Resea ch A icle
De elopmen and Cha ac e iza ion o New Monoclonal
An ibodies agains Human Recombinan CA XII
Do ile Dekamina iciu e,1Ri a Lasickiene,1Seppo Pa kkila,2Vaida Jogai e,1
Ju gi a Ma uliene,1Dauman as Ma ulis,1and Au elija Z i bliene1
1Ins i u eo Bio echnology,VilniusUni e si y,V.A.G aiciuno8,20241Vilnius,Li huania
2Schoolo MedicineandIns i u eo BiomedicalTechnology,Uni e si yo Tampe eandFimlabL d.,Medisiina inka u3,
33520 Tampe e, Finland
Co espondence should be add essed o Do ile Dekamina iciu e; do ile.dekamina iciu[email p o ec ed]
Recei ed 19 Augus 2013; Accep ed 7 Ap il 2014; Published 20 May 2014
Academic Edi o : Na halie M. Mazu e
Copy igh © 2014 Do ile Dekamina iciu e e al. This is an open access a icle dis ibu ed unde he C ea i e Commons A ibu ion
License, which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed.
Ca bonic anhyd ases (CAs) a e enzymes ha ca alyse he e e sible hyd a ion o CO2 o bica bona e. CA XII is conside ed a
po en ial bioma ke o umo cells and a p omising a ge o speci ic he apies. The aim o he cu en s udy was o de elop
new monoclonal an ibodies (MAbs) agains human ecombinan CA XII and e alua e hei diagnos ic po en ial. An ex acellula
ca aly ic domain o human CA XII was exp essed in E. coli and used as an immunogen. Se en s able hyb idoma cell lines p oducing
high-a ini y IgG an ibodies agains human CA XII we e gene a ed. The majo i y o MAbs we e highly speci ic o CA XII and
did no c oss- eac wi h human ecombinan CA I, CA II, CA VII, and CA XIII. In o de o demons a e he diagnos ic alue
o he MAbs, hey we e employed o he immunohis ochemis y analysis o CA XII exp ession in issues. Two MAbs (15A4
and 4A6) demons a ed a s ong and speci ic immunos aining o CA XII in human issue specimens. Flow cy ome y analysis
o 5 human umo cell lines wi h he MAb 15A4 e ealed i s immuno eac i i y wi h cellula CA XII. In conclusion, he MAbs
aised agains ecombinan ca aly ic domain o CA XII ecognize cellula CA XII and ep esen a p omising diagnos ic ool o he
immunode ec ion o CA XII-exp essing cells.
1. In oduc ion
The 𝛼-ca bonicanhyd ases(𝛼-CAs, EC 4.2.1.1) belong o
me alloenzymes ha ca alyse he e e sible hyd a ion o
ca bon dioxide o bica bona e (H2O+CO
2↔H++
HCO3−). So a , 15 di e en human CAs a e iden i ied ha
di e in hei enzyma ic p ope ies, subcellula localiza ion,
and issue dis ibu ion. Enzyma ically ac i e human CAs
a e ei he cy osolic (CA I, CA II, CA III, CA VII, and CA
XIII), memb ane bound (CA IV, CA IX, CA XII, and CA
XIV), mi ochond ial (CA VA, and CA VB), o sec e o y (CA
VI). CAs a e exp essed in a ious cells and issues such as
e y h ocy es, gas oin es inal ac , ep oduc i e ac , he
ne oussys em,kidney,lung,skin,eye,andmuscle[1–6]. The
mos impo an unc ion o CAs is he anspo o CO2in
a ious me abolizing issues. CAs a e also in ol ed in o he
physiological unc ions: pH egula ion, ion anspo , bone
eso p ion and sec e ion o gas ic juice, ce eb ospinal luid,
and panc ea ic juice [4].
Recen s udiesindica e ha a leas woo CA ans-
memb ane isozymes—CA IX and XII—a e associa ed wi h
humancance s.CAIXisawell- ecognized umo ma ke as
i is o e exp essed in many ypes o umo s and is ound in
only a ew no mal issues [2]. The e a e inc easing e idences
on he po en ial o CA XII as a new umo ma ke . CA XII
is a ansmemb ane p o ein wi h an ex acellula ca aly ic
domain. CA XII o e exp ession has been demons a ed in
human enal cell ca cinoma [7] as well as in b ain, colo ec al,
b eas , gas oin es inal, o a ian, and panc ea ic cance s [6].
CA XII is also exp essed in he no mal human kidney, colon,
lung, b ain, p os a e, o a y, and es is [1,8].
Hindawi Publishing Co po a ion
BioMed Resea ch In e na ional
Volume 2014, A icle ID 309307, 11 pages
h p://dx.doi.o g/10.1155/2014/309307
2BioMed Resea ch In e na ional
The exp ession o CA IX and CA XII is induced
unde hypoxic condi ions h ough hypoxia inducible ac o -
1. Hypoxia and consequen acidosis o umo mic oen i on-
men a e p incipal ea u es o many ypes o solid cance s.
