Pathogen and Circadian Controlled 1 (PCC1) Protein Is Anchored to the Plasma Membrane and Interacts with Subunit 5 of COP9 Signalosome in Arabidopsis

Pa hogen and Ci cadian Con olled 1 (PCC1) P o ein Is Ancho ed o he Plasma Memb ane and In e ac s wi h Subuni 5 o COP9 Signalosome in A abidopsis Rica do Mi ¤ , Jose ´Leo ´n* Ins i u o de Biologı ´a Molecula y Celula de Plan as, Consejo Supe io de In es igaciones Cien ı ´ icas-Uni e sidad Poli e ´cnica de Valencia, Valencia, Spain Abs ac The Pa hogen and Ci cadian Con olled 1 (PCC1) gene, p e iously iden i ied and u he cha ac e ized as in ol ed in de ense o pa hogens and s ess-induced lowe ing, codes o an 81-amino acid p o ein wi h a cys eine- ich C- e minal domain. This domain is essen ial o homodime iza ion and ancho ing o he plasma memb ane. T ansgenic plan s wi h he ß- glucu onidase (GUS) epo e gene unde he con ol o 1.1 kb p omo e sequence o PCC1 gene display a dual pa e n o exp ession. A ea ly pos -ge mina ion, PCC1 is exp essed only in he oo ascula u e and in he s oma a gua d cells o co yledons. Du ing he ansi ion om ege a i e o ep oduc i e de elopmen , PCC1 is s ongly exp essed in he ascula issue o pe ioles and basal pa o he lea , and i u he sp eads o he whole limb in ully expanded lea es. This de elopmen al pa e n o exp ession oge he wi h he la e lowe ing pheno ype o long-day g own RNA in e e ence (iPCC1) plan s wi h educed PCC1 exp ession poin ed o a egula o y ole o PCC1 in he pho ope iod-dependen lowe ing pa hway. iPCC1 plan s a e de ec i e in ligh pe cep ion and signaling bu a e no impai ed in he unc ion o he co e CO-FT module o he pho ope iod-dependen pa hway. The egula o y e ec exe ed by PCC1 on he ansi ion o lowe ing as well as on o he epo ed pheno ypes migh be explained by a mechanism in ol ing he in e ac ion wi h he subuni 5 o he COP9 signalosome (CSN). Ci a ion: Mi R, Leo ´n J (2014) Pa hogen and Ci cadian Con olled 1 (PCC1) P o ein Is Ancho ed o he Plasma Memb ane and In e ac s wi h Subuni 5 o COP9 Signalosome in A abidopsis. PLoS ONE 9(1): e87216. doi:10.1371/jou nal.pone.0087216 Edi o : Keqiang Wu, Na ional Taiwan Uni e si y, Taiwan Recei ed Augus 27, 2013; Accep ed Decembe 25, 2013; Published Janua y 27, 2014 Copy igh : ß2014 Mi , Leo ´n. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed. Funding: This wo k was unded by g an s BIO2008-00839, BIO2011-27526 and CSD2007-0057 om Minis e io de Ciencia e Inno acio ´n o Spain o J.L. A ellowship/con ac o he FPU p og am o he Minis e io de Educacio ´n y Ciencia (Spain) unded R.M. wo k. The unde s had no ole in s udy design, da a collec ion and analysis, decision o publish, o p epa a ion o he manusc ip . Compe ing In e es s: The au ho s ha e decla ed ha no compe ing in e es s exis . * E-mail: [email p o ec ed]s ¤ Cu en add ess: Depa men o Bo any and Plan Sciences and Cen e o Plan Cell Biology, Uni e si y o Cali o nia, Ri e side, Cali o nia, Uni ed S a es o Ame ica In oduc ion The Pa hogen and Ci cadian Con olled 1 (PCC1) gene in A abidopsis was o iginally iden i ied as a Pseudomonas sy ingae-induced gene wi h a ci cadian con olled pa e n o exp ession [1]. Fu he wo k e ealed PCC1 as a salicylic acid (SA)-induced gene wi h a po en ial unc ion in con olling lowe ing ime unde UV-C ligh s ess condi ions and also unde non-s essed condi ions [2]. Based on bioin o ma ic p edic ions, PCC1 has been cha ac e ized as one o he so-called Cys eine- ich T ansmemb ane (CYSTM) domain- con aining amily o p o eins [3]. Since plan s wi h educed PCC1 exp ession by means o an RNAi app oach (iPCC1 ansgenic lines) a e la e lowe ing [2] and PCC1 gene exp ession is po en ially con olled by he ci cadian clock [1], i seems likely ha PCC1 is connec ed o ligh signaling. In plan s, de elopmen om seed ge mina ion o he ep oduc i e s age is igh ly con olled by ligh . Ligh pe cep ion and downs eam signaling unc ionally in e ac s wi h di e en ho mone signaling pa hways in con olling mos o he de elopmen al ansi ions [4]. Gibbe ellins (GAs) a e key ho mones in many ligh -d i en ansi ions [5] including seed ge mina ion [6], hypoco yl elonga ion du ing sko omo phogenesis [7,8] and lowe ing ime [9]. The con ol exe ed by he combined s imuli o ligh and GAs on di e se de elopmen al p ocesses is based on mul iple egula o y le els om gene ansc ip ion [10] o pos - ansc ip ional [11] and pos - ansla ional [12] p ocesses. In he model plan A abidopsis haliana, ansc ip ion ac o s o he bHLH amily a e key ansc ip ional egula o s in con olling he elonga ion o hypoco yls in close connec ion wi h ep esso p o eins o he GA- ela ed DELLA amily [7,8]. I is also well documen ed ha DELLA p o eins a e subs a es o he pos - ansla ional modi ica ion based on ubiqui ina ion o lysine esidues media ed by he E3 ubiqui in ligase SCF SLY1 complex [13,14]. The ubiqui ina ing ac i i y o he SCF complexes is dependen on he unc ion o hei ou componen s (RBX1, Skp1- like, Cullin and F-box-p o eins). Mo eo e , cullin mus be pos - ansla ionally modi ied by binding he RUB/NEDD8 ubiqui in- like p o ein o SCF complexes o be assembled and ully ac i e [15]. This ubiqui ina ion machine y is nega i ely con olled by he unc ion o an eigh -subuni p o ein complex so-called COP9 signalosome (CSN), which has RUB isopep idase ac i i y