed e sion o
PCC1 con aining he i s 59 amino acids, hus lacking he C-
e minal domain equi ed o memb ane ancho ing, was used o
he DNA binding domain o GAL4 (N-Gal4-PCC1(1-59)-C) and
used as bai o sc een an A abidopsis lib a y o cDNA clones om
7-day old A abidopsis seedlings used o he ac i a ion domain o
GAL4. Among 31 posi i e clones de ec ed ou o 129 million
possible in e ac ions es ed in he Y2H sc eening, 7 clones esul ed
o be ei he ou o ame o an isense sequence clones and we e
consequen ly disca ded. Ano he 21 posi i e clones co esponded
o di e en sequences spanning he locus coding o he CSN5A
subuni o he COP9 signalosome (CSN). I has been p e iously
epo ed ha CSN5A binds he DNA binding domain o GAL4
and is hus equen ly conside ed as a alse posi i e in e ac o in
many di e en Y2H sc eenings [34]. The es 3 iden ical clones
co esponded o he sequence be ween nucleo ides 90 o 1207 o
he A 1g71230 coding o CSN5B/AJH2, he o he subuni 5 o
CSN. To con i m he s eng h o he in e ac ion be ween PCC1
and CSN5B/AJH2, he clones isola ed in he sc eening we e co-
ans o med in Saccha omyces ce e isiae s ain AH109 and he
ans o med yeas was pla ed in SC minimum medium (-His-
Leu-T p) supplemen ed wi h inc easing concen a ions o 3-
amino iazole (3-AT). E en a 20 mM 3-AT he g ow h o doubly
ans o med yeas s was clea ly supe io ela i e o he yeas s
ans o med wi h he GAL4AD-CSN5B and he emp y GAL4BD-
plasmids (Fig. 7A), hus sugges ing a s ong in e ac ion be ween
PCC1 and CSN5B. Because he Y2H sys em is an he e ologous
p ocedu e o es plan p o ein-p o ein in e ac ions cau ion is
equi ed when in e p e ing hose da a. The in plan a in e ac ion
be ween wo p o eins mus ul ill opological c i e ia wi h
subcellula localiza ions being consis en wi h po en ial in e ac ion.
I has been epo ed ha CSN5A in i s monome ic o m is loca ed
in he cy oplasm and nuclei [35]. We ha e ansien ly ans o med
Nico iana ben hamina wi h a 35S::GFP-CSN5B cons uc and ound
ha , simila ly o CSN5A, luo escence was de ec ed in he
cy oplasm and nucleus and i can no be uled ou he possibili y
ha is also localized in he plasma memb ane (Fig. 7B). By using
BiFC, he in e ac ion be ween PCC1 and bo h subuni s CSN5A
and CSN5B o CSN has been con i med in Nico iana. Figu e 7C
shows ha he YFP luo escence was econs uc ed in he plasma
memb ane.
I has been widely cha ac e ized ha CSN unc ions by clea ing
he ubiqui in-like p o ein RUB/NEDD8 om cullins [36], which
a e essen ial componen s in he SCF (Skip1-cullin-F-box) com-
plexes in ol ed as E3 ubiqui in ligases in he ubiqui in-p o easome
pa hway, which is he p eponde an p o ein u no e sys em in
plan s [37,38]. RUB modi ica ion o cullins has been cha ac e ized
o ac i a e he E3 ubiqui in ligase ac i i y [39] and hus CSN
should unc ion as a nega i e egula o o SCF complexes.
Howe e , gene ic app oaches ha e es ablished ha CSN unc ions
in i o p omo ing E3 ubiqui in ligase ac i i y as a consequence o
he p o ec i e e ec exe ed on SCF p o ein adap o s by limi ing
hei au oca aly ic deg ada ion [40]. We ha e checked whe he
iPCC1 plan s display al e ed CSN-media ed clea age o cullin1
(CUL1) when compa ed o wild ype plan s. Figu e 7D shows ha
iPCC1 displayed le els o RUB-CUL1 and CUL1 simila o wild
ype plan s, which sugges s ha PCC1 does no in e e e wi h de-
ubyla ing ac i i y o CSN, a leas ega ding o CUL1.
Discussion
Despi e i s small size and he lack o well cha ac e ized domains
in o ming abou i s po en ial unc ions, PCC1 p o ein has a
signi ican impac on a wide a ay o physiological p ocesses
including pola lipid con en , ABA- ela ed esponses and pa hogen
de ense in A abidopsis [33]. PCC1 was ini ially iden i ied as a gene
wi h a ci cadian con olled pa e n o exp ession and unc ionally
ela ed o de ense agains bio ophic pa hogens [1]. I was u he
cha ac e ized as a gene wi h a s ic ly SA-dependen exp ession
ha seems o be in ol ed in con olling bo h s ess-induced and
non s essed lowe ing [2]. Whe eas he pheno ypic e ec s o
PCC1 gain- and loss-o unc ion ha e been widely desc ibed
[1,2,33], much less is known ega ding he biochemis y and cell
biology o PCC1 p o ein. He e we ha e cha ac e ized PCC1 as a
plasma memb ane associa ed p o ein ha homodime izes and
equi es i s C- e minal domain o be ancho ed o he memb ane.
The C- e minus o PCC1 p o ein is a cys eine- ich domain ha
has being used o classi y his p o ein as a membe o he so-called
Cys eine- ich T ans Memb ane (CYSTM) domain-con aining
p o eins [3]. This amily o p o eins has been p oposed o be
in ol ed in esis ance o s ess and pa icula ly agains dele e ious
subs ances likely h ough he al e ed edox po en ial o he
memb ane due o he peculia a angemen o se e al sul hyd yl
g oups wi hin he memb ane [3]. The al e a ion o he memb ane
edox po en ial migh be de e minan o quenching adical
species o o a ec he up ake o me al ions, which has been
al eady epo ed o CDT1, ano he plan membe o he
CYSTM supe amily, in ol ed in he exclusion o hea y me als
in Digi a ia cilia is and O yza sa i a [41]. Besides, i has been also
p oposed ha he N- e minal pola diso de ed head o he
CYSTM p ope ies migh unde ce ain condi ions assume a
ce ain deg ee o s uc u e ha could be impo an o al e na i e
unc ions in he cy oplasm. In his ega d, he diso de ed egion
ups eam o he CYSTM domain has an amino acid composi ion
and o ganiza ion simila o p ion-like p o eins ha may assume
al e na i e con o ma ions [3]. Al hough a unca ed e sion o
PCC1 lacking i s CYSTM-con aining C- e minal domain los he
speci ic plasma memb ane localiza ion o he ull-leng h p o ein,
we do no ha e da a suppo ing whe he CYSTM domain migh
be impo an o PCC1 unc ion. Fu he compa a i e wo k wi h
plan s exp essing ei he he ull-leng h o unca ed e sions o
PCC1 will help o cla i y whe he he di e en domains o PCC1
migh be impo an o he egula o y oles exe ed by his p o ein
in p e iously desc ibed pheno ypes o e en in s ill uncha ac e ized
new p ocesses ela ed o PCC1 unc ion.
Ou analysis o he spa ial and empo al pa e n o PCC1
exp ession by using ansgenic A abidopsis plan s exp essing he
GUS epo e gene unde he con ol o a 1.1 kb p omo e
sequence o PCC1 locus allowed o unco e a dual pa e n o
exp ession dis inguishable bo h spa ially and empo ally. Du ing
PCC1-CSN In e ac ion and Ligh Signaling
PLOS ONE | www.plosone.o g 9 Janua y 2014 | Volume 9 | Issue 1 | e87216