scieee AI-readable full text Open interactive document viewer

Tick infestation in spur-thighed tortoise population: a pilot study for unraveling epidemiological patterns and demographic consequences

Segura, Amalia,Rafael, Marta,Vaz Rodrigues, Rita,Rodríguez, Óscar,Gortázar, Christian,Fuente, José de la

Abstract

Open Access funding provided thanks to the CRUE-CSIC agreement with Springer Nature.

Full text

RESEARCH Received: 11 September 2023 / Accepted: 6 November 2023 / Published online: 16 November 2023 © The Author(s) 2023 Amalia Segura and Marta Rafael contributed equally to this work. Extended author information available on the last page of the article Tick infestation in spur-thighed tortoise population: a pilot study for unraveling epidemiological patterns and demographic consequences AmaliaSegura1· MartaRafael2· RitaVaz-Rodrigues2· OscarRodríguez1· ChristianGortázar2· Joséde la Fuente2,3 Experimental and Applied Acarology (2023) 91:661–679 https://doi.org/10.1007/s10493-023-00863-7 Abstract Ectoparasites, such as ticks, modulate host population dynamics by impacting demographic traits. They transmit infectious agents among their hosts, posing a critical threat to animal and public health. This study aimed to characterize and analyze the Hyalomma aegyptium infestation on one of its main hosts, the spur-thighed tortoise, its effects on demographic traits, and to determine the diversity of infectious agents present in both ticks and tortoises in the Maamora forest (northwestern Morocco). Our results show that 100% of the tortoises were parasitized by adult ticks in spring, an infestation intensity of 4 ticks/ tortoise (5.1 and 3.6 ticks/tortoise in males and females, respectively; 4.2 and 3.3 ticks/ tortoise in gravid and non-gravid females, respectively) and an abundance ranging from 1 to 12. Although without significant differences, male tortoises had higher tick abundances than females. The interaction of tortoise sex and body condition was significantly related to tick abundance, male body condition decreased with higher tick abundance in contrast to females. Nevertheless, the interaction of body condition and reproductive stage of females was not significantly related to tick abundance. Gravid females were significantly associated with tick abundance, showing a slightly higher infestation than non-gravid females. Molecular analysis of pooled tick samples revealed the presence of Ehrlichia ewingii, Candidatus Midichloria mitochondrii, and Rickettsia africae, with a minimum infection rate of 0.61 to 1.84%. However, blood sample analysis of the tortoises was infectious agent-free, pinpointing a lack of significant health problems. Given the possible effect on the transmission of zoonotic diseases by spur-thighed tortoises associated with their frequent collection as pets, it should be surveyed to control possible human health problems. In conservation terms, as a long-lived species, the role of tick infestation in demographic traits might be included in the management and conservation programs of spur-thighed tortoises. Keywords Hyalomma aegyptium · Surveillance · Tick-borne infectious agents · Tortoise · Testudo graeca 1 3 Experimental and Applied Acarology (2023) 91:661–679 Introduction Ectoparasites may modulate host population dynamics by influencing natural selection (Fitze et al. 2004; Bull and Burzacott 2006). Long interaction between hosts and ectoparasites impacts host population structure and size, affecting defence effectiveness and resulting in most of the cases in adaptation and co-evolution (Hwang and Kuang 2003; Esser et al. 2019). Tortoises from the Testudo genus have been deeply documented as hosts of tick species of the Hyalomma genus, such as Hyalomma aegyptium L. (Hoogstraal and Kaiser 1960; Široký et al. 2006), affecting those ectoparasites their life-history traits. Particularly high is the encounter rate of H. aegyptium with spur-thighed tortoise Testudo graeca in Morocco, Tunisia, Turkey and Algeria (Gharbi et al. 2015; Tiar et al. 2016; Segura et al. 2019; Najjar et al. 2020), and to a lesser extend with Marginated tortoise Testudo marginata in Greece (Široký et al. 2006), Horsfield´s tortoise Testudo horsfieldii in Iran (Javanbakht et al. 2015), and Hermann´s tortoise Testudo hermanni in Albania (Hoogstraal, 1956; Široký et al. 2006; Bizhga et al. 2022). The endured contact between H. aegyptium and Testudo may depend on a complex interplay of factors involving host demographic factors such as sex, reproductive stage or population density, host-parasite factors including encounter, compatibility and recognition strategies (Hoberg and Brooks 2008) and abiotic factors including elevation, temperature, rainfall and humidity (Cumming 2002; Javanbakht et al. 2015). In particular, the effect of tick parasitism is often higher in male tortoises than in females (Segura et al. 2019; Laghzaoui et al. 2022; but see Tiar et al. 2016), representing either differences in exposure or susceptibility to ticks, such as male-specific behaviour in breeding time by differential habitat use (Robbins et al. 1998). Male parasitism might result in an extra biological cost if physiological aspects such as body condition are affected (Segura et al. 2019). The effect of parasitism in the reproduction of tortoise females may influence resource allocation trade-offs, reducing or increasing reproductive output according to different strategies (e.g., Lockley et al. 2020). Therefore, female reproductive success might be