ha emo es RUB modi ica ion om cullin p o eins [16]. The de ubyla ion eac ion is media ed by he subuni CSN5, a zinc me allop o ease, al hough de ec i e unc ion o any o he subuni s make CSN unable in de ubyla ion [17] and cause se e e de elopmen al [18] and de ense esponses [19]. PLOS ONE | www.plosone.o g 1 Janua y 2014 | Volume 9 | Issue 1 | e87216 He e we p esen mul iple lines o expe imen al e idence o he plasma memb ane localiza ion o PCC1 p o ein and i s homo- dime iza ion. We ound ha he cys eine- ich C- e minus is esponsible o bo h, ancho ing o he plasma memb ane and dime iza ion. PCC1 gene displays a changeable pa e n o exp ession h oughou de elopmen , which is consis en wi h po en ial egula o y oles in bo h de elopmen and de ense. Besides, PCC1 in e ac s wi h subuni s 5a and 5b o CSN a he plasma memb ane, which could explain he wide ange o al e ed pheno ypes obse ed in plan s wi h al e ed PCC1 ansc ip le els. Ma e ials and Me hods Plan Ma e ial and G ow h Condi ions A abidopsis haliana seeds o wild ype Col-0, pho o ecep o mu an s phyA,phyB (kindly dona ed by Miguel Bla´zquez, IBMCP, Valencia, Spain), c y1,c y2 and c y1c y2 (kindly dona ed by Jose Ja illo, CBGP, Mad id, Spain), co-10 mu an s and dexame asone- induced o e exp ession lines oxCO-GR (kindly dona ed by Fede ico Val e de, IBVF, Se illa, Spain), o ansgenic lines exp essing RNAi cons uc s o PCC1 gene p e iously desc ibed [2] we e su ace s e ilized wi h 30% bleach and 0.01% Tween 20, washed ex ensi ely wi h miliQ s e ile wa e , and sown in Mu ashige and Skoog medium supplemen ed wi h 0.8% aga and 1% suc ose. A e 3 d o s a i ica ion a 4uC on Pe i MS- con aining pla es, seeds we e ans e ed o a g ow h chambe unde whi e luo escen whi e ligh ( luence a e o 70 mmol m 22 s 21 ) wi h a 16 h-ligh /8 h-da k pho ope iod and a con olled empe a u e o 19–23uC. Nico iana ben hamina seeds we e sown in soil and g own in g een-house unde a 16-hligh / 8-h-da k pho ope iod and a con olled empe a u e o 19–23uC. Quan i a i e RT-PCR Analysis and GUS S aining To quan i y ansc ip le els, o al RNAs om wild ype and iPCC1 seedlings, ha es ed a 12 hou s a e dawn, we e ex ac ed, pu i ied wi h he RNeasy ki (QIAGEN), and analyzed by quan i a i e RT-PCR echniques as desc ibed p e iously [20]. P ime s used o qPCR a e included in Table 1. GUS s aining was pe o med in samples ha es ed a 12 hou s a e dawn wi h X- Gluc in he p esence o 5 mM e ycianide/ e ocyanide edox bu e . Ho mone T ea men s and Hypoco yl Elonga ion Tes s Imbibed seeds om wild ype Col-0 and h ee independen iPCC1 ansgenic lines we e s a i ied a 4uC o 4 days, hen successi ely ans e ed o whi e ligh a 21uC o 6 h, and o da kness o addi ional 18 h be o e being incuba ed o 4 addi ional days unde di e en ligh quali ies supplied by LED ligh s in a Pe ci al g ow h chambe . Fluence a es o 70 mmol m 22 s 21 o whi e ligh ; 5 mmol m 22 s 21 o a - ed ligh ; 30 mmol m 22 s 21 o ed ligh and 10 mmol m 22 s 21 o blue ligh we e used. A e di e en ligh quali y incuba ion, hypoco yls o seedlings we e laid on ace a e shee s, scanned and he leng h measu ed by using ImageJ so wa e. A ound 20 seedlings pe geno ype and condi ion we e measu ed in each o he h ee eplica e expe i- men s pe o med and he mean alue calcula ed. The esul s a e exp essed as he mean o h ee eplica es 6SD. When indica ed he ac i e gibbe ellin GA3 o he gibbe ellins biosyn hesis inhibi o paclobu azol (PAC) we e added o he g ow h media a he indica ed concen a ions. T ea men s wi h SA we e pe o med by adding he indica ed concen a ions o liquid media supplemen ed wi h 0.02% Tween-20 as su ac an . T ansien and S able T ans o ma ion o Nico iana and A abidopsis wi h GFP- agged Ve sions o PCC1 The PCC1 coding sequence was mobilized om en y Ga eway plasmids by ecombina ion o des ina ion bina y pGWB5 and pGWB6 ec o s [21] o gene a e cons uc s o C- and N- e minal PCC1 usion o GFP. A con ol GFP-s op-PCC1 cons uc exp essing ee GFP and a GFP-D177PCC1 cons uc exp essing a unca ed e sion con aining he i s 177 nucleo ides and excluding he 39-end coding o he C- e minus we e also mobilized om en y ec o s o he co esponding des ina ion bina y ec o s using Ga eway echnology. pGWB5 was also used o gene a e a GFP- agged CSN5B subuni o COP9 signalosome. Nico iana lea es we e ansien ly ans o med by in il a ion wi h Ag obac e ium ume aciens C58 s ain co- ans o med (1:1) wi h he co esponding plasmids and he P19 supp esso o silencing. Plasmids exp essing he whole PCC1 p o ein wi h C- e minal usions o GFP we e also used o s ably ans o med A abidopsis haliana by lo al dipping in suspensions o Ag obac e ium ume aciens C58 s ain ans o med wi h he co esponding plasmids. P ima y ans o man s we e selec ed in kanamycin-supplemen ed media and homozygous T3 seeds we e used h oughou his wo k. Yeas Two-Hyb id (Y2H) Sc eening o PCC1 In e ac o s A unca ed e sion o PCC1 con aining he i s 59 amino acids was cloned in o pB66 as a C- e minal usion o Gal4 DNA-binding domain (N-Gal4-PCC1(1-59)-C) and used as a bai o sc een a andom-p imed 7-day old A. haliana seedlings cDNA lib a y con aining 98.8 million cDNA clones cloned in o pP6 ec o . pB66 and pP6 a e de i ed om pAS2DD and pGADGH plasmids, espec i ely [22]. Sc eening was pe o med by using a ma ing app oach wi