nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 1
BRIEF RESEARCH REPORT
published: 13 Sep embe 2019
doi: 10.3389/ nana.2019.00083
Edi ed by:
Li ia D’Angelo,
Uni e si y o Naples Fede ico II, I aly
Re iewed by:
Hi omasa Funa o,
Toho Uni e si y, Japan
Pie e-Y es Risold,
Uni e si y o F anche-Com é, F ance
*Co espondence:
An ón Ba ei o-Iglesias
[email p o ec ed]
Recei ed: 29 July 2019
Accep ed: 02 Sep embe 2019
Published: 13 Sep embe 2019
Ci a ion:
Sob ido-Cameán D,
Yáñez-Gue a LA, Lamanna F,
Conde-Fe nández C, Kaessmann H,
Elphick MR, Anadón R, Rodicio MC
and Ba ei o-Iglesias A (2019) Galanin
in an Agna han: P ecu so
Iden i ica ion and Localisa ion
o Exp ession in he B ain o he Sea
Lamp ey Pe omyzon ma inus.
F on . Neu oana . 13:83.
doi: 10.3389/ nana.2019.00083
Galanin in an Agna han: P ecu so
Iden i ica ion and Localisa ion o
Exp ession in he B ain o he Sea
Lamp ey Pe omyzon ma inus
Daniel Sob ido-Cameán1, Luis Al onso Yáñez-Gue a2, F ancesco Lamanna3,
Candela Conde-Fe nández1, Hen ik Kaessmann3, Mau ice R. Elphick2, Ramón Anadón1,
Ma ía Celina Rodicio1and An ón Ba ei o-Iglesias1*
1Depa men o Func ional Biology, CIBUS, Facul y o Biology, Uni e sidade de San iago de Compos ela, San iago
de Compos ela, Spain, 2School o Biological and Chemical Sciences, Queen Ma y Uni e si y o London, London,
Uni ed Kingdom, 3Cen e o Molecula Biology o Heidelbe g Uni e si y (ZMBH), DKFZ-ZMBH Alliance, Heidelbe g,
Ge many
Galanin is a neu opep ide ha is widely exp essed in he mammalian b ain, whe e i
egula es many physiological p ocesses, including eeding and nocicep ion. Galanin
has been cha ac e ized ex ensi ely in jawed e eb a es (gna hos omes), bu li le is
known abou he galanin sys em in he mos ancien ex an e eb a e class, he
jawless e eb a es o agna hans. He e, we iden i ied and cloned a cDNA encoding
he sea lamp ey (Pe omyzon ma inus) galanin p ecu so (PmGalP). Sequence analysis
e ealed ha PmGalP gi es ise o wo neu opep ides ha a e simila o gna hos ome
galanins and galanin message-associa ed pep ides. Using mRNA in si u hyb idiza ion,
he dis ibu ion o PmGalP-exp essing neu ons was mapped in he b ain o la al
and adul sea lamp eys. This e ealed PmGalP-exp essing neu ons in he sep um,
p eop ic egion, s ia um, hypo halamus, p e halamus, and displaced cells in la e al
a eas o he elencephalon and diencephalon. In adul s, he la e ally mig a ed PmGalP-
exp essing neu ons a e obse ed in an a ea ha ex ends om he en al pallium o
he la e al hypo halamus and p e halamus. The s ia al and la e ally mig a ed PmGalP-
exp essing cells o he elencephalon we e no obse ed in la ae. Compa ison wi h
s udies on jawed e eb a es e eals ha he p esence o sep al and hypo halamic
galanin-exp essing neu onal popula ions is highly conse ed in e eb a es. Howe e ,
compa ed o mammals, he e is a mo e es ic ed pa e n o exp ession o he galanin
ansc ip in he b ain o lamp eys. This wo k p o ides impo an new in o ma ion on
he ea ly e olu ion o he galanin sys em in e eb a es and p o ides a gene ic and
neu oana omical basis o unc ional analyses o he galanin sys em in lamp eys.
Keywo ds: lamp ey, galanin, elencephalon, hypo halamus, s ia um, neu opep ides
Abb e ia ions: B3, hombencephalic Mülle cell 3; Ch, op ic chiasm; DCN, do sal column nucleus; DHyp, do sal
hypo halamus; dLP, la e al pallium, do sal pa ; , asciculus e o lexus; Ha, habenula; Hyp, hypo halamus; IS, is hmus;
lHa, le habenula; LHyp, la e al hypo halamus; LP, la e al pallium; M1-3, gian Mülle cells 1 o 3; Ma, Mau hne
neu on; MI, gian is hmic neu on (i.e., I1 neu on); MLFn, nucleus o he medial longi udinal ascicle; MP, medial pallium;
NH, neu ohypophysis; OB, ol ac o y bulb; ON, op ic ne e; OT, op ic ec um; o , op ic ac ; P, pineal o gan; PC,
pos e io commissu e; PO, p eop ic nucleus; PoC, pos op ic commissu e nucleus; PoR, pos op ic ecess; PT, p e ec um;
PTh, p e halamus; PTN, pos e io ube cle nucleus; Rh, hombencephalon; Ha, igh habenula; SC, spinal co d; ShL,
subhippocampal lobe; Sp, sep um; S , s ia um; Th, halamus; TS, o us semici cula is; VHyp, en al hypo halamus; LP,
la e al pallium, en al pa ; Vm, igeminal mo o nucleus; Xm, agal mo o nucleus; zl, zona limi ans in a halamica.