Bo h CA IX and CA XII p omo e umo g ow h and su i al
h ough pH main enance [6,8–10]. Recen s udies sugges
ha he unc ions o CA IX and CA XII ela ed o umo
g ow h and me as asis, as well as hei memb ane-associa ed
localiza ion, make hese enzymes p omising a ge s o spe-
ci ic he apies. Sul onamides ep esen he main g oup o
he speci ic CA chemical inhibi o s [11,12]. Two monoclonal
an ibodies (MAbs) agains CA IX we e gene a ed as speci ic
immunological ools o clinical de ec ion and he apy. Thei
diagnos ic alue has been con i med by immunohis ochem-
is y and adiolabeled monoclonal an ibody imaging [9].
Recen ly, he impo ance o CA XII as a se odiagnos ic
ma ke o lung cance has been demons a ed [13]. The MAb
6A10 aised agains CA XII exp essed in lung cance cells has
been shown o inhibi CA XII enzyma ic ac i i y and umo
g ow h in i o [14].
The aim o he cu en s udy was o de elop new
monoclonal an ibodies (MAbs) agains human ecombinan
CA XII and e alua e hei diagnos ic po en ial. We ha e
demons a ed ha he MAbs aised agains ecombinan
ca aly icdomaino CAXII ecognizecellula CAXIIanda e
aluable eagen s o i s immunode ec ion in human umo
issue specimens.
2. Ma e ials and Me hods
2.1. P oduc ion o Recombinan Ca bonic Anhyd ases.
Recombinan ex acellula domain o human CA XII
spanning amino acid (aa) esidues om 30 o 291 was
exp essed in E. coli cells and pu i ied as desc ibed p e iously
[15]. In b ie , E. coli Rose a (DE3) s ain cells (No agen,
Ge many) we e ans o med wi h ecombinan exp ession
ec o pET21a-CA XII. T ans o man s we e cul u ed
in Lu ia-Be ani (LB) medium, con aining 100 𝜇g/mL
ampicillin and 34 𝜇g/mL chlo amphenicol and g own a
37∘C and 220 pm o 16 h. The exp ession o CA XII was
induced wi h 1 mM isop opyl b-D- hiogalac oside (IPTG)
and in he p esence o 0.5 mM ZnSO4. The cul u e was g own
o 4 h a 30∘C and 220 pm. The cells we e ha es ed, mixed
wi h lysis bu e (20 mM Hepes, 0.1% T i on X-100, 0.15 M
NaCl, and 1 mM PMSF; pH 8.5), and dis up ed by sonica ion.
The soluble p o ein ac ion was pu i ied using a CA-a ini y
column con aining p-(aminome hyl)benzenesul onamide
aga ose (Sigma-Ald ich, S . Louis, USA). Elu ed CA XII
p o ein was dialyzed agains a s o age bu e con aining
10 mM Hepes (pH 7.5) and 50 mM NaCl. To es he
speci ici y o he MAbs o glycosyla ed o m o CA XII, he
ecombinan ex acellula domain o human CA XII was
exp essed in human cell line HEK293. Fo his pu pose,
exp ession plasmid based on pCEP4dS ec o designed
o hesec e iono ecombinan mammalianp o einswas
cons uc ed. The pCEP4dS ec o o inse ion o CA XII
gene was cons uc ed om he pCEP4 ec o (In i ogen,
Li e Technologies) by making wo modi ica ions. Fi s , he
ec o size was educed by he dele ion o 1990 base pai
agmen be ween he es ic ion si es o SalI (9953) and N uI
(7963). Second, he sec e ion signal was in oduced in o a
mul iple cloning si es. Two complemen a y single s anded
oligonucleo ides, con aining he sec e ion signal om he
V-J2-C egion o mu ine Ig kappa chain we e chemically
syn hesized and annealed. The esul an double s anded
oligonucleo ide was diges ed a he 5and 3ends wi h KpnI
and HindIII, espec i ely, and liga ed in o he ec o cu wi h
he same enzymes. Fo he exp ession o mammalian CA XII,
he pCEP4dS-CAXII plasmid was cons uc ed. The DNA
agmen , co esponding o he ca aly ic domain o CA XII
(amino acids 30 o 291), was cu ou om he pET21a-CAXII
plasmid [15] wi h NdeI and BamHI es ic ion endonucleases
and liga ed in o he pCEP4dS ec o , diges ed wi h HindIII
and BamHI. Recessed 3- e mini esul ing om he diges ion
wi h NdeI and HindIII we e illed in by Klenow agmen
be o e he liga ion. Because o he linke loca ed be ween
he sec e ion signal and he coding sequence o CA XII,
he exp essed CA XII p o ein has addi ional 8 amino acids
(DAAHMKLM) a he N e minus.