h Y187 (ma a) and CG1945 (ma a) yeas s ains as p e iously desc ibed [22]. A o al o 31 His+colonies we e selec ed on minimal medium lacking yp ophan, leucine and his idine. The p ey agmen s o he posi i e clones we e ampli ied by PCR and sequenced a hei 59and 39junc ions. The esul ing Table 1. Oligonucleo ides used o qRT-PCR in his wo k. P ime name Sequence (59 o 39) Re e ence qACT2-D g ccagccc cg g [20] qACT2-R g c cg gga ccagcag [20] qPCC1-2D gc ccagcc c g aca ca [2] qPCC1-2R cgac c g c ca ca gc ga [2] qFT-D caaccc cacc ccgagaa a [2] qFT-R gccaaagg g ccag g [2] qCO-D aacgaca agg ag ggagagaacaac [2] qCO-R gcagaa c gca ggcaa aca [2] qGID1a-F g gacgg agagaccgcga [20] qGID1a-R ccc cggg aaaaacgc [20] qGID1b-F acgg caaggaac cggc [20] qGID1b-R cgccc gacgg c c [20] qGID1c-F cggc caaa c cga c gg [20] qGID1c-R ggca gcagggac c [20] qRGA-F ac cgacggg acgcaga [20] qRGA-R g cg caccg cg cc [20] qGAI-3UTR-F aa gaa ga c g gaaccgg [20] qGAI-3UTR-R ggc cgg cggaaa c a c [20] doi:10.1371/jou nal.pone.0087216. 001 PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 2 Janua y 2014 | Volume 9 | Issue 1 | e87216 sequences we e used o iden i y he co esponding in e ac ing p o eins in he GenBank da abase (NCBI). P o ein-P o ein In e ac ion Tes s Based on Y2H, BiFC and IP-based Pull-down P o ein in e ac ions we e es ed in yeas by subcloning bai s and p eys used o he DNA binding (DB) and ac i a ion (AD) domains o GAL4 and he e e se op ion in pDBLeu and pPC86 ec o s (In i ogen). Selec ion was pe o med by pla ing se ial dilu ions o ans o med yeas s in minimal medium –T p-Leu-His supple- men ed wi h inc easing concen a ions o 3-amino iazole. In plan a in e ac ions be ween p o eins we e es ed by Bi unc ional Fluo escence Complemen a ion (BiFC) ough ansien co- ans- o ma ion o Nico iana lea es by ag oin il a ion wi h pai o p o eins each used o hal o he YFP molecule in pYFC43 and pYFN43 ec o s [23]. Recons i u ion o YFP-based luo escence was isualized by a TCS SL Leica con ocal mic oscope. Finally, e sions o PCC1 used o GFP, HA and c-myc ags and GFP- agged e sions o GFP-D177PCC1 and CSN5B subuni o COP9 signalosome we e co- ans o med in Nico iana lea es in he p esence o he P19 supp esso o silencing. To al p o ein ex ac s we e ob ained by g inding lea issue in liquid ni ogen and ex ac ion wi h TBS bu e supplemen ed wi h p o ease inhibi o cock ail (Sigma) and de e gen as indica ed. Immunop ecipi a ion o o al p o ein ex ac s was pe o med wi h magne ic beads co e ed wi h polyclonal abbi an ibodies agains HA o GFP ags (Mil eny). Pulled-down p o eins we e u he analyzed by Wes e n blo wi h p ima y an ibodies agains HA (polyclonal om Abcam), GFP (monoclonal om Clon ech) o c-myc (polyclonal coupled o HRP om Sigma) and seconda y an i- abbi o an i-mouse an ibodies coupled o ho se adish pe oxidase (GE Heal hca e). The Enhanced Chemiluniscence (ECL) de ec ion ki (GE Heal hca e) was used o expose Fuji ilm. Gene a ion o Double iPCC1/35S::GR-CO T ansgenic Plan s and Quan i ica ion o Flowe ing Time iPCC1 plan s wi h ex emely educed le els o PCC1 ansc ip because o he o e -exp ession o an RNAi cons uc o PCC1 [2] we e c ossed o co-2 mu an plan s ans o med o o e exp ess CO used o he Glucoco icoid Recep o (35S::CO-GR/co-2) ha makes CO unc ional in he nucleus only upon ea men wi h a GR ligand such as dexame hasone (DEX) [24]. A PCR-based geno yping p ocedu e using speci ic p ime s o CO (59-GCA- GAATCTGCATGGCAATGGCAATACA-39) and PCC1 (59- CGCTTACTCTGATGTACAGA -39) and common p ime s (5’-GCTCCTACAAATGCCATCA-3’) om 35S p omo e se- quence was used. Flowe ing ime was quan i ied by coun ing ose e plus cauline lea es upon bol ing as p e iously epo ed [25]. Resul s PCC1 is a Small P o ein Ancho ed o he Plasma Memb ane Pa hogen and Ci cadian Con olled 1 (PCC1) was o iginally iden i ied as an ea ly ac i a ed gene upon in ec ion wi h he bac e ial pa hogen Pseudomonas sy ingae A Rp 2 ha shows an exp ession pa e n con olled by he ci cadian clock [1]. La e on PCC1 was iden i ied in a compa a i e ansc ip omic analysis o SA-de icien e sus wild ype plan s as a SA- and UV-C ligh -induced gene ha codes o a po en ial ac i a o o s ess-s imula ed lowe ing in A abidopsis [2]. PCC1 is a small gene ha codes o an 81 amino acids p o ein wi h a molecula mass o 8.4 kDa. Despi e i s low hyd ophobici y, es ima ed by i s GRAVY index [26] o –0.129, much lowe ha he one obse ed o mos o he memb ane p o eins so a epo ed, PCC1 has been iden i ied in wo p e ious epo s sea ching o plasma memb ane associa ed p o eins in A abidopsis [27,28]. Fu he in silico analysis o PCC1 sequence wi h he memb ane speci ic TMP ed ool [29] p edic s a ansmemb ane helix in he C- e minus (be ween amino acids 60 and 78) o he p o ein (Fig. 1A), which coincides wi h i s mos hyd ophobic egion acco ding o i s GRAVY index alue, which is sligh ly o e 1.5 be ween he amino acids 65 and 75. Howe e , he use o di e en bioin o ma ic ools o he p edic ion o he cellula localiza ion o p o eins yields unequal esul s om ex acellula o cy oplasmic, nuclea o e en chlo oplas ic localiza ion. This disc epancy in he p edic ions p omp ed us o check he subcellula localiza ion o PCC1 h ough se e al molecula expe imen al app oaches. Fi s , we gene a ed cons uc s o ansien ly exp ess ecombinan e sions