F on ie s in Neu oana omy | www. on ie sin.o g 1Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 2
Sob ido-Cameán e al. Sea Lamp ey Galanin
INTRODUCTION
The neu ope ide galanin was named as such because in mos
species i con ains an N- e minal glycine and a C- e minal
alanine (Ta emo o e al., 1983). The ma u e galanin pep ide
comp ises 29–30 esidues and is clea ed om a p o-pep ide
p ecu so ha also gene a es he longe galanin message-
associa ed pep ide (GMAP; 60 esidues in humans). The
N- e minal pa o he ma u e galanin pep ide is c ucial o i s
biological ac i i y and is highly conse ed in jawed e eb a es.
Galanin is exp essed in he cen al and pe iphe al ne ous
sys ems and signals ia h ee ecep o sub ypes o egula e many
physiological p ocesses, including eeding, a ousal/sleep, lea ning
and memo y, pi ui a y ho mone elease, ne e egene a ion,
s ess/anxie y, nocicep ion/pain and he mo egula ion ( o
e iews see Lang e al., 2007, 2015;Šípko á e al., 2017).
The galanin p o-pep ide has been iden i ied biochemically
o gene ically in many jawed e eb a es, including mammalian
and non-mammalian species, and he galanine gic sys em has
been ex ensi ely cha ac e ized in he b ain o jawed e eb a es
( o e iews see Mensah e al., 2010;Lang e al., 2015). In
mammals, including humans, galanin is widely exp essed in he
b ain wi h galanin-exp essing neu onal popula ions p esen in
he elencephalon, hypo halamus and b ains em (Rökaeus e al.,
1984;Sko i sch and Jacobowi z, 1985;Kaplan e al., 1988;Co és
e al., 1990;Elmquis e al., 1992;Ko dowe e al., 1992;Palko i s
and Ho á h, 1994;Cheung e al., 2001;Pé ez e al., 2001; o
a e iew see Jacobowi z e al., 2004). In amphibians, ep iles
and bi ds, he elencephalon, hypo halamus, mesencephalon
and hombencephalon also con ain galanin-exp essing neu ons
(Lázá e al., 1991;Oli e eau and Oli e eau, 1992;Józsa and Mess,
1993;Jiménez e al., 1994). Howe e , in ishes he exp ession
o galanin appea s o be mo e es ic ed o elencephalic and
hypo halamic a eas (Valla ino e al., 1991;Unniappan e al., 2004;
Ad io e al., 2005;Rod íguez Díaz e al., 2011; o a e iew see
Mensah e al., 2010).
In con as o jawed e eb a es, he e is e y li le in o ma ion
on he galanin sys em o jawless e eb a es o agna hans, which
include lamp eys. Agna hans occupy a key phylogene ic posi ion
a he base o he e eb a e ee, which makes hem in e es ing
models o unde s and he ea ly e olu ion o neu opep ide gic
sys ems in e eb a es. In addi ion, lamp eys ha e complex li e
cycles wi h e y di e en la al and adul s ages in e ms o hei
ana omy and eeding beha io , which p o ides an excellen model
o unde s and he oles ha a gi en neu opep ide gic sys em
plays in di e en beha io al ci cums ances in he same species.
Only a ew s udies ha e looked a he o ganiza ion o he
galanin sys em in lamp eys (Buchanan e al., 1987;Jiménez e al.,
1996;Pombal and Puelles, 1999;Yáñez e al., 1999;Bosi e al.,
2004). These s udies we e conduc ed using an ibodies gene a ed
agains po cine galanin and epo ed he dis ibu ion o galanin-
like immuno eac i i y in he spinal co d (Buchanan e al., 1987),
b ain (Jiménez e al., 1996), and pa apineal o gan (Yáñez e al.,
1999) o adul lamp eys. Galanin-like-immuno eac i e (i ) ibe s,
bu no immuno eac i e neu ons, a e p esen in he spinal
co d o adul lamp eys, mainly in i s la e al egion (Buchanan
e al., 1987). In he b ain, galanin-like-i neu ons a e p esen
in he elencephalon, hypo halamus and p e halamus, bu no
in he mesencephalon o hombencephalon (Jiménez e al.,
1996). Galanin-like-i ibe s ha e been also desc ibed in di e en
b ain egions, including he p osencephalon, mesencephalon and
hombencephalon (Jiménez e al., 1996), and he pa apineal
o gan (Yáñez e al., 1999) o adul lamp eys. Howe e , he
galanin p ecu so ansc ip /pep ide has no ye been iden i ied
in lamp eys and he oles o galanin in he sea lamp ey
CNS a e no known.
He e, we epo he iden i ica ion o he galanin p ecu so
ansc ip o he sea lamp ey Pe omyzon ma inus (PmGalP).
Sequence analyses e ealed ha his p o-pep ide con ains galanin
and GMAP pep ide sequences. We also epo he pa e n o
exp ession o PmGalP in he CNS o bo h la al and adul animals
by means o in si u hyb idiza ion (ISH). Ou esul s con i med
he p esence o he known galanin-exp essing pe i en icula
neu onal popula ions o lamp eys, bu we also disco e ed he
exis ence o o he PmGalP-exp essing neu onal popula ions,
including he p esence o la e ally mig a ed neu ons in he
diencephalon and hypo halamus. Ou esul s p o ide a gene ic
and neu oana omical basis o u u e unc ional s udies on he
ole o galanin and GMAP in he CNS o lamp eys.