Exp ession o CA XII was ca ied ou using he F eeS yle
Max 293 exp ession sys em (In i ogen, Li e Technolo-
gies). F eeS yle 293-F suspension cell cul u e was main-
ained in 125–500 mL E lenmeye lasks con aining 30–
120 mL o F eeS yle medium in a 37∘Cincuba o wi ha
humidi ied a mosphe e o 8% CO2, on an o bi al shake
pla o m o a ing a 135 pm. F eeS yle cells we e an-
sien ly ans ec ed wi h he pu i ied pCEP4dS-CAXII plas-
mid acco ding o manu ac u e ’s ecommenda ions. Fou
daysla e , hecellcul u ewascen i ugeda 6000g o
20 min and he sec e ed CA XII p o ein was pu i ied om
he supe na an using a CA-a ini y column con aining p-
(aminome hyl)benzenesul onamide aga ose (Sigma-Li e Sci-
ence Ald ich). The elu ed CA XII p o ein was dialyzed in o a
s o age bu e con aining 10 mM Hepes (pH 7.5) and 50 mM
NaClands o eda −80∘C.
Recombinan s CA I, CA II, CA VII, and CA XIII we e
exp essed in E. coli and pu i ied as desc ibed p e iously [16].
2.2. P oduc ion o GST-Fused CA XII Segmen s o Epi ope
Mapping. DNA agmen s encoding h ee o e lapping seg-
men s o CA XII, numbe 1 (aa 27–130), numbe 2 (aa 111–
210), and numbe 3 (184–290), we e ampli ied om ull leng h
CA XII DNA by polyme ase chain eac ion (PCR) and cloned
in o bac e ial exp ession ec o pGex4T2. Th ee pai s o
p ime s wi h es ic ion endonuclease ecogni ion si es, s a
and s op codons, we e used in PCR (Table 1).
CA XII segmen s used o glu a hione-S- ans e ase
(GST) we e exp essed in E. coli BL21 (DE3) s ain (No agen).
T ans o medcellswe eg owninLBmedium,con aining
100 𝜇g/mL ampicillin a 37∘C and 220 pm o 16 h. The
sa u a ed cul u e was dilu ed (1 : 50) in esh LB medium,
con aining 100 𝜇g/mL ampicillin and 0.04 𝜇MZnSO
4and
g own o he op ical densi y (OD) a 600 nm OD600≈0.8.
The exp ession o GST- used CA XII segmen s was induced
wi h 1 mM IPTG and in he p esence o 0.4 mM ZnSO4.The
cul u e was g own o 4 h a 30∘C and 220 pm. The cells
BioMed Resea ch In e na ional 3
Table 1: PCR p ime s used o p oduce h ee o e lapping segmen s o CA XII.
Segmen numbe Segmen sequence PCR p ime sequences∗Res ic ion endonuclease
#1 Val 27-Gly130 5CCCGGGATCCGTGAACGGTTCCAAG 3BamHI
5ACGGCGGCCGCTTAGCCGTGCGGGTCATT 3No I
#2 Se 111-Leu210 5GGGCGGATCCTCTCGCTACAGTGCC 3BamHI
5GTCCTCTCGAGTTACAGCTCTTCAATGTTG 3XhoI
#3 Asp184-Se 290 5TCCGGGATCCGACAAGATCTTCAGTC 3BamHI
5AGACCTCGAGTTAGGAGAAGGAGGTGTATAC 3XhoI
∗Res ic ionendonuclease ecogni ionsi esa eunde lined.
we e ha es ed, mixed wi h lysis bu e (20 mM Hepes, 0.1%
T i on X-100, 0.15 M NaCl, (pH 8.5), and 1 mM PMSF), and
dis up ed by sonica ion. The exp ession le els o GST- usion
p o eins (GST-segmen numbe 1, 37.44 kDa; GST-segmen
numbe 2, 37.42 kDa; GST-segmen numbe 3, 38.92 kDa)
in he espec i elysa eso ans o medE. coli cells we e
e alua ed by sodium dodecyl sul a e-polyac ylamide gel
elec opho esis (SDS-PAGE).
2.3. Gene a ion o Monoclonal An ibodies. Th ee 6–8-week-
old emale BALB/c mice (ob ained om a b eeding colony a
he Depa men o Immunology o he Cen e o Inno a i e
Medicine, Vilnius, Li huania) we e immunized by a subcu-
aneous injec ion o 50 𝜇g o ecombinan CA XII. Fo an
ini ial immuniza ion, he an igen was emulsi ied in comple e
F eund adju an (Sigma). Subsequen immuniza ions a days
28 and 56 we e pe o med wi hou an adju an , wi h he
an igen dissol ed in PBS, espec i ely. An ise a we e collec ed
wo weeks a e each injec ion and es ed o he p esence o
CA XII-speci ic an ibodies by an indi ec ELISA. The mouse
wi h he highes an ibody i e was boos ed subcu aneously
wi h 50 𝜇g o CA XII dissol ed in PBS 3 days be o e he
cell usion. Hyb idomas we e gene a ed as desc ibed by
Kohle and Mils ein [17]. Mouse splenocy es we e used
wi h Sp2/0-Ag 14 mouse myeloma cells using polye hylene
glycol 4000 (PEG, Ro h). Hyb id cells we e selec ed in
g ow h medium supplemen ed wi h HAT (hypoxan hine,
aminop e in, and hymidine) (50x HAT media supplemen ,
Sigma-Ald ich). Cul u e supe na an s om wells wi h iable
clones we e sc eened by an indi ec ELISA using ecombinan
CA XII p o ein. S able hyb idoma clones sec e ing CA XII-
speci ic an ibodies we e ob ained a e wo cloning cycles
by a limi ing dilu ion assay. Hyb idoma cells we e g own
in comple e Dulbecco’s modi ied Eagle’s medium (DMEM,
Bioch om) supplemen ed wi h 15% e al bo ine se um (FBS,
Bioch om), 2 mM L-glu amine, and 200 𝜇g/mL gen amicin.
