scieee Science in your language
[en] (orig)

Tick infestation in spur-thighed tortoise population: a pilot study for unraveling epidemiological patterns and demographic consequences

Abstract

Open Access funding provided thanks to the CRUE-CSIC agreement with Springer Nature.

Read accessible full text

Tick infestation in spur-thighed tortoise population: a pilot study for unraveling epidemiological patterns and demographic consequences

Author: Segura, Amalia,Rafael, Marta,Vaz Rodrigues, Rita,Rodríguez, Óscar,Gortázar, Christian,Fuente, José de la
Publisher: Springer Nature
DOI: http://dx.doi.org/10.13039/501100003339
Source: https://digital.csic.es/bitstream/10261/340713/1/tickconsequences.pdf
RESEARCH
Recei ed: 11 Sep embe 2023 / Accep ed: 6 No embe 2023 / Published online: 16 No embe 2023
© The Au ho (s) 2023
Amalia Segu a and Ma a Ra ael con ibu ed equally o his wo k.
Ex ended au ho in o ma ion a ailable on he las page o he a icle
Tick in es a ion in spu - highed o oise popula ion: a
pilo s udy o un a eling epidemiological pa e ns and
demog aphic consequences
AmaliaSegu a1· Ma aRa ael2· Ri aVaz-Rod igues2· Osca Rod íguez1·
Ch is ianGo áza 2· Joséde la Fuen e2,3
Expe imen al and Applied Aca ology (2023) 91:661–679
h ps://doi.o g/10.1007/s10493-023-00863-7
Abs ac
Ec opa asi es, such as icks, modula e hos popula ion dynamics by impac ing demo-
g aphic ai s. They ansmi in ec ious agen s among hei hos s, posing a c i ical h ea
o animal and public heal h. This s udy aimed o cha ac e ize and analyze he Hyalomma
aegyp ium in es a ion on one o i s main hos s, he spu - highed o oise, i s e ec s on de-
mog aphic ai s, and o de e mine he di e si y o in ec ious agen s p esen in bo h icks
and o oises in he Maamo a o es (no hwes e n Mo occo). Ou esul s show ha 100%
o he o oises we e pa asi ized by adul icks in sp ing, an in es a ion in ensi y o 4 icks/
o oise (5.1 and 3.6 icks/ o oise in males and emales, espec i ely; 4.2 and 3.3 icks/
o oise in g a id and non-g a id emales, espec i ely) and an abundance anging om 1
o 12. Al hough wi hou signi ican di e ences, male o oises had highe ick abundances
han emales. The in e ac ion o o oise sex and body condi ion was signi ican ly ela ed
o ick abundance, male body condi ion dec eased wi h highe ick abundance in con as
o emales. Ne e heless, he in e ac ion o body condi ion and ep oduc i e s age o e-
males was no signi ican ly ela ed o ick abundance. G a id emales we e signi ican ly
associa ed wi h ick abundance, showing a sligh ly highe in es a ion han non-g a id
emales. Molecula analysis o pooled ick samples e ealed he p esence o Eh lichia
ewingii, Candida us Midichlo ia mi ochond ii, and Ricke sia a icae, wi h a minimum
in ec ion a e o 0.61 o 1.84%. Howe e , blood sample analysis o he o oises was in-
ec ious agen - ee, pinpoin ing a lack o signi ican heal h p oblems. Gi en he possible
e ec on he ansmission o zoono ic diseases by spu - highed o oises associa ed wi h
hei equen collec ion as pe s, i should be su eyed o con ol possible human heal h
p oblems. In conse a ion e ms, as a long-li ed species, he ole o ick in es a ion in
demog aphic ai s migh be included in he managemen and conse a ion p og ams o
spu - highed o oises.
Keywo ds Hyalomma aegyp ium · Su eillance · Tick-bo ne in ec ious agen s ·
To oise · Tes udo g aeca
1 3
Expe imen al and Applied Aca ology (2023) 91:661–679
In oduc ion
Ec opa asi es may modula e hos popula ion dynamics by in luencing na u al selec ion
(Fi ze e al. 2004; Bull and Bu zaco 2006). Long in e ac ion be ween hos s and ec opa a-
si es impac s hos popula ion s uc u e and size, a ec ing de ence e ec i eness and esul -
ing in mos o he cases in adap a ion and co-e olu ion (Hwang and Kuang 2003; Esse e
al. 2019). To oises om he Tes udo genus ha e been deeply documen ed as hos s o ick
species o he Hyalomma genus, such as Hyalomma aegyp ium L. (Hoogs aal and Kaise
1960; Ši oký e al. 2006), a ec ing hose ec opa asi es hei li e-his o y ai s. Pa icula ly
high is he encoun e a e o H. aegyp ium wi h spu - highed o oise Tes udo g aeca in
Mo occo, Tunisia, Tu key and Alge ia (Gha bi e al. 2015; Tia e al. 2016; Segu a e al.
2019; Najja e al. 2020), and o a lesse ex end wi h Ma gina ed o oise Tes udo ma gina a
in G eece (Ši oký e al. 2006), Ho s ield´s o oise Tes udo ho s ieldii in I an (Ja anbakh e
al. 2015), and He mann´s o oise Tes udo he manni in Albania (Hoogs aal, 1956; Ši oký e
al. 2006; Bizhga e al. 2022). The endu ed con ac be ween H. aegyp ium and Tes udo may
depend on a complex in e play o ac o s in ol ing hos demog aphic ac o s such as sex,
ep oduc i e s age o popula ion densi y, hos -pa asi e ac o s including encoun e , compa -
ibili y and ecogni ion s a egies (Hobe g and B ooks 2008) and abio ic ac o s including
ele a ion, empe a u e, ain all and humidi y (Cumming 2002; Ja anbakh e al. 2015). In
pa icula , he e ec o ick pa asi ism is o en highe in male o oises han in emales
(Segu a e al. 2019; Laghzaoui e al. 2022; bu see Tia e al. 2016), ep esen ing ei he di -
e ences in exposu e o suscep ibili y o icks, such as male-speci ic beha iou in b eeding
ime by di e en ial habi a use (Robbins e al. 1998). Male pa asi ism migh esul in an
ex a biological cos i physiological aspec s such as body condi ion a e a ec ed (Segu a
e al. 2019). The e ec o pa asi ism in he ep oduc ion o o oise emales may in luence
esou ce alloca ion ade-o s, educing o inc easing ep oduc i e ou pu acco ding o di -
e en s a egies (e.g., Lockley e al. 2020). The e o e, emale ep oduc i e success migh be
comp omised as a di ec consequence o esou ce exploi a ion by pa asi es. Whe eas small
(young) in ec ed emales could use a be -hedging s a egy in a ou o li e ime ep oduc i e
success, olde in ec ed emales could adop a e minal in es men s a egy (e.g., Lockley e
al. 2020). Addi ional ex e nal ac o s, such as he limi a ion o ood esou ces, will a ou
esou ce alloca ion om cu en ep oduc ion o su i al (and u u e ep oduc ion) un il he
in ec ion has passed (e.g., Hu d 2001; Pollock e al. 2012).
