First clinical isolation report of Shewanella algae from the stools of a patient with acute enteritis in Spain

Re Esp Quimio e 2018;31(2): 160-163 160 © The Au ho 2018. Published by Sociedad Española de Quimio e apia. All igh s ese ed. Fo pe missions, please e-mail: [email p o ec ed] INTRODUCTION Mo e han 50 species con o m he Shewanella genus. Among hem, Shewanella algae, Shewanella pu e aciens, Shewanella halio is and Shewanella xiamenensis can cause disease in humans wi h he o me causing i mo e o en [1]. The eason ha explains he p ominence o hese species o cause disease, and S. algae being mos abundan , a e unknown. S. algae a e a halophilic G am-nega i e od wi h a dis inc i e biochemis y: non-glucose e men ing, cy och ome oxidase posi i e, ni a e educ ion es posi i e, ca alase nega i e and H2S p oduce . I can be ound all o e he wo ld especially in seawa e , aqua ic animals and sedimen s. This mic obe can cause disease in human beings. Case epo s om he li e a u e include so issue in ec ions as p eponde an , bu also bac e- emia, o i is and a h i is, among o he s [2]. Mos o he cases come om wa m coas al a eas. Acu e en e i is cases a e sca ce and ha e been epo ed in associa ion wi h Esche ichia coli as ano he pa hogen [3] and as a ch onic dia hea case [4]. We p esen a case o acu e en e i is ha included S. algae. CASE REPORT We epo he case o a 69 yea s old pa ien wi h li e ci hosis, ischemic hea disease, high blood p essu e and wo admissions in he las wo mon hs. He li es in an u ban a ea in sou he n Spain, 67 km away om he coas wi h his wi e, e i ed o se e al yea s. Con ac wi h wild animals, ecen ips o he coas , consump ion o unp ocessed ood, o con ac wi h wa e o algae had no been epo ed. The pa ien a i ed a he eme gency oom wi h an acu e onse , non-bloody dia hea ha had begun 7 days ago. In he nex ew hou s, his condi ion de e io a ed as he had de el- oped shock, acu e kidney inju y, me abolic acidosis and hy- pe kalemia. He was hen admi ed o he ICU. A e ecei ing adequa e li e suppo and empi ic an ibio ic he apy consis - ing o cip o loxacin plus me onidazole, he eco e ed and was ABSTRACT We epo a case o acu e en e i is caused by Shewanella algae in a ci ho ic pa ien . Biochemical iden i ica ion sys ems e ealed o be insu icien o iden i y he Shewanella isola e a he species le el, hus equi ing 16S RNA and gy B pa ial gene sequencing. E en i co-in ec ion by Clos idium di icile could no be uled ou , his is, o ou knowledge, he i s epo o acu e en e i is caused by Shewanella algae in Eu ope. Key wo ds: En e i is, Molecula cha ac e iza ion, Shewanella algae , s ools. P ime aislamien o clínico en España de Shewanella algae en heces de un pacien e con en e i is aguda RESUMEN P esen amos un caso de en e i is aguda causada po Shewanella algae en un pacien e ci ó ico. Los sis emas de iden i icación median e p uebas bioquímicas no ue on ade- cuados pa a la iden i icación de S. algae a ni el especie, po lo que se equi ió la secuenciación pa cial de los genes 16S RNA y gy B. Aunque la en e medad debida a la co-in ección po Clos idium di icile no pod ía se desca ado, es e es, a nues- o en ende , el p ime caso de en e i is aguda causada po Shewanella algae en Eu opa. Palab as cla e: En e i is, ca ac e ización molecula , Shewanella algae , he- ces. Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in Spain 1Se icio de Apa a o Diges i o, Hospi al Uni e si a io Vi gen de las Nie es, G anada, Spain. 2Depa men o Mic obiology, Tumo and Cell Biology, Ka olinska Ins i u e , S ockholm, Sweden. 3 Depa amen o de Bioquímica, Mic obiología, Biología Celula y Gené ica, Uni e sidad de La Laguna, Spain and Ins i u o de En e medades T opicales y Salud Pública de Cana ias, Uni e sidad de la Laguna, Tene i e, Spain. 