All p ocedu es in ol ing expe imen al mice we e pe o med
unde con olled labo a o y condi ions in s ic acco dance
wi h he Li huanian and Eu opean legisla ion.
2.4. Indi ec ELISA. The speci ici ies o mouse an ise a and
hyb idoma supe na an s we e in es iga ed by an indi ec
ELISA. Recombinan CA XII dilu ed in coa ing bu e
(0.05 M sodium ca bona e sal , pH 9.6) o 5 𝜇g/mL was coa ed
on pla es (Ne be) a 50 𝜇Laliquo pe wellandincuba eda
4∘Co e nigh .Thecoa edwellswe eblockedwi h150𝜇L
o 1% BSA solu ion in PBS o 1 hou a oom empe a u e
(RT). Pla es we e washed wo imes wi h PBS-Tween bu e
(0.1% Tween 20 in PBS). An ise um samples o hyb idoma
g ow h medium we e dilu ed in PBS-Tween bu e , added o
he wells (50 𝜇L/well), and incuba ed o 1 hou a RT. The
pla es we e insed 5 imes wi h PBS-Tween bu e and hen
incuba ed wi h 50 𝜇L o goa an i-mouse IgG conjuga ed o
ho se adish pe oxidase (HRP) (Bio-Rad) dilu ed 1 : 5000 in
PBS-Tween bu e o 1 hou a RT. The pla es we e washed
5 imes wi h PBS-Tween bu e . Pe oxidase ac i i y was
de ec ed using 50 𝜇L o eady- o-use TMB subs a e (Sigma)
pe well. A e 10 min o incuba ion a RT, he eac ion was
s opped by adding 25 𝜇Laliquo pe wello 10%H
2SO4.The
op ical densi y (OD) was measu ed a 450 nm ( e e ence il e
620 nm) using mic opla e eade (Tecan, G ¨
odig, Aus ia).
The iso ypes o he MAbs we e de e mined by ELISA
using he monoclonal an ibody iso yping ki (The mo Fishe
Scien i ic, Vilnius, Li huania) acco ding o he manu ac u e ’s
p o ocol.
2.5. De e mina ion o he Appa en Dissocia ion Cons an
(𝐾𝑑). The appa en dissocia ion cons an s (Kd) o he MAbs
we e de e mined by an indi ec ELISA as desc ibed p e i-
ously [18]. B ie ly, he MAbs we e p epa ed in concen a ions
anging om 1.9 × 10−13 M o3.3 × 10−8 Mandincuba ed
in he mic o i e pla es coa ed wi h ecombinan CA XII.
The pla es we e hen incuba ed wi h HRP-labelled an i-
mouse IgG (Bio-Rad) and de eloped wi h TMB subs a e.
The appa en Kdwas calcula ed om a i a ion cu e and
de ined as a mola concen a ion o he MAbs co esponding
o he midpoin be ween maximum OD450 alue and he
backg ound.
2.6. Sodium Dodecyl Sul a e-Polyac ylamide Gel Elec opho e-
sis. Be o e sodium dodecyl sul a e-polyac ylamide gel elec-
opho esis (SDS-PAGE), p o ein samples we e added o he
Line Ma ke Reducing sample bu e (The mo Scien i ic)
andboiled o 5min.P o einsamples(1𝜇g pe lane) we e
sepa a edbyelec opho esison12%polyac ylamidegel.The
gels we e isualized by s aining wi h Coomassie b illian blue
(Sigma).
2.7. Immunoblo ing. A e SDS-PAGE, p o eins we e ans-
e ed o a poly inylidene di luo ide (PVDF) memb ane
(Ro h). The memb anes we e blocked wi h 5% milk powde
in PBS o 1 h a RT. The memb anes we e incuba ed wi h
4BioMed Resea ch In e na ional
undilu ed hyb idoma supe na an s o 1 h a RT, ollowed
by incuba ion wi h goa an i-mouse IgG conjuga ed o
ho se adish pe oxidase (HRP) (Bio-Rad) dilu ed 1 : 4000
in PBS-Tween bu e . The enzyma ic eac ion was de el-
oped using e ame hylbenzidine (TMB) eady- o-use ch o-
mogenic subs a e (Sigma).