compromised as a direct consequence of resource exploitation by parasites. Whereas small (young) infected females could use a bet-hedging strategy in favour of lifetime reproductive success, older infected females could adopt a terminal investment strategy (e.g., Lockley et al. 2020). Additional external factors, such as the limitation of food resources, will favour resource allocation from current reproduction to survival (and future reproduction) until the infection has passed (e.g., Hurd 2001; Pollock et al. 2012). Adults of H. aegyptium feed almost exclusively on tortoises of the genus Testudo. However, rare cases in other hosts, such as hares and hedgehogs, have been reported (Hoogstraal and Kaiser 1960; Gazyağci et al. 2010). Larvae and nymphs are less host-specific and feed on a variety of vertebrates (Estrada-Peña et al., 2017), including domestic animals (dogs, cattle, horses, or pigs; Aydin 2000), wild animals (lizards, birds, hedgehogs, rodents, or camels; Kar et al. 2011; Široký et al. 2011; Apanaskevich and Oliver 2014), and humans (Vatansever et al. 2008; Bursali et al., 2010). Ticks are considered the second vector of human diseases and are both vectors and reservoirs of infectious agents, harbouring bacterial, viral, and protozoan microorganisms (de la Fuente et al. 2017). The multitude of hosts affected by H. aegyptium poses a major concern as various dissemination scenarios may occur, leading to epidemiological consequences. Indeed, several infectious agents have been detected in H. aegyptium collected from spur-thighed tortoise, such as Rickettsia spp., Ehrlichia spp., Anaplasma spp., Coxiella burnetii, Crimean-Congo haemorrhagic fever 1 3 662 Experimental and Applied Acarology (2023) 91:661–679 virus (CCHFV) or Hemolivia mauritanica (Tiar et al. 2010; Bursali et al., 2011; Paștiu et al. 2012; Kautman et al. 2016; Barradas et al. 2019, 2020; Manoj et al. 2021; Mumcuoglu et al. 2022; Rjeibi et al. 2022). Particularly in Morocco, the presence of H. mauritanica, Ehrlichia spp., Midichloria mitochondrii, Wolbachia spp., relapsing fever borreliae, Francisella spp., and Rickettsia spp. has been reported from spur-thighed tortoise infested by H. aegyptium (e.g., Harris et al. 2013; Norte et al. 2021). In our study, we examined the presence of infectious agents in both H. aegyptium ticks and spur-thighed tortoises and the role of sex and female reproductive stage in tortoises as drivers of tick infestation in the host species. Spur-thighed tortoise have been red-listed as ‘vulnerable’ by the International Union for Conservation of Nature (IUCN 1996; Rhodin et al. 2021) and one of their main threats through their distribution is the collection and trade as pets (Pérez et al. 2004; Tiar et al. 2019; Segura et al. 2020). We selected a population located in the Maamora forest, a cork oak forest located in northern Morocco that is characterized as highly humid, when comparing with other areas of the tortoise distribution range, and considered close to the optimum niche of the tortoise distribution (Anadón et al. 2012). The population has been previously studied in 2018 in a private reserve where there is no pet trade and the undergrowth is well preserved (Segura et al. 2020). The study revealed high prevalence and moderate intensity of tick parasitism, and the influence of tick infestation on tortoise age, sex, body condition and population density (Segura et al. 2019). Indeed, this spur-thighed tortoise population has been recognized as one of the densest documented to date (Segura and Acevedo 2019). However, the epidemiological status of the tortoise community present in the Maamora forest is unknown, even though several demographic studies had discussed the different drivers of this tortoise population (Segura and Acevedo 2019; Segura et al. 2019, 2021). The high collection and trade of the species in this forest (Segura et al. 2020) pinpoint to the potential transmission of zoonotic pathogen agents. This study aims to (i) determine adult parasite prevalence, intensity and abundance in tortoises, (ii) analyse the role of tortoise sex, tortoise female reproduction stage and the interaction of both factors with the body condition as drivers of tick parasitism in the species, and (iii) identify and phylogenetically characterize tick-borne infectious agents, including Anaplasma spp., Babesia spp., C. burnetii, Ehrlichia spp., Hepatozoon spp. / H. mauritanica, Rickettsia spp., Borrelia spp., and CCHFV, in both H. aegyptium ticks and the spur-thighed tortoise. This study will contribute to the design of appropriate management and conservation plans and emphasizes the importance of surveillance and epidemiological profiling of both vectors and hosts. Materials and methods Study site The study was conducted in an area of low-elevation sandy soil (72–185 m above sea level) in the Maamora forest (Northwest Morocco; 34°02′54.19′′ N, 6°27′19.24′′ W, Grou-Bouregreg basin). The study area was located on the Mediterranean bioclimatic floor, with hot and dry summers, and the annual range of average rainfall was 300–500 mm and the mean annual temperature 22º C. Maamora forest is dominated by cork oak trees Quercus suber, scattered endemic wild pear Pyrus mamorensis, wild olive Olea europaea, green olive Phyl1 3 663 Experimental and Applied Acarology (2023) 91:661–679 lirea latifolia, and mastic Pistacia lentiscus, and a sparse understory of bush and shrub species such as Mediterranean broom Genista linifolia, Cytisus arboreus, Stauracanthus