MATERIALS AND METHODS
Animals
La al (n= 10) and adul (downs eam mig a ing young adul s,
n= 2; ups eam mig a ing adul s, n= 3) sea lamp eys, P. ma inus
L., we e used o his s udy. Downs eam mig a ing young
adul s and la ae (ammocoe e: leng hs comp ised be ween 80
and 120 mm, 4–7 yea s old) we e collec ed om he Ri e Ulla
(Galicia, Spain) wi h pe mission om he Xun a de Galicia.
Ups eam mig a ing adul s we e acqui ed om local supplie s.
Adul s we e ixed eshly, and la ae we e main ained in aqua ia
con aining i e sedimen and wi h app op ia e eeding, ae a ion
and empe a u e condi ions un il he day o use. Be o e all
expe imen s, animals we e deeply anes he ized wi h 0.1% icaine
me hanesul ona e (MS-222; Sigma, S . Louis, MO, Uni ed S a es)
in esh wa e and killed by decapi a ion. All expe imen s we e
app o ed by he Bioe hics Commi ee a he Uni e si y o
San iago de Compos ela and he Conselle iìa do Medio Ru al
e do Ma o he Xun a de Galicia (License Re . JLPV/IId) and
we e pe o med in acco dance wi h Eu opean Union and Spanish
guidelines on animal ca e and expe imen a ion.
Cloning and Sequencing o he PmGalP
cDNA
The PmGalP sequence was iden i ied in a cus om anno a ion o
p o ein-coding genes (unpublished da a) based on he P. ma inus
ge mline genome (Smi h e al., 2018). This sequence was
deposi ed in GenBank unde accession numbe MK977616.
La ae (n= 5) we e anes he ized as indica ed abo e
and he b ain and spinal co d we e dissec ed ou unde
s e ile condi ions. To al RNA was isola ed om hese issues
using he T iPu e eagen (Roche, Mannheim, Ge many).
The i s -s and cDNA syn hesis eac ion om o al RNA
F on ie s in Neu oana omy | www. on ie sin.o g 2Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 3
Sob ido-Cameán e al. Sea Lamp ey Galanin
was ca alyzed wi h Supe sc ip III e e se ansc ip ase
(In i ogen, Wal ham, MA, Uni ed S a es) using andom
p ime s (hexame s; In i ogen). Fo polyme ase chain
eac ion (PCR) cloning, speci ic oligonucleo ide p ime s
( o wa d: 50-TCTGCGTGCCATCATCGACT-30; e e se: 50-
TTACGCTTAGCTCGCCACGA-30) we e designed based on
he PmGalP ansc ip sequence. The ampli ied agmen s we e
cloned in o pGEM-T easy ec o s (P omega, Madison, WI,
Uni ed S a es) using s anda d p o ocols and sequenced by GATC
Bio ech (Cologne, Ge many) using Sange sequencing, which
con i med he o iginal sequence.
Alignmen o he PmGalP Sequence Wi h
Galanin P ecu so Sequences F om
O he Ve eb a es and Phylogene ic
Analyses
The amino acid sequence o he PmGalP (GenBank; MK977616)
was ob ained by ansla ion o he cDNA sequence using
ExPASy (Gas eige e al., 2003), and he signal pep ide was
p edic ed using SignalP 4.0 (Pe e sen e al., 2011). The PmGalP
sequence was aligned wi h galanin p ecu so s om a a ie y
o e eb a e species, including mammals, sau opsids, lobe-
inned ishes, ay- inned ishes, and ca ilaginous ishes (see
sec ion “Supplemen a y File S1” o a lis o he sequences
used). The alignmen s shown in Figu e 1B and Supplemen a y
Figu e S1 we e pe o med using MAFFT (Ka oh e al., 2017),
wi h he numbe o maximum i e a ions se o 1000 o
ensu e an op imal alignmen . The sco ing ma ix used was
BLOSUM62. The alignmen gene a ed was highligh ed using he
so wa e BOXSHADE1wi h 80% conse a ion as he minimum.
Finally, he sequences we e highligh ed in phylum-speci ic
colo s: mammals (pu ple), sau opsids (o ange), lobe- inned
ishes (yellow), ay- inned ishes (g een), ca ilaginous ishes
(pink), and agna hans (blue).
A phylogene ic analysis o galanin p ecu so s was pe o med
using he Neighbo -Joining me hod (Sai ou and Nei, 1987). The
amino acid sequences o ull- leng h p ecu so s (see sec ion
“Supplemen a y File S1” o a lis o he sequences) we e aligned
using MAFFTT and a ee was gene a ed, he Ciona in es inalis
galanin-like pep ide p ecu so was designa ed as an ou g oup.
The pe cen age o eplica e ees in which he associa ed axa
clus e ed oge he in he boo s ap (E on e al., 1996) es (1000
eplica es) a e shown nex o he b anches. The subs i u ion
model used was Jones-Taylo -Tho n on Gamma dis ibu ed.
The ee is d awn o scale, wi h b anch leng hs in he same
uni s as hose o he e olu iona y dis ances used o in e he
phylogene ic ee. The phylogene ic analysis was conduc ed in
MEGA7 (Kuma e al., 2016).