o PCC1 p o ein used in i s N- and C- e minus o GFP unde he 35S p omo e in Nico iana ben hamiana. Figu e 1B shows he le els o PCC1-GFP p o ein ex ac ed wi h ei he TBS bu e o TBS bu e supplemen ed wi h di e en de e gen s. Only in he p esence o de e gen s, PCC1-GFP p o ein was e icien ly ex ac ed as demons a ed by Wes e n blo using an i-GFP an ibody (Fig. 1B). A con ocal mic oscopy analysis o Nico iana lea es ansien ly ans o med wi h he 36 kDa usion p o eins PCC1-GFP, GFP- PCC1 and a con ol GFP-s op-PCC1 cons uc , which exp esses ee 28 kDa GFP, poin ed o luo escence associa ed o he plasma memb ane o bo h PCC1-GFP and GFP-PCC1 usion p o eins, in con as o he localiza ion o ee GFP in he cy osol and nucleus (Fig. 1C). To demons a e ha he memb ane localiza ion was dependen on he hyd ophobic C- e minus egion being ancho ed o he plasma memb ane, we gene a ed a C- e minal usion o GFP o he unca ed e sion GFP-D177PCC1 exp ess- ing he i s 177 bp o he coding sequence and hus lacking he C- e minus. We i s checked ha he di e en cons uc s exp essed p o eins o 36 kDa, 33 kDa and 28 kDa co esponding o GFP usions o he ull PCC1 p o ein, he unca ed e sion and ee GFP, espec i ely (Fig. 1D). The ypical luo escence associa ed o he plasma memb ane o he PCC1-GFP p o ein was changed o cy oplasmic and nuclea localiza ion o he unca ed e sion lacking he C- e minus (Fig. 1D), hus con i ming he essen ial ole o he C- e minus o be ancho ed o he plasma memb ane. These da a we e u he con i med by co-localiza ion s udies o luo escence associa ed o GFP and o he memb ane-speci ic s aining wi h luo opho e FM4-64 in Nico iana lea es ans o med wi h PCC1-GFP and D177PCC1-GFP. We ound co-localiza ion in he plasma memb ane o PCC1-GFP bu no o he unca ed e sion (Fig. S1). To check he possibili y ha PCC1 is associa ed o he cell wall, p o oplas s we e isola ed om Nico iana ben hamiana ansien ly ans o med wi h 35S::PCC1-GFP and 35S::GFP-PCC1 cons uc s as men ioned abo e. Figu e 1E shows ha luo escence associa ed o GFP was loca ed a he pe iphe y o cell wall- ee p o oplas , hus con i ming ha PCC1 is nei he loca ed in he cell wall no in he lea apoplas . Finally, we also checked whe he luo escence associa ed o PCC1-GFP exp ession was s ill es ic - ed o he plasma memb ane in plasmolysed cells o Nico iana lea es ans o med wi h 35S::PCC1-GFP cons uc . Figu e S2 shows ha GFP luo escence was de ec ed in he wo plasma memb anes o adjacen cells and no luo escence was de ec ed ei he in he apoplas o cell walls o plasmolysed cells. To ule ou he possibili y ha ansien exp ession o A abidopsis PCC1 in Nico iana ben hamiana causes abe an p o ein localiza ion on PM, ansgenic A abidopsis lines s ably exp essing he 35S::PCC1-GFP cons uc we e gene a ed. Figu e 2A shows PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 3 Janua y 2014 | Volume 9 | Issue 1 | e87216 Figu e 1. Plasma memb ane localiza ion o PCC1 p o ein. (A) Bioin o ma ic p edic ion o ansmemb ane po en ial o PCC1 using TMP ed ool. The C- e minal domain wi h posi i e po en ial is w i en in blue in he amino acid sequence below he plo . (B) Ex ac ion o PCC1 p o ein om Nico iana ben hamina lea es ansien ly ans o med wi h 35S::PCC1-GFP cons uc was assessed by using TBS bu e supplemen ed o no wi h di e en de e gen s as indica ed, and u he de ec ed by Wes e n blo wi h an i-GFP an ibodies. Ponceau S-s ained Rubisco is shown as loading con ol. (C) Exp ession o GFP- agged e sions o PCC1 in i s C- (PCC1-GFP) and N- e minus (GFP-PCC1) as wells as he ee GFP con ol (GFP-s op- PCC1) was analyzed by Wes e n blo wi h an i-GFP an ibodies and con ocal mic oscopy. (D) Exp ession o a GFP- agged unca ed PCC1 e sion (D177-PCC1-GFP) wi hou he po en ial C- e minal memb ane-associa ed domain leads o cy oplasmic localiza ion ins ead o he memb ane localiza ion o he whole GFP-PCC1 p o ein. (E) Isola ion o p o oplas s om ansien ly ans o med Nico iana ben hamina lea es con i med he plasma memb ane associa ion o PCC1 and allowed o ule ou cell wall localiza ion. doi:10.1371/jou nal.pone.0087216.g001 PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 4 Janua y 2014 | Volume 9 | Issue 1 | e87216 ha independen ansgenic lines o e exp essing PCC1-GFP displayed a plasma memb ane-associa ed luo escence pa e n simila o ha desc ibed abo e in ansien expe imen s in Nico iana (Fig. 1). Mo eo e , ansgenic lines exp essing 35S::D177PCC1-GFP cons uc showed luo escence in he cy o- plasm and he nuclei (Fig. 2B), hus con i ming ha PCC1 lacking he C- e minal domain is no ancho ed o he plasma memb ane. Because some algo i hms p edic ed plas id subcellula localiza- ion o PCC1, we ocused ou a en ion on hese o ganelles. We ound ha PCC1 was clea ly excluded om chlo oplas s in epide mal lea cells as well as in he gua d cells o s oma a (Fig. S3), hus allowing o ule ou a unc ional associa ion o PCC1 wi h plas ids. PCC1 Homodime iza ion and Ancho ing o he Plasma Memb ane equi e i s C- e minus To check whe he PCC1 may in e ac wi h i sel , we i s conduc ed a yeas wo hyb id (Y2H) app oach. PCC1 p o ein used o he ac i a ion domain (AD) o GAL4 was exp essed in Ma 203 s ain o Saccha omyces ce e isiae as demons a ed by Wes e n blo wi h an an ibody agains he AD (Fig. 3A). Concomi an ly, only yeas ans o med wi h bo h AD-PCC1 