Re Esp Quimio e 2018;31(2): 160-163 160
© The Au ho 2018. Published by Sociedad Española de Quimio e apia. All igh s ese ed. Fo pe missions, please e-mail: [email p o ec ed]
INTRODUCTION
Mo e han 50 species con o m he Shewanella genus.
Among hem, Shewanella algae, Shewanella pu e aciens,
Shewanella halio is and Shewanella xiamenensis can cause
disease in humans wi h he o me causing i mo e o en [1].
The eason ha explains he p ominence o hese species o
cause disease, and S. algae being mos abundan , a e unknown.
S. algae a e a halophilic G am-nega i e od wi h a dis inc i e
biochemis y: non-glucose e men ing, cy och ome oxidase
posi i e, ni a e educ ion es posi i e, ca alase nega i e and
H2S p oduce . I can be ound all o e he wo ld especially in
seawa e , aqua ic animals and sedimen s. This mic obe can
cause disease in human beings. Case epo s om he li e a u e
include so issue in ec ions as p eponde an , bu also bac e-
emia, o i is and a h i is, among o he s [2]. Mos o he cases
come om wa m coas al a eas. Acu e en e i is cases a e sca ce
and ha e been epo ed in associa ion wi h Esche ichia coli as
ano he pa hogen [3] and as a ch onic dia hea case [4]. We
p esen a case o acu e en e i is ha included S. algae.
CASE REPORT
We epo he case o a 69 yea s old pa ien wi h li e
ci hosis, ischemic hea disease, high blood p essu e and wo
admissions in he las wo mon hs. He li es in an u ban a ea
in sou he n Spain, 67 km away om he coas wi h his wi e,
e i ed o se e al yea s. Con ac wi h wild animals, ecen ips
o he coas , consump ion o unp ocessed ood, o con ac
wi h wa e o algae had no been epo ed.
The pa ien a i ed a he eme gency oom wi h an acu e
onse , non-bloody dia hea ha had begun 7 days ago. In he
nex ew hou s, his condi ion de e io a ed as he had de el-
oped shock, acu e kidney inju y, me abolic acidosis and hy-
pe kalemia. He was hen admi ed o he ICU. A e ecei ing
adequa e li e suppo and empi ic an ibio ic he apy consis -
ing o cip o loxacin plus me onidazole, he eco e ed and was
ABSTRACT
We epo a case o acu e en e i is caused by Shewanella
algae in a ci ho ic pa ien . Biochemical iden i ica ion sys ems
e ealed o be insu icien o iden i y he Shewanella isola e a
he species le el, hus equi ing 16S RNA and gy B pa ial gene
sequencing. E en i co-in ec ion by Clos idium di icile could
no be uled ou , his is, o ou knowledge, he i s epo o
acu e en e i is caused by Shewanella algae in Eu ope.
Key wo ds: En e i is, Molecula cha ac e iza ion,
Shewanella algae
, s ools.
P ime aislamien o clínico en España de
Shewanella algae
en heces de un pacien e con
en e i is aguda
RESUMEN
P esen amos un caso de en e i is aguda causada po
Shewanella algae en un pacien e ci ó ico. Los sis emas de
iden i icación median e p uebas bioquímicas no ue on ade-
cuados pa a la iden i icación de S. algae a ni el especie, po lo
que se equi ió la secuenciación pa cial de los genes 16S RNA
y gy B. Aunque la en e medad debida a la co-in ección po
Clos idium di icile no pod ía se desca ado, es e es, a nues-
o en ende , el p ime caso de en e i is aguda causada po
Shewanella algae en Eu opa.
Palab as cla e: En e i is, ca ac e ización molecula ,
Shewanella algae
, he-
ces.
Fi s clinical isola ion epo o Shewanella algae
om he s ools o a pa ien wi h acu e en e i is in
Spain
1Se icio de Apa a o Diges i o, Hospi al Uni e si a io Vi gen de las Nie es, G anada, Spain.
2Depa men o Mic obiology, Tumo and Cell Biology, Ka olinska Ins i u e , S ockholm, Sweden.
3
Depa amen o de Bioquímica, Mic obiología, Biología Celula y Gené ica, Uni e sidad de La Laguna, Spain and Ins i u o
de En e medades T opicales y Salud Pública de Cana ias, Uni e sidad de la Laguna, Tene i e, Spain.
4Se icio de Mic obiología, Hospi al Uni e si a io Vi gen de las Nie es, G anada, Spain
5Uni e si y o G anada, G anada, Spain.
Eleaza Fe nández-
Fe nández1a
Albe o J. Ma ín-
Rod íguez2a
Ma iano He nández3
José Ma ía Na a o-Ma í4
U e Römling2
José Gu ié ez-Fe nández4,5
Co espondence:
José Gu ié ez-Fe nández.
Labo a o io de Mic obiología. A enida de las Fue zas A madas, 2. E-18012 G anada, España.
E-mail: [email p o ec ed]
aThese au ho s con ibu ed equally o his a icle.