2.8. Flow Cy ome y Analysis. The eac i i ies o he MAbs
wi hcellula CAXIIwe ein es iga edby lowcy ome y
using 5 human cell lines: A-498 (human kidney ca cinoma),
U-87 (human p ima y glioblas oma), A-549 (human lung
adenoca cinoma), HeLa (human ce ical ca cinoma), and
CaSki (human ce ical ca cinoma) (ATCC, Manassas, VA,
USA). As a nega i e con ol, Chinese hams e o a y (CHO)
cells we e used. Cells we e cul i a ed in RPMI-1640 g ow h
medium (Bioch om, Be lin, Ge many) supplemen ed wi h
10% e al bo ine se um (Bioch om), 2 mM L-glu amine, and
200 𝜇g/mL gen amicin in humidi ied a mosphe e a 37∘C
and 5% CO2 o app oxima ely 70% con luence. Ha es ed
cells (106cells pe es ) we e ixed using a bu e con aining
pa a o maldehyde, washed wi h BD Pe m/Wash bu e (BD
Biosciences), and incuba ed wi h hyb idoma g ow h medium
a 4∘C o 30 min. As a nega i e con ol, i ele an MAbs o
IgG1 and IgG2a iso ypes we e used. Binding o he an ibodies
was de e mined using FITC-conjuga ed goa an i-mouse IgG
(BD Pha mingen, F anklin Lakes, USA) and measu ed by
s anda d low cy ome y (FACS) wi h CyFlowRspace low
cy ome e (Pa ec, Muens e , Ge many). No less han 20000
e en s pe es we e e alua ed wi h FloMax 2.7 so wa e.
2.9. Immunohis ochemis y Analysis. Immunohis ochemical
s aining was pe o med on o malin- ixed and pa a in-
embedded samples o colon adenoma, colon ca cinoma, enal
ca cinoma and no mal colon, and kidney issues a he
Ins i u e o Biomedical Technology, Uni e si y o Tampe e
(Tampe e, Finland). Tissue specimens we e collec ed and
es ed o CA XII exp ession as desc ibed p e iously [19].
Tissue sec ions (app oxima ely 5 𝜇m hick)we es ained
using an au oma ed Lab Vision Au os aine 480 (LabVision
Co po a ion, F emon , CA, USA) and Powe Vision Poly-
HRP Immunohis ochemis y ki (ImmunoVision Technolo-
gies, Bu lingame, CA, USA) acco ding o he manu ac u e ’s
p o ocol. Samples we e depa a inized in xylene and ehy-
d a ed in g aded alcohols. Tissue sec ions we e incuba ed
in 3% H2O2 o 5 min and blocked wi h cow colos um
dilu ed 1 : 2 in T is-bu e ed saline con aining 0.05% Tween-
20 o 30 min a RT. Slides we e incuba ed wi h he MAbs
o 30 min. A e insing in wash bu e o 35 min, samples
we e incuba ed in poly-HRP-conjuga ed an i- abbi /mouse
IgG (ImmunoVision Technologies) o 30 min. Slides we e
isualized using 3,3-o-diaminobenzidine e ahyd ochlo ide
(DAB) eady- o use solu ion (ImmunoVision Technologies).
3. Resul s
3.1. Gene a ion o Hyb idomas P oducing MAbs agains
Recombinan CA XII. In o de o gene a e hyb idomas,
BALB/c mice we e immunized wi h ecombinan CA XII
exp essed in E. coli and pu i ied by a ini y ch oma og a-
phy. Recombinan CA XII ep esen s he N- e minal ca -
aly ic domain (aa 30–291) o CA XII and lacks he signal,
ansmemb ane, and cy oplasmic domains. To e alua e he
immunogenici y o he ecombinan CA XII, an ise um
specimens we e collec ed a e each injec ion and es ed o
hep esenceo CAXII-speci ican ibodiesbyanindi ec
ELISA. A e 3 immuniza ions, he i e s o CA XII-speci ic
IgG an ibodies in he se a o immunized mice anged om
1 : 9000 o 1 : 21000 (da a no shown). Thus, ecombinan CA
XII was immunogenic in mice. Spleen cells o he mouse
wi h he highes an ibody i e we e used wi h mouse
myeloma cells ollowing s anda d p ocedu es. A he 12 h
day a e cell usion, hyb id clones sec e ing CA XII-speci ic
an ibodies we e sc eened by an indi ec ELISA on pla es
coa ed wi h he ecombinan CA XII. Se en s able hyb idoma
cell lines p oducing CA XII-speci ic MAbs o IgG iso ype
we e gene a ed (Table 2). Six ou o 7 MAbs we e o IgG1
sub ype; one MAb (clone 15A4) was o IgG2a sub ype. The
hyb idomas we e cul i a ed in cul u e and he supe na an s
we e collec ed o u he cha ac e iza ion o he MAbs.