and PCC1 used o he binding domain o GAL4 (BD-PCC1) we e able o g ow in His- ee selec i e medium (Fig. 3A), hus sugges ing ha PCC1 in e ac s wi h i sel o o m dime s o highe o de oligome s in yeas . To con i m he in e ac ion in plan a we used Bimolecula Fluo escence Complemen a ion (BiFC) assays in Nico iana ben hamiana. Fluo escence was only obse ed when Nico iana lea es we e ans o med wi h bo h CYFP-PCC1 and NYFP-PCC1 cons uc s leading o YFP econs uc ion in he plasma memb ane (Fig. 3B), hus con i ming bo h he memb ane localiza ion and he in e molecula in e ac ion o PCC1. In e - es ingly, he complemen ed luo escence was de ec ed in bo h plasma memb ane and associa ed esicle-like o ma ions (Fig. 3B). The in e ac ion was u he con i med by immunop ecipi a ion (IP)-based pull-down assays ollowed by Wes e n blo . Nico iana lea es we e co- ans o med wi h PCC1-HA and each o he ollowing cons uc s exp essing PCC1 used o he indica ed ags: PCC1-GFP, GFP-PCC1, GFP-s op-PCC1 and PCC1-myc. A e IP wi h an i-HA, we de ec ed 36 kDa PCC1-GFP and GFP-PCC1 by Wes e n blo wi h an i-GFP an ibody, as well as 24 kDa PCC1- myc in he co esponding immunop ecipi a ed p o eins (Fig. 3C). As a nega i e con ol, no GFP- agged p o ein was pulled down in lea es co- ans o med wi h PCC1-HA and GFP-s op-PCC1 cons uc , which exp esses ee GFP (Fig. 3C), sugges ing ha in e ac ion based on pull-down echniques was speci ic. By using a simila pull-down app oach wi h lea es co- ans o med wi h PCC1-HA and he GFP used o he PCC1 e sion unca ed in i s C- e minus (GFP-D177PCC1) we u he demons a ed ha homodime iza ion o PCC1 equi ed he cys eine- ich C- e minus o he p o ein. Figu e 3D shows ha GFP- used p o ein was de ec ed in he an i-HA-immunop ecipi a ed p o eins om lea es ans o med wi h PCC1-GFP bu no in lea es ans o med wi h GFP-s op-PCC1 o GFP-D177PCC1. The e e se IP wi h an i- GFP an ibodies, which pulled down all h ee GFP, GFP- D177PCC1 and ull size PCC1-GFP p o eins, only allowed de ec ing he HA- agged p o ein in he IP om PCC1-GFP co- ans o med lea es (Fig. 3D). Toge he ou indings demons a e ha PCC1 in e ac s wi h i sel h ough i s C- e minal domain ich in cys eine esidues, which, as shown abo e, is also essen ial o being ancho ed o he plasma memb ane. De elopmen al Pa e n o PCC1 Exp ession We ha e p e iously epo ed ha PCC1 gene exp ession changes h oughou pos -ge mina ion de elopmen , wi h low le els be o e he ansi ion o lowe ing and shi ing o high le els du ing ha de elopmen al ansi ion [2]. A 1.1 kb p omo e sequence ups eam he PCC1 ini ia ion codon was used o he ß- glucu onidase (GUS) epo e gene and he esul ing cons uc was used o ans o m A abidopsis plan s. We hen selec ed h ee independen homozygous p1100PCC1:GUS ansgenic lines, which we e used o check he PCC1-di ec ed exp ession in di e en o gans and a di e en imes a e ge mina ion. In p1100PCC1:GUS lines, he pa e n o exp ession was es ic ed o he ascula issue in oo s, hypoco yls and co yledons, as well as o he s oma a in co yledons be o e he ansi ion om ege a i e o ep oduc i e shoo apical me is em (Fig. 4A-C, F). Howe e , PCC1 exp ession dec eased p og essi ely in co yledons as he ansi ion o ep oduc i e apical me is em app oached (Fig. 4O), which unde ou expe imen al condi ions occu s a ound 9 days a e seed ge mina ion [2]. By 8 days a e ge mina ion, lowe exp ession was de ec ed in s oma a and ascula bundles (Fig. 4C). By day 10, GUS s aining was s ong in he pe ioles o he i s pai o lea es and expanded o he basal pa o lea es and subsequen ly o he es o he lea h ough he ascula issue and mesophyll (Fig. 4D, G). A longe imes a e ge mina ion, he GUS s aining was sp ead all o e he lea blade and ascula u e (Fig. 4E). No exp ession was de ec ed ei he in lowe s (Fig. 4M), siliques (Fig. 4N) o he elonga ion zone o he oo s (Fig. 4K). GUS s aining Figu e 2. Plasma memb ane localiza ion o PCC1 in ansgenic 35S::PCC1-GFP A abidopsis plan s. (A) Le els o PCC1-GFP p o ein in h ee independen homozygous lines and con ol C non- ans o med plan s we e analyzed by Wes e n blo wi h an i-GFP an ibodies. PonceauS-s ained Rubisco is shown as loading con ol. T ansgenic lines 1.6 and 3.8 wi h maximal PCC1 exp ession showed GFP-associa ed luo escence by con ocal mic oscopy in he plasma memb ane. (B) Memb ane-associa ed localiza ion o PCC1-GFP con as s wi h D177PCC1-GFP ha localizes in bo h he cy oplasm and nucleus. The second ow o images o e e y geno ype shows magni ica ion o s oma a gua d cells. doi:10.1371/jou nal.pone.0087216.g002 PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 5 Janua y 2014 | Volume 9 | Issue 1 | e87216 was de ec ed in he oo cap (Fig. 4K, L). The p e iously cha ac e ized SA-induced pa e n o PCC1 exp ession [2] was also con i med in p1100PCC1:GUS plan s wi h s onge s aining all o e SA- ea ed seedling compa ed o un ea ed ones (Fig. 4H-I). PCC1 and he Pho ope iod-Dependen Flowe ing Pa hway The pa e n o exp ession obse ed o PCC1 du ing he e en s in ol ed in con olling he ansi ion o lowe ing unde induc i e Figu e 3. Homodime iza ion o PCC1. (A) The usion o PCC1 wi h he ac i a ion domain (AD) o GAL4 is exp essed in Ma 203 yeas s ain as shown by Wes e n blo wi h an i-AD an ibodies. A nega i e con ol E and he non- ans o med yeas a e also shown ( op