genistoides, dwarf palm Chamaerops humilis, French lavender Lavandula stoechas, sageleaved rockrose Cistus salviifolius, Halimium halimifolium, and Thymelaea lythroides. The study took place on a private reserve (3000 ha) characterized by well-represented undergrowth (e.g., species richness and cover) when compared with other unprotected sites in Maamora (highly overgrazed by livestock; Said et al. 2014). Sampling Tortoises were captured by hand between April and May 2022 (Table S1) following approved ethical wildlife capture and management protocols. Each individual encountered was sexed, the body mass was determined using a precise balance (± 1 g), and the body size was measured (± 1 mm) as the straight anteroposterior distance between the nuchal and supracaudal scutes using a calliper (carapace length, CL). Collection and tick extraction were carried out within a private initiative for the conservation of T. graeca in Maamora Forest. All ticks attached to the tortoise body were counted in the field, and a representative subsample was collected for analysis of infectious agents. The removed ticks were identified at the species level with DNA barcoding of mitochondrial genes. Blood was collected from the subcarapacial plexus using a 1-mL syringe. For determining the female reproductive stage, females were radiographed dorsoventrally with a portable X-ray at 60 kV (20 mA) at a distance of 1 m, according to Gibbons and Greene (1979). The radiography allowed the identification of gravid females and assessed the clutch size. Figure 1 represents the methods employed Fig. 1 Methodological flowchart. Individual characteristics were recorded such as weight, sex, body size measures and quantification of eggs. The relationship between the variables was performed using general linear models and linear models with the R software. In addition, DNA was extracted from ticks and blood samples collected from the tortoises. Positive samples of the pathogens analysed were sequenced, and phylogenetic trees were generated 1 3 664 Experimental and Applied Acarology (2023) 91:661–679 in this article. All tortoises were released immediately after measurements and sample collections at the capture site. Three parasitological indicators were calculated: (1) infestation prevalence, by dividing the number of infested tortoises by the number of examined tortoises and multiplying it by 100, (2) mean infestation intensity, by dividing the number of ticks by the number of infested tortoises, and (3) tick abundance, by dividing the number of ticks by the number of examined tortoises. The tortoise body condition (BC), which represents the body mass adjusted to the body size (Nagy and Medica 1986), was determined by calculating residual values through a linear regression analysis (all individuals pooled). In this analysis, the natural logarithm (ln) of body mass was used as the dependent variable, whereas ln CL was used as the independent variable. The individual body-condition index measures the extent of mass deviation compared to the expected values based on the animal’s size, which can change with age, stage of reproduction, drought and disease. Both the ticks and the blood of the tortoises were stored at -25 °C in tubes with RNAlater and sodium heparin, respectively, for further analysis. Tick DNA/RNA isolation and PCR infectious agents analysis Nucleic acid extraction was accomplished from individual tick samples and tick pools (mean of 3,196 ticks/pool, ranging from 1 to 8 ticks). The pools were designed randomly, according to the number of ticks collected in the field. DNA and RNA were extracted from the internal tissues of ticks, discarding the external cuticle, and using TRI Reagent (SigmaAldrich, St. Louis, USA), following the manufacturer’s instructions. The concentration (ng/µL) and purity of samples were evaluated using a Nanodrop One spectrophotometer (Thermo Scientific, Waltham, USA), through the quantification of the nucleic acids at an optical density of 260 nm (OD260) and the ratio of absorbance at 260/280 nm. The quality of the extraction protocol and confirmation of tick species were appraised by the amplification of the mitochondrial 16S ribosomal DNA (16S rDNA) gene and the cytochrome oxidase subunit I (COI) gene of four individual ticks (Table 1). All samples were tested using conventional polymerase chain reaction (PCR) aimed at detecting the presence of Anaplasma spp., Babesia spp., C. burnetii, Ehrlichia spp., Hepatozoon spp. / H. mauritanica, or Rickettsia spp., a nested PCR for the detection of Borrelia spp., and a nested reverse transcription (RT)-PCR for the identification of the CCHFV. Table 1 provides information on the specific targeted regions for each PCR assay, the used protocol, and primers. The PCR reactions were performed in a 25 µL volume, including 12.5 µL of PCR Master Mix 2x (Promega, Madison, WI, USA), 1 µL of each primer (10 µM working solution), 9 µL of RNase-free water (Thermo Scientific), and 1.5 µL of DNA sample. For the nested RT-PCR assessment of CCHFV, the commercial kit Access RT-PCR System (Promega, Fitchburg, WI, USA) was used according to the manufacturer’s instructions. The PCRs were conducted in a C1000 touch PCR thermal cycler (Bio-Rad, Hercules, CA, USA), with the specific PCR fragments visualized in 1.5% agarose gel stained with GelRed (Biotium, Fremont, CA, USA) under UV transillumination. 