i
RNA in e e ence wi h alla o egula ing neu opep ide
genes a ec ing ci cadian hy hm, de elopmen ,
ma ing and ep oduc ion o Spodop e a ugipe da
(Lepidop e a: Noc uidae)
Disse a ion
Submi ed o ul il equi emen s o Doc o a e Deg ee
Facul y o Biology, Chemis y and Ea h Sciences
Uni e si y o Bay eu h
Ins i u e o Animal Ecology I
P o esso D . K. H. Ho mann
by
In isa Taha Elhag Hassanien
om Sudan
Bay eu h, Janua y 2013
i
This wo k was ca ied ou a he Depa men o Animal Ecology I o he Uni e si y
Bay eu h unde di ec ion o P o . D . Klaus Hube Ho mann and eme ged in he
pe iod o Ap il 2009 un il Decembe 2012.
1s expe : P o . D . K. H. Ho mann
2nd expe : P o . D . H. Feldhaa
Examina ion boa d: P o . D . G. Begemann, PD D . S . Heidmann, P o . D . G.
Rambold P o . D . K. H. Ho mann, P o . D . H. Feldhaa
ii
Dedica ion
Dedica ionDedica ion
Dedica ion
To my belo ed a he
&
wonde ul child en
iii
Acknowledgemen s
I would like o exp ess my since e acknowledgemen o P o . D . Klaus H. Ho mann,
he Head o he Animal Ecology I Depa men , o his wa m hos and supe ision.
I would like o exp ess my ai h ul acknowledgemen s o my supe iso PD. D .
Ma ina Meye ing-Vos o he nice supe ision and con inuous encou agemen .
I would like o hank Do o hea Wiesne and Ma ion P eiß o hei skill ul echnical
suppo .
I would like o hank my colleague F anziska Wende o he e o s and help wi h se
up he LC-MS and RT-PCR.
My g a i ude acknowledgemen s a e o he Ge man Academic Exchange Se ice
(DAAD) o awa ding me ull PhD schola ship.
i
Lis o con en s
Dedica ion ii
Acknowledgemen s iii
Lis o con en s i
Lis o igu es iii
Lis o ables xii
1 In oduc ion 1
1.1 Neu opep ides 1
1.2 Alla o opins 2
1.3 Alla os a ins 3
1.4 Ju enile ho mones (JH) 5
1.5 Regula ion o JH i e 6
1.6 Ecdys e oids 8
1.7 La al de elopmen 9
1.8 Me amo phosis 9
1.9 Rep oduc ion 10
1.10 RNA in e e ence (RNAi) 11
1.11 P oblem s a emen and jus i ica ion o he esea ch p ojec 12
2 Ma e ials and Me hods 14
2.1 RNA in e e ence echnique 14
2.1.1 Syn hesis o DNA- agmen 14
2.1.1.1 AT (alla o opin) 1 (Manduca sex a AT) 14
2.1.1.2 AS (alla os a in) ype A 17
2.1.1.3 T7-SK agmen de i ed om he sul akinin gene o G. bimacula us 18
2.1.2 Gel elec opho esis 19
2.1.3 Visualisa ion o DNA bands and imaging 20
2.1.4 DNA pu i ica ion 21
2.1.5 De e mina ion o DNA concen a ion 21
2.1.6 In i o ansc ip ion 21
2.1.7 Rea ing o S. ugipe da 23
2.1.8 Injec ion o S. ugipe da 23
2.1.9 Weigh o o a ies and eggs and pe cen age o ha ching 24
2.2 De ec ion and analysis o ho mones in he hemolymph 24

2.2.1 Hemolymph and issue collec ion o LC-MS analysis 24
2.2.2 Sample clean-up and ho mone ex ac ion 25
2.2.3 Analysis and quan i ica ion o ho mones 25
2.3 Gene cloning 27
2.3.1 In oduc ion o T7 AS and T7 AT DNA agmen s cloning 27
2.3.2 Ampli ica ion o he DNA agmen s 27
2.3.3 Liga ion 27
2.3.4 Compe en cells 28
2.3.5 T ans o ma ion 29
2.3.6 Fe men a ion 30
2.3.7 Pu i ica ion o plasmid DNA 30
2.4 AT 1 gene exp ession s udies 32
2.4.1 RT-PCR 32
2.4.2 Tissue dissec ion 32
2.4.3 To al RNA ex ac ion om he issues 32
2.4.4 DNA diges ion 33
2.4.5 Re e se ansc ip ion 34
2.4.6 Syn hesis o s anda d cu es 35
2.4.6.1 Ampli ica ion o he AT 1 agmen 35
2.4.6.2 Ampli ica ion o he ß-ac in agmen 36
2.4.7 Op imiza ion o s anda d cu es o eal- ime PCR 37
2.4.8 Real- ime PCR 39
2.4.9 Analysis o he eal- ime RT-PCR 41
2.5 Su ey on da a collec ion 43
2.6 S a is ical analysis 43
3 Resul s 44
3.1 E ec s o in i o gene silencing o AT 1 in emales o S. ugipe da on
ansc ip le el in issues, me amo phosis, ci cadian hy hm o
adul eme gence, ep oduc ion and ho mone le els in he hemolymph 44
3.1.1 Mo ali y 44
3.1.2 T ansc ip le els in b ain and o a y 47
3.1.3 Pa ame e s o adul de elopmen 50
3.1.4 JH in he hemolymph o la ae 57
3.1.5 Ecdys e oids in he hemolymph o la ae 59
i
3.1.6 Body weigh o la ae 61
3.1.7 JH in he hemolymph o i gin emales 62
3.1.8 Ecdys e oids in he hemolymph o i gin emales 63
3.1.9 Rep oduc ion o i gin emales 64
3.1.10 JH in he hemolymph o ma ed emales 67
3.1.11 Ecdys e oids in he hemolymph o ma ed emales 68
3.1.12 Rep oduc ion o ma ed emales 69
3.1.13 O a y weigh o ma ed emales, weigh o o iposi ed eggs and ha ching
a es 71
3.1.14 Spe ma opho es deposi ed by males 74
3.2 In i o gene silencing o AT 1 in males o S. ugipe da and e ec s
on ho mone le els, e ili y and ep oduc ion o emales ma ed wi h
such ea ed males 76
3.2.1 JH in he hemolymph o i gin males 76
3.2.2 Ecdys e oids in he hemolymph o i gin males 78
3.2.3 JH i e s in accesso y glands o i gin and ma ed males 78
3.2.4 Ma e ial ans e ed om male o emale by ma ing 80
3.2.5 Hemolymph JH i e s o emales ma ed wi h AT 1 gene silenced males 82
3.2.6 Hemolymph ecdys e oid i e s o emales ma ed wi h AT 1 gene
silenced males 83
3.2.7 Rep oduc ion o emales ma ed wi h AT 1 gene silenced males 84
3.2.8 O a y weigh o emales ma ed wi h AT 1 gene silenced males,
weigh o deposi ed eggs and ha ching 86
3.2.9 Spe ma opho es deposi ed by males 89
3.3 In i o gene silencing o alla os a in ype A in males o S. ugipe da
and e ec s on ma e ial ans e ed om he male o he emale by
ma ing 91
3.3.1 JH i e s in accesso y glands o i gin and ma ed males 91
3.3.2 Ma e ial ans e ed om male o emale by ma ing 93
3.3.3 Hemolymph JH i e s o emales ma ed wi h AS ype A gene silenced
males 95
3.3.4 Hemolymph edys e oid i e s o emales ma ed wi h AS ype A gene
silenced males 96
4 Discussion 98
ii
4.1 E ec o AT 1 gene silencing on ansc ip le el in issues 98
4.2 E ec o AT 1 gene silencing on li e cycle 99
4.2.1 Mo ali y 100
4.2.2 La al de elopmen 100
4.2.3 Me amo phosis 102
4.2.4 Adul moul ing 104
4.2.5 Ma ing and ep oduc ion 105
4.3 E ec o AT 1 gene silencing on S. ugipe da emale ep oduc ion 108
4.4 E ec o AT 1 gene silencing in S. ugipe da males 111
4.4.1 Males accesso y glands 111
4.4.2 JH ans e ed om males o emales 112
4.5 Conclusions 114
5 Summa y 116
6 Zusammen assung 118
7 Re e ences xiii
8 Appendix xxxi
9 Abb e ia ions xxxi
iii
Lis o igu es
Figu e (1): Daily pe cen mo ali y o i gin S. ugipe da emales (A)
and (B) accumula i e mo ali y o e 14 days o adul li e 46
Figu e (2): Gene exp ession o Manse-AT (AT 1) a e silencing
he gene ansc ip le el in he b ain o 2 day old i gin emales
o S. ugipe da 48
Figu e (3): Gene exp ession o Manse-AT (AT1) a e silencing
he gene ansc ip le el in he o a y o 2 day old i gin emales
o S. ugipe da 49
Figu e (4): Du a ion un il p epupal commi men a e moul ing in o he
las la al s age (L6) 50
Figu e (5): Du a ion o ans o ma ion in o pupa om moul ing in o he
las la al s age (L6) 51
Figu e (6): Pe cen age o adul emales (A) and males (B) eme gence 52
Figu e (7): Pe cen age o eme ging adul emales o S.
ugipe da in ela ion o he ligh -da k cycle (L:D 16:8 h) 53
Figu e (8): Pe cen age o eme ging adul males o S.
ugipe da in ela ion o he ligh -da k cycle (L:D 16:8 h) 54
Figu e (9): E ec o AT 1 gene silencing on ime om eme gence o i s
ma ing in adul emales o S. ugipe da 55
Figu e (10): Time om eme gence o i s egg laying in un ea ed emales 56
Figu e (11): Pe cen age o i gin and ma ed emales o S. ugipe da ha
s a ed egg deposi ion on day 2 a e eme gence 57
Figu e (12): E ec o AT 1 gene silencing on he i e o JH in he hemolymph
o 3 day old penul ima e la ae (L5/3), 1-4 d old las ins a la ae
(L6), and he p epupal (PP) s age o S. ugipe da 59
Figu e (13): E ec o AT 1 gene silencing on he i e o ee ecdys e oids in
he hemolymph o 3 day old penul ima e la ae (L5/3),1-4 d
old las ins a la ae (L6), and he p epupal (PP1) s age o
S. ugipe da 60
Figu e (14): E ec o AT 1 gene silencing on he body weigh o 3 day
old penul ima e la ae (L5/3), 1-3 d old las ins a la ae
3
AT 1 cDNA ha encodes 134 amino acids, has been cloned om se e al dip e ans
and lepidop e ans (Veens a and Cos es, 1999; T uesdell e al., 2000; Abdel-la ie e
al., 2003a). The AT 1 gene is exp essed as h ee mRNA iso o ms ha di e om
each o he by al e na i e splicing (Abdel-la ie e al., 2003a), hus p o iding a
mechanism o he p oduc ion o pep ides speci ic o each iso o m. The h ee mRNAs
a e exp essed in b ain, diges i e ac , and ep oduc i e o gans o la ae, pupae, and
adul s o S. ugipe da in a ime- and issue-speci ic manne (Abdel-la ie e al.,
2003b). I s exp ession in he b ain, gu and ep oduc i e ac p o es he dual ole o
he pep ides as b ain/gu neu opep ides and implies ha hey ha e unc ions in
ep oduc i e p ocesses (Abdel-la ie e al., 2004a). The exp ession o his gene
inc eased in he ne e co d o las ins a la ae o M. sex a ha we e s a ed,
pa asi ized, o ed he edys e oid agonis RH 5992 (Lee and Ho odyski, 2002). Each
o hese ea men s esul ed in educ ion o eeding and an inc eased le el o
hemolymph JH.
AT 1-like pep ides we e iden i ied in L. ole acea (Audsley e al., 2000a). Mo eo e ,
h ee addi ional Manse-AT-like sequences ha a e lanked by basic amino acid
esidues ha e been iden i ied (Ho odyski e al., 2001). These pep ides a e p edic ed
o include h ee alla o opin-like pep ides ha exhibi limi ed s uc u al iden i y o
Manse-AT and o e lapping biological ac i i ies (Lee e al., 2002). Manse-AT–like
sequences e ealed ha hey may be de i ed om a duplica ion o ances al Manse-
AT sequences ollowed by di e gence (Ho odyski e al., 2001).
1.3 Alla os a ins
Besides he lepidop e an ypical alla os a in C- ype (Manse-AS), membe s o he
Y/FXFGL-NH2 alla os a ins (A- ype alla os a ins) we e iden i ied immunologically om
he ne i co po is ca diaci (NCC) o M. sex a (S ay and Tobe, 2007). Howe e ,
Manse-AS C- ype pep ide ep esen s he “ ue” lepidop e an alla os a in and has
been shown o be p esen a i s in he obacco ho nwo m M. sex a (K ame e al.,
1991), sequenced by Audsley e al. (1998) and shown o inhibi in i o JH
biosyn hesis by he CA o la al (M. sex a, K ame e al., 1991; L. ole acea, Audsley
e al., 2000b) and adul (M. sex a; Audsley and Wea e , 2003b) mo hs. The Manse-
AS gene has been cloned om Pseudale ia unipunc a (Jansons e al., 1996) and S.
ugipe da (Abdel-la ie e al., 2003). Besides i s alla o egula o y ac i i y, he pep ides
showed inhibi o y e ec s on gu pe is alsis in i o, supp essed eeding, e a ded
In oduc ion

4
g ow h and inc eased gu mo ili y in L. ole acea, bu hey did no inhibi in i o JH
biosyn hesis by he CA in L. ole acea (Audsley e al., 2001) and in P. unipunc a
(Jansons e al., 1996). Howe e , a e supp ession o Manse-AS gene exp ession in
he 5 h la ae s age and in adul s o S. ugipe da, a posi i e e ec on JH i e s in he
hemolymph was de e mined. Mo eo e , in AS ype C gene silenced animals, he
weigh o he la ae was educed causing a p olonga ion o he la al s age (G ieble
e al., 2008).