Adul s o H. aegyp ium eed almos exclusi ely on o oises o he genus Tes udo. How-
e e , a e cases in o he hos s, such as ha es and hedgehogs, ha e been epo ed (Hoogs aal
and Kaise 1960; Gazyağci e al. 2010). La ae and nymphs a e less hos -speci ic and eed
on a a ie y o e eb a es (Es ada-Peña e al., 2017), including domes ic animals (dogs,
ca le, ho ses, o pigs; Aydin 2000), wild animals (liza ds, bi ds, hedgehogs, oden s, o
camels; Ka e al. 2011; Ši oký e al. 2011; Apanaske ich and Oli e 2014), and humans
(Va anse e e al. 2008; Bu sali e al., 2010). Ticks a e conside ed he second ec o o
human diseases and a e bo h ec o s and ese oi s o in ec ious agen s, ha bou ing bac-
e ial, i al, and p o ozoan mic oo ganisms (de la Fuen e e al. 2017). The mul i ude o
hos s a ec ed by H. aegyp ium poses a majo conce n as a ious dissemina ion scena ios
may occu , leading o epidemiological consequences. Indeed, se e al in ec ious agen s ha e
been de ec ed in H. aegyp ium collec ed om spu - highed o oise, such as Ricke sia spp.,
Eh lichia spp., Anaplasma spp., Coxiella bu ne ii, C imean-Congo haemo hagic e e
1 3
662
Expe imen al and Applied Aca ology (2023) 91:661–679
i us (CCHFV) o Hemoli ia mau i anica (Tia e al. 2010; Bu sali e al., 2011; Paș iu e al.
2012; Kau man e al. 2016; Ba adas e al. 2019, 2020; Manoj e al. 2021; Mumcuoglu e al.
2022; Rjeibi e al. 2022). Pa icula ly in Mo occo, he p esence o H. mau i anica, Eh lichia
spp., Midichlo ia mi ochond ii, Wolbachia spp., elapsing e e bo eliae, F ancisella spp.,
and Ricke sia spp. has been epo ed om spu - highed o oise in es ed by H. aegyp ium
(e.g., Ha is e al. 2013; No e e al. 2021).
In ou s udy, we examined he p esence o in ec ious agen s in bo h H. aegyp ium icks
and spu - highed o oises and he ole o sex and emale ep oduc i e s age in o oises as
d i e s o ick in es a ion in he hos species. Spu - highed o oise ha e been ed-lis ed as
‘ ulne able’ by he In e na ional Union o Conse a ion o Na u e (IUCN 1996; Rhodin e
al. 2021) and one o hei main h ea s h ough hei dis ibu ion is he collec ion and ade as
pe s (Pé ez e al. 2004; Tia e al. 2019; Segu a e al. 2020). We selec ed a popula ion loca ed
in he Maamo a o es , a co k oak o es loca ed in no he n Mo occo ha is cha ac e ized
as highly humid, when compa ing wi h o he a eas o he o oise dis ibu ion ange, and
conside ed close o he op imum niche o he o oise dis ibu ion (Anadón e al. 2012). The
popula ion has been p e iously s udied in 2018 in a p i a e ese e whe e he e is no pe
ade and he unde g ow h is well p ese ed (Segu a e al. 2020). The s udy e ealed high
p e alence and mode a e in ensi y o ick pa asi ism, and he in luence o ick in es a ion
on o oise age, sex, body condi ion and popula ion densi y (Segu a e al. 2019). Indeed,
his spu - highed o oise popula ion has been ecognized as one o he denses documen ed
o da e (Segu a and Ace edo 2019). Howe e , he epidemiological s a us o he o oise
communi y p esen in he Maamo a o es is unknown, e en hough se e al demog aphic
s udies had discussed he di e en d i e s o his o oise popula ion (Segu a and Ace edo
2019; Segu a e al. 2019, 2021). The high collec ion and ade o he species in his o es
(Segu a e al. 2020) pinpoin o he po en ial ansmission o zoono ic pa hogen agen s. This
s udy aims o (i) de e mine adul pa asi e p e alence, in ensi y and abundance in o oises,
(ii) analyse he ole o o oise sex, o oise emale ep oduc ion s age and he in e ac ion
o bo h ac o s wi h he body condi ion as d i e s o ick pa asi ism in he species, and
(iii) iden i y and phylogene ically cha ac e ize ick-bo ne in ec ious agen s, including Ana-
plasma spp., Babesia spp., C. bu ne ii, Eh lichia spp., Hepa ozoon spp. / H. mau i anica,
Ricke sia spp., Bo elia spp., and CCHFV, in bo h H. aegyp ium icks and he spu - highed
o oise. This s udy will con ibu e o he design o app op ia e managemen and conse a-
ion plans and emphasizes he impo ance o su eillance and epidemiological p o iling o
bo h ec o s and hos s.
Ma e ials and me hods
S udy si e
The s udy was conduc ed in an a ea o low-ele a ion sandy soil (72–185 m abo e sea le el)
in he Maamo a o es (No hwes Mo occo; 34°02′54.19′′ N, 6°27′19.24′′ W, G ou-Bou e-
g eg basin). The s udy a ea was loca ed on he Medi e anean bioclima ic loo , wi h ho
and d y summe s, and he annual ange o a e age ain all was 300–500 mm and he mean
annual empe a u e 22º C. Maamo a o es is domina ed by co k oak ees Que cus sube ,
sca e ed endemic wild pea Py us mamo ensis, wild oli e Olea eu opaea, g een oli e Phyl-
1 3
663
Expe imen al and Applied Aca ology (2023) 91:661–679
li ea la i olia, and mas ic Pis acia len iscus, and a spa se unde s o y o bush and sh ub
species such as Medi e anean b oom Genis a lini olia, Cy isus a bo eus, S au acan hus
genis oides, dwa palm Chamae ops humilis, F ench la ende La andula s oechas, sage-
lea ed ock ose Cis us sal ii olius, Halimium halimi olium, and Thymelaea ly h oides. The
s udy ook place on a p i a e ese e (3000 ha) cha ac e ized by well- ep esen ed unde -
g ow h (e.g., species ichness and co e ) when compa ed wi h o he unp o ec ed si es in
Maamo a (highly o e g azed by li es ock; Said e al. 2014).