1 3 665 Experimental and Applied Acarology (2023) 91:661–679 Sequencing and phylogenetic analysis Presumed positive samples were purified and sequenced using the Sanger method at Secugen (Madrid, Spain). Sequences were edited with the Chromas software v.2.6.6., and homology analysis was conducted using the National Center for Biotechnology Information (NCBI) database, employing the Basic Local Alignment Search Tool (BLAST). The Table 1 Primers and PCR protocols according to the pathogen analysed Pathogen and target gene Sequence 5’-3’ (F: Forward / R: Reverse) Fragment (bp) Annealing (ºC) Reference 16S rDNA F: CCGGTCTGAACTCAGATCAAGT R: CTGCTCAATGATTTTTTAAATTGCTGTGG 460 48 Rodríguez et al. 2022 COI F: GGTCAACAAATCATAAAGATATTGG R: TAAACTTCAGGGTGACCAAAAATCA 650 50 CoimbraDores et al. 2018 Anaplasma spp. (16S rRNA) F: CAGAGTTTGATCCTGGCTCAGAACG R: GAGTTTGCCGGGACTTCTTCTGTA 421 42 Moraga Fernández et al. 2022 Anaplasma spp. (msp5) F: GCATAGCCTCCGCGTCTTTC R: TCCTCGCCTTGGCCCTCAGA 456 54 Moraga Fernández et al. 2022 Anaplasma spp. (msp4) F: CGGATCCTTAGCTGAACAGGAATCTTGC R: GGGAGCTCCTATGAATTACAGAGAATTGTTTAC 849 60 Moraga Fernández et al. 2022 Babesia spp. (18S rRNA) F: AAT ACC CAA TCC TGA CAC AGG G R: TTA AAT ACG AAT GCC CCC ACC 408 58 Barradas et al. 2020 Borrelia burgdorferi sensu lato (flagellin) F1: GCATCACTTTCAGGGTCTCA R1: TGGGGAACTTGATTAGCCTG F2: CTTTAAGAGTTCATGTTGGAG R2: TCATTGCCATTGCAGATTGT 390 55 and 58 Norte et al. 2021 Coxiella burnetii (IS111a) F: CAAGAATGATCGTAACGATGCGC R: CTCGTAACACCAATCGCTTCG 349 63 Rjeibi et al. 2022 Crimean-Congo Haemorrhagic Fever vírus (CCHFV S segment) F1: TTGTGTTCCAGATGGCCAGC R1: CTTAAGGCTGCCGTGTTTGC F2: GAAGCAACCAARTTCTGTGC R2: AAACCTATGTCCTTCCTCC 211 60 and 57 MoragaFernández et al. 2021 Ehrlichia spp. (16S rRNA) F: GGTACCYACAGAAGAAGTCC R: TAGCACTCATCGTTTACAGC 345 54 Barradas et al. 2020; Gal et al. 2008 Hepatozoon spp. / Hemolivia mauritanica (18S rRNA) F: GTTTCTGACCTATCAGCTTTCGACG R: CAAATCTAAGAATTTCACCTCTGAC 600 60 Norte et al. 2021; Ujvari et al. 2004 Rickettsia spp. (16S rRNA) F: AGAGTTTGATCCTGGCTCAG R: AACGTCATTATCTTCCTTGC 416 54 Rodríguez et al. 2022 Rickettsia spp. (ompA) F: ATGGCGAATATTTCTCCAAAA R: AGTGCAGCATTCGCTCCCCCT 630 54 MoragaFernández et al. 2019 Rickettsia spp. (ompB) F: GGGTGCTGCTACACAGCAGAA R: CCGTCACCGATATTAATTGCC 618 53 MoragaFernández et al. 2019 1 3 666 Experimental and Applied Acarology (2023) 91:661–679 16S rDNA sequence was deposited in GenBank under the accession number OQ295899. The COI partial sequences obtained in this study were attributed the accession numbers OQ320497 and OQ556797. The 16S rRNA partial sequences of Ehrlichia identified in this study were ascribed the accession numbers OQ9931657, OQ991496, OQ991497 and OQ996270. The outer membrane protein A [ompA] partial sequence of Rickettsia was submitted to Genbank and assigned the accession number OR003919. Multiple sequence alignment was carried out using the Multiple Sequence Comparison by Log-Expectation (MUSCLE) algorithm. Phylogenetic analysis was performed in MEGA software v.11.0.13. Corrected Akaike Information Criterion (cAIC) was used to select the best-fit model, and a phylogenetic tree for positive infectious agents was generated using maximum likelihood and Neighbor-Joining methods. To ensure the reliability of produced trees, 1000 bootstrap replicates were implemented. Blood nucleic acid isolation and PCR infectious agent analysis Blood DNA was extracted from tortoises with suspected infectious agents present in tick samples using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and following the manufacturer’s instructions. The samples were tested using conventional PCR against Anaplasma spp., Ehrlichia spp. and Rickettsia spp. (Table 1). The PCR protocol followed the same indications as the one described for the tick infectious agents research. Statistical analysis χ2 tests were used to assess differences in infestation intensity between tortoise sexes and between gravid and non-gravid tortoise females. Two generalized linear models (GLM) with a Poisson distribution and logarithmic link function were performed with the R v.4.3.1 (2023) software, to analyse the relationship between tick infestation rate (tick abundance) and (i) the tortoise sex and the interaction of body condition with sex, and (ii) female reproductive stage (gravid/non-gravid females) and the interaction of body condition with reproductive stage. For all analyses, statistical significance was declared at α = 0.05 (confidence level of 95%). Results Tick infestation rate and tortoise demographic traits In total 520 ticks (mostly adults with the exception of four nymphs) were counted on the 130 tortoises captured (98 females, 32 males). Overall, the infestation prevalence was 100% with all the tortoises parasitized by ticks, and the mean (± 95% confidence interval) infestation intensity was 4 ± 0.42 ticks/tortoise. Tick abundance ranged from 1 to 12 ticks/tortoise. Males presented higher infestation intensity (5.3 ± 1.11 ticks/tortoise) than females (3.6 ± 0.40 ticks/tortoise) but the differences between them were not significant (χ2 = 2.4, d.f. = 1, P = 0.1). The model for determining the infestation rate effect on sex and body condition showed a significant relation of sex and a significant interaction between body condition and 1 3 667 Experimental and Applied Acarology (2023) 91:661–679 sex. Males had higher tick abundances, and tick abundance decreased in males in relation to their body condition (Table 2; Fig. 2). Gravid females (34%; 1–5 eggs) presented higher mean infestation intensity than nongravid females (4.2 vs. 3.3 