4Se icio de Mic obiología, Hospi al Uni e si a io Vi gen de las Nie es, G anada, Spain 5Uni e si y o G anada, G anada, Spain. Eleaza Fe nández- Fe nández1a Albe o J. Ma ín- Rod íguez2a Ma iano He nández3 José Ma ía Na a o-Ma í4 U e Römling2 José Gu ié ez-Fe nández4,5 Co espondence: José Gu ié ez-Fe nández. Labo a o io de Mic obiología. A enida de las Fue zas A madas, 2. E-18012 G anada, España. E-mail: [email p o ec ed] aThese au ho s con ibu ed equally o his a icle. B ie epo A icle his o y Recei ed: 25 Sep embe 2017; Re ision Reques ed: 5 Ma ch 2018; Re ision Recei ed: 6 Ma ch 2018; Accep ed: 7 Ma ch 2018 Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in SpainE. Fe nández-Fe nández, e al. Re Esp Quimio e 2018;31(2): 160-163 161 (AGAGTTTGATCCTGGCTCAG) / 1492R (GGTTACCTTGTTACGACTT) [6], and SW-GYRB-F (GAAGTGGCKATGCAGTGGAA)/SW- GYRB-R (CGRCRAATACCACAGCCRAG) [7], espec i ely. Bo h sequences we e deposi ed in he GenBank sequence da abase (NCBI) unde he accession numbe s KY774312 (16S RNA) and KY774313 (gy B), and he phylogene ic ela ionships o he iso- la e, he ea e designa ed as G1, we e econs uc ed ( igu e 2). O no e, 16S RNA sequencing e ealed o be insu icien o p o ide iden i ica ion a he species le el ( igu e 2A). As shown in igu e 2B, he axonomical posi ion o G1 alls uni ocally wi hin he S. algae clade o he gy B econs uc ion. An ibiog am pe o med by E-Tes in Muelle -Hil on me- dium and ae obiosis using an inoculum ma ching a 0.5 Mc- Fa land u bidi y s anda d e ealed he ollowing MICs (mg/L): ampicillin (0.125), cip o loxacin (0.094), ime hop im-sul- ame hoxazole (0.19), ce o axime (0.125), gen amicin (0.138) and colis in (3). The pa ien had ano he hospi al admission due o acu e dia hea seconda y o C. di icile in ec ion one mon h a e he epo ed incidence. A s ool sample ob ained one mon h la e wi hou he pa ien ha ing signs o in ec ion came back nega i e o S. algae. E hical s a emen . The s udy p o ocol was ca ied ou ans e ed o he gene al Gas oen e ology wa d om whe e he was discha ged. S ools samples ob ained in he eme gency oom came back posi i e o S. algae and Toxin (A+B) Clos id- ium di icile. The S. algae isola e g ew on all g ow h cul u e media ha a e commonly used o he isola ion o en e opa h- ogenic bac e ia as well as on non-selec i e media like blood aga and in ch omogenic medium speci ic o he isola ion o u opa hogens (U isele 4, BioRad, Mad id, Spain) ( igu e 1). The isola e was also ound o be o ni hine deca boxylase posi i e, indole nega i e, unable o p oduce acid om suc ose, and e- sis an o colis in. I was able o g ow in 6.5% NaCl, o cause hemolysis and mucoid colonies in blood aga . S. algae g ew a 42ºC and we e iden i ied by mass spec ome y MALDI-TOF (Ma ix-Assis ed Lase Deso p ion/Ioniza ion, B uke Dal onics, Mad id, Spain) (sco e 2.16). I was no iden i ied by API 20NE (bioMé ieux®, Ma cy-l’E oile, F ance) o Mic oScan Walkaway (Beckman Coul e , L’Hospi ale de Llob ega , Spain). As S. algae and S. halio is canno be clea ly di e en ia ed on he basis o hei biochemical cha ac e is ics o by MAL- DI-TOF [5], a molecula cha ac e iza ion o he isola e was conduc ed. Pa ial sequences o he 16S RNA and gy B genes we e ob ained a e PCR ampli ica ion wi h he p ime pai s 8F Figu e 1 G ow h o Shewanella algae on cul u e media (A = CIN, B = XLD, C= seleni e b o h, D= Heck oen, E = MacConkey, and F = blood aga ) o en e opa hogenic bac e ia. A B C D E F Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in SpainE. Fe nández-Fe nández, e al. Re Esp Quimio e 2018;31(2): 160-163 162 in acco dance wi h he Decla a ion o Helsinki. This was a non-in e en ional s udy based solely on ou ine p ocedu es using biological ma e ial only o s anda d gas oin es inal ac in ec ion diagnos ics as p esc ibed by a ending physi- cians. The e was no addi ional sampling o modi ica ion o he ou ine sampling p o ocol, and da a analyses we e ca ied ou using an anonymous da abase. The e o e, e hical app o al was conside ed unnecessa y acco ding o na ional guidelines. The Clinical Managemen Uni o In ec ious Diseases and Clinical Mic obiology o he Uni e si y Hospi al Vi gen de las Nie es, Spain g an ed pe mission o access and use he da a. DISCUSSION E en hough mos Shewanella in ec ions a e caused by S. algae and o a lesse ex en S. pu e aciens, o e he las ew yea s, wo o he species wi h a pa hogenic po en ial o humans ha e been epo ed, namely S. halio is [8] and S. xiamenensis [9]. A pa hogenic po en ial o S. algae is inc easingly ecog- nized wo ldwide [1]. Since he Shewanella genus is abundan in ma ine en i onmen s, in ec ion o en occu s ia con ac wi h seawa e o consump ion o aw sea ood. S ikingly, in some o he cases like he one p esen ed he e, no appa en ela ion- ship o such isk ac o s exis . This pa hogen has been iden i ied in oppo unis ic in ec ions in pa ien s on pe i oneal dialysis, wi h neoplas ic disease, ube culosis and hepa obilia y disease like he case we ha e p esen ed [5]. While we canno ule ou a simul aneous in ec ion wi h C. di icile, i is wo h no ing ha he pa ien had al eady es ed posi i e o C. di icile in ec ion in a ecen admission. A any a e, we we e unable o ind o he S. algae plus C. di icile acu e dia hea cases in he li e a u e. Some imes, au oma ed sys ems used in mic obiology labo a o ies canno yield a eliable iden i- ica ion o Shewanella spp. The eby, i is necessa y o eso o molecula analyses in ol ing he sequencing o mo e han one gene, as in he case epo ed he ein, since 16S RNA sequenc- ing and MALDI-TOF mass spec ome y may no be enough o disc imina e a he species le el. The e a e no p e ious S. algae in ec ion cases epo ed in ou a ea. Howe e , i is impo an o know i s po en ial o cause se e e gas oin es inal disease in immunocomp omised pa ien s in o de o iden i y i eadily. I is also wo h highligh ing he need o conduc ing accu a e species iden i ica ion gi en he limi a ions e en o mode n, up- o-da e iden i ica ion echniques. FUNDING None o decla e. CONFLICTS OF INTEREST The au ho decla e ha hey ha e no con lic s o in e es . REFERENCES 1. Hol HM, Gah n-Hansen B, B uun B. Shewanella algae and She- wanella pu e aciens: clinical and mic obiological cha ac e is- ics. Clin Mic obiol In ec 2005;11: 347-52. DOI: 10.1111/j.1469- 0691.2005.01108.x 2. Sha ma KK, Kalawa U. Eme ging in ec ions: Shewanella- A se ies o i e cases. J Lab Physicians 2010;2: 61-5. DOI: 10.4103/0974- 2727.72150 3. Dey S, Bha acha ya D, Roy S, Nadgi SD, Pa il A, Kholku e SD. Sh- ewanella algae in acu e gas oen e i is. Indian J Med Mic obiol 2015;33: 172-5. DOI: 10.4103/0255-0857.148442 4. Molina-Gue a a E, U eña-Rome o S, Ramí ez-Salas A, O o- peza-Ba ios G. Shewanella algae en un pacien e con dia ea c ónica. P ime caso en Cos a Rica. Ac a Méd Cos a icense 2009; 51:172-4. h p:// e .scielo.o g/g 5dx 5. Byun JH, Pa k H, Kim S. The Phan om Menace o he pa ien s wi h Figu e 2 Bayesian phylogene ic ees o isola e G1 and e e ence s ains based on pa ial 16S RNA sequences (1406 n , Hasegawa- Kishino-Yano dis ance model, in a ian si es) (A) and gy B (597 n , Tamu a and Nei model wi h equal base equencies, gamma dis ibu ion) (B). Accession numbe s a e gi en in pa en heses. Maximum likelihood ees showed he same opology. Numbe s a he nodes a e he Bayesian pos e io p obabili y a e 5x106 gene a ions and boo s ap a e 1000 eplica es. The scale ba indica es he numbe o subs i u ions pe si e. Fi s clinical isola ion epo o Shewanella algae om he s ools o a pa ien wi h acu e en e i is in SpainE. Fe nández-Fe nández, e al. Re Esp Quimio e 2018;31(2): 160-163 163 hepa obilia y diseases: Shewanella halio is, o en misiden i ied as Shewanella algae by biochemical es s and MALDI-TOF. Jpn J In ec Dis 2017; 70:177-80. DOI: 10.7883/yoken.JJID.2015.658 6. Ellis MW, Johnson RC, C aw o d K, Lanie JB, Me ell DS. Molecu- la cha ac e iza ion o a ca alase-nega i e me hicillin-suscep ible S aphylococcus au eus subsp. s ain collec ed om a pa ien wi h cu aneous abscess. J Clin Mic obiol 2014; 52:344-66. DOI: 10.1128/ JCM.02455-13 7. An onelli A, Di Palo DM, Galano A, Becciani S, Mon agnani C, Pecile P e al. In es inal ca iage o Shewanella xiamenensis simula ing ca iage o OXA-48–p oducing En e obac e iaceae. Diagn Mic obi- ol In ec Dis 2015; 82:1-3. DOI: 10.1016/j.diagmic obio.2015.02.008 8. Poo o awan K, Cha suwan T, Lakananu ak N, Chansaen oj J, Ko- molmi P, Poo o awan Y. Shewanella halio is Associa ed wi h Se- e e So Tissue In ec ion, Thailand, 2012. Eme g In ec Dis 2013; 19:1019-21. DOI: 10.3201/eid1906.121607 9. Zong Z. Nosocomial pe ipanc ea ic in ec ion associa ed wi h Sh- ewanella xiamenensis. J Med Mic obiol 2011; 60:1387-90. DOI: 10.1099/jmm.0.031625-0