In si u Hyb idisa ion
Templa es o in i o ansc ip ion we e p epa ed by
PCR ampli ica ion as ollows. A 352-base pai (bp)
agmen o he PmGalP sequence was ob ained using
he p ime s desc ibed bu in his case, he e e se p ime
1www.ch.embne .o g/so wa e/BOX_ o m.h ml
included he sequence o he uni e sal T7 p omo e
(TAAGCTTTAATACGACTCACTATAGGGAGA). Fo he
gene a ion o sense p obes, he sequence o he T7 p omo e
was included in he o wa d p ime s. Digoxigenin (DIG)-labeled
ibop obes we e syn hesized using he ampli ied agmen s
as empla es and ollowing s anda d p o ocols using a T7
polyme ase (Nzy ech, Lisbon, Po ugal).
The me hods employed o mRNA in si u hyb idisa ion we e
he same as p e iously desc ibed o y osine hyd oxylase, a 5-
HT1a ecep o and a GABAB ecep o (Ba ei o-Iglesias e al.,
2010;Co nide-Pe onio e al., 2013;Romaus-Sanju jo e al.,
2016). B ie ly, he b ains/ os al spinal co ds o la ae and young
and ma u e adul s we e dissec ed ou and ixed by imme sion o
12 h in 4% pa a o maldehyde (PFA) in phospha e-bu e ed saline
(PBS) a 4◦C. Then, hey we e c yop o ec ed wi h 30% suc ose
in PBS, embedded in Tissue-TekR
O.C.T.TM Compound (Saku a,
To ance, CA, Uni ed S a es), ozen in liquid ni ogen-cooled
isopen ane, and cu se ially on a c yos a (14µm hickness) in
ans e se planes. Sec ions we e moun ed on Supe os R
Plus
glass slides (Menzel, B unswick, Ge many). The sec ions we e
incuba ed wi h he PmGalP DIG-labeled an isense ibop obe
(1µg/mL) a 70◦C o e nigh in hyb idiza ion mix and ea ed
wi h RNAse A (Sigma) in he pos -hyb idiza ion washes. Then,
he sec ions we e incuba ed wi h a sheep an i-DIG an ibody
conjuga ed o alkaline phospha ase (1:2000; Roche) o e nigh
a 4◦C. S aining was conduc ed in BM Pu ple (Roche) a 37◦C
un il he signal was clea ly isible. No s aining was de ec ed
when using sense p obes. Finally, he sec ions we e moun ed in
MowiolR
(Sigma).
Imaging
Pho omic og aphs we e ob ained wi h an BX51 mic oscope
equipped wi h a DP71 digi al came a (Olympus, Tokyo,
Japan). Pla es o pho omic og aphs and minimal b igh /con as
adjus men s we e pe o med wi h Pho oshop CS (Adobe).
D awings we e done wi h Co elD aw 2019.
Nomencla u e
Fo he nomencla u e o b ain egions and b ain nuclei
we ollowed he nomencla u e used by ou g oup in
ecen s udies on he o ganiza ion o di e en neu onal
sys ems (including neu opep ide gic sys ems) in he sea
lamp ey b ain (Ba ei o-Iglesias e al., 2017;Fe nández-
López e al., 2017). In some ins ances, equi alencies o
nomencla u es used by o he au ho s a e men ioned in
he esul s and discussion. The eade s should ake in o
accoun ha in lamp eys mos ma u e neu ons a e loca ed in
pe i en icula loca ions in he b ain and do no mig a e away
om he en icle.
RESULTS
Iden i ica ion o PmGalP and Sequence
Analysis
Analysis o P. ma inus ge mline genome sequence da a
e ealed he occu ence o a candida e galanin p ecu so in
F on ie s in Neu oana omy | www. on ie sin.o g 3Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 4
Sob ido-Cameán e al. Sea Lamp ey Galanin
FIGURE 1 | Con inued
F on ie s in Neu oana omy | www. on ie sin.o g 4Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 5
Sob ido-Cameán e al. Sea Lamp ey Galanin
FIGURE 1 | Iden i ica ion o a galanin p ecu so in he sea lamp ey Pe omyzon ma inus. (A) Nucleo ide sequence (lowe case) o a ansc ip ha encodes he
Pe omyzon ma inus galanin p ecu so (PmGalP; uppe case). The s a and s op codons a e highligh ed in g een. The p edic ed signal pep ide sequence is shown
in blue and dibasic clea age si es a e shown in g een. The pu a i e galanin pep ide de i ed om he p ecu so p o ein is shown in ed, wi h he C- e minal glycine
ha is subs a e o amida ion shown in o ange. The p ime s used o cloning o a agmen o PmGalP cDNA a e highligh ed in yellow. (B) Alignmen o a egion o
PmGalP, including he galanin pep ide bounded by dibasic clea age si es, wi h he co esponding egion o galanin p ecu so p o eins om o he e eb a e species.
Conse ed esidues a e highligh ed, wi h conse a ion in mo e han 70% o sequences shown in black and wi h conse a i e subs i u ions shown in g ay.