ticks/tortoise, n = 33 and 65, respectively) but the differences between them were not significant (χ2 = 1.08, d.f. = 1, P = 0.29). The model showed a significant relation between tick abundance and the reproductive stage of the females, gravid females with higher tick abundance than non-gravid females. In addition, it showed a lack Table 2 Statistical parameters of the generalized linear model (GLM) carried out to determine tick abundance variation in relation to the tortoise sex and the interaction of body condition and sex in tortoises Model predictors Estimate SE t P (Intercept) 1.287e + 00 5.307e-02 24.252 < 0.01 Body condition -2.617e-05 4.945e-04 -0.053 0.96 Sex1 Males 2.620e-01 1.003e-01 2.613 < 0.01 Body condition × males -4.978e-03 1.083e-03 -4.597 < 0.01 1Class reference for the categorical variable sex is ‘female’ Fig. 2 Number of ticks encountered categorized by sex and according to body condition (BC). Female data are represented in red, male data in blue 1 3 668 Experimental and Applied Acarology (2023) 91:661–679 of significance in the interaction between body condition and the reproductive stage of the females (Table 3). PCR analysis A sample of 163 ticks (156 males, six females, and one nymph) was used for DNA extraction and analysis. All 163 ticks were confirmed as H. aegyptium by barcoding of 16S rDNA and COI genes. BLAST analysis revealed 98.9–100% identity of two ticks, one identified for both genes, with H. aegyptium (GenBank accession numbers MG418679, AF132821 and KY548846). Phylogenetic analysis was performed to evaluate the genetic association between the sequenced samples and other Hyalomma species obtained from the GenBank database (Figs. 3 and 4). Both phylogenetic trees present clusters of the genotypes H. marginatum, H. excavatum, H. aegyptium and H. impeltatum and an outgroup of Ixodes ricinus (GenBank accession number MH645522 and MZ305543). The samples retrieved in this study cluster in the subgroup of H. aegyptium, being aggregated with samples collected from Turkey (KR870970) or Israel (KU130407), in the case of 16S rDNA sequences, and from Israel (KT989617), Morocco (OL467652) or Algeria (OL467646) in COI sequences. Sequence and BLAST analysis of suspected positive samples revealed four tick pools as positive for the Ehrlichia 16S rRNA gene (7.84%), and one (1.96%) as positive for the Rickettsia ompA gene. BLAST analysis of the Ehrlichia 16S rRNA gene of H. aegyptium showed three samples sharing 98–99% identity with Candidatus M. mitochondrii (GenBank accession number MG668797, OQ320500 or MK416236.1) and one with 99.6% identity to Ehrlichia ewingii (GenBank accession number MW092750). One sample (isolate 12) positive to Ehrlichia 16S rRNA presented a co-infection with Rickettsia sharing 99.7% identity with Rickettsia africae when targeting the ompA gene (GenBank accession number MW874463). Phylogenetic analysis for the Ehrlichia 16S rRNA (Fig. 5) confirmed the classification as Candidatus M. mitochondrii and E. ewingii. It shows a cluster between the isolates 44 (OQ996270), 20 (OQ991497) and 7 (OQ9931657) and Candidatus M. mitochondrii detected in H. anatolicum ticks from China (MG668797), H. aegyptium from Qatar (MW092748) and Morocco (MW293914), H. dromedarii from Tunisia (MK416236) and H. rufipes from Ghana (OQ320500). Concerning isolate 12 (OQ991496), it clusters with sequences identified as E. ewingii collected from Haemaphysalis bandicota from Taiwan (OK345369) and H. aegyptium from Qatar (MW092750). In terms of the Rickettsia ompA sequences, the phylogenetic analysis confirms the classification as R. africae (Fig. 6). The positive sample (isolate 12 - OR003919) clusters with R. africae sequences from Turkey (JQ691730) or Table 3 Statistical parameters of the generalized linear model (GLM) carried out to determine tick abundance variation in relation to the reproductive stage (gravid and non-gravid females) and the interaction of body condition and reproductive stage Model predictors Estimate SE t P (Intercept) 1.448 0.084 17.108 < 0.01 Reproductive stage Non-gravid1-0.251 0.108 -2.316 < 0.01 Body condition -0.0004 0.0009 -0.478 0.63 Body condition × non-gravid 0.0004 0.001 0.449 0.65 1Class reference for the categorical variable sex is ‘gravid’ 1 3 669 Experimental and Applied Acarology (2023) 91:661–679 Bizhga B, Sönmez B, Bardhaj L, Sherifi K, Gündemir O, Duro S (2022) Hyalomma aegyptium the dominant hard tick in tortoises Tesdudo hermanni boettgeri found in different regions of Albania. Int J Parasitol Parasites Wildl 17:199–204. https://doi.org/10.1016/j.ijppaw.2022.02.002 Brianti E, Dantas-Torres F, Giannetto S, Risitano A, Brucato G, Gaglio G, Otranto D (2010) Risk for the introduction of exotic ticks and pathogens into Italy through the illegal importation of tortoises, Testudo graeca. Med Vet Entomol 24(3):336–339. https://doi.org/10.1111/j.1365-2915.2010.00874.x Bull CM, Burzacott DA (2006) The influence of parasites on the Retention of Long-Term partnerships in the Australian sleepy Lizard, Tiliqua rugosa. Oecologia 146(4):675–680. https://doi.org/10.1007/ s00442-005-0224-z Bursali A, Tekin S, Keskin A, Ekici M, Dundar E (2011) Species diversity of ixodid ticks feeding on humans in Amasya, Turkey: Seasonal abundance and presence of Crimean-Congo hemorrhagic Fever virus. J Med Entomol 48(1):85–93. https://doi.org/10.1603/me10034 Bursali A, Tekin S, Orhan M, Keskin A, Ozkan M (2010) Ixodid ticks (Acari: Ixodidae) infesting humans in tokat province of Turkey: species diversity