panel). G ow h o yeas s co- ans o med wi h AD-PCC1 and PCC1 used o he DNA binding domain o GAL4 (BD-PCC1) bu no wi h AD-PCC1 and he emp y BD ec o in minimal media –Leu – T p –His is indica i e o sel -in e ac ion o PCC1 in yeas wo-hyb id. (B) Bimolecula luo escence complemen a ion (BiFC)- based demons a ion o PCC1-homodime iza ion and localiza ion o dime s in he plasma memb ane o Nico iana ben hamiana lea es ansien ly co- ans o med wi h he indica ed cons uc s. (C) Con i ma ion o PCC1 homodime iza ion by pull-down assays in Nico iana ben hamiana lea es ansien ly co- ans o med wi h PCC1-HA and GFP- and c-myc- agged e sions o PCC1 as indica ed. Immunop ecipi a ion (IP) was pe o med wi h an i-HA and pulled-down p o eins de ec ed by Wes e n blo wi h he polyclonal an ibodies indica ed. (D) Homodime iza ion o PCC1 equi ed he ansmemb ane C- e minal domain as demons a ed by pull-down assays in Nico iana ben hamiana lea es ansien ly co- ans o med wi h PCC1-HA and GFP- agged e sions o comple e and unca ed PCC1 molecules. IPs using an i-HA and an i-GFP ollowed by WB using he indica ed an ibodies a e shown a he le . doi:10.1371/jou nal.pone.0087216.g003 PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 6 Janua y 2014 | Volume 9 | Issue 1 | e87216 long days sugges s ha PCC1 migh be connec ed o o e en pa icipa e in he signaling pa hway con olling he pho ope iod- dependen lowe ing. CONSTANS (CO) and FLOWERING LOCUS T (FT) a e essen ial egula o s in he pho ope iod- dependen lowe ing pa hway [30] and FT has been cha ac e ized as a mobile signal ansloca ed om lea es h ough he ascula issue o he shoo apical me is em (SAM) o ac i a e lowe ing upon in e ac ion wi h FD ansc ip ion ac o [31,32]. The ac ha PCC1 exp ession p og esses om SAM o lea es and, in u n, FT is expo ed om lea es o SAM, migh be ela ed o se e al al e na i e hypo hesis: PCC1 migh in e e e wi h CO ac i a ing FT; o PCC1 migh physically in e ac wi h ei he CO o FT hus modula ing hei localiza ions/ unc ions; o migh in e e e wi h FT ansloca ion o SAM and i s u he in e ac ion wi h FD ansc ip ion ac o . To es he i s hypo hesis, iPCC1/35S::CO- GR/co-2 plan s we e gene a ed by c ossing iPCC1 plan s wi h ex emely educed le els h ough an RNAi app oach [2] o co-2 mu an plan s ans o med o o e exp ess CO used o he Figu e 4. Spa ial pa e n o PCC1 exp ession analyzed wi h pPCC1::GUS ansgenic plan s. GUS-s ained seedlings o (A) 4 days a e sowing (d.a.s.); (B) 6 d.a.s.; (C) 8 d.a.s.; (D) 10 d.a.s.; (E) 14 d.a.s. (F) De ail o GUS-s ained gua d cells o seedling shown in (A). (G) Lea showing showing s aining om he pe iole o he dis al pa s. (H) and (I) Con ol un ea ed and 0.1 mM SA- ea ed 14-day old seedlings, espec i ely. (J) Vascula issue s ained in he uppe pa o oo s. (K) Absence o GUS s aining in he elonga ion zone and ip o oo s. (L) De ail o s ained calyp a. (M) and (N) Absence o exp ession in lowe and siliques, espec i ely. (O) Time-cou se o GUS s aining in co yledons a di e en imes a e ge mina ion showing he s oma a- and ascula issue-associa ed pa e ns. The gene a ion o pPCC1::GUS ansgenic lines and he p o ocols used o GUS s aining we e p e iously epo ed [33]. doi:10.1371/jou nal.pone.0087216.g004 PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 7 Janua y 2014 | Volume 9 | Issue 1 | e87216 Glucoco icoid Recep o . Because bo h cons uc s con ained esis ance o kanamycin as selec ion ma ke , we de eloped a PCR-based geno yping p ocedu e using speci ic p ime s o CO and PCC1 and common p ime s om 35S p omo e sequence. We con i med by qRT-PCR ha homozygous double ansgenic plan s o e exp essed CO while showing s ongly educed PCC1 le els (Fig. 5A). Mo eo e , FT exp ession was ac i a ed upon Dex ea men by inducing CO nuclea ansloca ion (Fig. 5A). We obse ed ha despi e he s ong down- egula ion o PCC1, double ansgenic plan s only lowe ed ea lie in he p esence o Dex, his is, when FT was ac i a ed (Fig. 5B). These da a suppo ha PCC1 is no equi ed o he ac i a ion o FT by CO and he subsequen lo al ansi ion. To es whe he PCC1 migh in e ac in plan a wi h CO o FT, BiFC was used in Nico iana ben hamiana lea es co- ans o med wi h he co esponding p o eins used o N- and C- e minal pa s o YFP. Nei he co- ans o ma ion wi h CO and PCC1 o FT and PCC1 we e able o econs uc GFP luo escence (Fig. 5C). As a posi i e con ol, he p e iously epo ed in e ac ion o FT and FD was obse ed in he nuclei (Fig. 5C). In ol emen o PCC1 in Ligh -Regula ed De elopmen PCC1 egula es lowe ing ime, as demons a ed by he la e lowe ing pheno ype obse ed in iPCC1 plan s g own unde long day pho ope iodic condi ions [2]. Howe e , his seems o be no ela ed o in e e ence wi h he unc ion o he well cha ac e ized egula o s o he pho ope iod-dependen lowe ing pa hway as demons a ed abo e. Al e na i ely, PCC1 con ol o his de elop- men al ansi ion migh be ela ed o o he key ac o such as ligh pe cep ion ope a ing in his pa hway. Nex , we checked whe he iPCC1 plan s migh display o he ligh - ela ed pheno ypes. The pho omo phogenic inhibi ion o hypoco yl elonga ion, co yledon opening and acquisi ion o pho osyn he ic compe ence is con- olled h ough ligh pe cep ion and downs eam signaling in ol ing Phy och ome In e ac ing Fac o s (PIFs) as well as gibbe ellin- ela ed DELLA p o eins [7,8]. We