B ie epo
A icle his o y
Recei ed: 25 Sep embe 2017; Re ision Reques ed: 5 Ma ch 2018; Re ision Recei ed: 6 Ma ch 2018; Accep ed: 7 Ma ch 2018
Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in SpainE. Fe nández-Fe nández, e al.
Re Esp Quimio e 2018;31(2): 160-163 161
(AGAGTTTGATCCTGGCTCAG) / 1492R (GGTTACCTTGTTACGACTT)
[6], and SW-GYRB-F (GAAGTGGCKATGCAGTGGAA)/SW-
GYRB-R (CGRCRAATACCACAGCCRAG) [7], espec i ely. Bo h
sequences we e deposi ed in he GenBank sequence da abase
(NCBI) unde he accession numbe s KY774312 (16S RNA) and
KY774313 (gy B), and he phylogene ic ela ionships o he iso-
la e, he ea e designa ed as G1, we e econs uc ed ( igu e 2).
O no e, 16S RNA sequencing e ealed o be insu icien o
p o ide iden i ica ion a he species le el ( igu e 2A). As shown
in igu e 2B, he axonomical posi ion o G1 alls uni ocally
wi hin he S. algae clade o he gy B econs uc ion.
An ibiog am pe o med by E-Tes in Muelle -Hil on me-
dium and ae obiosis using an inoculum ma ching a 0.5 Mc-
Fa land u bidi y s anda d e ealed he ollowing MICs (mg/L):
ampicillin (0.125), cip o loxacin (0.094), ime hop im-sul-
ame hoxazole (0.19), ce o axime (0.125), gen amicin (0.138)
and colis in (3). The pa ien had ano he hospi al admission
due o acu e dia hea seconda y o C. di icile in ec ion one
mon h a e he epo ed incidence. A s ool sample ob ained
one mon h la e wi hou he pa ien ha ing signs o in ec ion
came back nega i e o S. algae.
E hical s a emen . The s udy p o ocol was ca ied ou
ans e ed o he gene al Gas oen e ology wa d om whe e
he was discha ged. S ools samples ob ained in he eme gency
oom came back posi i e o S. algae and Toxin (A+B) Clos id-
ium di icile. The S. algae isola e g ew on all g ow h cul u e
media ha a e commonly used o he isola ion o en e opa h-
ogenic bac e ia as well as on non-selec i e media like blood
aga and in ch omogenic medium speci ic o he isola ion o
u opa hogens (U isele 4, BioRad, Mad id, Spain) ( igu e 1). The
isola e was also ound o be o ni hine deca boxylase posi i e,
indole nega i e, unable o p oduce acid om suc ose, and e-
sis an o colis in. I was able o g ow in 6.5% NaCl, o cause
hemolysis and mucoid colonies in blood aga . S. algae g ew
a 42ºC and we e iden i ied by mass spec ome y MALDI-TOF
(Ma ix-Assis ed Lase Deso p ion/Ioniza ion, B uke Dal onics,
Mad id, Spain) (sco e 2.16). I was no iden i ied by API 20NE
(bioMé ieux®, Ma cy-l’E oile, F ance) o Mic oScan Walkaway
(Beckman Coul e , L’Hospi ale de Llob ega , Spain).
As S. algae and S. halio is canno be clea ly di e en ia ed
on he basis o hei biochemical cha ac e is ics o by MAL-
DI-TOF [5], a molecula cha ac e iza ion o he isola e was
conduc ed. Pa ial sequences o he 16S RNA and gy B genes
we e ob ained a e PCR ampli ica ion wi h he p ime pai s 8F
Figu e 1 G ow h o
Shewanella
algae
on cul u e media (A = CIN, B = XLD, C=
seleni e b o h, D= Heck oen, E = MacConkey, and F = blood aga ) o
en e opa hogenic bac e ia.
A B C
D E F
Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in SpainE. Fe nández-Fe nández, e al.
Re Esp Quimio e 2018;31(2): 160-163 162
in acco dance wi h he Decla a ion o Helsinki. This was a
non-in e en ional s udy based solely on ou ine p ocedu es
using biological ma e ial only o s anda d gas oin es inal
ac in ec ion diagnos ics as p esc ibed by a ending physi-
cians. The e was no addi ional sampling o modi ica ion o he
ou ine sampling p o ocol, and da a analyses we e ca ied ou
using an anonymous da abase. The e o e, e hical app o al was
conside ed unnecessa y acco ding o na ional guidelines. The
Clinical Managemen Uni o In ec ious Diseases and Clinical
Mic obiology o he Uni e si y Hospi al Vi gen de las Nie es,
Spain g an ed pe mission o access and use he da a.
DISCUSSION
E en hough mos Shewanella in ec ions a e caused by S.
algae and o a lesse ex en S. pu e aciens, o e he las ew
yea s, wo o he species wi h a pa hogenic po en ial o humans
ha e been epo ed, namely S. halio is [8] and S. xiamenensis
[9]. A pa hogenic po en ial o S. algae is inc easingly ecog-
nized wo ldwide [1]. Since he Shewanella genus is abundan in
ma ine en i onmen s, in ec ion o en occu s ia con ac wi h
seawa e o consump ion o aw sea ood. S ikingly, in some
o he cases like he one p esen ed he e, no appa en ela ion-
ship o such isk ac o s exis . This pa hogen has been iden i ied
in oppo unis ic in ec ions in pa ien s on pe i oneal dialysis,
wi h neoplas ic disease, ube culosis and hepa obilia y disease
like he case we ha e p esen ed [5].