and seasonal activity. J Vector Ecol 35(1):180–186. https:// doi.org/10.1111/j.1948-7134.2010.00045.x Celina SS, Cerný J (2022) Coxiella burnetii in ticks, livestock, pets and wildlife: A mini-review. Frontiers in Veterinary Science, 9. https://doi.org/10.3389/fvets.2022.1068129 Coimbra-Dores MJ, Maia-Silva M, Marques W, Oliveira AC, Rosa F, Dias D (2018) Phylogenetic insights on mediterranean and afrotropical Rhipicephalus species (Acari: Ixodida) based on mitochondrial DNA. Exp Appl Acarol 75(1):107–128. https://doi.org/10.1007/s10493-018-0254-y Cossu CA, Collins NE, Oosthuizen MC, Menandro ML, Bhoora RV, Vorster I, Cassini R, Stoltsz H, Quan M, van Heerden H (2023) Distribution and prevalence of Anaplasmataceae, Rickettsiaceae and Coxiellaceae in African ticks: a systematic review and Meta-analysis. Microorganisms 11(3) Article 3. https:// doi.org/10.3390/microorganisms11030714 Cumming GS (2002) Comparing climate and vegetation as limiting factors for species ranges of African ticks. Ecology 83(1):255–268. https://doi.org/10.1890/0012-9658(2002)083[0255:CCAVAL]2.0.CO;2 Daniel M, Cerný V, Dusbábek F, Honzáková E, Olejnícek J (1976) Influence of microclimate on the life cycle of the common tick Ixodes ricinus (L.) in thermophilic oak forest. Folia Parasitol 23(4):327–342 de la Fuente J, Antunes S, Bonnet S, Cabezas-Cruz A, Domingos AG, Estrada-Peña A, Johnson N, Kocan KM, Mansfield KL, Nijhof AM, Papa A, Rudenko N, Villar M, Alberdi P, Torina A, Ayllón N, Vancova M, Golovchenko M, Grubhoffer L, …, Rego ROM (2017) Tick-Pathogen Interactions and Vector Competence: Identification of Molecular Drivers for Tick-Borne Diseases. Frontiers in Cellular and Infection Microbiology, 7. https://doi.org/10.3389/fcimb.2017.00114 Díaz-Paniagua C, Keller C, Andreu AC (2001) Long-term demographic fluctuacions of the spur-thighed tortoise, Testudo graeca in SW Spain. Ecography 24:707–721 Esser HJ, Herre EA, Kays R, Liefting Y, Jansen PA (2019) Local host-tick coextinction in neotropical forest fragments. Int J Parasitol 49(3):225–233. https://doi.org/10.1016/j.ijpara.2018.08.008 Estrada-Peña A, Pfäffle M, Baneth G, Kleinerman G, Petney TN (2017) Ixodoidea of the Western palaearctic: a review of available literature for identification of species. Ticks Tick Borne Dis 8(4):512–525. https:// doi.org/10.1016/j.ttbdis.2017.02.013 Fitze PS, Tschirren B, Richner H (2004) Life History and Fitness consequences of ectoparasites. J Anim Ecol 73(2):216–226 Gal A, Loeb E, Yisaschar-Mekuzas Y, Baneth G (2008) Detection of ehrlichia canis by PCR in different tissues obtained during necropsy from dogs surveyed for naturally occurring canine monocytic ehrlichiosis. Vet J (London, England:1997) 175(2):212–217. https://doi.org/10.1016/j.tvjl.2007.01.013 Gazyağci S, Aşan N, Demirbaş Y (2010) A common tortoise tick, Hyalomma aegyptium Linne 1758 (Acari: Ixodidae), identified on eastern hedgehog (Erinaceus concolor Martin 1838) in Central Anatolia. Turkish J Veterinary Anim Sci 34(2):211–213. https://doi.org/10.3906/vet-0808-21 Gharbi M, Rjeibi MR, Rouatbi M, Mabrouk M, Mhadhbi M, Amairia S, Amdouni Y, Boussaadoun MA (2015) Infestation of the spur-thighed tortoise (Testudo graeca) by Hyalomma aegyptium in Tunisia. Ticks and Tick-Borne Diseases 6(3):352–355. https://doi.org/10.1016/j.ttbdis.2015.02.009 Gibbons JW, Greene JL (1979) X-Ray photography: a technique to Determine Reproductive patterns of Freshwater turtles. Herpetologica 35(1):86–89 González-Barrio D, Ruiz-Fons F (2019) Coxiella burnetii in wild mammals: a systematic review. Transbound Emerg Dis 66(2):662–671. https://doi.org/10.1111/tbed.13085 Harris DJ, Graciá E, Jorge F, Maia JPMC, Perera A, Carretero MA, Giménez A (2013) Molecular detection of Hemolivia (Apicomplexa: Haemogregarinidae) from ticks of north African Testudo graeca (Testudines: Testudinidae) and an estimation of their phylogenetic relationships using 18S rRNA sequences. Comp Parasitol 80(2):292–296. https://doi.org/10.1654/4594.1 Hoberg EP, Brooks DR (2008) A Macroevolutionary Mosaic: episodic Host-Switching, geographical colonization and diversification in Complex host-parasite systems. J Biogeogr 35(9):1533–1550 1 3 676 Experimental and Applied Acarology (2023) 91:661–679 Hoogstraal H (1956) Notes on African haemaphysalis ticks. III. The hyrax parasites H. bequaerti sp. nov, H. orientalis N. and W., 1915 (new combination), and H. cooleyi Bedford, 1929 (Ixodoidea, Ixodidae). J Parasitol 42(2):156–172. Hoogstraal H, Kaiser MN (1960) Some host relationships of the Tortoise Tick, Hyalomma (Hyalommasta) Aegyptium (L.) (Ixodoidea, Ixodidae) in Turkey. Ann Entomol Soc Am 53(4):457–458. https://doi. org/10.1093/aesa/53.4.457 Hurd H (2001) Host fecundity reduction: a strategy for damage limitation? Trends Parasitol 17(8):363–368. https://doi.org/10.1016/S1471-4922(01)01927-4 Hwang T-W, Kuang Y (2003) Deterministic extinction effect of parasites on host populations. J Math Biol 46(1):17–30. https://doi.org/10.1007/s00285-002-0165-7 IUCN (1996) Tortoise & Freshwater Turtle Specialist Group. Testudo graeca. The IUCN Red List of Threatened Species 1996. https://doi.org/10.2305/IUCN.UK.1996.RLTS.T21646A9305693.en Javanbakht H, Široký P, Mikulíček P, Sharifi M (2015) Distribution and abundance of Hemolivia Mauritanica (Apicomplexa: Haemogregarinidae) and its vector Hyalomma aegyptium in tortoises of Iran. Biologia 70(2):229–234. https://doi.org/10.1515/biolog-2015-0024 Jensenius M, Fournier P-E, Raoult D (2004) Tick-borne rickettsioses in international travellers. Int J Infect Dis 8(3):139–146. https://doi.org/10.1016/j.ijid.2003.06.004 Kar S, Yilmazer N, Midilli K, Ergin S, Alp H, Gargılı A (2011) Presence of the Zoonotic Borrelia burgdorferi sl. And Rickettsia spp. In the Ticks from Wild Tortoises and Hedgehogs. Journal of Marmara University Institute of Health Sciences. https://www. semanticscholar.org/paper/Presence-of-the-Zoonotic-Borrelia-burgdorferi-sl.