analyzed whe he iPCC1 seedlings displayed di e en ial hypoco yl elonga ion pheno ypes compa ed o wild ype seedlings unde di e en quali ies o ligh . Figu e 6A shows ha iPCC1 hypoco yls g ew longe han hose o wild ype seedlings unde blue, ed and a - ed ligh s. Whe eas iPCC1 hypoco yls we e also longe han wild ype ones unde whi e ligh (Fig. 6C and Fig. S4), iPCC1 hypoco yls we e no signi ican ly longe han wild ype unde da kness (Fig. S4). Longe hypoco yls in a ed, ed, o blue ligh s migh be ela ed o de iciency in he pe cep ion o hose quali ies o ligh s h ough phy och omes and c yp och omes, espec i ely. Howe e , based on compa a i e ansc ip ome analysis o iPCC1 s wild ype seedlings [33], no s a is ically signi ican change in he ansc ip le els o he phy och ome and c yp och ome encoding genes was de ec ed (Table S1). Because iPCC1 hypoco yls we e no as long as hose om phyA mu an unde a ed ligh , phyB mu an unde ed ligh o as hose om c y1c y2 double mu an unde blue ligh , we belie e ha iPCC1 seedlings a e somehow pa ially blind o ligh in gene al, o possibly de ec i e in downs eam componen s o ligh signaling cascades ha a e common o di e en ligh quali ies. Rega ding his, he le els o PCC1 ansc ip a e up- egula ed in he phyB mu an and, in u n, down- egula ed in c y1,c y2 and c y1c y2 mu an s when compa ed o wild ype plan s (Fig. 6B) sugges ing ha ed and blue ligh signaling exe s nega i e and posi i e modula ion, espec i ely, on PCC1 gene exp ession. Since GAs p omo e hypoco yl elonga ion, we es ed whe he iPCC1 and wild ype seedlings esponded simila ly o exogenous GAs unde whi e ligh . Figu e 6C shows ha iPCC1 hypoco yls we e as esponsi e as wild ypes o 4 mM GA 3 ea men . By con as , a 15 mMGA 3 wild ype hypoco yls we e s ill esponsi e o GAs bu iPCC1 hypoco yls we e no esponsi e anymo e (Fig. 6C). We also checked he e ec o he GA syn hesis inhibi o paclobu azol (PAC) on hypoco yl elonga- ion unde di e en ligh quali ies. The s ong hypoco yl sho ening e ec exe ed by PAC was obse ed in bo h wild ype and iPCC1 hypoco yls g own unde blue, ed and a - ed ligh s, bu iPCC1 hypoco yls we e s ill signi ican ly longe han wild ypes in e e y condi ion es ed (Fig. 6D). Because GA signaling is a key egula o y ac o in he con ol o hypoco yl elonga ion, we es ed by qRT-PCR he ansc ip le els o GA ecep o and DELLA Figu e 5. PCC1 does no in e e e wi h pho ope iod dependen lo al ansi ion pa hway no in e ac s wi h i s egula o y componen s. (A) PCC1,CO and FT ansc ip le els in wild ype, double ansgenics iPCC1/35S::CO-GR and hei pa en al plan s in he absence and p esence o 10 mM o he GR ligand dexame hasone (DEX). (B) Flowe ing ime quan i ied by coun ing o al ( ose e plus cauline) lea es in long day-g own plan s o he geno ypes desc ibed in (A) ea ed o no wi h DEX. * ep esen s s a is ically signi ican (p,0.05 in S uden s - es ) di e en alues in DEX- ea ed compa ed o un ea ed (Mock) seedlings. (C) Analysis o po en ial in e ac ions be ween PCC1 and CO o FT by BiFC. The in e ac ion be ween FT and FD in nuclei is shown as posi i e con ol. doi:10.1371/jou nal.pone.0087216.g005 PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 8 Janua y 2014 | Volume 9 | Issue 1 | e87216 encoding genes in wild ype and iPCC1 seedlings. Figu e 6E shows ha genes coding o he GA ecep o s, GID1a,GID1b and GID1c, we e all sligh ly bu signi ican ly down- egula ed in iPCC1 seedlings, hus suppo ing ha GA pe cep ion migh be al e ed in iPCC1 plan s. Nei he RGA no GAI gene ansc ip s we e signi ican ly al e ed in iPCC1 seedlings (Fig. 6E). Whe he de icien gibbe ellins pe cep ion migh be esponsible o he delayed lowe ing obse ed in iPCC1 plan s will equi e u he wo k. In summa y, he pa ial sko omo phogenic pheno ype unde di e en ligh quali ies and he al e ed sensi i i y o GAs in iPCC1 plan s as well as he opposi e egula ion exe ed by PHYB and CRY pho o ecep o s on PCC1 exp ession, poin o PCC1 as an impo an egula o y node in pho omo phogenic esponses. Y2H-based Sc eening Re eals he In e ac ion be ween PCC1 and he Subuni 5 o he COP9 Signalosome To cla i y he way PCC1 may exe egula ion on ligh - egula ed de elopmen we conduc ed a Y2H sc eening o p o ein in e ac o s o PCC1. Fo ha pu pose, a unca ed e sion o PCC1 con aining he i s 59 amino acids, hus lacking he C- e minal domain equi ed o memb ane ancho ing, was used o he DNA binding domain o GAL4 (N-Gal4-PCC1(1-59)-C) and used as bai o sc een an A abidopsis lib a y o cDNA clones om 7-day old A abidopsis seedlings used o he ac i a ion domain o GAL4. Among 31 posi i e clones de ec ed ou o 129 million possible in e ac ions es ed in he Y2H sc eening, 7 clones esul ed o be ei he ou o ame o an isense sequence clones and we e consequen ly disca ded. Ano he 21 posi i e clones co esponded o di e en sequences spanning he locus coding o he CSN5A subuni o he COP9 signalosome (CSN). I has been p e iously epo ed ha CSN5A binds he DNA binding domain o GAL4 and is hus equen ly conside ed as a alse posi i e in e ac o in many di e en Y2H sc eenings [34]. The es 3 iden ical clones co esponded o he sequence be ween nucleo ides 90 o 1207 o he A 1g71230 coding o CSN5B/AJH2, he o he subuni 5 o CSN. To con i m he s eng h o he in e ac ion be ween PCC1 and CSN5B/AJH2, he clones isola ed in he sc eening we