The ubiqui ous A- ype F/YXFGL (I, V) amide cock oach alla os a ins a e eleased by
exocy osis om b ains in many in e eb a es, and hey inhibi JH biosyn hesis by he
CA o cock oaches, c icke s, and e mi es, p obably by a ge ing he JH biosyn hesis
pa hway p io o he con e sion o a nesol o JH (Woodhead e al., 1989; M. sex a,
K ame e al., 1991; S ay e al., 1991; M. sex a, K ame e al., 1991; LIoyd e al.,
2000). Thei widesp ead localiza ion in cen al and s oma ogas ic ne ous sys em
implies a mo e gene al ole as neu o ansmi e s and neu omodula o s (Du e e al.,
1997a; S ay and Tobe, 2007). They we e i s disco e ed in la ae and adul s o he
i ipa ous cock oach Diplop e a punc a a (Woodhead e al., 1989) and la e in o he
cock oaches such as Bla ella ge manica (Bellés e al., 1994), bu also in
c us aceans like Ca cinus maenas (Du e e al., 1997b) and he ige p awn, Penaeus
monodon (Du e e al., 2002). Se e al pep ides we e isola ed om he e mi e
Re iculi e mes la ipes (Yagi e al., 2008), he c icke G yllus bimacula us (Lo enz e
al., 1999), and he s ick insec Ca ausius mo osus (Lo enz e al., 2000). Type A
alla os a ins inhibi JH biosyn hesis in he CA o se e al insec o de s (Lo enz e al.,
1999; Li e al., 2005; Yagi e al., 2005; Cla k e al., 2008; Abdel-la ie and Ho mann,
2010). Thei e ec on he CA o cock oaches depends on he dose and sensi i i y o
he CA as well (S ay e al., 1996).
The alla os a in A- ype pep ide ecep o has been cloned; i was localized wi hin he
b ain la e al neu osec e o y cells, bu also, o example, in he a body, indica ing he
mul i unc ional ole o he pep ides (S ay e al., 1993; Aue swald e al., 2001). A ype
alla os a ins a e pleio opic pep ides, simila o soma os a ins, which e lec s pa allel
e olu ion o hese pep ides (Bendena e al., 1997). They a ec many physiological
p ocesses including s imula ion o diges i e enzymes like in e ase, α-amylase and
ca bohyd a e me abolizing enzymes, as well as inhibi ion o JH (III) biosyn hesis,
muscle con ac ion, o a ian ecdys e oid biosyn hesis, i ellogenin p oduc ion, and
cock oach ep oduc ion (Bellés e al., 1987; Fusé e al., 1999; Hul e al., 2008).
In oduc ion
5
AS A- ype genes we e cloned om se e al cock oach species, dip e ans,
lepidop e ans, e mi es, and he c icke , G yllus bimacula us (Meye ing-Vos e al.,
2001; Abdel-la ie e al., 2004b; Wang e al., 2004; Ellio e al., 2009). In G.
bimacula us he gene was shown o be exp essed in b ain, caecum, diges i e ac
(ileum, midgu , colon), and in a ious issues such as a body, o a ies and emale
ep oduc i e glands (Meye ing-Vos and Ho mann, 2003).
The i s lepidop e an ype A alla os a in was isola ed om M. sex a and has been
named lepidos a in-1. Colocaliza ion o he ype A alla os a in wi h a diu e ic ho mone
in he b ain o M. sex a and i s synch onous co- elease implies ha his pep ide has a
ole in liquid anspo a ion and myogenic con ac ion in he lepidop e an la al
hindgu (Da is e al., 1997; S ay, 2000). Howe e , he pep ides do no a ec JH
biosyn hesis in lepidop e ans. The cDNA o he lepidop e an b ain/gu AS A- ype
p ep oho mone encodes 9 o 10 membe s o he Y/FXFGL-a pep ide amily and was
sequenced om S. ugipe da (Abdel-la ie e al., 2004b).
1.4 Ju enile ho mones (JH)
Ju enile ho mones (JH) a e sesqui e penoids, which a e syn hesized by he co po a
alla a a (CA), eleased in o he hemolymph, and anspo ed by ca ie p o eins o
hei a ge cells. So a , se en JH homologs a e known om a ious insec o de s,
whe eas JH III is mos ly widesp ead. In lepidop e ans, JH I, II, and III we e ound.
Because o hei non-pola na u e ju enile ho mones easily pene a e he cell
memb ane by di usion as well as do he ecdys e oids. Wi hin he cell, ju enile
ho mones may bind o a ecep o and in e ac somehow wi h he genome, hus
ac i a ing he DNA machine y (Da ey, 2000). Righ now, he USP-subuni o
ecdys e oid ecep o s and he ansc ip ion ac o s Me - ole an and E 75A a e
discussed as pu a i e JH ecep o s (Klowden, 2008). Ju enile ho mones a e c ucial
in all insec de elopmen al and ep oduc i e e en s (Riddi o d, 2008) including
emb yogenesis, la al moul ing, me amo phosis, i ellogenin syn hesis, i ellogenin
up ake by he o a ies and o a ian de elopmen , polymo phism, diapause egula ion,
and a ious aspec s o me abolism associa ed wi h hese unc ions. Besides hei
gene al ju enoid unc ion in la ae and gonado opic unc ion in adul insec s
(Pos le hwai and Jones, 1978; Yamamo o e al., 1988), hey con ol cas e
di e en ia ion e.g. in he damp-wood e mi e Hodo e mopsis sjos ed i (Isop e a:
Te mopsidae) (Co ne e e al., 2008) and in honey bees Apis melli e a L. (Rachinsky
In oduc ion
6
and Ha elde , 1990), and a e co ela ed wi h agg ession in colony de ence and
es ablishmen o dominance in bu ying bee les (Sco , 2006). Mo eo e , PBAN
(phe omone biosyn hesis ac i a ing neu opep ide) ac i a ion and he elease o
phe omones a e con olled by JH II ha up- egula es he pu a i e phe omone
ecep o p o ein in emale pupae, o example in Helico e pa a mige a (Ra aeli e al.,
2003). JH also igge s he ligh muscle hyd olysis in a wing dimo phic c icke ,
Modiog yllus con o ma us (Tanaka, 1994).
JH is supposed o be in ol ed in diapause egula ion o o e win e ing insec s (Taub-
Mon emayo a e al., 2005), bu Okuda e al. (1996) epo ed ha o he ac o s han
JH e oke diapause o Nomada succinc a and N. japonica. JH is in ol ed in he
ma e nal egula ion o phase-dependen p ogeny cha ac e is ics in Schis oce ca
g ega ia (Maeno and Tanaka, 2009), and Cispe e al. (2000) epo ed ha JH is
esponsible o wing polymo phism in he c icke G yllus i mus. Taub-Mon emayo a
e al. (2005) s a ed ha he sexual dimo phism in he boll wee il, An honomus
g andis, is no due o JH i e di e ences be ween emales and males.
C us acean ju enile ho mone (me hyl a nesoa e), an in e media y me aboli e o JH
biosyn hesis in he CA o insec s, is eleased by he mandibula o gans om all
c us acean species and a ec s la al de elopmen and ep oduc ion (Bo s e al.,
1987).
The JH ho mone analog me hop ene s imula ed i ellogenesis and o a ian
de elopmen in sexually ma u e emales o Nomada succinc a and N. japonica
(Okuda e al., 1996). Me hop ene also s imula ed i ellogenin p oduc ion in in ac
males o he boll wee il, A. g andis (Taub-Mon emayo e al., 2005). While JH III had
no e ec on he i ellogenin p oduc ion in he a body o adul emales o Locus a
mig a o ia (Taub-Mon emayo e al., 2005), me hop ene ac ed on he locus a body
o b ing abou he exp ession o he Vg gene (Wya e al., 1987). In conclusion,
me hop ene seems o ac as a ue JH analog in many adul insec s.
1.5 Regula ion o JH i e
The hemolymph ju enile ho mone i e is egula ed by JH syn hesis and elease om
he co po a alla a, ac i i y o JH es e ase in he hemolymph and issues, a ailabili y
o binding p o eins in he hemolymph, ho mone up ake by he issues, and by
ho mone ca abolism and ho mone exc e ion (De Ko and G ange , 1981; Klowden,
2008). B ain s imula o y and inhibi o y neu osec e ion and o a y soma ic signals
In oduc ion
7
modula e he CA ac i i y in di e en ways acco ding o de elopmen al s ages.
Con ol ac o s egula ing JH biosyn hesis in he CA may ac ia ne es o ia he
hemolymph ( Tobe, 1980; Tobe e al., 1982; Rankin and S ay, 1983; Ka aoka e al.,
1989; Woodhead e al., 1989; P a e al., 1990; K ame e al., 1991; S ay e al.,
1991; Gu e al., 1995; Veens a and Cos es, 1999; Rachinsky e al., 2000; Audsley e
al., 2000a; Audsley e al., 2000b; LIoyd e al., 2000; Elekonich and Ho odyski, 2003).
The cDNAs o me alona e pa hway enzymes in ol ed in JH biosyn hesis we e
cloned (Bombyx mo i, Kinjoh e al., 2007). JH binding p o eins (JHBP) ha e a high
a ini y o he ho mone and belong o he lipopho in ac ion o hemolymph p o eins
(Lep ino a sa decemlinea a; De Ko e al., 1987). JH binding p o eins JHBPs and
JHEHs (JH epoxide hyd olase) o wo lepidop e an species we e cha ac e ized
(P es wick e al., 1996). The concen a ion o binding p o eins and he ac i i ies o
deg ada i e enzymes change du ing he insec s’ li e cycle and may co ela e wi h
changes in ho mone i e s.
In many insec s JH analogs inhibi JH syn hesis in he CA, e.g. enoxyca b in D.
punc a a (Lenkic e al., 2009). A simila e ec was obse ed o endogenous JH III in
in ac emales o P. ame icana (Edwa ds e al., 1987). I appea s ha he JH analog
enoxyca b as well as endogenous JH will con ol CA ac i i y by a nega i e eedback
mechanism (Edwa ds e al., 1987).
As shown abo e, many neu opep ides a e egula ing JH biosyn hesis in a s imula o y
o inhibi o y way, and hey may ac a di e en s eps o JH biosyn hesis. Aedes
aegyp i alla o opin (Aedae-AT) and a nesoic acid p obably ac on he e minal s eps
o JH biosyn hesis (Li e al., 2003a). Howe e , Manse-AT had s imula o y e ec s on
JH I o JH III elease h ough inc easing he supply o ace yl- and p opionyl-CoA
p ecu so s (M. sex a Teal, 2002). Manse-AS, on he o he side, ac s p io o
o ma ion o he sesqui e pene alcohol p ecu so s o JH (Helio his i scens; Teal,
2002). Alla os a ins ac on JH biosyn hesis h ough inhibi ion o he ac i i y o inal
enzymes, con e ing a nesoic acid o me hyl a nesoa e and hen o JH (Wang e al.,
1995). Su he land and Feye eisen (1996), howe e , p oposed ha he inhibi ion o
JH III biosyn hesis by an A- ype alla os a in occu s a he i s s ep o JH III syn hesis
i.e. he ans e o 2C uni s om mi ochond ia o he cy oplasm by he ica boxyla e
ca ie and/o he ATP-ci a e lyase. G un enko e al. (2005) sugges ed ha ecdysone
con ols JH syn hesis h ough dopamine in D osophila. Tu e al. (2005) epo ed ha
In oduc ion
8
he insulin signaling pa hway may media e JH biosyn hesis h ough he JH egula o y
neu opep ides.
1.6 Ecdys e oids
The p o ho aco opic ho mone PTTH s imula es ecdys e oid sec e ion by insec
p o ho acic glands (Gilbe e al., 2002). PTTH does no only ac i a e glandula
y osine kinase, bu y osine phospho yla ion is equi ed o ecdysone sec e ion and
occu s a a e y ea ly s ep in he PTTH signalling pa hway (Smi h e al., 2003). The
neu opep ides gene ally s imula e he con e sion o choles e ol o ecdysone and 20-
hyd oxyecdysone (20E). Le els o ee ecdys e oids in he hemolymph a e con olled
by eedback mechanisms (Klowden, 2008). The nuclea ecdys e oid ecep o
con ols he cell ansc ip ion machine y and ep esen s a he e odime o ecdysone
ecep o (EcR) and ul aspi acle (USP) (Klowden, 2008). JH III po en ia es he
ansc ip ional inducibili y o edcys e oids ac ing ia EcR also in mammals showing a
s ong unc ional ela ionship be ween he wo ho mones (Hen ich e al., 2003). The
JH analog ZR-515 has he abili y o ac i a e PTTH in las ins a la ae and pupae o
Mames a b assicae (Hi uma e al., 1978).