3.2. Speci ici y and A ini y o he MAbs. All MAbs we e
eac i e in ELISA wi h he ecombinan E. coli-exp essed CA
XII (da a no shown). To es he eac i i y o he MAbs
wi h SDS-dena u ed an igen, he pu i ied CA XII p o ein
and c ude lysa e o E. coli ans o med wi h pET21a-CA XII
ec o we e dena u ed by boiling in sample bu e (The mo
Fishe Scien i ic) con aining SDS and 2-me cap oe hanol and
subjec ed o p o ein elec opho esis and immunoblo ing.
All MAbs speci ically ecognized p o ein band o 31 kDa,
which co esponded o ecombinan CA XII (Figu e 1,lane
1) and did no c oss- eac wi h o he p o eins o E. coli lysa es
(Figu e 1,lane2).Thus,allMAbswe e eac i ewi hSDS-
dena u ed ecombinan CA XII (Table 2).
As heMAbswe e aisedagains E. coli-exp essed ecom-
binan CA XII ha did no unde go pos ansla ional mod-
i ica ions, he abili y o he MAbs o ecognize glycosyla ed
o m o CA XII was e alua ed. Fo his pu pose, he eac-
i i ies o he MAbs wi h ecombinan CA XII exp essed in
human HEK 293 cells we e es ed bo h by ELISA and Wes e n
blo . The MAbs di e ed in hei capabili y o ecognize
glycosyla ed CA XII exp essed in mammalian cells. MAbs
4A6,9A8,and15A4showedas ong eac i i ywi h he
ecombinan glycosyla ed CA XII bo h by ELISA and Wes e n
blo (Figu e 1,lane3,Table 2). In con as , MAbs 1D5 and 5D2
we e non eac i e wi h CA XII exp essed in mammalian cells
(Table 2). MAbs 8C9 and 13F5 showed a mode a e eac i i y
wi h CA XII exp essed in mammalian cells (Figu e 1,lane3,
Table 2).
To in es iga e he c oss- eac i i ies o he MAbs wi h CA
iso o ms o he han XII, he p e iously pu i ied CAs we e
used [15]. The analysis o MAb eac i i ies bo h by ELISA and
Wes e n blo e ealed ha 6 MAbs eac ed exclusi ely wi h
he ecombinan CAXIIanddidno showany eac i i ywi h
ecombinan s CA I, CA II, CA VII, and CA XIII (Table 2).
Only he MAb 13F5 showed a weak c oss- eac i i y wi h CA
II and CA VII in ELISA bu no in Wes e n blo (Table 2).
BioMed Resea ch In e na ional 5
Table 2: Cha ac e iza ion o he MAbs aised agains ecombinan CA XII: summa ized da a.
Reac i i y wi h CA XII:
MAb clone C oss- eac i i y o he MAbs wi h
ecombinan CA iso o ms IgG sub ype Appa en 𝐾𝑑,𝑀exp essed in E. coli exp essed in mammalian cells in cance cells o issue
CA I CA II CA VII CA XIII ELISA WB ELISA WB FACS IHC
1D5 −−−− IgG1 2.07 ×10−10 ++−−−−
4A6 −−−− IgG1 1.07 ×10−9+++ + −−/+
5D2 −−−− IgG1 5.45 ×10−10 ++−−−−
8C9 −−−− IgG1 1.88 ×10−10 ++−/+ + −−
9A8 −−−− IgG1 6.17 ×10−10 +++ + −−
13F5 −−/+ −/+ −IgG1 1.12 ×10−10 ++−/+ + −−
15A4 −−−− IgG2a 2.02 ×10−10 +++ + + +
“+”: s ong eac ion, “−/+”: weak eac ion, “−”: no eac ion.
6BioMed Resea ch In e na ional
(kDa)
M123 M123 M123 M123
170
130
100
(kDa)
(kDa)
(kDa)
170
130
100
70
55
40
35
25
15
10
70
55
40
35
25
15
10
170
130
100
70
55
40
35
25
15
10
170
130
100
70
55
40
35
25
15
10
SDS-PAGE 1D54A65D2
(a)
(kDa)
(kDa)
(kDa)
(kDa)
170
130
100
70
55
40
35
25
15
10
170
130
100
70
55
40
35
25
15
10
170
130
100
70
55
40
35
25
15
10
170
130
100
70
55
40
35
25
15
10
8C9 9A8 13F5 15A4
M123M12 3M1 2 3M123
(b)
Figu e 1: Reac i i y o he MAbs wi h dena u ed ecombinan CA XII exp essed in E. coli and mammalian cells. Uppe -le mos panel: SDS-
PAGE; emaining panels: immunoblo wi h MAbs 1D5, 4A6, 5D2, 8C9, 9A8, 13F5, and 15A4. Line M: p es ained MW ma ke s (The mo Fishe
Scien i ic, Vilnius); line 1: pu i ied ecombinan CA XII p o einexp essed in E. coli;line2:lysa eo E. coli Rose a (DE3) s ain cells; line 3:
pu i ied ecombinan CA XII p o ein exp essed in mammalian cells.