-Kar-Yilmazer/ a46af162925a268f7b6144e74de55dd0274331ed Kar S, Rodriguez SE, Akyildiz G, Cajimat MNB, Bircan R, Mears MC, Bente DA, Keles AG (2020) Crimean-Congo hemorrhagic Fever virus in tortoises and Hyalomma aegyptium ticks in East Thrace, Turkey: potential of a cryptic transmission cycle. Parasites & Vectors 13(1):201. https://doi.org/10.1186/ s13071-020-04074-6 Karlsen A, Vojtek B, Mojžišová J, Prokeš M, Drážovská M (2020) Anaplasmosis in animals. Folia Vet 64(4):17–26. https://doi.org/10.2478/fv-2020-0033 Kautman M, Tiar G, Papa A, Široký P (2016) AP92-like Crimean-Congo Hemorrhagic Fever Virus in Hyalomma aegyptium ticks, Algeria. Emerg Infect Dis 22(2):354. https://doi.org/10.3201/eid2202.151528 Laghzaoui E-M, Bouazza A, Abbad A, El Mouden EH (2022) Cross-sectional study of ticks in the vulnerable free-living spur-thighed tortoise Testudo graeca (Testudines: Testudinidae) from Morocco. Int J Acarol 48(1):76–83. https://doi.org/10.1080/01647954.2021.2024595 Lockley EC, Fouda L, Correia SM, Taxonera A, Nash LN, Fairweather K, Reischig T, Durão J, Dinis H, Roque SM, Lomba JP, dos Passos L, Cameron SJK, Stiebens VA, Eizaguirre C (2020) Long-term survey of sea turtles (Caretta caretta) reveals correlations between parasite Infection, feeding ecology, reproductive success and population dynamics. Sci Rep 10(1). https://doi.org/10.1038/s41598-020-75498-4 Manoj RRS, Mendoza-Roldan JA, Latrofa MS, Remesar S, Brianti E, Otranto D (2021) Molecular detection of zoonotic blood pathogens in ticks from illegally imported turtles in Italy. Acta Trop 222:106038. https://doi.org/10.1016/j.actatropica.2021.106038 Mendoza-Roldan JA, Mendoza-Roldan MA, Otranto D (2021) Reptile vector-borne Diseases of zoonotic concern. Int J Parasitology: Parasites Wildl 15:132–142. https://doi.org/10.1016/j.ijppaw.2021.04.007 Mihalca AD, Racka K, Gherman C, Ionescu DT (2008) Prevalence and intensity of blood apicomplexan Infections in reptiles from Romania. Parasitol Res 102(5):1081–1083. https://doi.org/10.1007/ s00436-008-0912-9 Moraga-Fernández A, Chaligiannis Ι, Cabezas-Cruz A, Papa A, Sotiraki S, de la Fuente J, Fernández de Mera IG (2019) Molecular identification of spotted fever group Rickettsia in ticks collected from dogs and small ruminants in Greece. Exp Appl Acarol 78(3):421–430. https://doi.org/10.1111/tbed.13756 Moraga Fernández A, Ortiz JA, Jabbar A, Ghafar A, Cabezas-Cruz A, de la Fuente G, de la Fuente J, Fernández de Mera IG (2022) Fatal cases of bovine anaplasmosis in a herd infected with different anaplasma marginale genotypes in southern Spain. Ticks Tick Borne Dis 13(1):101864. https://doi.org/10.1016/j. ttbdis.2021.101864 Moraga-Fernández A, Ruiz-Fons F, Habela MA, Royo-Hernández L, Calero-Bernal R, Gortazar C, de la Fuente J, Fernández de Mera IG (2021) Detection of new crimean-congo haemorrhagic fever virus genotypes in ticks feeding on deer and wild boar, Spain. Transbound Emerg Dis 68(3):993–1000. https:// doi.org/10.1111/tbed.13756 Mumcuoglu KY, Arslan-Akveran G, Aydogdu S, Karasartova D, Kosar N, Gureser AS, Shacham B, TaylanOzkan A (2022) Pathogens in ticks collected in Israel: I. Bacteria and protozoa in Hyalomma aegyptium and Hyalomma dromedarii collected from tortoises and camels. Ticks and Tick-Borne Diseases 13(1):101866. https://doi.org/10.1016/j.ttbdis.2021.101866 1 3 677 Experimental and Applied Acarology (2023) 91:661–679 Nagy KA, Medica PA (1986) Physiological Ecology of Desert Tortoises in Southern Nevada. Herpetologica 42(1):73–92 Najjar C, Kaabi B, Younsi H, Petretto M, Riordan P, Zhioua E (2020) Ticks parasitizing the spur thighed tortoise (Testudo graeca) population of Tunisia. J Wildl Dis 56(4):815–822. https://doi.org/10.7589/2019-09-219 Norte AC, Harris DJ, Silveira D, Nunes CS, Núncio MS, Martínez EG, Giménez A, de Sousa R, Lopes de Carvalho I, Perera A (2021) Diversity of microorganisms in Hyalomma aegyptium collected from spurthighed tortoise (Testudo graeca) in North Africa and Anatolia. Transbound Emerg Dis 69(4):1951– 1962. https://doi.org/10.1111/tbed.14188 Paștiu AI, Matei IA, Mihalca AD, D’Amico G, Dumitrache MO, Kalmár Z, Sándor AD, Lefkaditis M, Gherman CM, Cozma V (2012) Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: evidence for host-switching behaviour in ticks? Parasites & Vectors 5(1):301. https://doi. org/10.1186/1756-3305-5-301 Pérez I, Giménez A, Sánchez-Zapata JA, Anadón JD, Martínez M, Esteve MÁ (2004) Non-commercial collection of spur-thighed tortoises (Testudo graeca graeca): a cultural problem in southeast Spain. Biol Conserv 118(2):175–181. https://doi.org/10.1016/j.biocon.2003.07.019 Pollock NB, Vredevoe LK, Taylor EN (2012) How do host sex and reproductive state affect host preference and feeding duration of ticks? Parasitol Res 111(2):897–907. https://doi.org/10.1007/s00436-012-2916-8 Randolph SE (2004) Tick ecology: Processes and patterns behind the epidemiological risk posed by ixodid ticks as vectors. Parasitology, 129 Suppl, S37-65. https://doi.org/10.1017/s0031182004004925 Rhodin AGJ, Iverson JB, Bour R, Fritz U, Georges A, Shaffer HB, van Dijk PP Turtles