In se e al lepidop e ans, he PTTH gene was isola ed and sequenced (Shionoya e
al., 2003). A 226 amino acid p ep oho mone closely ela ed o PTTH had been
cloned om Bombyx mo i, Samia cyn hia icini, An he aea pe ani, and Hyalopho a
cec opia (Ka aoka e al., 1991; Ishizaki and Suzuki, 1994). The ecombinan PTTH
p oduced by E. coli was shown o be biologically ac i e o ini ia e bo h he la al and
he adul moul s in b ainless M. sex a. Ecdysio opins such as PTTH s imula e
ecdys e oid biosyn hesis (Koolman, 1989) and ecdysios a ins (PTSP) inhibi hei
biosyn hesis. Hua e al. (1999) isola ed PTSP (p o ho acos a ic) pep ides om he
b ain o B. mo i, which we e simila o MIP I (see B- ype alla os a ins abo e) and
showed high homology wi h e eb a e galanins. The inhibi ion o ecdys e oid
biosyn hesis by PTSP wo ks h ough ac i a ion o cAMP (Hua and Koolman, 1995).
In adul insec s, p o ho acic glands may degene a e and ecdys e oids a e eleased
om o he issues such as ollicle cells o he o a y, he abdominal a
body/epide mis o he es es ( e iewed by B own e al., 2009). P o ho acic glands
usually sec e e ecdysone which is con e ed o he physiologically ac i e 20E in
a ious pe iphe al issues like he Malpighian ubules (Rees and Isaac, 1985).
Females may ans e ecdys e oids in o he eggs whe e hey induce emb yonic
In oduc ion

9
moul ings (Ho mann e al., 1985). In gene al, ecdys e oids we e ound o induce
emb yonic, la al, pupal and adul moul ings. Ecdys e oids and no JH III ini ia e
i ellogenin (Vg) gene exp ession, syn hesis and elease o Vg in o he hemolymph,
and i ellogenin up ake in o he oocy es in some adul insec s, like in dip e ans, and
also in icks (Thompson e al., 2005).
1.7 La al de elopmen
Insec de elopmen and ep oduc ion a e egula ed by ecdys e oids, ju enile
ho mones, and neu opep ides (Gäde and Ho mann, 2005). La al de elopmen is
guided by he simul aneous p esence o ecdys e oids and ju enile ho mones o
la al - la al moul ing. In insec s wi h holome abolic de elopmen , i has been shown
qui e clea ly ha he JH i e is high a he ime o las -la al moul ing, and hen
declines o a e y low o unde ec able le el p io o la al commi men (Riddi o d,
1972). In S. uigpe da JH I o JH III a e p esen in la ae, bu JH III is he
p edominan homolog. The JH i e s a e luc ua ing du ing la al de elopmen , as
well as he p esence and dis ibu ion o Manse/Spo -AT and Manse/Spo -AS
pep ides (Abdel-la ie e al., 2004a). Injec ion o Manse-AS pep ide in o la ae o S.
ugipe da had no e ec on he i e o JH homologs, body weigh and mo ali y (Oeh
e al., 2000), whe eas, silencing o he Manse-AS gene o S. uigpe da la ae
caused ele a ion o JH i e s, educ ion o body weigh , inc easing mo ali y and
p olonga ion o la al s ages (G ieble e al., 2008).
1.8 Me amo phosis
A small peak o ecdys e oids ini ia es pupal commi men in he Lepidop e a (Wa son
e al., 1987) and he ecdys e oids a e eleased by he p o ho acic glands (Sehnal e
al., 1988). The iming o pupal commi men is ga ed by PTTH and dic a ed by he
endogenous JH i e (Roun ee and Bollenbache , 1986). Mo eo e , enhancemen o
ecdys e oid ecep o s was shown by Riddi o d and T uman (1993) du ing ha ime,
indica ing ha hey igge he ansc ip ion machine y du ing me amo phosis.
Ecdys e oids in he absence o JH ac i a e wo classes o genes: one esponsible o
he pheno ype ypical o he nex (pupal) de elopmen al s age and he o he
pe mi ing a modi ied esponse o ecdys e oids (Wang e al., 1995). Mo e ecdysone
is hen sec e ed and ini ia es me amo phosis. Va ious la al issues ans o m in o
pupal issues and become insensi i e o JH (Riddi o d, 1972).
In oduc ion
10
Elimina ion o he CA om penul ima e ins a la ae o M. sex a accele a ed
pupa ion, adul eye di e en ia ion and di e en ia ion o he base o he o ewings
(Kiguchi and Riddi o d, 1978). Alla ec omy hus caused changes leading o
me amo phosis including a ans o ma ion o he p o ho acic glands om la al o
pupal ype.
On he o he hand, inhibi ion o pupal commi men was epo ed by keeping JH i e s
high, ha means by ea ing wi h JH o JH analogs be o e onse o me amo phosis.
Re a da ion o me amo phosis in a ou o supe nume a y la al moul s was
obse ed ollowing ea men wi h JH analogs (K emen and Nijhou , 1998).
1.9 Rep oduc ion
Vi ellogenin (Vg) is syn hesized by he a body, sec e ed in o he hemolymph and
aken up in o oocy es by endocy osis ia speci ic Vg- ecep o s (Raikhel and
Dhadialla, 1992). In mos adul emales JH induces i ellogenesis and con ols
oocy e g ow h and ma u a ion (Bendena e al., 1997). In some species Vg p oduc ion
is accomplished by p ope eeding (Fei e al., 2005). In dip e ans, JH, o hei mimics,
and 20E ac in combina ion o s imula e o a ian ma u a ion and i ellogenin syn hesis
(Kelly e al., 1987). Fo example, p oduc ion o i ellogenin equi es bo h JH and 20E
in Musca domes ica (Adams and Filipi, 1988), whe eas 20E did no a ec
i ellogenesis in he Culicidae (Red e n, 1982). JH III is impo an in cho ion
o ma ion du ing la e o a ian ma u a ion (Dia aea g andiosella; Shu e al., 1997),
whe eas 20E is he esponsible ho mone in Galle ia mellonella (Memmel e al.,
1988).
In gene al, ju enile ho mones and ecdys e oids ha e gonado opic unc ions in adul
insec s (see abo e). The ecdys e oids a e syn hesized in he ollicle cells o o a ies
and es es, o ins ance, in adul emales o Bla ella ge manica (Romana e al.,
1995).
The cock oach alla os a in Dippu-AST 1 had an inhibi o y e ec on o a y
de elopmen in a 4 day old mealwo m emale (Wasielwski e al., 2009). Mo eo e ,
ype A and ype B alla os a in epi opes we e ound in he o a y o las ins a la ae
and adul c icke s, G yllus bimacula us, especially in he co ical cy oplasm o he
oocy e an e io pole (Wi ek and Ho mann, 2001). F om hese esul s i can be
concluded ha JH biosyn hesis in adul insec s is also con olled by alla o egula ing
neu opepides.
In oduc ion
11
1.10 RNA in e e ence (RNAi)
Biological e en s conce ning su i al, g ow h and di e en ia ion occu as a espond
o al e ing pa e ns in gene exp ession. Gene ansc ip ion le el quan i ica ion has
become c ucial in gene unc ioning esea ch (Zamo ano e al., 1996). Mo eo e ,
many o he disco e ed genes a e empo a y wi h unknown unc ions (Bellés, 2010).
The RNA in e e ence (RNAi) echnique, o pos ansc ip ional gene silencing
(PTGS), media ed by 21 o 22 nucleo ide small in e e ing RNAs (Elbashi e al.,
2000), which induce deple ion o a chosen ansc ip , can help esol ing his
challenge (Bellés, 2010). So a , he possibili y o s udying he unc ions o
homologous genes in di e en species can acili a e an e olu iona y insigh in o
de elopmen al p ocesses o insec s (Bellés, 2010). Mo eo e , he RNAi can help
s udying mechanisms o ac ion o known insec icides, and o de elop new a ge s o
new insec icides. RNAi i sel could be en isaged as an insec con ol ool h ough
a ge ing i al genes, al hough e icien sys ems o dsRNA o mula ion and deli e y
mus be de eloped (P ice e al., 2008; Whya d e al., 2009; Tao e al., 2010).
RNAi is a na u al p ocess o egula e gene exp ession (Liebe , 2010) by down-
modula ion o a speci ic mRNA (Bellés, 2010), igge ed by sho helical RNA
molecules named small in e e ing RNA (siRNA) ha a e gene a ed in he cells om
la ge double-s anded RNA p ecu so s by enzyma ic deg ada ion h ough he
RNase enzyme Dice . These siRNAs a e hen inco po a ed in o a silencing complex
called RISC (RNA-induced silencing complex), which iden i ies and silences
complemen a y messenge RNA (Meis e and Tuschl, 2004). RNA in e e ence
al eady p o ed i s use ulness in unc ional genomic esea ch on insec s. Hu enne
and Smagghe (2010) desc ibed a leas wo pa hways o dsRNA up ake in insec s:
he ansmemb ane channel-media ed up ake mechanism and an ‘al e na i e’
endocy osis-media ed up ake mechanism.
Pes insec s should be able o ake up he dsRNA h ough eeding and diges ion in o
hei midgu . Recen ly, we could show in ou labo a o y ha S. ugipe da la ae ake
up dsRNA dissol ed in a semi-syn he ic die and ha his dsRNA supp esses gene
exp ession (G ieble e al., 2008). The au ho s demons a ed ha dsRNA aken up
wi h he ood was success ul in supp ession o Manse-AS and Spo -AT 2 genes in
se e al issues o la ae and adul mo hs, esul ing in massi e mo ali y in his pes
species. Hu enne and Smagghe (2010) highligh ed he achie emen o implemen ing
In oduc ion
12
RNAi in insec pes con ol wi h success ul expe imen s using ansgenic plan s and a
di e si y o insec o de s/species and a ge genes, espec i ely.
1.11 P oblem s a emen and jus i ica ion o he esea ch
p ojec
Alla o egula ing neu opep ides a e nume ous and ha e been localized in a ious
insec issues. The e a e some epo s on in i o s udies, which in es iga ed he
bioac i i y o hese pep ides, bu in i o s udies a e a e. The RNA in e e ence is an
up- o-da e me hod used in i o o supp ess gene exp ession selec i ely and se es
as a ool o analyze gene unc ions.
Alla os a ins (AS) and alla o opins (AT) a e neu opep ides ha inhibi o s imula e
he biosyn hesis o ju enile ho mones (JH). In he mo h, S. ugipe da, a leas wo
ypes o AS ( ype A and ype C) and wo AT (AT 1 and AT 2) a e exp essed, which
a e g ouped by s uc u al ea u es. Bo h A- and C- ype alla os a ins and AT 1
pep ides a e localised in neu osec e o y cells o he b ain and a e p esen in he CC,
CA and en al ne e co d, al hough a ia ions exis in di e en sexes and a di e en
s ages o de elopmen (Abdel-la ie e al., 2003; 2004a; 2004b). Howe e , he
widesp ead exp ession o he genes in a ious issues co obo a es hei
mul i unc ional oles. So a , exp ession and localiza ion si es o AT 1 pep ide
sugges ha he pep ide may ha e unc ions dis inc om egula ion o JH
biosyn hesis.
Ju enile ho mones and ecdys e oids a e classical ho mones con olling he
de elopmen , me amo phosis and ep oduc ion o insec s. Se e al homologs o he
ju enile ho mones (JH I, II, and III) exis in he Lepidop e a (see abo e). The e a e
indica ions ha he hemolymph i e s o de ined iso o ms a e con olled in ela ion o
he de elopmen al s age and age o S. ugipe da by he alla o egula ing
neu opep ides.
The all a mywo m, S. ugipe da, is an ag icul u ally impo an pes species. Much
e o has been pe o med o imp o e pes con ol s a egies based on dis up ion o
he insec endoc ine sys em. One o he majo a ge s is he con ol o JH
biosyn hesis in he CA h ough alla o egula o y neu opep ides (De Ko e al., 1987).
In oduc ion
19
Sample Volume (µl)
H2O 34.5
Pu e 10x 5
MgCl2 3
dNTPs (2.5 mM) 4
T7-SK 10 p ime 1
T7-SK 10 p ime 1
Templa e (~100 ng/µl) 0.5
Taq polyme ase (Fe men as) 1 U/µl 1
To al olume 50
Table (5): Pipe e scheme o he PCR eac ion o ampli y he T7 sul akinin agmen .
The ollowing he mocycle p o ile was used (Table 6):
S ep
Tempe a u e (°C) Time No. o cycles
1 95 4 min 1
2
3
4
94
67
72
30 sec
1 min
2 min
1
5
6
7
95
64
72
45 sec
1 min
2 min
45
8
9
72
4
10 min
∞
1
Table (6): PCR empe a u e p o ile o ampli ica ion o he T7 sul akinin agmen .