Sampling
To oises we e cap u ed by hand be ween Ap il and May 2022 (Table S1) ollowing app o ed
e hical wildli e cap u e and managemen p o ocols. Each indi idual encoun e ed was sexed,
he body mass was de e mined using a p ecise balance (± 1 g), and he body size was mea-
su ed (± 1 mm) as he s aigh an e opos e io dis ance be ween he nuchal and sup acaudal
scu es using a callipe (ca apace leng h, CL). Collec ion and ick ex ac ion we e ca ied
ou wi hin a p i a e ini ia i e o he conse a ion o T. g aeca in Maamo a Fo es . All icks
a ached o he o oise body we e coun ed in he ield, and a ep esen a i e subsample was
collec ed o analysis o in ec ious agen s. The emo ed icks we e iden i ied a he species
le el wi h DNA ba coding o mi ochond ial genes. Blood was collec ed om he subca a-
pacial plexus using a 1-mL sy inge. Fo de e mining he emale ep oduc i e s age, emales
we e adiog aphed do so en ally wi h a po able X- ay a 60 kV (20 mA) a a dis ance o
1 m, acco ding o Gibbons and G eene (1979). The adiog aphy allowed he iden i ica ion
o g a id emales and assessed he clu ch size. Figu e 1 ep esen s he me hods employed
Fig. 1 Me hodological lowcha . Indi idual cha ac e is ics we e eco ded such as weigh , sex, body size
measu es and quan i ica ion o eggs. The ela ionship be ween he a iables was pe o med using gene al
linea models and linea models wi h he R so wa e. In addi ion, DNA was ex ac ed om icks and blood
samples collec ed om he o oises. Posi i e samples o he pa hogens analysed we e sequenced, and
phylogene ic ees we e gene a ed
1 3
664
Expe imen al and Applied Aca ology (2023) 91:661–679
in his a icle. All o oises we e eleased immedia ely a e measu emen s and sample col-
lec ions a he cap u e si e.
Th ee pa asi ological indica o s we e calcula ed: (1) in es a ion p e alence, by di id-
ing he numbe o in es ed o oises by he numbe o examined o oises and mul iplying
i by 100, (2) mean in es a ion in ensi y, by di iding he numbe o icks by he numbe o
in es ed o oises, and (3) ick abundance, by di iding he numbe o icks by he numbe
o examined o oises. The o oise body condi ion (BC), which ep esen s he body mass
adjus ed o he body size (Nagy and Medica 1986), was de e mined by calcula ing esidual
alues h ough a linea eg ession analysis (all indi iduals pooled). In his analysis, he
na u al loga i hm (ln) o body mass was used as he dependen a iable, whe eas ln CL was
used as he independen a iable. The indi idual body-condi ion index measu es he ex en
o mass de ia ion compa ed o he expec ed alues based on he animal’s size, which can
change wi h age, s age o ep oduc ion, d ough and disease.
Bo h he icks and he blood o he o oises we e s o ed a -25 °C in ubes wi h RNAla e
and sodium hepa in, espec i ely, o u he analysis.
Tick DNA/RNA isola ion and PCR in ec ious agen s analysis
Nucleic acid ex ac ion was accomplished om indi idual ick samples and ick pools
(mean o 3,196 icks/pool, anging om 1 o 8 icks). The pools we e designed andomly,
acco ding o he numbe o icks collec ed in he ield. DNA and RNA we e ex ac ed om
he in e nal issues o icks, disca ding he ex e nal cu icle, and using TRI Reagen (Sigma-
Ald ich, S . Louis, USA), ollowing he manu ac u e ’s ins uc ions. The concen a ion
(ng/µL) and pu i y o samples we e e alua ed using a Nanod op One spec opho ome e
(The mo Scien i ic, Wal ham, USA), h ough he quan i ica ion o he nucleic acids a an
op ical densi y o 260 nm (OD260) and he a io o abso bance a 260/280 nm. The quali y
o he ex ac ion p o ocol and con i ma ion o ick species we e app aised by he ampli ica-
ion o he mi ochond ial 16S ibosomal DNA (16S DNA) gene and he cy och ome oxidase
subuni I (COI) gene o ou indi idual icks (Table 1). All samples we e es ed using con-
en ional polyme ase chain eac ion (PCR) aimed a de ec ing he p esence o Anaplasma
spp., Babesia spp., C. bu ne ii, Eh lichia spp., Hepa ozoon spp. / H. mau i anica, o Ricke -
sia spp., a nes ed PCR o he de ec ion o Bo elia spp., and a nes ed e e se ansc ip ion
(RT)-PCR o he iden i ica ion o he CCHFV. Table 1 p o ides in o ma ion on he speci ic
a ge ed egions o each PCR assay, he used p o ocol, and p ime s.
The PCR eac ions we e pe o med in a 25 µL olume, including 12.5 µL o PCR Mas e
Mix 2x (P omega, Madison, WI, USA), 1 µL o each p ime (10 µM wo king solu ion), 9
µL o RNase- ee wa e (The mo Scien i ic), and 1.5 µL o DNA sample. Fo he nes ed
RT-PCR assessmen o CCHFV, he comme cial ki Access RT-PCR Sys em (P omega,
Fi chbu g, WI, USA) was used acco ding o he manu ac u e ’s ins uc ions. The PCRs
we e conduc ed in a C1000 ouch PCR he mal cycle (Bio-Rad, He cules, CA, USA), wi h
he speci ic PCR agmen s isualized in 1.5% aga ose gel s ained wi h GelRed (Bio ium,
F emon , CA, USA) unde UV ansillumina ion.
1 3
665

Expe imen al and Applied Aca ology (2023) 91:661–679
Sequencing and phylogene ic analysis
P esumed posi i e samples we e pu i ied and sequenced using he Sange me hod a Secu-
gen (Mad id, Spain). Sequences we e edi ed wi h he Ch omas so wa e .2.6.6., and
homology analysis was conduc ed using he Na ional Cen e o Bio echnology In o ma-
ion (NCBI) da abase, employing he Basic Local Alignmen Sea ch Tool (BLAST). The
Table 1 P ime s and PCR p o ocols acco ding o he pa hogen analysed
Pa hogen and
a ge gene
Sequence 5’-3’ (F: Fo wa d / R: Re e se) F ag-
men
(bp)
An-
neal-
ing
(ºC)
Re e ence
16S DNA F: CCGGTCTGAACTCAGATCAAGT
R: CTGCTCAATGATTTTTTAAATTGCTGTGG
460 48 Rod íguez e
al. 2022
COI F: GGTCAACAAATCATAAAGATATTGG
R: TAAACTTCAGGGTGACCAAAAATCA
650 50 Coimb a-
Do es e al.
2018
Anaplasma spp.
(16S RNA)
F: CAGAGTTTGATCCTGGCTCAGAACG
R: GAGTTTGCCGGGACTTCTTCTGTA
421 42 Mo aga
Fe nández e
al. 2022
Anaplasma spp.
(msp5)
F: GCATAGCCTCCGCGTCTTTC
R: TCCTCGCCTTGGCCCTCAGA
456 54 Mo aga
Fe nández e
al. 2022
Anaplasma spp.
(msp4)
F: CGGATCCTTAGCTGAACAGGAATCTTGC
R:
GGGAGCTCCTATGAATTACAGAGAATTGTTTAC
849 60 Mo aga
Fe nández e
al. 2022
Babesia spp.
(18S RNA)
F: AAT ACC CAA TCC TGA CAC AGG G
R: TTA AAT ACG AAT GCC CCC ACC
408 58 Ba adas e
al. 2020
Bo elia bu g-
do e i sensu
la o ( lagellin)
F1: GCATCACTTTCAGGGTCTCA
R1: TGGGGAACTTGATTAGCCTG
F2: CTTTAAGAGTTCATGTTGGAG
R2: TCATTGCCATTGCAGATTGT
390 55
and
58
No e e al.