(C) Neighbo -joining ee showing ela ionships o galanin- ype p ecu so s in selec ed cho da e species. The pe cen age o eplica e ees in which he associa ed
axa clus e ed oge he in he boo s ap es (1000 eplica es) a e shown nex o he b anches. The analysis was conduc ed in MEGA 7. The u ocho da e galanin-like
sequence om Ciona in es inalis (Cin ) was used o oo he ee and is highligh ed in g ay. Species names in he alignmen (B) a e as ollows: Hsap (Homo sapiens),
B au (Bos au us), Rno (Ra us no egicus), Ssc (Sus sc o a), Ggal (Gallus gallus), Asin (Alliga o sinensis), Lcha (La ime ia chalumnae), S hi (Sinocyclocheilus
hinoce ous), D e (Danio e io), Amex (As yanax mexicanus), Locu (Lepisos eus ocula us), R yp (Rhincodon ypus), Cmil (Callo hinchus milii), Pma (Pe omyzon
ma inus). Addi ionally, in he alignmen (B) and he phylogene ic ee (C), species names a e highligh ed in axon-speci ic colo s: pu ple (mammals), o ange
(sau opsids), yellow (lobe- inned ishes), g een ( ay- inned ishes), pink (ca ilaginous ishes), blue (agna hans). The accession numbe s and he alignmen o he
sequences used o build his phylogene ic ee a e shown in Supplemen a y File S1.
P. ma inus (PmGalP; GenBank accession numbe MK977616).
PmGalP is a 118- esidue p o ein (Figu e 1) wi h a 23- esidue
signal pep ide, a 26 esidue galanin-like pep ide bounded by
dibasic clea age si es (Figu e 1A) and a 56- esidue galanin-
associa ed pep ide-like sequence ha spans om he second
dibasic clea age si e o he C- e minus o he p ecu so
(Supplemen a y Figu e S1).
The sequence o he p edic ed C- e minally amida ed ma u e
pep ide was aligned wi h galanin- ype pep ides om o he
e eb a es, including mammals, sau opsids, lobe- inned ishes,
ay- inned ishes, and ca ilaginous ishes. Compa ison o he
P. ma inus galanin wi h gna hos ome galanins e ealed bo h
simila i ies and di e ences. Comp ising 26 esidues, P. ma inus
galanin is sho e han gna hos ome galanins, which a e 29 o
30 esidues in leng h (Figu es 1A,B). Howe e , he i s hi een
esidues o P. ma inus galanin a e iden ical o gna hos ome
galanins (Figu e 1B). The esidue a posi ion 14 (his idine, H)
is conse ed in all gna hos ome galanins, whe eas in P. ma inus
galanin his posi ion is occupied by a h eonine (T) esidue,
which is a non-conse a i e subs i u ion. Posi ions 15 o 21
in P. ma inus galanin ha e conse a i e subs i u ions wi h
espec o gna hos ome galanins, bu by compa ison wi h
human galanin posi ions 22 and 23 in P. ma inus galanin
ha e non-conse a i e subs i u ions o Phenylalanine (F) wi h
Leucine (L), and o Se ine (S) wi h Aspa agine (N), espec i ely.
Howe e , his ea u e is no unique o P. ma inus galanin,
because di e ences a posi ion 22 a e also seen in all he ay-
inned ishes and in he ca ilaginous ish Rhincodon ypus
and di e ences a posi ion 23 a e also seen in wo sau opsids
and in he ca ilaginous ish Callo hinchus milii. Residues a
posi ions 24 o 26 in gna hos ome galanins a e missing in
P. ma inus galanin bu he C- e minal GLAamide o P. ma inus
galanin is a highly conse ed ea u e o mos gna hos ome
galanins (Figu e 1B).
Based on an alignmen o PmGalP wi h ou een o he
galanin- ype p ecu so p o ein sequences, a phylogene ic
econs uc ion was made using he neighbo -joining me hod
wi h he galanin- ype p ecu so om he u ocho da e
C. in es inalis used o oo he ee. The phylogene ic analysis o
p ecu so s shows ha he PmGalP occupies a posi ion in he ee
consis en wi h he basal phylogene ic posi ion o agna hans in
e eb a e phylogeny (Figu e 1C).
Dis ibu ion o PmGalP-Exp essing
Neu onal Popula ions in he Lamp ey
B ain
The exp ession o he PmGalP ansc ip in he CNS o he
sea lamp ey was analyzed using mRNA in si u hyb idisa ion.
Exp ession o PmGalP was es ic ed o he p osencephalon
and no exp ession was de ec ed in he mesencephalon,
hombencephalon o spinal co d o bo h la al (Figu e 2)
and adul (Figu e 3) sea lamp eys.
La ae
The dis ibu ion o PmGalP-posi i e (PmGalP+) neu ons was
analyzed in la ae wi h body leng hs be ween 80 and 120 mm
(Figu e 2). PmGalP+neu ons we e ound in wo elencephalic
egions (Figu es 2B,C,F,G). The mos os al popula ion o
PmGalP+cells was ound in a pe i en icula loca ion in
he sep um (sep ocommissu al p eop ic a ea o Pombal e al.,
2009;Figu es 2B,F). S ongly s ained PmGalP+neu ons we e
also ound in he p eop ic nucleus (Figu es 2C,G). This
p eop ic popula ion appea ed as a caudal con inua ion o he
sep al popula ion.
In he ala diencephalon, a g oup o s ongly s ained
PmGalP+cells was obse ed in he os al pa o he
p e halamus (p osome e 3; see Pombal e al., 2009). In
his egion, mos o he PmGalP+cells a e loca ed in he
pe i en icula a ea (Figu es 2D,H), bu some la e ally displaced
PmGalP+cells we e also obse ed (Figu es 2D,H). In he
hypo halamus, nume ous PmGalP+cells we e obse ed in
he pe i en icula a ea o he in undibula ecess ( en al
hypo halamus; Figu es 2E,I). Some o hese cells showed
a s ongly s ained dend i e c ossing he ependymal laye ,
sugges ing ha hey a e ce eb ospinal luid-con ac ing cells
(Figu e 2I). Some la e ally displaced PmGalP+cells we e also
p esen in his hypo halamic egion (Figu es 2E,I).