2.1.2 Gel elec opho esis
1.8% gels we e cas ed by weighing 540 mg aga ose (PeqGOLD Uni e sal Aga ose
PeqLab, E langen, Ge many) wi h analysis scale MC210P Sa o ius, Gö ingen
(Ge many), mel ing in he p esence o 30 ml 0.5 x TBE pu e (T is base, bo ic acid
Sigma, Ge many), 0.5 M EDTA (AppliChem, Ge many), H2O, pH 0.8, boiled in he
Ma e ials and Me hods

20
mic owa e (Bosch, S u ga , Ge many) a 600 W o 1 min un il he aga ose was
o ally dissol ed o ge a clea , anspa en solu ion. The mos con enien me hod o
isualize DNA in aga ose gels is s aining wi h he luo escen dye e hidium b omide
(Sha p e al., 1973). Two µl e hidium b omide (10 mg/ml wa e ) (P omega, Madison,
USA) was added o he gel o s aining he bands sho ly be o e he mel ed gel
solu ion was pou ed in o gel chambe s and allowed o ha den. Upon ha dening, he
aga ose o ms a ma ix wi h de ined densi y, which is de e mined by he
concen a ion o he aga ose in he solu ion. To make iscosi y o DNA samples high
and p e en deg ada ion o he DNA samples, loading bu e (AppliChem, Da ms ad ,
Ge many) con aining b omo-phenol-blue as a dye, suc ose and EDTA was used.
DNA solu ion was mixed wi h loading bu e added in a a io o 5:1 ( / ) and
ans e ed in o he aga ose gel slo s. 12 µl 1000 bp DNA ma ke ( agmen size: 100,
150, 200, 300, 400, 500, 600, 700, 800, 900, 1000 bp, Diagonal, Müns e , Ge many)
was used. The gel was co e ed wi h 0.5 x TBE-bu e (445 mM T is; 445 mM bo ic
acid; 12.5 mM EDTA), scheduled wi h Milli-Q-wa e and adjus ed o pH 8.0 (pH-Me e
766 Calima ic Knick, Be lin, Ge many). Elec opho esis was un wi h elec opho esis
powe supply BioRAD powe /PAC 3000 (Bio-Rad Labo a o ies GmbH, Ge many) o
35 min and 5 V/cm. DNA, which is nega i ely cha ged a neu al pH, mig a es
owa ds he anode.
2.1.3 Visualisa ion o he DNA band and imaging
The loca ion o DNA wi hin he gel was de e mined di ec ly by s aining wi h low
concen a ions o he luo escen dye e hidium b omide de ec ed di ec ly by pu ing
he gel unde UV ligh . “UV adia ion a 254 nm is abso bed by he DNA and
ansmi ed o he dye; adia ion a 302 nm and 366 nm is abso bed by he bound dye
i sel which emi s ligh a ound 600 nm p esen ing an o ange colou ” (Samb ook e al.,
1989).
The DNA agmen s we e imaged by Image Mas e ® VDS Sys em (Ve sion 3.0)
Pha macia Bio ech, F eibu g (Ge many), and analyzed using image mas e p og am.
Pho og aphs o gels we e made using ansmi ed o inciden ul a iole ligh . The
mos sensi i e ilm is Pola oid ype 57 o 667 (ASA 3000) Roche Diagnos ics,
Mannheim (Ge many). Pho os we e aken by “Image mas e sys em” (Ame sham),
sa ed and he in ensi y o bands was densime ically analysed and he in eg a ed
densi y calcula ed.
Ma e ials and Me hods
21
A e wa ds, he gel was obse ed unde he ul a iole adia ion, an UV-ba wing
adia o om Kon ad Benda, Wiesloch (Ge many) was used as p o ec o om UV
adia ion. The a ge DNA band was cu ou p ecisely, pu in o a 2 ml ube wi h known
weigh and he weigh o he isola ed gel pa was de e mined by di e ence. DNA
bands we e eco e ed om he gel ei he u ilized o dsRNA ansc ip ion used a long
ou RNAi and exp ession expe imen s o o Manse-AT agmen sequencing.
2.1.4 DNA pu i ica ion
GFX® PCR DNA and Gel Band pu i ica ion ki (GE heal h ca e, F eibu g, Ge many)
was used o ex ac he DNA bands om he gel acco ding o manu ac u e p o ocols.
10 µl cap u e bu e pe 10 mg aga ose was added o he gel and hea ed a 60°C o
5 min. The gel was comple ely dissol ed. Using P1000 pipe e (Gilson, Middle on,
USA) and 1000 µl pipe e ips (long ips) (Kiske Bio ech, S ein u , Ge many), 400 -
500 µl gel we e ans e ed o a column and he column was cen i uged sho ly a
10000 x g. Column was wice washed wi h 500 µl washing bu e , incuba ed o one
min and cen i uged again o 1 min a 10000 x g. Then, 30 µl o elu ion bu e we e
added, incuba ed o one min and column was cen i uged o ano he 1 min o
eco e he pu i ied DNA.
2.1.5 De e mina ion o DNA concen a ion
Pu i ied DNA dilu ed o a p ope amoun in 100 µl o highly pu i ied milliQ wa e was
measu ed using a spec opho ome e [UV/VIS Spec ome e Lambda 25 Pe kin
Elme Ins umen s, Shel on, USA, UV Winlab S anda d L 610-0025 Pe kin Elme
(Ve sion 4.0) Shel on, USA] a 260 nm wa e leng h and a mic o qua z cu e e om
Hellma Analy ics, Müllheim, Ge many. One uni o op ical densi y co esponds o 50
µg dsDNA/ml. In some expe imen s, DNA concen a ion was measu ed u ilizing he
Nanod op Pho ome e ®, Implen (USA).
2.1.6 In i o ansc ip ion
T ansc ip ion is he ci cumsc ibing o a speci ic DNA in o RNA. DNA empla e wo ks
as a ma ix o he syn hesis o he RNA co d. Pu e DNA adjacen o p omo e si es
o DNA-dependen RNA polyme ases can be used o in i o ansc ip ion.
Ma e ials and Me hods
22
In a i s s ep PCR was conduc ed o yield dsDNA and o gene a e he DNA
agmen s de i ed om he a ge lepidop e an sequence elonga ed wi h he p ope
p omo o sequences. The DNA p oduc s we e sepa a ed h ough gel elec opho esis
and pu i ied wi h GFX® PCR DNA and Gel Band pu i ica ion ki . PCR was ollowed by
gene a ion o ssRNAs om bo h complimen a y DNA-s ands in one ube wi h he T7
MEGAsc ip ® RNAi ki (Ambion, Hun ingdon, UK). 0.8 -1 µg DNA (in a maximum o 6
µl) was used and comple ed o a inal 20 µl o mas e mix, hen he eac ion ubes
we e sho ly o exed, cen i uged and a e wa ds incuba ed in an incuba o
(Hae eus, Hanau, Ge many) a 37°C o e nigh o ansc ibe he RNA; ini ia ing
syn hesizing o big amoun o RNA as possible. The eac ion solu ions we e pipe ed
as desc ibed below (Table 7):
Solu ion Volume (µl)
H2O Comple e o o al olume
ATP, CTP, GTP, UTP Each 2
Reac ion bu e 10x 2
Templa e band A X, max. in 6 µl
Enzyme mix 2
To al olume 20
Table (7): Pipe e scheme o he ansc ip ion eac ion o gene a e AT 1 and AS A -
ype dsRNA. X = 0.8 -1 µg.
The incuba ion s ep was ollowed by a DNase diges ion o emo e he empla e DNA.
1 µl Tu bo-DNase was ca e ully added o he eac ion, mixed wi h ips, and incuba ed
a 37°C o 15 min. A e wa ds he DNase was dena u ed a 65°C o 15 min. Fo
con enien p ecipi a ion o dsRNA and emo ing uninco po a ed nucleo ides and
mos p o eins, 15 µl nucleic acid ee wa e and 30 µl o LiCl (Ambion, Hun ingdon,
UK) we e added o he solu ion and mixed ho oughly.
The dsRNA was p ecipi a ed a -20ºC o e nigh ollowed by longe s o age a -70ºC
un il use. Fo ge ing a good pelle he ubes we e cen i uged a 4°C o 15 min a
12000 x g wi h he Mul i uge 1 LR He aeus Ins umen s, Hanau (Ge many).
Supe na an solu ion was discha ged, he pelle washed wi h ice-cold 75% ETOH
(p.a), mixed and cen i uged a 4°C o 5 min a 12000 x g. The pelle was d ied a ai
Ma e ials and Me hods
23
and esuspended in 50 µl RNase ee wa e by pipe ing up and down. A inal
dena u a ion o 5 min a 95ºC and an annealing s ep a oom empe a u e o e nigh
was ollowed. Quan i ica ion o dsRNA concen a ion was done by
spec opho ome ic de e mina ion using Nanod op pho ome e . dsRNA was analyzed
wi h gel elec opho esis o check he size and he success o annealing. Gel was
p epa ed wi h he s anda d me hod bu all solu ions we e p epa ed wi h RNase ee
wa e . 0.2 µg in 10 µl inal sample olume was used o analysis.
2.1.7 Rea ing o S. ugipe da
Pupae o S. ugipe da we e kindly supplied by Baye C opScience AG, Le e kusen
(Ge many). The animals we e ea ed a long day condi ions (16 h pho ophase: 8 h
sco ophase) a 27°C and a ela i e humidi y o abou 70%. Each pupa was
indi idually kep in a sepa a e compa men o asso men boxes (9 х 32 х 36 mm pe
compa men , Lice a GmbH & Co KG, Bad Salzu len, Ge many) un il eme gence,
which was obse ed e e y ½ h du ing da k and ligh pe iods. Those insec s ha
eme ged we e conside ed o be 0 day mo hs. F eshly eme ged adul emales and
males we e kep in 20 × 20 × 10 cm plas ic boxes. Ei he wo animals o same sex
we e pu oge he o hey we e mixed in a 1:1 emale o male a io. They we e ed
wi h 10% suga solu ion and gi en wa e . Fil e pape was p o ided o egg laying.
La ae o S. ugipe da we e ed wi h a ood mix u e o Noc uidae p o ided as d ied
ood by Baye C opScience AG, Le e kusen (Ge many), which has been cooked in
ou lab.
2.1.8 Injec ion o S. ugipe da
1.5 µg dsRNA in 2 µl noc uid Ringe solu ion (7.1 mM CaCl2, 22 mM Na-ß-glyce o-
phospha e, 13.5 mM MgSO4, 29.6 mM MgCl2 and 29.5 mM KCl, pH adjus ed o 6.8
wi h KH2PO4 and il e ed s e ile wi h 0.2 µm meshes) o 2 µl noc uid Ringe solu ion
as a con ol was injec ed abdominally in o he hi d segmen o adul mo h di ec ly
a e eme gence o in o he oo o he las pseudopod o eshly moul ed penul ima e
la ae, using Injec ions Sy inges Mic oli e TM (10 µl) Hamil on, Bonaduz (CH).
Ma e ials and Me hods
24
2.1.9 Weigh o o a ies and eggs and pe cen age o
ha ching
A e injec ion o he mo hs ( emale o male) an un ea ed male o emale was added,
o each in a a io o 1:1 o bo h sexes in sepa a ed Bellaplas boxes, acco ding o he
expe imen al pu pose. The emales we e dissec ed a ce ain days om day 2 un il
day 7 a e ma ing unde binocula mic oscope (Binocula M7S, Wild, Hee b ugg,
Swi ze land). Decapi a ed animals we e co e ed wi h modi ied c icke Ringe saline
(86 mM NaCl, 5.4 mM KCl, 3 mM CaCl2) (Lo enz e al., 1997), ixed wi h needles a
he ho ax and he abdomen was la e ally opened by a sisso . The a ge issues
we e wi hd awn and adhe ing a body o o he issues emo ed ca e ully. Clean
o a ies we e weighed using p ecision scale 1219 MP Sa o ius, Gö ingen
(Ge many).
Fo weighing 100 deposi ed eggs we e collec ed by ca e ully emo ing egg packs
om he box wall and co e and con i ming hei numbe unde binocula
mic oscope. The weighed eggs we e kep in well closed plas ic con aine un il
ha ching ( o ea ing condi ions see abo e) and he eme ged la ae we e coun ed.
2.2 De ec ion and analysis o ho mones in he hemolymph
Many me hods ha e been de eloped o measu ing ho mone p oduc ion o ho mone
i e s, such as a es o ho mone biosyn hesis by adiochemical assay o ho mone
i e s by immunochemical me hods o gas ch oma og aphy-mass spec ome y (GC-
MS). In his wo k we used he liquid ch oma og aph-mass spec ome y me hod (LC-
MS) de eloped by Wes e lund and Ho mann (2004), which is less ime consuming
and equi es less sol en s han o he echniques, and makes i possible o measu e
JH homologs and hei deg ada ion p oduc s as well as ecdys e oids simul aneously.
2.2.1 Hemolymph and issue collec ion o LC-MS analysis
Hemolymph was collec ed om adul mo hs by apping he in e segmen al
memb anes and collec ing he leaking d op u ilizing a mic opipe e (20 µl)
(Blaub and® in a Ma k B and, We heim, Ge many). Since he adul mo hs bleed
only ma ginally, he hemolymph had o be combined om se e al animals o yield he
inal 20 µl o hemolymph. La ae we e cu a he pseudopods and om one la a 20
µl could be collec ed. The hemolymph was ans e ed in o a clean, empe ed glass
Ma e ials and Me hods

25
ube (50 x 6-6.5 mm, Assis an , Sondheim/Rhön, Ge many), hea ed a 240°C o 16 h
in an o en T 5042K He aeus, Hanau (Ge many), which con ained 100 µl me hanol
and 100 µl isooc ane ( o liquid ch oma og aphy, Me ck KGaA, Da ms ad ,
Ge many). The mix u e was immedia ely o exed o 20 sec and hen incuba ed a
oom empe a u e o 20 min. Fo long ime s o age he ial was sealed wi h pa a ilm
and aluminium oil and kep a -70°C.