2021
Coxiella bu -
ne ii (IS111a)
F: CAAGAATGATCGTAACGATGCGC
R: CTCGTAACACCAATCGCTTCG
349 63 Rjeibi e al.
2022
C imean-Congo
Haemo hagic
Fe e í us
(CCHFV S
segmen )
F1: TTGTGTTCCAGATGGCCAGC
R1: CTTAAGGCTGCCGTGTTTGC
F2: GAAGCAACCAARTTCTGTGC
R2: AAACCTATGTCCTTCCTCC
211 60
and
57
Mo aga-
Fe nández e
al. 2021
Eh lichia spp.
(16S RNA)
F: GGTACCYACAGAAGAAGTCC
R: TAGCACTCATCGTTTACAGC
345 54 Ba adas e
al. 2020; Gal
e al. 2008
Hepa ozoon
spp. / Hemoli ia
mau i anica
(18S RNA)
F: GTTTCTGACCTATCAGCTTTCGACG
R: CAAATCTAAGAATTTCACCTCTGAC
600 60 No e e al.
2021; Uj a i
e al. 2004
Ricke sia spp.
(16S RNA)
F: AGAGTTTGATCCTGGCTCAG
R: AACGTCATTATCTTCCTTGC
416 54 Rod íguez e
al. 2022
Ricke sia spp.
(ompA)
F: ATGGCGAATATTTCTCCAAAA
R: AGTGCAGCATTCGCTCCCCCT
630 54 Mo aga-
Fe nández e
al. 2019
Ricke sia spp.
(ompB)
F: GGGTGCTGCTACACAGCAGAA
R: CCGTCACCGATATTAATTGCC
618 53 Mo aga-
Fe nández e
al. 2019
1 3
666
Expe imen al and Applied Aca ology (2023) 91:661–679
16S DNA sequence was deposi ed in GenBank unde he accession numbe OQ295899.
The COI pa ial sequences ob ained in his s udy we e a ibu ed he accession numbe s
OQ320497 and OQ556797. The 16S RNA pa ial sequences o Eh lichia iden i ied in
his s udy we e asc ibed he accession numbe s OQ9931657, OQ991496, OQ991497 and
OQ996270. The ou e memb ane p o ein A [ompA] pa ial sequence o Ricke sia was
submi ed o Genbank and assigned he accession numbe OR003919. Mul iple sequence
alignmen was ca ied ou using he Mul iple Sequence Compa ison by Log-Expec a ion
(MUSCLE) algo i hm. Phylogene ic analysis was pe o med in MEGA so wa e .11.0.13.
Co ec ed Akaike In o ma ion C i e ion (cAIC) was used o selec he bes - i model, and a
phylogene ic ee o posi i e in ec ious agen s was gene a ed using maximum likelihood
and Neighbo -Joining me hods. To ensu e he eliabili y o p oduced ees, 1000 boo s ap
eplica es we e implemen ed.
Blood nucleic acid isola ion and PCR in ec ious agen analysis
Blood DNA was ex ac ed om o oises wi h suspec ed in ec ious agen s p esen in ick
samples using he DNeasy Blood & Tissue Ki (Qiagen, Hilden, Ge many) and ollowing
he manu ac u e ’s ins uc ions. The samples we e es ed using con en ional PCR agains
Anaplasma spp., Eh lichia spp. and Ricke sia spp. (Table 1). The PCR p o ocol ollowed
he same indica ions as he one desc ibed o he ick in ec ious agen s esea ch.
S a is ical analysis
χ2 es s we e used o assess di e ences in in es a ion in ensi y be ween o oise sexes and
be ween g a id and non-g a id o oise emales. Two gene alized linea models (GLM)
wi h a Poisson dis ibu ion and loga i hmic link unc ion we e pe o med wi h he R .4.3.1
(2023) so wa e, o analyse he ela ionship be ween ick in es a ion a e ( ick abundance)
and (i) he o oise sex and he in e ac ion o body condi ion wi h sex, and (ii) emale ep o-
duc i e s age (g a id/non-g a id emales) and he in e ac ion o body condi ion wi h ep o-
duc i e s age. Fo all analyses, s a is ical signi icance was decla ed a α = 0.05 (con idence
le el o 95%).
Resul s
Tick in es a ion a e and o oise demog aphic ai s
In o al 520 icks (mos ly adul s wi h he excep ion o ou nymphs) we e coun ed on he
130 o oises cap u ed (98 emales, 32 males). O e all, he in es a ion p e alence was 100%
wi h all he o oises pa asi ized by icks, and he mean (± 95% con idence in e al) in es a-
ion in ensi y was 4 ± 0.42 icks/ o oise. Tick abundance anged om 1 o 12 icks/ o oise.
Males p esen ed highe in es a ion in ensi y (5.3 ± 1.11 icks/ o oise) han emales
(3.6 ± 0.40 icks/ o oise) bu he di e ences be ween hem we e no signi ican (χ2 = 2.4, d. .
= 1, P = 0.1). The model o de e mining he in es a ion a e e ec on sex and body condi ion
showed a signi ican ela ion o sex and a signi ican in e ac ion be ween body condi ion and
1 3
667
Expe imen al and Applied Aca ology (2023) 91:661–679
sex. Males had highe ick abundances, and ick abundance dec eased in males in ela ion o
hei body condi ion (Table 2; Fig. 2).
G a id emales (34%; 1–5 eggs) p esen ed highe mean in es a ion in ensi y han non-
g a id emales (4.2 s. 3.3 icks/ o oise, n = 33 and 65, espec i ely) bu he di e ences
be ween hem we e no signi ican (χ2 = 1.08, d. . = 1, P = 0.29). The model showed a sig-
ni ican ela ion be ween ick abundance and he ep oduc i e s age o he emales, g a id
emales wi h highe ick abundance han non-g a id emales. In addi ion, i showed a lack
Table 2 S a is ical pa ame e s o he gene alized linea model (GLM) ca ied ou o de e mine ick abundance
a ia ion in ela ion o he o oise sex and he in e ac ion o body condi ion and sex in o oises
Model p edic o s Es ima e SE P
(In e cep ) 1.287e + 00 5.307e-02 24.252 < 0.01
Body condi ion -2.617e-05 4.945e-04 -0.053 0.96
Sex1
Males 2.620e-01 1.003e-01 2.613 < 0.01
Body condi ion × males -4.978e-03 1.083e-03 -4.597 < 0.01
1Class e e ence o he ca ego ical a iable sex is ‘ emale’
Fig. 2 Numbe o icks encoun e ed ca ego ized by sex and acco ding o body condi ion (BC). Female
da a a e ep esen ed in ed, male da a in blue
1 3
668
Expe imen al and Applied Aca ology (2023) 91:661–679
o signi icance in he in e ac ion be ween body condi ion and he ep oduc i e s age o he
emales (Table 3).