e co- ans o med in Saccha omyces ce e isiae s ain AH109 and he ans o med yeas was pla ed in SC minimum medium (-His- Leu-T p) supplemen ed wi h inc easing concen a ions o 3- amino iazole (3-AT). E en a 20 mM 3-AT he g ow h o doubly ans o med yeas s was clea ly supe io ela i e o he yeas s ans o med wi h he GAL4AD-CSN5B and he emp y GAL4BD- plasmids (Fig. 7A), hus sugges ing a s ong in e ac ion be ween PCC1 and CSN5B. Because he Y2H sys em is an he e ologous p ocedu e o es plan p o ein-p o ein in e ac ions cau ion is equi ed when in e p e ing hose da a. The in plan a in e ac ion be ween wo p o eins mus ul ill opological c i e ia wi h subcellula localiza ions being consis en wi h po en ial in e ac ion. I has been epo ed ha CSN5A in i s monome ic o m is loca ed in he cy oplasm and nuclei [35]. We ha e ansien ly ans o med Nico iana ben hamina wi h a 35S::GFP-CSN5B cons uc and ound ha , simila ly o CSN5A, luo escence was de ec ed in he cy oplasm and nucleus and i can no be uled ou he possibili y ha is also localized in he plasma memb ane (Fig. 7B). By using BiFC, he in e ac ion be ween PCC1 and bo h subuni s CSN5A and CSN5B o CSN has been con i med in Nico iana. Figu e 7C shows ha he YFP luo escence was econs uc ed in he plasma memb ane. I has been widely cha ac e ized ha CSN unc ions by clea ing he ubiqui in-like p o ein RUB/NEDD8 om cullins [36], which a e essen ial componen s in he SCF (Skip1-cullin-F-box) com- plexes in ol ed as E3 ubiqui in ligases in he ubiqui in-p o easome pa hway, which is he p eponde an p o ein u no e sys em in plan s [37,38]. RUB modi ica ion o cullins has been cha ac e ized o ac i a e he E3 ubiqui in ligase ac i i y [39] and hus CSN should unc ion as a nega i e egula o o SCF complexes. Howe e , gene ic app oaches ha e es ablished ha CSN unc ions in i o p omo ing E3 ubiqui in ligase ac i i y as a consequence o he p o ec i e e ec exe ed on SCF p o ein adap o s by limi ing hei au oca aly ic deg ada ion [40]. We ha e checked whe he iPCC1 plan s display al e ed CSN-media ed clea age o cullin1 (CUL1) when compa ed o wild ype plan s. Figu e 7D shows ha iPCC1 displayed le els o RUB-CUL1 and CUL1 simila o wild ype plan s, which sugges s ha PCC1 does no in e e e wi h de- ubyla ing ac i i y o CSN, a leas ega ding o CUL1. Discussion Despi e i s small size and he lack o well cha ac e ized domains in o ming abou i s po en ial unc ions, PCC1 p o ein has a signi ican impac on a wide a ay o physiological p ocesses including pola lipid con en , ABA- ela ed esponses and pa hogen de ense in A abidopsis [33]. PCC1 was ini ially iden i ied as a gene wi h a ci cadian con olled pa e n o exp ession and unc ionally ela ed o de ense agains bio ophic pa hogens [1]. I was u he cha ac e ized as a gene wi h a s ic ly SA-dependen exp ession ha seems o be in ol ed in con olling bo h s ess-induced and non s essed lowe ing [2]. Whe eas he pheno ypic e ec s o PCC1 gain- and loss-o unc ion ha e been widely desc ibed [1,2,33], much less is known ega ding he biochemis y and cell biology o PCC1 p o ein. He e we ha e cha ac e ized PCC1 as a plasma memb ane associa ed p o ein ha homodime izes and equi es i s C- e minal domain o be ancho ed o he memb ane. The C- e minus o PCC1 p o ein is a cys eine- ich domain ha has being used o classi y his p o ein as a membe o he so-called Cys eine- ich T ans Memb ane (CYSTM) domain-con aining p o eins [3]. This amily o p o eins has been p oposed o be in ol ed in esis ance o s ess and pa icula ly agains dele e ious subs ances likely h ough he al e ed edox po en ial o he memb ane due o he peculia a angemen o se e al sul hyd yl g oups wi hin he memb ane [3]. The al e a ion o he memb ane edox po en ial migh be de e minan o quenching adical species o o a ec he up ake o me al ions, which has been al eady epo ed o CDT1, ano he plan membe o he CYSTM supe amily, in ol ed in he exclusion o hea y me als in Digi a ia cilia is and O yza sa i a [41]. Besides, i has been also p oposed ha he N- e minal pola diso de ed head o he CYSTM p ope ies migh unde ce ain condi ions assume a ce ain deg ee o s uc u e ha could be impo an o al e na i e unc ions in he cy oplasm. In his ega d, he diso de ed egion ups eam o he CYSTM domain has an amino acid composi ion and o ganiza ion simila o p ion-like p o eins ha may assume al e na i e con o ma ions [3]. Al hough a unca ed e sion o PCC1 lacking i s CYSTM-con aining C- e minal domain los he speci ic plasma memb ane localiza ion o he ull-leng h p o ein, we do no ha e da a suppo ing whe he CYSTM domain migh be impo an o PCC1 unc ion. Fu he compa a i e wo k wi h plan s exp essing ei he he ull-leng h o unca ed e sions o PCC1 will help o cla i y whe he he di e en domains o PCC1 migh be impo an o he egula o y oles exe ed by his p o ein in p e iously desc ibed pheno ypes o e en in s ill uncha ac e ized new p ocesses ela ed o PCC1 unc ion. Ou analysis o he spa ial and empo al pa e n o PCC1 exp ession by using ansgenic A abidopsis plan s exp essing he GUS epo e gene unde he con ol o a 1.1 kb p omo e sequence o PCC1 locus allowed o unco e a dual pa e n o exp ession dis inguishable bo h spa ially and empo ally. Du ing PCC1-CSN In e ac ion and Ligh Signaling PLOS ONE | www.plosone.o g 9 Janua y 2014 | Volume 9 | Issue 1 | e87216