Mo hs we e dissec ed unde binocula mic oscope, co e ed wi h modi ied c icke
Ringe saline (Lo enz e al., 1997). Accesso y glands o bu sa copula ix we e
isola ed and adhe ing issues ca e ully emo ed. A e wa ds, he a ge issue was
ans e ed in o a empe ed glass ube which con ained 100 µl me hanol and 100 µl
isooc ane. The issue was ca e ully g ound by a small glass homogenize (0.5 ml,
Mo o co dless Kno s, Vineland, USA) o 90 sec, o exed and incuba ed a oom
empe a u e o 20 min. The sealed ex ac ed solu ion could be s o ed a -70°C un il
use.
2.2.2 Sample clean-up and ho mone ex ac ion
Ho mones we e ex ac ed in mul iple s eps including emo ing o p o ein laye .
Sample clean-up in ol es he p ecipi a ion o p o eins by me hanol/isooc ane (1:1
/ ), cen i uga ion and pa ial e apo a ion o he o ganic sol en s. Samples om -
70°C we e cen i uged a 1000 x g o 20 min, as a esul solu ion sepa a ed in o 3
phases. The uppe phase o isooc ane was ans e ed in o a new glass ube and he
esul ing p o ein phase and me hanol phase we e e-cen i uged a 1000 x g o 5
min. The p o ein o ms a pelle a he bo om o he glass and he o e laying
me hanol phase was aken and combined wi h he isooc ane phase. This s ep was
ollowed by e apo a ion o isooc ane and concen a ing he sample olume om
app oxima ely 200 µl o 20 µl using eeze-d ying Ch is alpha RVC 2-4 (Ch is ,
Os e ode, Ge many). A e wa ds he samples we e again cen i uged a 1000 x g o
4 min. The inal olume was de e mined by a Hamil on sy inge and ans e ed in o
small au osample ials (Ca l Ro h GmbH & Co KG, We heim, Ge many).
2.2.3 Analysis and quan i ica ion o ho mones
The simple, as and sensi i e liquid ch oma og aphy-mass spec ome y (LC-MS)
de eloped o de e mina ion o ju enile ho mones (JH), JH diols and JH acids in
Ma e ials and Me hods
26
insec hemolymph, as desc ibed by Wes e lund and Ho mann (2004), was used o
quan i y he JH i e o he a ious JH iso o ms and o he ee ecdys e oids. LC-MS
appa a us composed o an au oinjec o (SIL-10AD VP) and an Eldex Mic oP o HPLC
sys em wi h wo HPLC pumps (LC-20AD) o liquid ch oma og aphy, coupled wi h an
LCMS 2010A om Shimadzu, Duisbu g (Ge many). A e ex ac ion and clean-up o
he ho mones, he JH compounds and he ecdys e oids we e sepa a ed on a C18
column (Rep oSil-Pu ODS-3, 5 µm, D . Maisch GmbH, Amme buch, Ge many)
supplemen ed wi h a p ecolumn (C18, Phenomenex, Ascha enbu g, Ge many) a
37°C by g adien elu ion o wa e (Me ck KGaA, Da ms ad , Ge many) - me hanol
(hype g ade, Me ck KGaA, Da ms ad , Ge many) a a low a e o 200 µl/min. The
elu ion g adien inc eased wi hin 0-10 min om 30 o 100%, s ayed a 100% om 10-
15 min and hen dec eased wi hin 15-16 min om 100 o 30% and s ayed a 30%
un il minu e 30. Samples we e analysed by elec osp ay mass spec ome y
(maximum o sample ol age 4.5 kV, de ec o ol age 1.5 kV and a CDL- ol age o
25 V, ni ogen low 4 l/min, CDL- empe a u e 250°C and hea ing block 200°C). Due
o he high abundance o Na+ in insec hemolymph, [M+Na]+ is p ima ily o med, bu
also he [M+K]+ was de ec ed. The limi o de ec ion and quan i ica ion was 6 o 20 pg
o JH, and 20 o 100 pg o ecdys e oids. Due o ma ix e ec s, he calib a ion cu e
o each o he JH was compiled by spiking c icke (G. bimacula us) hemolymph wi h
a low JH- i e (0 d adul c icke s) wi h s anda ds JH I, JH II, and JH III (Fluka, Neu-
Ulm, Ge many). LC-MS so wa e® (LabSolu ions LCMSsolu ion, Ve sion 3.0,
Shimadzu Co po a ion, Duisbu g, Ge many) was used o analyse ecdys e iod and
ju enile ho mone i e s as desc ibed by Wes e lund and Ho mann (2004).
Ma e ials and Me hods
27
2.3 Gene cloning
2.3.1 In oduc ion o T7 AT and T7 AS– ype A DNA
agmen s cloning
Con e ing o poly (A)+ mRNA in o double s anded DNA and he con enien mode n
echnique o cloning DNA in o p oka yo ic ec o s ha e become undamen al ools o
molecula biology. Di e en s a egies we e used o inse he double-s anded cDNA
in o a si e ha is closely lanked by wo hexanucleo ide es ic ion si es.
E. coli bac e ia ca ying ecombinan plasmid DNA we e g own in cul u e media o
ampli y T7 AT and T7 AS– ype A DNA agmen s. The p ocess o gene cloning
includes se e al s eps. Fi s he DNA agmen becomes ampli ied om cDNA (o
DNA agmen s) o he gene by means o a PCR, hen he isola ed DNA is liga ed
in o a sui able ec o and he ecombinan plasmid ans o med in o compe en
mic oo ganisms. Inc easing ( e men a ion) o mic oo ganisms is an impo an s ep o
he gene cloning ollowed by ex ac ion and pu i ica ion o he plasmids ou o he
mic oo ganisms (Samb ook e al., 1989).
2.3.2 Ampli ica ion o he DNA agmen s
T7 AT 1 o T7 AS- ype A DNA agmen s, which we e used along ou esea ch wo k,
we e checked and p o en by cloning and sequencing. Fi s DNA agmen s we e
ampli ied, pu i ied by gel elec opho esis, ex ac ed by GFX® PCR DNA and Gel
Band pu i ica ion ki (GE heal h ca e, F eibu g, Ge many) and pho ome ically
quan i ied as desc ibed be o e (see 2.1.1 and 2.1.2).
2.3.3 Liga ion
Gene pJETTM cloning Ki K 1231, K 1232 (The mo Scien i ic, Ge many) was used o
cloning o T7 AT o AS- ype A DNA agmen s gene a ed by PCR. P io o liga ion he
DNA agmen was gel-pu i ied and ea ed wi h a p oo eading DNA polyme ase o
ge blun ends used in a 3:1 mola a io wi h he plasmid PJET 12/blun . The DNA
blun ing enzyme is a p op ie a y he mos able Taq DNA polyme ase wi h p oo
eading ac i i y. I emo es 3´- o e hangs and ills in 5´- o e hangs. Nucleo ides o
he blun ing eac ion we e supplied in he eac ion bu e included in he ki .
1. Se up blun ing eac ion (Table 8):
Ma e ials and Me hods
28
Componen Volume ecommended Volume used
2x eac ion bu e 10 µl 5 µl
PCR p oduc s 1- 2 µl 1 µl
Wa e , nuclease ee Up o 6 µl 2.5 µl
DNA blun ing enzyme 1 µl 0.5 µl
To al olume 18 µl 9 µl
Table (8): Componen s o blun ing eac ion.
The blun ing eac ion was se up, o exed b ie ly and cen i uged o sho in e al.
2. The mix u e was incuba ed a 70°C o 5 min and chilled b ie ly on ice.
3. Liga ion eac ion was se up. The ollowing solu ions we e added (Table 9).
Componen Volume ecommended Volume used
PJET 1.2/ blun cloning
ec o (50 ng/µl)
1 µl 0.5 µl
T4 DNA ligase (5 U/µl) 1 µl 0.5 µl
To al olume 20 µl 10 µl
Table (9): Componen s o liga ion eac ion.
4. The liga ion eac ion was incuba ed a oom empe a u e (22°C) o 5 min.
5. The liga ion solu ion was used di ec ly o bac e ial ans o ma ion.
2.3.4 Compe en cells
E. coli bac e ia cells in oduce DNA unde no mal condi ions only in limi ed amoun .
Howe e , o ans o m such ypes e ec i ely, hose cells we e subjec ed o physical
and/ o chemical ea men s in o de o become compe en cells (Samb ook e al.,
1989).
Bac e ia we e manipula ed in luid cul u es o LB medium (Lu ia-Be ani-Medium) [1 l
desal ed wa e , 5 g yeas ex ac (AppliChem, Ge many), 5 g yp on (ApplieChem,
Ge many),10 g NaCl, s i ed and au ocla ed]. 250 µl o a s a suspension o E. coli
JM109, Geno ype: ecA1, endA1, gy A96, hi, hsdR17 ( K-, mK+), elA1, supE44, _
Ma e ials and Me hods
35
Tempe a u e (°C) Time (min)
25 10:00
37 120:00
85 0:05
4 ∞
Table (12): Tempe a u e p o ile o e e se ansc ip ion PCR eac ion.
2.4.6 Syn hesis o s anda d cu es
2.4.6.1 Ampli ica ion o he AT 1 agmen
Fo an e alua ion o he exp ession da a, manu ac u ing o ex e nal s anda d cu es
is necessa y, which should be gene a ed wi h a DNA agmen as a empla e
composed o a pa o he a ge gene sequence (Table 13). The plo o log o ini ial
copy numbe o he DNA p oduc e sus c ( h eshold alue) o he PCR eac ion is a
s aigh line ha ep esen s he s anda d cu e. In his wo k we used AT 1 and ß-
ac in RNAs as s anda d cu es.
The AT 1 gene has h ee mRNAs which di e om each o he by al e na i e splicing,
he AT iso o ms A, B and C (Abdel-la ie e al., 2003). Fo he ampli ica ion o he AT
agmen , he p ime s AT5p 5’- CAT TTC AAT GCA TTT GGC GGT AGC- 3’ and
AT5p R 5’- CCC TGG CGG TCA TCA TCT C- 3’ we e used. The p ime s add ess a
gene sequence a ea, which co e s all h ee mRNA iso o ms.
Sample Volume (µl)
H2O 34.5
Pu e 10 x 5
dNTPs (2.5 mM) 4
Cacl2 3
AT5p p ime 1
ATp R p ime 1
Mal 7 agmen s 0.5
Taq polyme ase (Fe men as) 1 U/µl 1
To al olume 50
Ma e ials and Me hods

36
Table (13): Pipe e scheme o ampli ica ion o s anda d empla es.
2.4.6.2 Ampli ica ion o he ß-ac in agmen
The in e nal s anda d should be exp essed a a cons an le el in di e en issues o
an o ganism. RNA om housekeeping ß-ac in gene was used o no malize pa e n o
AT 1 gene exp ession. Fo analysis o ß-ac in gene exp ession a s anda d cu e was
un in pa allel. The s anda d empla e o such a PCR was gene a ed by using Ac
5’- CCT CAA CCC TAA GGC CAA CAG G - 3’ and Ac 5’- CCA TCA CCG GAG
TCC AAG ACG - 3’ p ime s and cDNA as a empla e (Table 14). Fo he op imiza ion
o his PCR eac ion composed o 50 µl olume 1 µl o he cDNA was pipe ed as he
empla e. The concen a ion o he used p ime s was 5 µM. The PCR was un in a
Tpe sonal The mocycle (Biome a, Analy ical Jena Company) wi h a de ined he mo
p o ile (Table 15).
Sample Volume (µl)
H2O 4
Pu e 10 x 1
dNTPs (2.5 mM) 1
Cacl2 1
Ac p ime 0.5
Ac p ime 0.5
cDNA 1/10 (5 ng) 1
Taq DNA polyme ase 1 U/ µl (Fe men as) 1
To al olume 10
Table (14): Pipe e scheme o s anda d ß-ac in ampli ica ion.
Ma e ials and Me hods
37
S ep
Tempe a u e (°C) ime No. o cycles
1 95 3 min 1 x
2
3
4
94
68
68
30 sec
41 sec
60 sec
-1°C 10 x
5
6
7
94
60
68
30 sec
45 sec
90 sec
45 x
8
9
68
10
10
∞
1 x
Table (15): The mocycle p og amm SP3 was used o ampli y ß-ac in s anda d
empla e.
ß-Ac in and AT 1 PCR p oduc s we e yielded in he ange o 143 and 150 bp,
espec i ely. The syn hesized AT 1 and ß-ac in agmen s we e analysed by gel
elec opho esis, hei bands we e cu ou p ecisely, pho og aphed, pu i ied om gel
and hei concen a ions we e measu ed using nanod op pho ome e as desc ibed
be o e (2.1.2- 2.1.5).