of the World: Annotated Checklist and Atlas of Taxonomy, Synonymy, Distribution, and, Status C (2021) Chelonian Research Monographs, 8, 1–472. https://doi.org/10.11606/issn.2316-9079.v20i2p225-228 Rjeibi MR, Amairia S, Mhadhbi M, Rekik M, Gharbi M (2022) Detection and molecular identification of Anaplasma phagocytophilum and Babesia Spp. Infections in Hyalomma aegyptium ticks in Tunisia. Arch Microbiol 204(7):385. https://doi.org/10.1007/s00203-022-02995-7 Robbins RG, Karesh WB, Calle PP, Leontyeva OA, Pereshkolnik SL, Rosenberg S (1998) First Records of Hyalomma aegyptium (Acari: Ixodida: Ixodidae) from the Russian Spur-Thighed Tortoise, Testudo graeca nikolskii, with an analysis of Tick Population dynamics. J Parasitol 84(6):1303–1305. https:// doi.org/10.2307/3284699 Rocha SC, Velásquez CV, Aquib A, Al-Nazal A, Parveen N (2022) Transmission cycle of Tick-Borne Infections and co-infections, Animal models and Diseases. Pathogens 11(11). https://doi.org/10.3390/ pathogens11111309 Rodríguez-Caro RC, Capdevila P, Graciá E, Barbosa JM, Giménez A, Salguero-Gómez R (2021) The limits of demographic buffering in coping with environmental variation. Oikos 130(8):1346–1358. https://doi. org/10.1111/oik.08343 Rodríguez O, de la Fuente G, Fernández de Mera IG, Vaz-Rodrigues R, Gortázar C, de la Fuente J (2022). The saharan antelope addax (Addax nasomaculatus) as a host for Hyalomma marginatum, tick vector of crimean-congo hemorrhagic fever virus. Ticks Tick Borne Dis 13(6):102034. https://doi.org/10.1016/j. ttbdis.2022.102034 Said L, Assmaa A, Najib G, Gmira N (2014) Contribution à l’évaluation de la pression pastorale dans la forêt de la Maamora. Parcours forestiers et surpâturage. Nat Technologie, 39–50 Segura A, Acevedo P (2019) The importance of protected and unprotected areas for the Mediterranean spurthighed tortoise demography in northwest Morocco. Amphibia-Reptilia 40(3):361–371. https://doi. org/10.1163/15685381-20191143 Segura A, Rodríguez O, Ruiz-Fons F, Acevedo P (2019) Tick parasitism in the Mediterranean spur-thighed tortoise in the Maamora forest, Morocco. Ticks and Tick-Borne Diseases 10(2):286–289. https://doi. org/10.1016/j.ttbdis.2018.11.002 Segura A, Delibes-Mateos M, Acevedo P (2020) Implications for conservation of Collection of Mediterranean spur-Thighed Tortoise as pets in Morocco: residents’ perceptions, habits, and knowledge. Animals 10(2):265. https://doi.org/10.3390/ani10020265 Segura A, Rodriguez-Caro RC, Gracia E, Acevedo P (2021) Differences in reproductive success in young and old females of a long-lived species. Animals 11:467 Široký P, Petrželková KJ, Kamler M, Mihalca AD, Modrý D (2006) Hyalomma aegyptium as dominant tick in tortoises of the genus Testudo in Balkan countries, with notes on its host preferences. Exp Appl Acarol 40(3):279–290. https://doi.org/10.1007/s10493-006-9036-z Široký P, Mikulíček P, Jandzík D, Kami H, Mihalca AD, Rouag R, Kamler M, Schneider C, Záruba M, Modrý D (2009) Co-distribution pattern of a Haemogregarine Hemolivia Mauritanica (Apicomplexa: Haemogregarinidae) and its Vector Hyalomma aegyptium (Metastigmata: Ixodidae). J Parasitol 95(3):728– 733. https://doi.org/10.1645/GE-1842.1 Široký P, Erhart J, Petrželková KJ, Kamler M (2011) Life cycle of tortoise tick Hyalomma aegyptium under laboratory conditions. Exp Appl Acarol 54(3):277–284. https://doi.org/10.1007/s10493-011-9442-8 1 3 678 Experimental and Applied Acarology (2023) 91:661–679 Temur AI, Kuhn JH, Pecor DB, Apanaskevich DA, Keshtkar-Jahromi M (2021) Epidemiology of CrimeanCongo Hemorrhagic Fever (CCHF) in Africa—underestimated for decades. Am J Trop Med Hyg 104(6):1978–1990. https://doi.org/10.4269/ajtmh.20-1413 Tiar G, Rouag R, Ziane FERRAHC, Benyacoub N, S., Luiselli L (2010) Prevalence of Hemolivia Mauritanica (Apicomplexa: Adeleina) in the blood of an Algerian population of the spur-thighed tortoise, Testudo graeca. Afr Herp News 50:14–21 Tiar G, Tiar-Saadi M, Benyacoub S, Rouag R, Široký P (2016) The dependence of Hyalomma aegyptium on its tortoise host Testudo graeca in Algeria. Med Vet Entomol 30(3):351–359. https://doi.org/10.1111/ mve.12175 Tiar G, Boudebza R, Souallem I, Tiar-Saadi M (2019) Enquête sur l’ampleur du ramassage illégal des tortues terrestres sauvages: Pratique non suffisamment contrôlée en Algérie (cas de la Wilaya d’El Tarf, nord-est algérien). 2 Ujvari B, Madsen T, Olsson M (2004) High prevalence of Hepatozoon spp. (Apicomplexa, hepatozoidae) Infection in water pythons (Liasis fuscus) from tropical Australia. J Parasitol 90(3):670–672. https:// doi.org/10.1645/GE-204R Vatansever Z, Gargili A, Aysul NS, Sengoz G, Estrada-Peña A (2008) Ticks biting humans in the urban area of Istanbul. Parasitol Res 102(3):551–553. https://doi.org/10.1007/s00436-007-0809-z Wernery U (2014) Zoonoses in the Arabian Peninsula. Saudi Med J 35(12):1455–1462. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Authors and Affiliations AmaliaSegura1· MartaRafael2· RitaVaz-Rodrigues2· OscarRodríguez1· ChristianGortázar2· Joséde la Fuente2,3 José de la Fuente [email protected] 1 BP 30, Sidi Allal el Bahraoui 15250, Morocco 2 SaBio, Instituto de Investigación en Recursos Cinegéticos (IREC), Consejo Superior de Investigaciones Científicas (CSIC), Universidad de Castilla-La Mancha (UCLM)-Junta de Comunidades de Castilla-La Mancha (JCCM), Ronda de Toledo 12, Ciudad Real 13005, Spain 3 Center for Veterinary Health Sciences, Department of Veterinary Pathobiology, Oklahoma State University, Stillwater, OK 74078, USA 1 3 679