PCR analysis
A sample o 163 icks (156 males, six emales, and one nymph) was used o DNA ex ac-
ion and analysis. All 163 icks we e con i med as H. aegyp ium by ba coding o 16S DNA
and COI genes. BLAST analysis e ealed 98.9–100% iden i y o wo icks, one iden i ied
o bo h genes, wi h H. aegyp ium (GenBank accession numbe s MG418679, AF132821
and KY548846). Phylogene ic analysis was pe o med o e alua e he gene ic associa ion
be ween he sequenced samples and o he Hyalomma species ob ained om he GenBank
da abase (Figs. 3 and 4). Bo h phylogene ic ees p esen clus e s o he geno ypes H. ma -
gina um, H. exca a um, H. aegyp ium and H. impel a um and an ou g oup o Ixodes icinus
(GenBank accession numbe MH645522 and MZ305543). The samples e ie ed in his
s udy clus e in he subg oup o H. aegyp ium, being agg ega ed wi h samples collec ed
om Tu key (KR870970) o Is ael (KU130407), in he case o 16S DNA sequences, and
om Is ael (KT989617), Mo occo (OL467652) o Alge ia (OL467646) in COI sequences.
Sequence and BLAST analysis o suspec ed posi i e samples e ealed ou ick pools
as posi i e o he Eh lichia 16S RNA gene (7.84%), and one (1.96%) as posi i e o he
Ricke sia ompA gene. BLAST analysis o he Eh lichia 16S RNA gene o H. aegyp ium
showed h ee samples sha ing 98–99% iden i y wi h Candida us M. mi ochond ii (Gen-
Bank accession numbe MG668797, OQ320500 o MK416236.1) and one wi h 99.6% iden-
i y o Eh lichia ewingii (GenBank accession numbe MW092750). One sample (isola e
12) posi i e o Eh lichia 16S RNA p esen ed a co-in ec ion wi h Ricke sia sha ing 99.7%
iden i y wi h Ricke sia a icae when a ge ing he ompA gene (GenBank accession numbe
MW874463).
Phylogene ic analysis o he Eh lichia 16S RNA (Fig. 5) con i med he classi ica ion
as Candida us M. mi ochond ii and E. ewingii. I shows a clus e be ween he isola es 44
(OQ996270), 20 (OQ991497) and 7 (OQ9931657) and Candida us M. mi ochond ii de ec ed
in H. ana olicum icks om China (MG668797), H. aegyp ium om Qa a (MW092748)
and Mo occo (MW293914), H. d omeda ii om Tunisia (MK416236) and H. u ipes om
Ghana (OQ320500). Conce ning isola e 12 (OQ991496), i clus e s wi h sequences iden i-
ied as E. ewingii collec ed om Haemaphysalis bandico a om Taiwan (OK345369) and
H. aegyp ium om Qa a (MW092750). In e ms o he Ricke sia ompA sequences, he
phylogene ic analysis con i ms he classi ica ion as R. a icae (Fig. 6). The posi i e sample
(isola e 12 - OR003919) clus e s wi h R. a icae sequences om Tu key (JQ691730) o
Table 3 S a is ical pa ame e s o he gene alized linea model (GLM) ca ied ou o de e mine ick abundance
a ia ion in ela ion o he ep oduc i e s age (g a id and non-g a id emales) and he in e ac ion o body
condi ion and ep oduc i e s age
Model p edic o s Es ima e SE P
(In e cep ) 1.448 0.084 17.108 < 0.01
Rep oduc i e s age
Non-g a id1-0.251 0.108 -2.316 < 0.01
Body condi ion -0.0004 0.0009 -0.478 0.63
Body condi ion × non-g a id 0.0004 0.001 0.449 0.65
1Class e e ence o he ca ego ical a iable sex is ‘g a id’
1 3
669
Expe imen al and Applied Aca ology (2023) 91:661–679
Bizhga B, Sönmez B, Ba dhaj L, She i i K, Gündemi O, Du o S (2022) Hyalomma aegyp ium he dominan
ha d ick in o oises Tesdudo he manni boe ge i ound in di e en egions o Albania. In J Pa asi ol
Pa asi es Wildl 17:199–204. h ps://doi.o g/10.1016/j.ijppaw.2022.02.002
B ian i E, Dan as-To es F, Gianne o S, Risi ano A, B uca o G, Gaglio G, O an o D (2010) Risk o he
in oduc ion o exo ic icks and pa hogens in o I aly h ough he illegal impo a ion o o oises, Tes udo
g aeca. Med Ve En omol 24(3):336–339. h ps://doi.o g/10.1111/j.1365-2915.2010.00874.x
Bull CM, Bu zaco DA (2006) The in luence o pa asi es on he Re en ion o Long-Te m pa ne ships in
he Aus alian sleepy Liza d, Tiliqua ugosa. Oecologia 146(4):675–680. h ps://doi.o g/10.1007/
s00442-005-0224-z
Bu sali A, Tekin S, Keskin A, Ekici M, Dunda E (2011) Species di e si y o ixodid icks eeding on humans
in Amasya, Tu key: Seasonal abundance and p esence o C imean-Congo hemo hagic Fe e i us. J
Med En omol 48(1):85–93. h ps://doi.o g/10.1603/me10034
Bu sali A, Tekin S, O han M, Keskin A, Ozkan M (2010) Ixodid icks (Aca i: Ixodidae) in es ing humans in
oka p o ince o Tu key: species di e si y and seasonal ac i i y. J Vec o Ecol 35(1):180–186. h ps://
doi.o g/10.1111/j.1948-7134.2010.00045.x
Celina SS, Ce ný J (2022) Coxiella bu ne ii in icks, li es ock, pe s and wildli e: A mini- e iew. F on ie s in
Ve e ina y Science, 9. h ps://doi.o g/10.3389/ e s.2022.1068129
Coimb a-Do es MJ, Maia-Sil a M, Ma ques W, Oli ei a AC, Rosa F, Dias D (2018) Phylogene ic insigh s on
medi e anean and a o opical Rhipicephalus species (Aca i: Ixodida) based on mi ochond ial DNA.