2.4.7 Op imiza ion o s anda d cu es o eal- ime PCR
The choice o sui able DNA polyme ase and bu e s we e conside ed, and
con amina ion es s we e ca ied ou o all samples and s anda ds o check and
a oid any con amina ion du ing he exp ession analysis. The ampli ied DNA
agmen s o he eal- ime PCR we e analysed (10 µl aliquo ou o PCR) by means o
gel elec opho esis on an aga ose gel.
A i s , a ious concen a ions om he AT 1 and ß-ac in empla es we e gene a ed
as desc ibed (2.4.6.1 and 2.4.6.2) and we e used in he eal- ime PCR o analyse he
e ec i eness and pu i y, as well. 10 µl o he pipe ed eac ion solu ions (Table 16)
we e ans e ed o Op ical 8-Tube s ips (0.2 ml) om Applied Biosys ems (Fos e
Ci y, USA) ha we e co e ed by Op ical Cups (Applied Biosys ems, Fos e Ci y,
USA). A e se up he samples we e cen i uged sho ly by Mic o20 cen i uge
He ich (Nobles ille, USA). The op imal numbe o PCR cycles o each sample was
Ma e ials and Me hods
38
de e mined by analyzing he amoun o PCR p oduc s a e a se ies o PCR
ampli ica ions wi h accele a ing cycles om 35 o 40 by gel elec opho esis.
Solu ion Volume (µl)
Powe SYBR
®
G een
PCR Mas e Mix
10
H2O 7
Fo wa d p ime 5 µM 0.5
Rewa d p ime 5 µM 0.5
Templa e (AT 1 o ß-ac in
DNA agmen s) 100 nM
2
To al olume 20
Table (16): Pipe e scheme o he eac ion used o eal- ime PCR s anda d cu e
op imiza ion.
Then, s anda d cu es using SYBR G een I as a luo escence dye, we e gene a ed,
ega ding hei linea esponse o e a la ge dynamic ange by pe o ming 10 samples
wi h DNA concen a ions be ween 2 pg and 0.002 pg unning 40 PCR cycles (Table
17). All he esul s ha ga e posi i e p oduc s peaked in he mel ing cu es be ween
87.4°C and 88.2°C. The cDNA concen a ions o 2 pg o 0.002 pg showed a linea
ange o ampli ica ion wi h an e iciency alue (E) o 99.9 % and we e chosen as AT1
and ß-ac in s anda ds o u he expe imen s. Ampli ica ion o ou independen
se ial dilu ions o he cDNA cons i u es he s anda d cu e. Addi ionally, a nega i e
con ol eac ion by lea ing ou he empla e was un in pa allel.
In gene al, he highes and lowes c (cycle h eshold) alues we e disca ded o
co ec o pipe ing e o s and he emaining ou alues we e a e aged o gi e he
inal c alue o ha de ined dilu ion. The c alue is in e sely p opo ional o he log
o he ini ial copy numbe . The e o e, a s anda d cu e is gene a ed by plo ing he c
alues, wi h 99% con idence in e als, agains he decade loga i hm o he ini ial copy
numbe .
Ma e ials and Me hods
39
40 x
Table (17): PCR empe a u e p o ile p og am o ampli ica ion o s anda d AT 1 and
ß-ac in DNA agmen s.
2.4.8 Real- ime PCR
Re e se ansc ip ion polyme ase chain eac ion (RT-PCR) is a eliable echnique
measu ing p ecise di e ences be ween mRNA le els among samples (Shiao, 2003).
Two common me hods we e used o analyze he da a o absolu e and ela i e
quan i ica ion. Absolu e quan i ica ion de e mines he inpu copy numbe , usually by
ela ing he PCR signal o a s anda d cu e. Rela i e quan i ica ion ela es he PCR
signals o he a ge ansc ip in a ea men g oup o ha o ano he sample such as
un ea ed con ol. The 2-∆∆c me hod is a con enien way o analysing changes in
gene exp ession ela i ely (Li ak and Schmi gen, 2001).
Real- ime PCR eac ions we e pe o med in iplica es each in a 20 µl eac ion
mix u e olume (Table 18) ollowing he manu ac u e ’s ins uc ions o he
Powe SYBR® g een PCR Mas e Mix (Applied Biosys ems, Wa ing on, UK). They
we e un on an ABI P ism 7300 sequence de ec ion sys em (Applied Biosys ems).
S ep Tempe a u e (°C ) Time
1 95 3 min
2
3
4
94
62 ( o AT and ß-ac in)
68
30 sec
45 sec
90 sec
5 68 10 min
6 4 ∞
Ma e ials and Me hods
40
Solu ion Volume
Powe SYBR
®
G een
PCR Mas e Mix
10 µl
H2O 7 µl
Fo wa d p ime (5 nM) 0.5 µl
Re e se p ime (5 nM) 0.5 µl
Templa e: cDNA 2.0 µl
To al olume 20 µl
Table (18): Pipe e scheme o eal- ime PCR eac ions o ampli y agmen s o he
AT 1 o ß-ac in cDNA. Fo wa d/ e e se p ime : AT5p /AT5p R o s Ac / s Ac ,
espec i ely.
Two µl o he e e se ansc ip ion eac ion mix u e we e used as empla e acco ding
o cDNA gene a ed om 80 ng o al RNA. To educe di e ences du ing cDNA
syn hesis s ep, all RNA samples ha e been e e se- ansc ibed simul aneously. In
pa allel, eac ions we e un o de ec genomic DNA con amina ions by using 2 µl o
he p epa ed empla e solu ion desc ibed be o e (see 2.4.5.). Addi ionally, nega i e
con ols by lea ing ou he empla es we e pe o med. S anda d cu es o he AT 1
and endogenous con ols we e gene a ed by ou se ial dilu ions om he cDNA o ß-
ac in and AT 1 and included in each eal- ime PCR un. All hese eac ions we e se
up in Op ical 96 well eac ion pla es om Applied Biosys ems (Fos e Ci y, USA). 96
well pla es we e co e ed wi h Op ical Adhesi e Film Ki om Applied Biosys ems
(Fos e Ci y, USA) and sho ly cen i uged a 22°C and 4000 x g wi h a 96 well pla e
o o adap ed o Cen i uge 5415C (Eppendo , Hambu g, Ge many).
The he mal cycling p o ile (Table 19) was un on he 7300 Real- ime PCR Sys em
connec ed o a Dell Lap op (Applied Biosys ems, Fos e Ci y, USA).
Ma e ials and Me hods

41
S ep Tempe a u e (°C) Time (min) No. o cycles
1
2
3
4
Dissocia ion
s age
95
95
62
68
95
60
95
1:00
0:15
1:00
10:00
0:15
1:00
0:15
1
41
1
1
Table (19): Real- ime PCR he mocycle p og am.
The 7300 Real- ime PCR Sys em is able o de ec luo escence emission be ween
500 nm and 660 nm. The esul ing luo escence is induced du ing RT-PCR by
in e ac ion o SYBR G een wi h he DNA p oduc s o he PCR eac ion. The
quan i ica ion o gene exp ession can be achie ed by plo ing luo escence agains
cycles and compa e he sample signal wi h ha o s anda ds a cycle h eshold.
2.4.9 Analysis o he eal- ime RT-PCR
In his s udy, he exp ession o syn hesized AT 1 was measu ed as ansc ip le els
in issues no malized agains ha o he ß-ac in housekeeping gene. The analysis o
AT 1 gene exp ession was ca ied ou by bo h, absolu e and ela i e quan i ica ion
me hods. The absolu e alues o he a ge ansc ip le els o AT 1 we e no malized
o ha o he e e ence gene ß-ac in. The SBYR G een I (Applied Biosys em) was
used o quan i ica ion o di e en ially exp essed genes. C ( h eshold cycle) alues,
de ined as he ac ional cycle numbe a which he luo escence passes a ixed
alue, we e used o es ima e ela i e concen a ions o a ge sequences (Li ak and
Schmi gen, 2001; P a l, 2001). By measu ing he h eshold alues o samples o
known concen a ion, s anda d cu es we e p oduced. The linea ange o
ampli ica ion ep esen s he ange o e which he loga i hm o he a ge
concen a ion e sus he h eshold alue o ms a linea ela ionship. The slope o he
Ma e ials and Me hods
42
s anda d cu e o e he linea ange was used o de e mine he ampli ica ion
e iciency, using he ollowing equa ion:
E iciency = 10 (-1/Slope) -1
To ensu e ha he exp ession in di e en samples di e ed e y s ongly, long PCR
he mocycle p og ams had been used.
The analysis ook place, he e o e, o all samples ia he s anda d cu e and he
basis line, which is g asped in he eal- ime PCR by he de ice au oma ically du ing
he backg ound phase o he PCR, was se o all 96 well pla es discs au oma ically
by means o he SDS 7300 Sys ems So wa e Applied Biosys ems, Fos e Ci y (USA)
ela ed o he analysis. A e wa ds, he h eshold was se manually o each disc
wi hin he loga i hmically linea phase. In addi ion, he loga i hmic iew in he
ampli ica ion plo was selec ed, in which exclusi ely his phase o he PCR is
ep esen ed. Ou o he s anding cu e gene a ed by he p og am au oma ically on
he basis o he s a copy numbe o each dilu ion, he quan i y in all samples was
calcula ed.
Addi ionally a ela i e quan i ica ion me hod was used. Fo he calcula ion o be alid,
he e iciencies o he a ge and e e ence mus be app oxima ely equal. In ha case
he amoun o a ge DNA p oduc s no malized o an endogenous e e ence con ol
and ela i e o a calib a o , is gi en by 2-∆∆CT (Li ak and Schmi gen, 2001). B ie ly,
∆CT (CT di e alue) is calcula ed o each sample by sub ac ing he a e age CT
alue ob ained om se e al PCR eplica es o an endogenous con ol (in his s udy
ß-ac in) om he a e age c alue ob ained om a ge sequences calib a o (in his
s udy he AT 1). The ∆CT alue ob ained o he calib a o (in his s udy Ringe
con ols) is hen used o calcula e concen a ions in each sample ela i e o he
calib a o .
S eps o calcula ion:
(1) Calib a o = CT goal gene – CT e e ence gene (∆CT calib a o )
(2) Sample = CT goal gene – CT e e ence gene (∆CT e e ence)
(3) CT Sample – CT Calib a o = (∆∆CT)
(4) Rela i e Exp ession = 2-∆∆C
T
Ma e ials and Me hods
43
Wi h goal gene = AT 1; e e ence gene = ß-ac in; sample: dsRNA injec ed; calib a o :
Ringe injec ed con ol.
2.5 Su ey on da a collec ion
The ollowing da a we e eco ded a e gene silencing:
1. Rela i e AT 1 ansc ip le els using RT-PCR in combina ion wi h eal- ime
PCR we e measu ed.
2. Mo ali y among injec ed S. ugipe da la ae and adul s was ollowed.
3. Pa ame e s o la al las ins a de elopmen we e ollowed (la al weigh gain,
p epupa ion, pupa ion, me amo phosis).
4. Hemolymph samples we e collec ed om L5/3, L6/1, L6/2, L6/3, L6/4 la ae
and p epupae and ho mone i e s we e measu ed.
5. Ci cadian hy hms o adul eme gence, ma ing beha iou and copula ion
du a ion we e eco ded.
6. O iposi ion o ma ed emales du ing he i s 10 days o adul li e a e
injec ion o dsRNA was de e mined. Ei he emales o males we e ea ed
di ec ly a e he imaginal moul .
7. O iposi ion o i gin emales du ing he i s 14 days o adul li e a e injec ion
o dsRNA a imaginal moul was eco ded.
8. Hemolymph samples we e collec ed on days 2, 4, 6, and 8 a e ecdysis om
i gin and ma ed emales o JH measu emen s. JH was also quan i ied in he
bu sa copula ix o emales and in he ep oduc i e accesso y glands o he
males be o e and a e ma ing.
9. Egg weigh and la al ha ching a e ea men o he emales o males wi h
dsRNA was obse ed.
2.6 S a is ical analysis
Fo he s a is ical analysis, he Sigma Plo ® e sion 11 (Sys a So wa e Inc. (USA)
was used. No mally dis ibu ed da a we e s a is ically analysed using Mic oso ®
O ice Excel 2003 (Mic oso Co po a ion 2003), hen analysed wi h he s uden ’s -
es in o de o compa e wo es g oups. In he case o no no mally dis ibu ed da a
o when using pe cen age alues a s a is ical analysis wi h he Mann-Whi ney U- es
was used. S a is ical signi ican alues a e ma ked by as e isks and a e shown as:
* = P <0.05; ** = P < 0.01; *** = P < 0.005; **** = P < 0.001.
Ma e ials and Me hods
44
3 Resul s
3.1 E ec s o in i o gene silencing o AT 1 in emales o S.
ugipe da on ansc ip le el in issues, me amo phosis,
ci cadian hy hm o adul eme gence, ep oduc ion and
ho mone le els in he hemolymph
3.1.1 Mo ali y
The i gin emales o S. uigpe da we e ea ed indi idually ei he wi hou ea men , o
injec ed wi h 2 µl noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe on day 1
a e ecdysis. The pe cen age o mo ali y was calcula ed o e 14 days. Few i gin
un ea ed emales died on day 2. Injec ion o dsRNA AT 1 in o he adul s did no cause
any di e ences in he ange and peak o mo ali y in compa ison wi h con ols. The
p o ile o mo ali y in i gin emales is shown in Figu e 1A. The accumula ed mo ali y o
i gin emales a e 14 days was 22.4% o un ea ed emales, 23.1% o Ringe injec ed
con ols and 20.1% o AT 1 gene silenced animals (Figu e 1B).