To de e mine he a ini y o he MAbs, hei appa en 𝐾𝑑
alues we e measu ed by an indi ec ELISA. The 𝐾𝑑 alues
o he MAbs calcula ed om h ee expe imen s anged om
1.07 × 10−9 M o6.17 × 10−10 M, indica ing high-a ini y
binding (Table 2).
3.3. Localiza ion o MAb Epi opes. To iden i y he epi opes
o ecombinan CA XII ecognized by he MAbs, h ee
pa ially o e lapping GST- used agmen s o CA XII we e
cons uc ed: agmen numbe 1 (aa 27–130), agmen num-
be 2 (aa 110–210), and agmen numbe 3 (aa 184–290).
Schema ic ep esen a ion o GST- used CA XII agmen s is
shown in Figu e 2.
GST- used agmen s o CA XII we e exp essed in E.
coli BL21 (DE3) s ain. Exp ession le els o GST- used CA
XII agmen s in E. coli lysa es we e analysed by SDS-
PAGE and Wes e n blo using comme cial an ibodies agains
GST (Figu e 3). All agmen s we e e icien ly exp essed in
ans o med E. coli cells. The eac i i ies o he MAbs wi h
GST- used CA XII agmen s we e in es iga ed by Wes e n
blo using lysa es o ans o med E. coli cells exp essing he
espec i e agmen s. MAbs 1D5, 4A6, and 5D2 ecognized
agmen numbe 1 ha ep esen s he N- e minal egion o
CA XII (aa 27–130). As he MAbs 1D5, 4A6, and 5D2 we e
eac i e wi h he whole ecombinan ca aly ic domain o CA
XII (aa 30–291) and did no ecognize agmen numbe 2 (aa
111–210), he epi opes o hese MAbs we e loca ed be ween aa
BioMed Resea ch In e na ional 7
w CA XII (aa 1-354)
Recombinan CA XII (aa 30-291)
(aa 27-130)
(aa 110-210)
(aa 184-290)
Numbe 1
Numbe 2
Numbe 3
Figu e 2: Schema ic ep esen a ion o GST- used CA XII agmen s used o epi ope mapping. W CA XII: ull leng h CA XII. Recombinan
CA XII-E. coli-exp essed ex acellula ca aly ic domain o CA XII used o he gene a ion and cha ac e iza ion o MAbs.
170
130
100
70
55
40
35
25
15
M12345
SDS-PAGE
(kDa)
(a)
15
170
130
100
70
55
40
35
25
M12345
An i-GST
(kDa)
(b)
Figu e 3: Analysis o he exp ession o GST- used CA XII agmen s in E. coli lysa es. (a) SDS-PAGE. (b) Wes e n blo wi h an i-GST MAbs
(The mo Scien i ic): lane M: p es ained MW ma ke s (The mo Scien i ic); lane 1: pu i ied ecombinan CA XII p o ein; lanes 2–4: lysa es o
ans o med E. coli cells exp essing CA XII agmen s numbe 1 (lane 2), numbe 2 (lane 3), and numbe 3 (lane 4); line 5: lysa e o ans o med
E. coli cells exp essing GST. A ow (←) indica es GST- used CA XII agmen s.
30 and 110 o CA XII. MAbs 8C9 and 13F5 eac ed exclusi ely
wi h agmen numbe 3 ha ep esen s C- e minal egion
o CA XII (aa 184–290). As he MAbs 8C9 and 13F5 did no
ecognize an o e lapping agmen numbe 2 (aa 111–210), he
epi opes o hese MAbs we e loca ed be ween aa 210 and 290
o CA XII. MAbs 9A8 and 15A4 ecognized bo h agmen
numbe s 2 and 3. I was concluded ha hei epi opes a e
loca ed be ween aa 184 and 210, as his is an o e lapping
sequence o bo h agmen numbe s 2 and 3. Summa ized
da a on MAb eac i i ies wi h GST- used CA XII agmen s
a e p esen ed in Table 3.
3.4. The Reac i i ies o he MAbs wi h he Cellula CA XII
by Flow Cy ome y. To in es iga e he eac i i ies o he
MAbs wi h he cellula ull-leng h CA XII, we ha e used
human cance cell lines A-498 (human kidney ca cinoma),
U-87 (human p ima y glioblas oma), A-549 (human lung
adenoca cinoma), HeLa (human ce ical ca cinoma), and
CaSki (human ce ical ca cinoma) wi h p e iously epo ed
di e en exp ession le els o CA XII [13,20]. As a nega i e
con ol, Chinese hams e o a y (CHO) cells we e used. The
cells we e cul i a ed unde no moxic condi ions, hen ea ed
wi h he MAbs and analysed by low cy ome y. The MAbs
di e ed in hei capaci y o ecognize he cellula CA XII
in human cance cell lines. The MAb 15A4 showed a s ong
speci ic immunos aining o A-498, U-87, A-549, CaSki, and
HeLa cells and had no eac ion wi h CHO cells used a as
anega i econ ol(Figu e 4(a)). In con as , no eac i i y o
he MAbs 1D5, 4A6, 5D2, and 9A8 wi h hese cell lines was
obse ed (Figu e 4(b)).The MAbs 8C9 and 13F5, howe e ,
we e eac i e bo h wi h human cell lines and CHO cells (da a
no shown), indica ing nonspeci ic s aining.