Exp Appl Aca ol 75(1):107–128. h ps://doi.o g/10.1007/s10493-018-0254-y
Cossu CA, Collins NE, Oos huizen MC, Menand o ML, Bhoo a RV, Vo s e I, Cassini R, S ol sz H, Quan
M, an Hee den H (2023) Dis ibu ion and p e alence o Anaplasma aceae, Ricke siaceae and Coxiel-
laceae in A ican icks: a sys ema ic e iew and Me a-analysis. Mic oo ganisms 11(3) A icle 3. h ps://
doi.o g/10.3390/mic oo ganisms11030714
Cumming GS (2002) Compa ing clima e and ege a ion as limi ing ac o s o species anges o A ican
icks. Ecology 83(1):255–268. h ps://doi.o g/10.1890/0012-9658(2002)083[0255:CCAVAL]2.0.CO;2
Daniel M, Ce ný V, Dusbábek F, Honzáko á E, Olejnícek J (1976) In luence o mic oclima e on he li e
cycle o he common ick Ixodes icinus (L.) in he mophilic oak o es . Folia Pa asi ol 23(4):327–342
de la Fuen e J, An unes S, Bonne S, Cabezas-C uz A, Domingos AG, Es ada-Peña A, Johnson N, Kocan
KM, Mans ield KL, Nijho AM, Papa A, Rudenko N, Villa M, Albe di P, To ina A, Ayllón N, Vanco a
M, Golo chenko M, G ubho e L, …, Rego ROM (2017) Tick-Pa hogen In e ac ions and Vec o Com-
pe ence: Iden i ica ion o Molecula D i e s o Tick-Bo ne Diseases. F on ie s in Cellula and In ec-
ion Mic obiology, 7. h ps://doi.o g/10.3389/ cimb.2017.00114
Díaz-Paniagua C, Kelle C, And eu AC (2001) Long- e m demog aphic luc uacions o he spu - highed
o oise, Tes udo g aeca in SW Spain. Ecog aphy 24:707–721
Esse HJ, He e EA, Kays R, Lie ing Y, Jansen PA (2019) Local hos - ick coex inc ion in neo opical o es
agmen s. In J Pa asi ol 49(3):225–233. h ps://doi.o g/10.1016/j.ijpa a.2018.08.008
Es ada-Peña A, P ä le M, Bane h G, Kleine man G, Pe ney TN (2017) Ixodoidea o he Wes e n palaea c ic:
a e iew o a ailable li e a u e o iden i ica ion o species. Ticks Tick Bo ne Dis 8(4):512–525. h ps://
doi.o g/10.1016/j. bdis.2017.02.013
Fi ze PS, Tschi en B, Richne H (2004) Li e His o y and Fi ness consequences o ec opa asi es. J Anim Ecol
73(2):216–226
Gal A, Loeb E, Yisascha -Mekuzas Y, Bane h G (2008) De ec ion o eh lichia canis by PCR in di e en is-
sues ob ained du ing nec opsy om dogs su eyed o na u ally occu ing canine monocy ic eh lichio-
sis. Ve J (London, England:1997) 175(2):212–217. h ps://doi.o g/10.1016/j. jl.2007.01.013
Gazyağci S, Aşan N, Demi baş Y (2010) A common o oise ick, Hyalomma aegyp ium Linne 1758 (Aca i:
Ixodidae), iden i ied on eas e n hedgehog (E inaceus concolo Ma in 1838) in Cen al Ana olia. Tu k-
ish J Ve e ina y Anim Sci 34(2):211–213. h ps://doi.o g/10.3906/ e -0808-21
Gha bi M, Rjeibi MR, Roua bi M, Mab ouk M, Mhadhbi M, Amai ia S, Amdouni Y, Boussaadoun MA
(2015) In es a ion o he spu - highed o oise (Tes udo g aeca) by Hyalomma aegyp ium in Tunisia.
Ticks and Tick-Bo ne Diseases 6(3):352–355. h ps://doi.o g/10.1016/j. bdis.2015.02.009
Gibbons JW, G eene JL (1979) X-Ray pho og aphy: a echnique o De e mine Rep oduc i e pa e ns o
F eshwa e u les. He pe ologica 35(1):86–89
González-Ba io D, Ruiz-Fons F (2019) Coxiella bu ne ii in wild mammals: a sys ema ic e iew. T ansbound
Eme g Dis 66(2):662–671. h ps://doi.o g/10.1111/ bed.13085
Ha is DJ, G aciá E, Jo ge F, Maia JPMC, Pe e a A, Ca e e o MA, Giménez A (2013) Molecula de ec ion o
Hemoli ia (Apicomplexa: Haemog ega inidae) om icks o no h A ican Tes udo g aeca (Tes udines:
Tes udinidae) and an es ima ion o hei phylogene ic ela ionships using 18S RNA sequences. Comp
Pa asi ol 80(2):292–296. h ps://doi.o g/10.1654/4594.1
Hobe g EP, B ooks DR (2008) A Mac oe olu iona y Mosaic: episodic Hos -Swi ching, geog aphical coloni-
za ion and di e si ica ion in Complex hos -pa asi e sys ems. J Biogeog 35(9):1533–1550
1 3
676

Expe imen al and Applied Aca ology (2023) 91:661–679
Hoogs aal H (1956) No es on A ican haemaphysalis icks. III. The hy ax pa asi es H. bequae i sp. no , H.
o ien alis N. and W., 1915 (new combina ion), and H. cooleyi Bed o d, 1929 (Ixodoidea, Ixodidae). J
Pa asi ol 42(2):156–172.
Hoogs aal H, Kaise MN (1960) Some hos ela ionships o he To oise Tick, Hyalomma (Hyalommas a)
Aegyp ium (L.) (Ixodoidea, Ixodidae) in Tu key. Ann En omol Soc Am 53(4):457–458. h ps://doi.
o g/10.1093/aesa/53.4.457
Hu d H (2001) Hos ecundi y educ ion: a s a egy o damage limi a ion? T ends Pa asi ol 17(8):363–368.
h ps://doi.o g/10.1016/S1471-4922(01)01927-4
Hwang T-W, Kuang Y (2003) De e minis ic ex inc ion e ec o pa asi es on hos popula ions. J Ma h Biol
46(1):17–30. h ps://doi.o g/10.1007/s00285-002-0165-7
IUCN (1996) To oise & F eshwa e Tu le Specialis G oup. Tes udo g aeca. The IUCN Red Lis o Th ea -
ened Species 1996. h ps://doi.o g/10.2305/IUCN.UK.1996.RLTS.T21646A9305693.en
Ja anbakh H, Ši oký P, Mikulíček P, Sha i i M (2015) Dis ibu ion and abundance o Hemoli ia Mau i anica
(Apicomplexa: Haemog ega inidae) and i s ec o Hyalomma aegyp ium in o oises o I an. Biologia
70(2):229–234. h ps://doi.o g/10.1515/biolog-2015-0024
Jensenius M, Fou nie P-E, Raoul D (2004) Tick-bo ne icke sioses in in e na ional a elle s. In J In ec
Dis 8(3):139–146. h ps://doi.o g/10.1016/j.ijid.2003.06.004
Ka S, Yilmaze N, Midilli K, E gin S, Alp H, Ga gılı A (2011) P esence o he Zoono ic Bo -
elia bu gdo e i sl. And Ricke sia spp. In he Ticks om Wild To oises and Hedge-
hogs. Jou nal o Ma ma a Uni e si y Ins i u e o Heal h Sciences. h ps://www.