Resul s
51
(A)
0
10
20
30
40
50
60
8 days 9 days 10 days 11 days 12 days
du a ion [days]
eme gence o emales [%]
Ringe dsRNA AT 1
(B)
0
10
20
30
40
50
60
70
80
8 days 9 days 10 days 11 days 12 days 13 days
du a ion [days]
eme gence o males [%]
Ringe dsRNA AT 1
Figu e (6): Pe cen age o adul emales (A) and males (B) eme gence. Newly eclosed
L6/1 we e injec ed wi h ei he 2 µl noc uid Ringe (n = 28) o 1.5 µg
dsRNA AT 1 in 2 µl noc uid Ringe (n = 23). Pupae we e kep in
asso men boxes and obse ed con inuously.
Resul s

52
S. ugipe da la ae and pupae we e ea ed unde 16 L: 8 D pho ope iod un il
eme gence and ime o adul moul ing was obse ed. 48.3% o he emales om
un ea ed pupae eme ged in he ange o 3 hou s a he end o he pho ophase,
whe eas mos o hem eme ged du ing he ea ly sco ophase wi h a peak a e wo hou s
da kness (Figu e 7). Ringe injec ion caused some di e ences in he ime o adul
emale eme gence compa ed o un ea ed ones. Eme gence was mainly shi ed o he
end o he ligh -phase, and only one hi d o he animals eme ged a he beginning o
he sco ophase. A simila pa e n was obse ed o dsRNA AT 1 injec ed la ae.
0
5
10
15
20
25
30
35
40
08:00
08:30
09:00
09:30
10:00
10:30
11:00
11:30
12:00
12:30
13:00
13:30
14:00
14:30
15:00
ime [hou ]
eme gence o emales [%]
wi hou Ringe dsRNA AT 1
pho ophase
sco ophase
Figu e (7): Pe cen age o eme ging adul emales o S. ugipe da in ela ion o he
ligh -da k cycle (L: D 16: 8 h). 11:00 – 15:00 (MET) ep esen s i s hou s o
sco ophase, 08:00 – 11:00 ep esen s las hou s o he pho ophase. Pupae
we e kep in asso men boxes and eme gence was obse ed e e y 30
minu es. Un ea ed emales n = 29, noc uid Ringe n = 86, and emales AT1
gene silenced n = 23.
16.1% o males eme ged om un ea ed la ae/pupae in he ange o 2.5 hou s a he
end o he pho ophase, whe eas mos o hem eme ged du ing he ea ly sco ophase,
wi h peak eme gence one hou a e ligh o . Ringe injec ion caused some di e ences
Resul s
53
in he ime o adul eme gence compa ed o un ea ed animals. Mos o he males
eme ged 2 hou s be o e he sco ophase, and ano he peak occu ed 30 min a e ligh s
o . The pa e n o eme gence a e AT 1 gene silencing was simila o ha o he
Ringe con ols, bu wi h a sligh shi o he ligh phase (maximum 2 ½ hou s be o e
ligh o ) (Figu e 8).
0
5
10
15
20
25
30
35
40
45
50
08:00
08:30
09:00
09:30
10:00
10:30
11:00
11:30
12:00
12:30
13:00
13:30
14:00
14:30
15:00
ime [hou ]
eme gence o males [%]
wi hou Ringe dsRNA AT 1
pho ophase
sco ophase
Figu e (8): Pe cen age o eme ging adul males o S. ugipe da in ela ion o he ligh -
da k cycle (L: D 16: 8 h). 11:00 – 15:00 (MET) ep esen s i s hou s o
sco ophase, 08:00 – 11:00 ep esen s las hou s o he pho ophase. Pupae
we e kep in asso men boxes and eme gence was obse ed e e y ½ hou .
Un ea ed males n = 65, noc uid Ringe n = 32, and males AT 1 gene
silenced n = 65.
24 + 3 hou s a e adul moul , mo hs s a ed o become ac i e and eeding. The i gin
emales began o ma e wi hin 1 o 2 hou s in he ea ly sco ophase and coupling las ed
o 1.5 o 2 hou s. O iposi ion occu ed in he succeeding sco ophases. Ringe injec ed
emales ma ed be ween 21 o 30 hou s a e eme gence wi h a peak a 24 hou s. AT 1
gene silenced emales s a ed ma ing 23 hou s a e eme gence un il 27 hou s (Figu e
9). The peak o ma ing was shi ed o 25 hou s a e eme gence. Repea ed ma ing
occu ed almos e e y 24 hou s, sho ly be o e o in he ea ly da k phase.
Resul s
54
0
5
10
15
20
25
30
35
40
45
50
21h 22h 23h 24h 25h 26h 27h 28h 29h 30h 31h
ime a e eme gence
ma ing o emales [%]
Ringe dsRNA AT
Figu e (9): E ec o AT 1 gene silencing on ime om eme gence o i s ma ing in
emales o S. ugipe da. F eshly moul ed emales we e injec ed wi h ei he
2 µl o noc uid Ringe (n = 55) o 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe
(n = 67). Each emale was kep indi idually in a box wi h an un ea ed
male. 10% suc ose, wa e and il e pape o egg deposi ion we e
supplied and animals we e obse ed each hou .
Ma ed emales o S. ugipe da s a ed laying eggs 45 o 54 hou s a e eme gence, and
daily o iposi ion was epo ed in his polyand ous mo h (Figu e 10). F om he deposi ed
eggs i s ins a la ae ha ched wi hin 60 o 72 hou s wi h no signi ican di e ences,
nei he in ime no in ha ching a es, be ween AT 1 gene silenced and con ol animals
( esul s no shown).
Resul s
55
0
5
10
15
20
25
30
45h 46h 47h 48h 49h 50h 51h 52h 53h 54h 55h
ime a e eme gence [hou ]
o iposi ion [%]
Figu e (10): Time om eme gence o i s egg laying in un ea ed emales. F eshly
moul ed emales and males we e kep in boxes in 1: 1 a io and 10%
suc ose, wa e and il e pape o egg deposi ion we e supplied. Egg
laying was obse ed each hal hou du ing 2 hou s a he end o
pho ophase and du ing he i s 5 hou s o sco ophase; n = 15.
The ime o i s egg deposi ion in i gin un ea ed emales, i gin Ringe injec ed
emales and i gin AT 1 dsRNA ea ed emales was measu ed. 16.1% o i gin
un ea ed emales, 23.1% o i gins ea ed wi h noc uid Ringe , and 46.7% o i gins
AT 1 gene silenced s a ed o deposi eggs on 2 day a e eme gence (Figu e 11). In
ma ed emales, egg laying on day 2 a e eme gence was gene ally highe han in
i gins. Howe e , he e was no di e ence in i s o iposi ion ime be ween Ringe
injec ed con ols and AT 1 dsRNA ea ed animals, nei he when males (♂) no when
emales (♀) had been ea ed wi h he AT 1 dsRNA. Thus AT 1 gene silencing o
emales induces i gins o deposi mo e eggs ea lie , bu has no e ec in ma ed
emales.
Resul s
56
0
10
20
30
40
50
60
70
80
90
i gin (♀) ma ed (♂) ma ed (♀)
emales [%]
wi hou Ringe dsRNA AT 1
Figu e (11): Pe cen age o i gin and ma ed emales o S. ugipe da ha s a ed egg
deposi ion on day 2 a e eme gence. Vi gin emales we e wi hou
ea men o injec ed wi h 2 µl noc uid Ringe o 1.5 µg dsRNA AT 1 in 2
µl noc uid Ringe . Ma ed (♂): An AT 1 dsRNA ea ed male was kep
oge he wi h an un ea ed emale. Ma ed (♀): An AT 1 dsRNA ea ed
emale was kep oge he wi h an un ea ed male. 10% suc ose, wa e
and il e pape o egg deposi ion we e supplied. n wi hou ea men =
31, Ringe = 52, dsRNA AT 1 = 30.
3.1.4 JH in he hemolymph o la ae
Ju enile ho mone (JH) allows la al moul ing in esponse o ecdys e oids bu p e en s
he swi ching o gene exp ession necessa y o me amo phosis. The JH i e is high a
he ime o las la al moul ing, and hen declines o a e y low o unde ec able le el. In
his wo k, la al pha a e (L5) o S. ugipe da we e injec ed wi h ei he 1.5 µg dsRNA AT
1 in 2 µl noc uid Ringe o 2 µl noc uid Ringe in o an e io pseudopods immedia ely
a e hei moul ing. Figu e 12 A shows ha AT 1 gene silencing in L5/1 la ae had no
e ec on he JH i e o he hemolymph h ee days la e (L5/3: 22.03 ± 6.1 pg/ µl) in
compa ison wi h con ols (18.5 ± 6.3 pg/ µl). JH i e s d opped du ing he ollowing days
o he 6 h la al s age bu , again, no di e ences be ween AT 1 gene silenced animals
and Ringe con ols we e obse ed (L6/1 11.7 ± 5 pg/ µl s.11 ± 0.3 pg/ µl, L6/2 7 ± 2
pg/ µl s. 7 ± 1.4 pg/ µl, L6/3 3.9 ± 0.8 pg/ µl s. 3.4 ± 0.5 pg/ µl). In all cases, JH III was
he main JH homolog and only low amoun s o JH I and JH II we e de ec ed. AT 1 gene
Resul s

57
silencing o L6/1 la ae led o a signi ican educ ion o JH I a he end o he la al s age
(L6/4) (0.1 ± 0.2 pg/ µl compa ed o 1.6 ± 0.9 pg/ µl in he con ols; P < 0.05), whe eas
he JH III i e (71.7 ± 7.9 pg/ µl) was signi ican ly ele a ed in compa ison o con ols
(42.0 ± 0 pg/ µl; P < 0.05). This esul ed in a signi ican ly inc eased o al JH i e in AT 1
gene silenced animals sho ly be o e pupa ion. P epupa (PP1), on he o he hand, did
no show any di e ences be ween he JH i e s o AT 1 gene silenced and con ol
animals (Figu e 12 B). JH i e s we e gene ally highe in wande ing phase (L6/4) and
p epupal s age han in younge 6 h ins a la ae.
(A)
0
5
10
15
20
25
30
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
L5/3 L6/1 L6/2 L6/3
s age/ age [days]
JH homologs [pg/ µl]
Ringe dsRNA AT 1
Resul s
58
(B)
0
10
20
30
40
50
60
70
80
90
JH I JH II JH III JH ( ) JH I JH II JH III JH ( )
L6/4 PP1
s age/ age [days]
JH homologs [pg/ µl]
Ringe dsRNA AT 1
*
*
*
Figu e (12): (A) E ec o AT 1 gene silencing a he i s day o he penul ima e la al
s age (L5/1) on he i e o he JH homologs in 3 day old penul ima e
la ae (L5/3) and in 1 o 3 day old las ins a la ae (L6) o S. ugipe da.
(B) E ec o AT 1 gene silencing a he i s day o he las la al s age
(L6/1) on he i e o he JH homologs in 4 day old las ins a la ae and in
he young p epupa (PP1). Newly eclosed L5/1 and L6/1, espec i ely,
we e injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl
noc uid Ringe . Hemolymph was aken om indi idual la a and JH
homologs we e measu ed by LC-MS. Means ± SEM; n (Ringe , dsRNA
AT 1) = 8 - 10. Mann-Whi ney U- es , as e isks indica e signi ican
di e ences be ween ea men s, * P < 0.05.
3.1.5 Ecdys e oids in he hemolymph o la ae
Pha a e L5 la ae (L5/1) and young las ins a la ae (L6/1) o S. ugipe da we e
injec ed wi h ei he 1.5 µl dsRNA AT 1 in 2 µl noc uid Ringe o 2 µl noc uid Ringe in o
an e io pseudopods immedia ely a e moul ing. Hemolymph samples we e aken om
indi idual la ae e e y 24 hou s (L5/3 o PP1) and concen a ions o ee ecdys e oids
(ecdysone, 20-hyd oxyecdysone) we e measu ed by LC-MS. Ecdys e oid i e s o
penul ima e and las ins a la ae we e no a ec ed by AT 1 gene silencing un il days 3
o he las la al s age, whe eas a s ong inc ease o ee ecdys e oids in wande ing
la ae L6/4 and p epupae was obse ed. L6/4 exhibi ed much highe 20-
Resul s
59
hyd oxyecdysone concen a ions (146.6 ± 34.6 pg/ µl) in compa ison o he con ol (51.6
± 15.3 pg/ µl, P < 0.005). Knockdown o AT 1 gene exp ession also induced a
signi ican inc ease o 20-hyd oxyecdysone (741.6 ± 143.8 pg/ µl s. 326.2 ± 57.3 pg/
µl, P < 0.05) and ecdysone (77.2 ± 14.4 pg/ µl s. 5.03 ± 2.8 pg/ µl, P < 0.001) in he
p epupa (Figu e 13). F ee ecdys e oid i e s we e gene ally highe in wande ing phase
(L6/4) and p epupal s age han in younge 6 h ins a la ae.