Adul s
We in es iga ed possible changes in he PmGalP+popula ions
a e me amo phosis and du ing sexual ma u a ion by analyzing
b ains o young downs eam (abou 17 cm in leng h) and
ma u e ups eam (abou 85 cm in leng h) mig a ing adul sea
lamp eys (Figu e 3). The gene al dis ibu ion o PmGalP+cells
F on ie s in Neu oana omy | www. on ie sin.o g 5Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 6
Sob ido-Cameán e al. Sea Lamp ey Galanin
FIGURE 2 | Schema ic d awings (A–E) and pho omic og aphs (F–I) o sec ions o he la al sea lamp ey b ain showing he dis ibu ion o PmGalP exp essing
neu ons. Fo abb e ia ions, see lis . The plane o sec ion o schema ic d awings B–E is indica ed in A. A ows indica e he p esence o la e ally mig a ed cells. The
as e isks indica e he en icles. A de ail o CSF-c cells o he hypo halamus is shown in I’. Do sal is o he op. Scale ba s: 100 µm.
F on ie s in Neu oana omy | www. on ie sin.o g 6Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 7
Sob ido-Cameán e al. Sea Lamp ey Galanin
FIGURE 3 | Schema ic d awings (A–E) and pho omic og aphs (F–K) o sec ions o he adul sea lamp ey b ain showing he dis ibu ion o PmGalP exp essing
neu ons. Fo abb e ia ions, see lis . Iis a pho omic og aph o an ups eam mig a ing adul sea lamp ey, he es o he pho omic og aphs a e om young adul s. The
plane o sec ion o schema ic d awings B–E is indica ed in A. The as e isks indica e he en icles. Do sal is o he op. Scale ba s: 100 µm.
F on ie s in Neu oana omy | www. on ie sin.o g 7Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 8
Sob ido-Cameán e al. Sea Lamp ey Galanin
in young and ma u e adul lamp eys is simila and he e o e he
desc ip ion below o PmGalP+cells in adul lamp eys is based on
ou analysis o bo h young and ma u e animals.
As in la ae, he mos os al PmGalP+popula ion was
obse ed in he pe i en icula a ea o he sep um (Figu es 3B,F).
The p eop ic nucleus o adul sea lamp eys also con ained
s ongly s ained PmGalP+cells (Figu es 3C,G). In e es ingly, a
new and conspicuous popula ion o PmGalP+cells was ound
dispe sed in he adul elencephalon in a egion anging om he
a ea la e al o he do sal pa o he p eop ic nucleus o he en al
pa o he la e al pallium (Figu es 3B,C,G,H). In adul lamp eys,
some weakly s ained PmGalP+cells we e also obse ed in he
cha ac e is ic cell band o he s ia um (Figu es 3B,G,H).
In he adul sea lamp ey diencephalon, a PmGalP+popula ion
was also ound in he p e halamus. These PmGalP+cells we e
ound in he os al p e halamus as in la ae, bu hey also
ex ended mo e caudally in adul s (Figu es 3D,E,J). La e ally
displaced PmGalP+cells we e also p esen in he p e halamus
(Figu es 3D,E,J). These displaced cells o he p e halamus
appea ed o be in con inui y wi h hose o he elencephalon (see
p e ious pa ag aph). In he do sal and en al hypo halamus o
adul lamp eys, a la ge g oup o PmGalP+cells was obse ed
in pe i en icula laye s a ound bo h he pos -op ic and he
in undibula ecesses. In he en al hypo halamus, hese cells
we e s ongly s ained and occupied h ee o ou compac ows
o cells. In he do sal hypo halamus, we obse ed he p esence
o ewe PmGalP+cells and hese we e less densely packed
(Figu es 3E,J,K). As in la ae, la e ally displaced PmGalP+cells
we e also obse ed in he hypo halamus, al hough hese cells we e
mo e nume ous han in la ae (Figu es 3E,I–K).
DISCUSSION
Galanin is a 29- esidue neu opep ide in e eb a es (30 esidues
in humans) wi h nume ous endoc ine ac i i ies. Exogenously
adminis e ed galanin has many biological ac ions, including
inhibi ion o ace ylcholine and insulin elease, s imula ion
o eeding, modula ion o spinal nocicep i e lexo e lexes,
inhibi ion o gas ic acid sec e ion and educ ion o alcohol
consump ion (Ch’ng e al., 1985;Ami ano e al., 1989;Xu
e al., 1990, 1995;C awley, 1995;Kask e al., 1995;Millón e al.,
2019). The amino acid sequence o gna hos ome galanins is
in gene al e y conse ed, as hey only di e in i e amino
acid esidues. No ably, mos o hese di e ences a e in he
C- e minal egion om esidues 16 o 30, whe eas esidues 1–
15 a e highly conse ed (Fisone e al., 1989;Land e al., 1991;
Mensah e al., 2010). In his s udy, we epo he iden i ica ion o a
galanin p ecu so in he agna han P. ma inus (PmGalP). PmGalP
con ains a p edic ed C- e minally amida ed pep ide comp ising
26 esidues, which is 3 o 4 esidues sho e han galanins
ound in o he e eb a es. An alignmen o he P. ma inus
galanin wi h galanins om gna hos omes shows ha he lamp ey
galanin is he mos di e gen o he sequences epo ed hus
a in e eb a es, wi h se e al non-conse a i e amino acid
subs i u ions. Fu he mo e, P. ma inus galanin does no align
comple ely wi h gna hos ome galanins in he C- e minal egion,
due i s sho e leng h. Howe e , he i s hi een esidues a e
iden ical o hose in gna hos ome galanins and esidues 15 o
21 comp ise a combina ion o conse ed and non-conse ed
esidues (Figu e 1B).