seman icschola .o g/pape /P esence-o - he-Zoono ic-Bo elia-bu gdo e i-sl.-Ka -Yilmaze /
a46a 162925a268 7b6144e74de55dd0274331ed
Ka S, Rod iguez SE, Akyildiz G, Cajima MNB, Bi can R, Mea s MC, Ben e DA, Keles AG (2020)
C imean-Congo hemo hagic Fe e i us in o oises and Hyalomma aegyp ium icks in Eas Th ace,
Tu key: po en ial o a c yp ic ansmission cycle. Pa asi es & Vec o s 13(1):201. h ps://doi.o g/10.1186/
s13071-020-04074-6
Ka lsen A, Voj ek B, Mojžišo á J, P okeš M, D ážo ská M (2020) Anaplasmosis in animals. Folia Ve
64(4):17–26. h ps://doi.o g/10.2478/ -2020-0033
Kau man M, Tia G, Papa A, Ši oký P (2016) AP92-like C imean-Congo Hemo hagic Fe e Vi us in Hya-
lomma aegyp ium icks, Alge ia. Eme g In ec Dis 22(2):354. h ps://doi.o g/10.3201/eid2202.151528
Laghzaoui E-M, Bouazza A, Abbad A, El Mouden EH (2022) C oss-sec ional s udy o icks in he ulne able
ee-li ing spu - highed o oise Tes udo g aeca (Tes udines: Tes udinidae) om Mo occo. In J Aca ol
48(1):76–83. h ps://doi.o g/10.1080/01647954.2021.2024595
Lockley EC, Fouda L, Co eia SM, Taxone a A, Nash LN, Fai wea he K, Reischig T, Du ão J, Dinis H,
Roque SM, Lomba JP, dos Passos L, Came on SJK, S iebens VA, Eizagui e C (2020) Long- e m su ey
o sea u les (Ca e a ca e a) e eals co ela ions be ween pa asi e In ec ion, eeding ecology, ep o-
duc i e success and popula ion dynamics. Sci Rep 10(1). h ps://doi.o g/10.1038/s41598-020-75498-4
Manoj RRS, Mendoza-Roldan JA, La o a MS, Remesa S, B ian i E, O an o D (2021) Molecula de ec ion
o zoono ic blood pa hogens in icks om illegally impo ed u les in I aly. Ac a T op 222:106038.
h ps://doi.o g/10.1016/j.ac a opica.2021.106038
Mendoza-Roldan JA, Mendoza-Roldan MA, O an o D (2021) Rep ile ec o -bo ne Diseases o zoono ic
conce n. In J Pa asi ology: Pa asi es Wildl 15:132–142. h ps://doi.o g/10.1016/j.ijppaw.2021.04.007
Mihalca AD, Racka K, Ghe man C, Ionescu DT (2008) P e alence and in ensi y o blood apicomplexan
In ec ions in ep iles om Romania. Pa asi ol Res 102(5):1081–1083. h ps://doi.o g/10.1007/
s00436-008-0912-9
Mo aga-Fe nández A, Chaligiannis Ι, Cabezas-C uz A, Papa A, So i aki S, de la Fuen e J, Fe nández de Me a
IG (2019) Molecula iden i ica ion o spo ed e e g oup Ricke sia in icks collec ed om dogs and
small uminan s in G eece. Exp Appl Aca ol 78(3):421–430. h ps://doi.o g/10.1111/ bed.13756
Mo aga Fe nández A, O iz JA, Jabba A, Gha a A, Cabezas-C uz A, de la Fuen e G, de la Fuen e J, Fe nán-
dez de Me a IG (2022) Fa al cases o bo ine anaplasmosis in a he d in ec ed wi h di e en anaplasma
ma ginale geno ypes in sou he n Spain. Ticks Tick Bo ne Dis 13(1):101864. h ps://doi.o g/10.1016/j.
bdis.2021.101864
Mo aga-Fe nández A, Ruiz-Fons F, Habela MA, Royo-He nández L, Cale o-Be nal R, Go aza C, de la
Fuen e J, Fe nández de Me a IG (2021) De ec ion o new c imean-congo haemo hagic e e i us gen-
o ypes in icks eeding on dee and wild boa , Spain. T ansbound Eme g Dis 68(3):993–1000. h ps://
doi.o g/10.1111/ bed.13756
Mumcuoglu KY, A slan-Ak e an G, Aydogdu S, Ka asa o a D, Kosa N, Gu ese AS, Shacham B, Taylan-
Ozkan A (2022) Pa hogens in icks collec ed in Is ael: I. Bac e ia and p o ozoa in Hyalomma aegyp-
ium and Hyalomma d omeda ii collec ed om o oises and camels. Ticks and Tick-Bo ne Diseases
13(1):101866. h ps://doi.o g/10.1016/j. bdis.2021.101866
1 3
677
Expe imen al and Applied Aca ology (2023) 91:661–679
Nagy KA, Medica PA (1986) Physiological Ecology o Dese To oises in Sou he n Ne ada. He pe ologica
42(1):73–92
Najja C, Kaabi B, Younsi H, Pe e o M, Rio dan P, Zhioua E (2020) Ticks pa asi izing he spu highed o oise
(Tes udo g aeca) popula ion o Tunisia. J Wildl Dis 56(4):815–822. h ps://doi.o g/10.7589/2019-09-219
No e AC, Ha is DJ, Sil ei a D, Nunes CS, Núncio MS, Ma ínez EG, Giménez A, de Sousa R, Lopes de
Ca alho I, Pe e a A (2021) Di e si y o mic oo ganisms in Hyalomma aegyp ium collec ed om spu -
highed o oise (Tes udo g aeca) in No h A ica and Ana olia. T ansbound Eme g Dis 69(4):1951–
1962. h ps://doi.o g/10.1111/ bed.14188
Paș iu AI, Ma ei IA, Mihalca AD, D’Amico G, Dumi ache MO, Kalmá Z, Sándo AD, Le kadi is M, Ghe -
man CM, Cozma V (2012) Zoono ic pa hogens associa ed wi h Hyalomma aegyp ium in endange ed
o oises: e idence o hos -swi ching beha iou in icks? Pa asi es & Vec o s 5(1):301. h ps://doi.
o g/10.1186/1756-3305-5-301
Pé ez I, Giménez A, Sánchez-Zapa a JA, Anadón JD, Ma ínez M, Es e e MÁ (2004) Non-comme cial col-
lec ion o spu - highed o oises (Tes udo g aeca g aeca): a cul u al p oblem in sou heas Spain. Biol
Conse 118(2):175–181. h ps://doi.o g/10.1016/j.biocon.2003.07.019
Pollock NB, V ede oe LK, Taylo EN (2012) How do hos sex and ep oduc i e s a e a ec hos p e e ence and
eeding du a ion o icks? Pa asi ol Res 111(2):897–907. h ps://doi.o g/10.1007/s00436-012-2916-8
Randolph SE (2004) Tick ecology: P ocesses and pa e ns behind he epidemiological isk posed by ixodid
icks as ec o s. Pa asi ology, 129 Suppl, S37-65. h ps://doi.o g/10.1017/s0031182004004925
Rhodin AGJ, I e son JB, Bou R, F i z U, Geo ges A, Sha e HB, an Dijk PP Tu les o he Wo ld: Anno-
a ed Checklis and A las o Taxonomy, Synonymy, Dis ibu ion, and, S a us C (2021) Chelonian
Resea ch Monog aphs, 8, 1–472. h ps://doi.o g/10.11606/issn.2316-9079. 20i2p225-228
Rjeibi MR, Amai ia S, Mhadhbi M, Rekik M, Gha bi M (2022) De ec ion and molecula iden i ica ion o
Anaplasma phagocy ophilum and Babesia Spp. In ec ions in Hyalomma aegyp ium icks in Tunisia.