3.5. The Reac i i ies o he MAbs wi h he Cellula CA XII
by Immunohis ochemis y. Immunohis ochemis y analysis
(IHC) was used o in es iga e he eac i i ies o he MAbs
wi h he cellula ull-leng h CA XII p o ein on o malin-
ixed and pa a in-embedded samples o colon adenoma,
colon ca cinoma, enal ca cinoma, and no mal colon and
kidney issues. Two MAbs, clones 4A6 and 15A4, showed
speci ic immunos aining o enal ca cinoma, colon adenoma,
and colon ca cinoma specimens and did no show any
8BioMed Resea ch In e na ional
80
60
40
20
0
100101102103104
100101102103104
100101102103104100101102103104
Coun
Coun
Coun
Coun
Coun
Coun
FITC
FITC FITC FITC
FITC
FITC
120
90
60
30
0
88
66
44
22
0
98
74
49
25
0
112
84
56
28
0
115
86
58
29
0
100101102103104100101102103104
U-87, 15A4 A-549, 15A4 A-498, 15A4
CHO, 15A4
CaSki, 15A4
HeLa, 15A4
(a)
Coun
Coun
Coun
FITC FITC FITC
113
85
57
28
0
103
77
52
26
0
121
91
61
30
0
100101102103104
100101102103104
100101102103104
A-498, 1D5 CaSki, 1D5 CHO, 1D5
(b)
Figu e 4: Flow-cy ome y analysis o U-87, A-549, A-498, HeLa, and CaSki cell lines immunos ained wi h he MAbs: (a) 15A4 (IgG2a sub ype)
(black line); (b) 1D5 (IgG2a sub ype) (black line); i ele an MAbs o IgG1 o IgG2a sub ypes we e used as nega i e con ol (g ay line).
Table 3: The eac i i y o he MAbs wi h GST- used CA XII agmen s and p edic ed localiza ion o MAb epi opes.
MAb clone CA XII p o ein agmen s P edic ed localiza ion o MAb epi opes
#1 (aa 27–130) #2 (aa 111–210) #3 (aa 184–290)
1D5 + −− aa 30–110
4A6 + −− aa 30–110
5D2 + −− aa 30–110
8C9 −− +aa210–290
9A8 −++ aa184–210
13F5 −− +aa210–290
15A4 −++ aa184–210
BioMed Resea ch In e na ional 9
(a) (b)
(c) (d)
(e) ( )
Figu e 5: Immunos aining o colon adenoma (a), no mal colon (b), no mal kidney ((d), ( )), and enal ca cinoma ((c), (e)) specimens o
CA XII exp ession using newly p oduced mAbs 15A4 ((a)–(d)) and 4A6 ((e), ( )). MAb clone 15A4 hyb idoma supe na an was dilu ed 1 : 100;
4A6-1 : 10. O iginal magni ica ions ×400.
unspeci ic backg ound s aining o he espec i e no mal
issues (Figu e 5). The MAb 4A6 was eac i e in IHC a highe
concen a ions (dilu ion o hyb idoma supe na an 1 : 10,
Figu es 5(e) and 5( ))ascompa ed o heMAb15A4(dilu ion
o hyb idoma supe na an 1 : 100, Figu es 5(a)–5(d)), which
is explained by di e en a ini ies o he MAbs: 𝐾𝑑we e
1.07 × 10−9 and 2.02 × 10−10, espec i ely.O he MAbsdid
no show any speci ic immunos aining o issue specimens
(da a no shown). Thus, he IHC esul s demons a e he
po en ial o he MAbs 4A6 and 15A4 as speci ic eagen s
o he immunode ec ion o CA XII in o malin- ixed and
pa a in-embedded issuespecimens.
4. Discussion
CA XII is a single-pass ansmemb ane p o ein wi h an
ex acellula ca aly ic domain [1].Basedoni s olein umo
p og ession, his enzyme is conside ed o be a use ul diag-
nos ic and p ognos ic bioma ke o di e en umo s [6].
Howe e , heda aonCAXIIdis ibu ioninno maland
umo issues a e s ill incomple e. In es iga ion o CA XII
exp ession in di e en cell ypes migh be p omo ed by he
a ailabili y o highly speci ic and well-cha ac e ized MAbs.
To gene a e MAbs agains memb ane-bound p o eins, such
as ca bonic anhyd ases, immuniza ions wi h in ac cells,