In e es ingly, ecep o binding assays and in i o
pha macological expe imen s ha e demons a ed ha he
N- e minal egion o galanins is he mos impo an egion o
he ac i a ion o galanin ecep o s and subsequen biological
ac ions. Expe imen s using di e en agmen s o galanins
demons a ed ha syn he ic galanin con aining only he
i s 15 o 16 esidues, GAL(1–15) and GAL(1–16), binds
o galanin ecep o s wi h a ini y in he nanomola ange,
wi h a i e old lowe a ini y compa ed o ull-leng h galanin.
In con as , syn he ic galanin con aining esidues 17–29 o
galanin, GAL(17–29), has 10,000- old lowe a ini y compa ed
o galanin. This sugges s ha he C- e minal esidues 17–
29 con ibu e e y li le o ecep o binding and ac i a ion
(Fisone e al., 1989;Lagny-Pou mi e al., 1989;Gallwi z
e al., 1990). Fu he mo e, in i o analysis o he inhibi o y
e ec s o galanin on gas ic acid sec e ion in a s e ealed
ha N- e minal agmen s o galanin (GAL 1–10) and (GAL
1–15) e ain app oxima ely 60% o he ac i i y o ull-leng h
galanin, whils a C- e minal agmen (GAL 15–29) had no
bioac i i y when es ed a he same dose anges as galanin
and he agmen (GAL 9–29) e ained only 5% o ac i i y o
ull-leng h galanin (Rossowski and Coy, 1989;Mungan e al.,
1992). These indings a e consis en wi h he inding ha he
N- e minal 13-amino acid esidues o galanin a e conse ed
in e eb a es, including P. ma inus, whe eas he C- e minal
egion o galanins is much mo e a iable and mos no ably in
P. ma inus. The e o e, he di e gence in he C- e minal egion
o P. ma inus galanin by compa ison wi h gna hos ome galanins
likely e lec s lack o selec ion p essu e because his egion is less
impo an han he N- e minal egion o ecep o ac i a ion
and bioac i i y.
P e ious s udies on he o ganiza ion o he galanine gic
sys em in he CNS o lamp eys we e pe o med only in adul s and
using an ibodies gene a ed agains po cine galanin (Buchanan
e al., 1987; Jiménez e al., 1996;Yáñez e al., 1999). He e, we
gene a ed speci ic ibop obes agains he PmGalP and analyzed
i s exp ession in he CNS o la al and adul sea lamp eys using
in si u hyb idisa ion. This con i med he p esence o p e iously
epo ed (Jiménez e al., 1996) galanin-like-i pe i en icula
cell popula ions o he sea lamp ey p osencephalon (sep al,
hypo halamic and p e halamic popula ions) and galanin-like-i
la e ally mig a ed elencephalic cells. Howe e , Jiménez e al.
(1996) used an ou da ed neu oana omical nomencla u e in hei
immunohis ochemical s udy, wi h he sep al egion iden i ied
as he nucleus commissu ae an e io by hese au ho s. Ou
analysis using in si u hyb idisa ion also iden i ied s ong PmGalP
exp ession in he p eop ic a ea in con inua ion wi h he sep al
popula ion, he p esence o weakly s ained s ia al PmGalP+
cells and he p esence o la e ally mig a ed PmGalP+cells
in he p e halamus and hypo halamus. These galanine gic
popula ions we e no p e iously epo ed by Jiménez e al.
(1996) in hei immunohis ochemical s udy. The easons o
hese disc epancies migh be ela ed o he sensi i i y o he
F on ie s in Neu oana omy | www. on ie sin.o g 8Sep embe 2019 | Volume 13 | A icle 83
nana-13-00083 Sep embe 12, 2019 Time: 16:21 # 9
Sob ido-Cameán e al. Sea Lamp ey Galanin
po cine an ibodies used o o he di e en ial accumula ion
o PmGalP ansc ip s and ma u e galanin pep ide in he
soma and ibe s o galanine gic neu ons. In addi ion, we
ex ended ou analyses o he la al b ain showing ha mos
o he galanine gic popula ions a e al eady p esen be o e he
me amo phosis, wi h he excep ion o he la e ally mig a ed
and s ia al cells o he elencephalon, which we e only p esen
in adul lamp eys.
The ad an age o p e ious immunohis ochemical s udies
is ha hey e ealed he p esence o ex ensi e galanin-like-i
inne a ion o he b ain (Jiménez e al., 1996), pa apineal o gan
(Yáñez e al., 1999), and spinal co d (Buchanan e al., 1987). Ou
s udy con i ms he lack o galanine gic cells in he spinal co d
and b ains em, which sugges s ha he galanin-like-i ibe s o he
lamp ey spinal co d epo ed by Buchanan e al. (1987) mus be o
hypo halamic o igin. The hypo halamus is he only b ain egion
wi h PmGalP exp essing neu ons ha also con ains descending
neu ons ha p ojec o he spinal co d in lamp eys (Ba ei o-
Iglesias e al., 2008). This should be expe imen ally con i med in
u u e hodological s udies.