A ch Mic obiol 204(7):385. h ps://doi.o g/10.1007/s00203-022-02995-7
Robbins RG, Ka esh WB, Calle PP, Leon ye a OA, Pe eshkolnik SL, Rosenbe g S (1998) Fi s Reco ds o
Hyalomma aegyp ium (Aca i: Ixodida: Ixodidae) om he Russian Spu -Thighed To oise, Tes udo
g aeca nikolskii, wi h an analysis o Tick Popula ion dynamics. J Pa asi ol 84(6):1303–1305. h ps://
doi.o g/10.2307/3284699
Rocha SC, Velásquez CV, Aquib A, Al-Nazal A, Pa een N (2022) T ansmission cycle o Tick-Bo ne In ec-
ions and co-in ec ions, Animal models and Diseases. Pa hogens 11(11). h ps://doi.o g/10.3390/
pa hogens11111309
Rod íguez-Ca o RC, Capde ila P, G aciá E, Ba bosa JM, Giménez A, Salgue o-Gómez R (2021) The limi s
o demog aphic bu e ing in coping wi h en i onmen al a ia ion. Oikos 130(8):1346–1358. h ps://doi.
o g/10.1111/oik.08343
Rod íguez O, de la Fuen e G, Fe nández de Me a IG, Vaz-Rod igues R, Go áza C, de la Fuen e J (2022).
The saha an an elope addax (Addax nasomacula us) as a hos o Hyalomma ma gina um, ick ec o o
c imean-congo hemo hagic e e i us. Ticks Tick Bo ne Dis 13(6):102034. h ps://doi.o g/10.1016/j.
bdis.2022.102034
Said L, Assmaa A, Najib G, Gmi a N (2014) Con ibu ion à l’é alua ion de la p ession pas o ale dans la o ê
de la Maamo a. Pa cou s o es ie s e su pâ u age. Na Technologie, 39–50
Segu a A, Ace edo P (2019) The impo ance o p o ec ed and unp o ec ed a eas o he Medi e anean spu -
highed o oise demog aphy in no hwes Mo occo. Amphibia-Rep ilia 40(3):361–371. h ps://doi.
o g/10.1163/15685381-20191143
Segu a A, Rod íguez O, Ruiz-Fons F, Ace edo P (2019) Tick pa asi ism in he Medi e anean spu - highed
o oise in he Maamo a o es , Mo occo. Ticks and Tick-Bo ne Diseases 10(2):286–289. h ps://doi.
o g/10.1016/j. bdis.2018.11.002
Segu a A, Delibes-Ma eos M, Ace edo P (2020) Implica ions o conse a ion o Collec ion o Medi e a-
nean spu -Thighed To oise as pe s in Mo occo: esiden s’ pe cep ions, habi s, and knowledge. Animals
10(2):265. h ps://doi.o g/10.3390/ani10020265
Segu a A, Rod iguez-Ca o RC, G acia E, Ace edo P (2021) Di e ences in ep oduc i e success in young and
old emales o a long-li ed species. Animals 11:467
Ši oký P, Pe želko á KJ, Kamle M, Mihalca AD, Mod ý D (2006) Hyalomma aegyp ium as dominan
ick in o oises o he genus Tes udo in Balkan coun ies, wi h no es on i s hos p e e ences. Exp Appl
Aca ol 40(3):279–290. h ps://doi.o g/10.1007/s10493-006-9036-z
Ši oký P, Mikulíček P, Jandzík D, Kami H, Mihalca AD, Rouag R, Kamle M, Schneide C, Zá uba M, Mod ý
D (2009) Co-dis ibu ion pa e n o a Haemog ega ine Hemoli ia Mau i anica (Apicomplexa: Haemo-
g ega inidae) and i s Vec o Hyalomma aegyp ium (Me as igma a: Ixodidae). J Pa asi ol 95(3):728–
733. h ps://doi.o g/10.1645/GE-1842.1
Ši oký P, E ha J, Pe želko á KJ, Kamle M (2011) Li e cycle o o oise ick Hyalomma aegyp ium unde
labo a o y condi ions. Exp Appl Aca ol 54(3):277–284. h ps://doi.o g/10.1007/s10493-011-9442-8
1 3
678
Expe imen al and Applied Aca ology (2023) 91:661–679
Temu AI, Kuhn JH, Peco DB, Apanaske ich DA, Kesh ka -Jah omi M (2021) Epidemiology o C imean-
Congo Hemo hagic Fe e (CCHF) in A ica—unde es ima ed o decades. Am J T op Med Hyg
104(6):1978–1990. h ps://doi.o g/10.4269/aj mh.20-1413
Tia G, Rouag R, Ziane FERRAHC, Benyacoub N, S., Luiselli L (2010) P e alence o Hemoli ia Mau i-
anica (Apicomplexa: Adeleina) in he blood o an Alge ian popula ion o he spu - highed o oise,
Tes udo g aeca. A He p News 50:14–21
Tia G, Tia -Saadi M, Benyacoub S, Rouag R, Ši oký P (2016) The dependence o Hyalomma aegyp ium on
i s o oise hos Tes udo g aeca in Alge ia. Med Ve En omol 30(3):351–359. h ps://doi.o g/10.1111/
m e.12175
Tia G, Boudebza R, Souallem I, Tia -Saadi M (2019) Enquê e su l’ampleu du amassage illégal des o -
ues e es es sau ages: P a ique non su isammen con ôlée en Algé ie (cas de la Wilaya d’El Ta ,
no d-es algé ien). 2
Uj a i B, Madsen T, Olsson M (2004) High p e alence o Hepa ozoon spp. (Apicomplexa, hepa ozoidae)
In ec ion in wa e py hons (Liasis uscus) om opical Aus alia. J Pa asi ol 90(3):670–672. h ps://
doi.o g/10.1645/GE-204R
Va anse e Z, Ga gili A, Aysul NS, Sengoz G, Es ada-Peña A (2008) Ticks bi ing humans in he u ban a ea
o Is anbul. Pa asi ol Res 102(3):551–553. h ps://doi.o g/10.1007/s00436-007-0809-z
We ne y U (2014) Zoonoses in he A abian Peninsula. Saudi Med J 35(12):1455–1462.
Publishe ’s No e Sp inge Na u e emains neu al wi h ega d o ju isdic ional claims in published maps and
ins i u ional a ilia ions.
Au ho s and A ilia ions
AmaliaSegu a1· Ma aRa ael2· Ri aVaz-Rod igues2· Osca Rod íguez1·
Ch is ianGo áza 2· Joséde la Fuen e2,3
José de la Fuen e
[email p o ec ed]
1 BP 30, Sidi Allal el Bah aoui 15250, Mo occo
2 SaBio, Ins i u o de In es igación en Recu sos Cinegé icos (IREC), Consejo Supe io de
In es igaciones Cien í icas (CSIC), Uni e sidad de Cas illa-La Mancha (UCLM)-Jun a de
Comunidades de Cas illa-La Mancha (JCCM), Ronda de Toledo 12, Ciudad Real 13005, Spain
3 Cen e o Ve e ina y Heal h Sciences, Depa men o Ve e ina y Pa hobiology, Oklahoma
S a e Uni e si y, S illwa e , OK 74078, USA
1 3
679