While we canno ule ou a simul aneous in ec ion wi h C.
di icile, i is wo h no ing ha he pa ien had al eady es ed
posi i e o C. di icile in ec ion in a ecen admission. A any
a e, we we e unable o ind o he S. algae plus C. di icile acu e
dia hea cases in he li e a u e. Some imes, au oma ed sys ems
used in mic obiology labo a o ies canno yield a eliable iden i-
ica ion o Shewanella spp. The eby, i is necessa y o eso o
molecula analyses in ol ing he sequencing o mo e han one
gene, as in he case epo ed he ein, since 16S RNA sequenc-
ing and MALDI-TOF mass spec ome y may no be enough o
disc imina e a he species le el. The e a e no p e ious S. algae
in ec ion cases epo ed in ou a ea. Howe e , i is impo an
o know i s po en ial o cause se e e gas oin es inal disease
in immunocomp omised pa ien s in o de o iden i y i eadily.
I is also wo h highligh ing he need o conduc ing accu a e
species iden i ica ion gi en he limi a ions e en o mode n, up-
o-da e iden i ica ion echniques.
FUNDING
None o decla e.
CONFLICTS OF INTEREST
The au ho decla e ha hey ha e no con lic s o in e es .
REFERENCES
1. Hol HM, Gah n-Hansen B, B uun B. Shewanella algae and She-
wanella pu e aciens: clinical and mic obiological cha ac e is-
ics. Clin Mic obiol In ec 2005;11: 347-52. DOI: 10.1111/j.1469-
0691.2005.01108.x
2. Sha ma KK, Kalawa U. Eme ging in ec ions: Shewanella- A se ies
o i e cases. J Lab Physicians 2010;2: 61-5. DOI: 10.4103/0974-
2727.72150
3. Dey S, Bha acha ya D, Roy S, Nadgi SD, Pa il A, Kholku e SD. Sh-
ewanella algae in acu e gas oen e i is. Indian J Med Mic obiol
2015;33: 172-5. DOI: 10.4103/0255-0857.148442
4. Molina-Gue a a E, U eña-Rome o S, Ramí ez-Salas A, O o-
peza-Ba ios G. Shewanella algae en un pacien e con dia ea
c ónica. P ime caso en Cos a Rica. Ac a Méd Cos a icense 2009;
51:172-4. h p:// e .scielo.o g/g 5dx
5. Byun JH, Pa k H, Kim S. The Phan om Menace o he pa ien s wi h
Figu e 2 Bayesian phylogene ic ees o isola e G1
and e e ence s ains based on pa ial
16S RNA
sequences (1406 n , Hasegawa-
Kishino-Yano dis ance model, in a ian
si es) (A) and
gy B
(597 n , Tamu a and
Nei model wi h equal base equencies,
gamma dis ibu ion) (B). Accession
numbe s a e gi en in pa en heses.
Maximum likelihood ees showed he
same opology. Numbe s a he nodes a e
he Bayesian pos e io p obabili y a e
5x106 gene a ions and boo s ap a e
1000 eplica es. The scale ba indica es
he numbe o subs i u ions pe si e.
Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in SpainE. Fe nández-Fe nández, e al.
Re Esp Quimio e 2018;31(2): 160-163 163
hepa obilia y diseases: Shewanella halio is, o en misiden i ied as
Shewanella algae by biochemical es s and MALDI-TOF. Jpn J In ec
Dis 2017; 70:177-80. DOI: 10.7883/yoken.JJID.2015.658
6. Ellis MW, Johnson RC, C aw o d K, Lanie JB, Me ell DS. Molecu-
la cha ac e iza ion o a ca alase-nega i e me hicillin-suscep ible
S aphylococcus au eus subsp. s ain collec ed om a pa ien wi h
cu aneous abscess. J Clin Mic obiol 2014; 52:344-66. DOI: 10.1128/
JCM.02455-13
7. An onelli A, Di Palo DM, Galano A, Becciani S, Mon agnani C, Pecile
P e al. In es inal ca iage o Shewanella xiamenensis simula ing
ca iage o OXA-48–p oducing En e obac e iaceae. Diagn Mic obi-
ol In ec Dis 2015; 82:1-3. DOI: 10.1016/j.diagmic obio.2015.02.008
8. Poo o awan K, Cha suwan T, Lakananu ak N, Chansaen oj J, Ko-
molmi P, Poo o awan Y. Shewanella halio is Associa ed wi h Se-
e e So Tissue In ec ion, Thailand, 2012. Eme g In ec Dis 2013;
19:1019-21. DOI: 10.3201/eid1906.121607
9. Zong Z. Nosocomial pe ipanc ea ic in ec ion associa ed wi h Sh-
ewanella xiamenensis. J Med Mic obiol 2011; 60:1387-90. DOI:
10.1099/jmm.0.031625-0