As no ed by Jiménez e al. (1996), compa ison wi h o he
e eb a es shows ha he dis ibu ion o galanine gic neu onal
popula ions in lamp eys is simila o ha o jawed ishes,
since in bo h g oups galanin-exp essing neu ons a e mainly
es ic ed o he p osencephalon. This is in s iking con as o
amphibians, ep iles, bi ds and mammals, in which galanine gic
cell popula ions a e p esen also in he mesencephalon and
hombencephalon (see sec ion “In oduc ion”). Fo example,
in he b ains em o mammals, including humans, galanin
exp ession is p ominen in he locus coe uleus (Melande e al.,
1986;Hole s e al., 1988;Xu e al., 1998;Le Maî e e al.,
2013). In e es ingly, y osine hyd oxylase in si u hyb idiza ion
and immunohis ochemical s udies indica e ha lamp eys do
no ha e a locus coe uleus (Pie e e al., 1997;Ba ei o-Iglesias
e al., 2010), which sugges s ha hese ea u es e ol ed a e
he spli o jawless and jawed e eb a es. So, e olu ion o he
galanine gic sys em in e eb a es in ol ed an inc ease in he
numbe o mesencephalic and b ains em popula ions. O he
neu onal sys ems, as se o one gic (Pa en , 1984;Pie e e al.,
1992) and glycine gic (Villa -Ce iño e al., 2008) sys ems,
ha e also e ol ed wi h an inc ease in caudal popula ions. In
con as , p esen and p e ious esul s show ha he p esence
o sep al and hypo halamic galanine gic neu onal popula ions
is a highly conse ed cha ac e in all e eb a es (Goodson
e al., 2004;Ad io e al., 2005). The galanine gic sep al neu ons
ha e been implica ed in he egula ion o social beha io in
bi ds and mammals (Goodson e al., 2004), whe eas galanine gic
hypo halamic neu ons a e mainly implica ed in he egula ion o
eeding in ishes and mammals (Leibowi z e al., 1998;Sahu, 1998;
Volko e al., 2005). In e es ingly, bo h la al and adul lamp eys
ha e PmGalP+neu ons in hei sep um and hypo halamus.
The e o e, he lamp ey would be an in e es ing e eb a e model
o in es iga e he oles o galanin in hese b ain egions in
con ex o e y di e en de elopmen al s ages in e ms o social
and eeding beha io s. Ou s udy p o ides a molecula and
neu oana omical basis o u u e unc ional s udies on he ole o
galanin and GAMP in hese and o he b ain egions o lamp eys.
DATA AVAILABILITY
The da ase s gene a ed o his s udy can be ound in GenBank
unde accession numbe MK977616.
ETHICS STATEMENT
This animal s udy was e iewed and app o ed by he Bioe hics
Commi ee a he Uni e si y o San iago de Compos ela and he
Conselle ía do Medio Ru al e do Ma o he Xun a de Galicia
(License Re . JLPV/IId).
AUTHOR CONTRIBUTIONS
DS-C, LY-G, FL, CC-F, and HK con ibu ed o he acquisi ion
o expe imen al da a. DS-C, LY-G, ME, RA, MR, and AB-I
con ibu ed o he da a analysis and in e p e a ion, and
d a ing o he manusc ip . AB-I con ibu ed o he concep
and design o he s udy. All au ho s ha e app o ed he
inal manusc ip .
FUNDING
G an sponso s: Spanish Minis y o Economy and
Compe i i eness and he Eu opean Regional De elopmen
Fund 2007–2013 (G an numbe : BFU-2017-87079-P).
LY-G was suppo ed by a Ph.D. s uden ship awa ded
by he Mexican Council o Science and Technology
(CONACyT s uden ship no. 418612), and Queen Ma y
Uni e si y o London.
ACKNOWLEDGMENTS
The au ho s hank he s a o Ximonde Biological S a ion o
p o iding he lamp eys used in his s udy.
SUPPLEMENTARY MATERIAL
The Supplemen a y Ma e ial o his a icle can be ound online
a : h ps://www. on ie sin.o g/a icles/10.3389/ nana.2019.
00083/ ull#supplemen a y-ma e ial
FIGURE S1 | Alignmen o selec ed galanin p ecu so s om e eb a es used o
he iden i ica ion o signal pep ides (unde lined in blue), ma u e pep ides
(unde lined in ed), and galanin-associa ed pep ides (unde lined in pu ple).
Conse ed esidues a e highligh ed. Conse a ion in mo e han 70% o sequences
is highligh ed in black, conse a i e subs i u ions a e highligh ed in g ay. Species
names a e as ollows: Hsap (Homo sapiens), B au (Bos au us), Rno (Ra us
no egicus), Ssc (Sus sc o a), Ggal (Gallus gallus), Asin (Alliga o sinensis), Lcha
(La ime ia chalumnae), S hi (Sinocyclocheilus hinoce ous), D e (Danio e io),
Amex (As yanax mexicanus), Locu (Lepisos eus ocula us), R yp (Rhincodon
ypus), Cmil (Callo hinchus milii), and Pma (Pe omyzon ma inus). Accession
numbe s a e shown nex o he names.
FILE S1 | Sequences used o he phylogene ic econs uc ion in Figu e 1C.
F on ie s in Neu oana omy | www. on ie sin.o g 9Sep embe 2019 | Volume 13 | A icle 83