0
100
200
300
400
500
600
700
800
900
1000
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
L5/3 L6/1 L6/2 L6/3 L6/4 PP1
s age/age [days]
Ecdys e oids [µg/ µl]
Ringe dsRNA AT 1
****
***
*
Figu e (13): E ec o AT 1 gene silencing on he i e o ee ecdys e oids (ecdysone;
20E = 20-hyd oxyecdysone) in he hemolymph o 3 day old penul ima e
la ae (L5/3), 1 o 4 day old las ins a la ae (L6), and he ea ly p epupal
(PP1) s age o S. ugipe da. Newly eclosed L5/1 and L6/1 we e injec ed
wi h ei he 2 µl noc uid Ringe o 1.5 µl dsRNA AT 1 in 2 µl noc uid Ringe .
Hemolymph was aken om indi idual animals and ecdys e oid
concen a ions we e measu ed by LC-MS. Means ± SEM; n (Ringe ,
dsRNA AT 1) = 8 - 10. Mann-Whi ney U- es , as e isks indica e signi ican
di e ences be ween ea men s, * P < 0.05; ***P < 0.005, ****P < 0.001.
Resul s
60
3.1.6 Body weigh o la ae
The imely onse o me amo phosis in holome abolous insec s depends on eaching he
app op ia e size known as c i ical weigh in he las la al s age. Once c i ical weigh is
eached, ju enile ho mone (JH) i e s decline, esul ing in he elease o
p o ho acico opic ho mone (PTTH) a he nex pho ope iodic ga e and he eby inducing
me amo phosis. The body weigh o la ae L5/1 (97.2 ± 6 mg) inc eased con inuously
and eached a peak in 3 day old las ins a la ae L6/3 (613.8 ± 16.7 mg). The body
weigh hen d opped o lowe alue in he p epupal s age PP (262.9 ± 5.9 mg), and
e en less in pupal s age (no shown). RNA in e e ence in i o by abdominal injec ion o
dsRNA AT 1 in o young penul ima e la ae (L5/1) did no a ec body weigh changes
(Figu e 14).
0
100
200
300
400
500
600
700
800
L5/1 L5/2 L5/3 L6/1 L6/2 L6/3 PP
la al s age
% o gained weigh
Ringe dsRNA AT1
Figu e (14): E ec o AT 1 gene silencing on he body weigh o 1 o 3 day old
penul ima e la ae (L5), 1 o 3 day old las la ae (L6), and he p epupa o
S. ugipe da. Newly eclosed la ae L5/1 we e injec ed ei he wi h 2 µl
noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe in o he las
pseudopodium. The body weigh immedia ely a e he moul in o he
penul ima e la al s age was se o 100% (97.2 ± 6 mg). n (Ringe , dsRNA
AT 1) = 12. Mann-Whi ney U- es . No signi ican di e ences be ween
ea men s.
Resul s
67
o JH III (59.75 ± 15.7 pg/ µl compa ed o 20.3 ± 11.7 pg / µl, P < 0.005 in he con ol)
(Figu e 20).
0
20
40
60
80
100
120
140
160
180
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
JH I JH II JH
III
JH
( )
2d ♀ M 4d ♀ M 6d ♀ M 7d ♀ M 8d ♀ M
age [days]
JH homologs [pg/ µl]
Ringe dsRNA AT 1
** ***
Figu e (20): E ec o AT 1 gene silencing on he i e o he JH homologs in he
hemolymph o 2 o 8 day (d) old ma ed (M) emales o S. ugipe da.
Newly eme ged emales we e injec ed wi h ei he 2 µl noc uid Ringe o
1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe in o he hi d abdominal
segmen . Animals we e ea ed in a 1: 1 a ion wi h un ea ed males and
a new male was added a he 4 h day. Each box was supplied wi h 10%
suc ose, wa e and il e pape o egg laying. Hemolymph was collec ed
om 2 d, 4 d, 6 d, 7d, and 8 d old ma ed emales du ing he i s 3 o 4
hou s o sco ophase. JH i e s we e measu ed by LC-MS. Means ± SEM;
n = 7 - 9 (R), 8 - 10 (dsRNA AT 1). Mann-Whi ney U- es , as e isks
indica e signi ican di e ences be ween ea men s, ** P < 0.01, *** P <
0.005.
3.1.11 Edys e oids in he hemolymph o ma ed emales
Ma ing accele a es he inal s ages o egg ma u a ion and egg laying which may
accele a e he p oduc ion o ecdys e oids in he ollicle cells o he o a y. 20-
Hyd oxyecdysone concen a ion in he hemolymph o ma ed emales was al eady high
a day 2 a e eme gence (15.2 ± 4.8 pg / µl) and luc ua ed he ea e in an age-
dependen manne (4 day old 9.9 ± 5.3 pg / µl, 6 day old 22.8 ± 7.9 pg / µl, 7 day old 5.8
± 3.5 pg / µl, and 8 day old 12.6 ± 3.5 pg / µl). AT 1 gene silencing o ma ed emales
Resul s

68
had only sligh e ec s on he concen a ions o 20-hyd oxyecdysone in he hemolymph
o he animals, whe eas he concen a ion o ecdysone was signi ican ly s imula ed in 7
day old emales (4.6 ± 2 pg / µl compa ed o a alue close o de ec ion limi in he
con ol, P < 0.001) (Figu e 21).
0
5
10
15
20
25
30
35
40
45
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
20 E
ecdysone
2d ♀ M 4d ♀ M 6d ♀ M 7d ♀ M 8d ♀ M
age/ [day]
Ecdys e oids [pg/ µl]
Ringe dsRNA AT 1
***
Figu e (21): E ec o AT 1 gene silencing on he i e o ee ecdys e oids (ecdysone
and 20-hyd oxyecdysone, 20E) in he hemolymph o 2 o 8 day (d) old
ma ed (M) emales o S. ugipe da. F eshly eme ged adul emales we e
abdominally injec ed wi h ei he 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe
o 2 µl noc uid Ringe as a con ol. Animals we e ea ed in a 1: 1 a ion
wi h un ea ed males and a new male was added a he 4 h day. Each box
was supplied wi h 10% suc ose, wa e , and il e pape o egg laying.
Hemolymph was collec ed om 2 d, 4 d, 6 d, 7 d, and 8 d old ma ed
emales du ing he i s 3 o 4 hou s o sco ophase. Ecdys e oids we e
measu ed by LC-MS. Means ± SEM; n = 7 - 9 (R), 8 - 10 (dsRNA AT1).
Mann-Whi ney U- es , as e isks indica e signi ican di e ences be ween
ea men s, *** P < 0.005.
3.1.12 Rep oduc ion o ma ed emales
Ma ed emales laid much mo e eggs han i gin emales (see Figu es 18 and 19). Eggs
we e deposi ed con inuously a e ma ing om day 2 onwa ds wi h a maximum on day 3
(217.2 ± 25.3 eggs), bu egg laying hen declined slowly un il day 9/10. The AT 1 gene
silenced ma ed emales showed a simila o iposi ion p o ile as he Ringe con ols, bu
Resul s
69
he peak on day 3 was signi ican ly highe (345 ± 24 eggs) and a second smalle peak
occu ed on day 7 (Figu e 23 A). AT 1 gene silenced ma ed emales o e all laid 1515 ±
131 eggs compa ed o he Ringe con ol wi h 1113 ± 146 eggs (P < 0.001) (Figu e 23
B). In conclusion, ma ing as well as AT 1 gene silencing d as ically inc eased
o iposi ion.
(A)
0
50
100
150
200
250
300
350
400
0d 1d 2d 3d 4d 5d 6d 7d 8d 9d 10d
age [days]
O iposi ion [eggs/ day]
Ringe dsRNA AT 1
****
****
**
****
Resul s
70
(B)
0
200
400
600
800
1000
1200
1400
1600
1800
Ringe dsRNA AT 1
ea men
O iposi ion [eggs/ emale]
****
Figu e (22): E ec o AT 1 gene silencing on he p o ile o egg laying (A) and on
accumula ed egg deposi ion (B) o ma ed emales o S. ugipe da.
F eshly eme ged emales we e injec ed wi h ei he 2 µl noc uid Ringe o
1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe . Males we e added o he
emales in 1: 1 a io and a new male was added o each emale a day 4.
10% suc ose, wa e , and il e pape we e supplied o egg deposi ion.
Daily laid eggs we e coun ed. Means ± SEM; n (R) = 55, (dsRNA AT1) =
69. Mann-Whi ney U- es , as e isks indica e signi ican di e ences
be ween ea men s, * P < 0.05, **** P < 0.001.
3.1.13 O a y weigh o ma ed emales, weigh o o iposi ed
eggs and ha ching a es
The o a y weigh o ma ed emales o S. uipe da inc eased wi h age o a maximum a
day 7 a e eme gence (60 o 90 mg) (Figu e 23), independen o ea men o he
animals (Ringe injec ion o AT 1 gene silencing). The o a y weigh o con ol emales
inc eased signi ican ly om 23 ± 17.9 mg in 3 day old emales o 90.6 ± 7.6, P < 0.05,
bu no signi ican ly in case o dsRNA AT 1 injec ed emales (41.3 ± 12 mg and 61.8 ±
7.6 mg, espec i ely). Also i inc eased om 34.2 ± 6.1 mg in con ol 5 day old emales
o 90.6 ± 7.6 mg (P < 0.05) in 7 day old ones. dsRNA AT 1 injec ed emales exhibi ed
Resul s
71
an o a y weigh o 20 ± 6 mg in 5 day old animals compa ed o 61.8 ± 7.6 mg (P < 0.05)
in 7 day old ones (Figu e 23).
0
20
40
60
80
100
120
3d 5d 7d
age [days]
O a y weigh [mg]
Ringe dsRNA AT 1
*
***
ns
Figu e (23): E ec o AT 1 gene silencing on he o a y weigh o ma ed emales o S.
ugipe da. F eshly eme ged emales we e injec ed wi h ei he 2 µl noc uid
Ringe o 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe . Males we e added o
he emales in a 1: 1 a io and animals we e supplied wi h 10% suc ose,
wa e , and il e pape o o iposi ion. Noc uid Ringe n = 8, dsRNA AT 1
n= 8. Means ± SEM. Mann-Whi ney U- es , as e isks indica e signi ican
di e ences be ween ea men s, * P < 0.05, ** P < 0.01, ns = no
signi ican .
The weigh o laid eggs was low du ing he i s days o he o iposi ion pe iod (5 o 10
mg pe 100 eggs, ha means an a e age o 75 µg / egg), whe eas olde emales (day 6
o 7 o adul li e) laid hea ie eggs (up o 340 µg / egg). AT 1 gene silencing did no
in luence he weigh o eggs laid by younge emales, whe eas he egg weigh o olde
emales (day 6) was signi ican ly educed (Figu e 24).
Resul s
72
0
5
10
15
20
25
30
35
40
45
2d 3d 4d 5d 6d 7d
weigh o 100 eggs [mg]
Ringe dsRNA AT 1
*
****
*
age [days]
Figu e (24): E ec o AT 1 gene silencing on weigh o laid eggs by ma ed emales o
S. ugipe da. F eshly eme ged emales we e injec ed wi h ei he 2 µl
noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe . Males we e
added in 1: 1 a io o emales and a new male was added a day 4. Wa e ,
10% suc ose, and il e pape we e supplied o o iposi ion. Daily laid eggs
we e coun ed and weighed in po ion o hund ed using p ecise balance.
Noc uid Ringe n = 8, dsRNA AT 1 n = 8. Means ± SEM. Mann-Whi ney U-
es , as e isks indica e signi ican di e ences be ween ea men s, * P <
0.05, **** P < 0.001.
O iposi ion was checked daily and e ili y (% egg ha ching) o eggs laid on days 2 o 7
was de e mined. Pe cen age o ha ching om eggs o ma ed, Ringe injec ed emales
was highes o young emales (87.1 ± 2.2 % o eggs om 2 day old emales), bu
d opped owa ds eggs om olde emales (24.6 ± 8.2 % o eggs om 7 day old
emales). Pe cen age o ha ched eggs deposi ed by ma ed AT 1 gene silenced emales
did no signi ican ly di e om he con ols (Figu e 25), bu he dec ease o % ha ching
om day 2 o day 7 was signi ican ly di e en (P<0.05).
Resul s

73
0
10
20
30
40
50
60
70
80
90
100
2d 3d 4d 5d 6d 7d
% o ha ching eggs
Ringe dsRNA AT 1
*
ns
age [days]
Figu e (25): E ec o AT 1 gene silencing on ha ching o eggs laid by ma ed emales o
S. ugipe da. F eshly eme ged emales we e injec ed wi h ei he 2 µl
noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe . Males we e
added o emales in a 1: 1 a io. 10% suc ose, wa e , and il e pape we e
supplied o o iposi ion. The daily laid eggs om 2 o 7 day old emales
we e coun ed and eggs we e ans e ed o incuba ion con aine s. Eggs
we e obse ed daily o ha ching o i s ins a la ae. Noc uid Ringe n =
8, dsRNA AT 1 n = 8. Means ± SEM. Mann-Whi ney U- es , as e isks
indica e signi ican di e ences be ween ea men s, * P < 0.05; ns, no
signi ican .
3.1.14 Spe ma opho es deposi ed by males
The swi ch om i gin o o iposi ional beha iou o ma ed emales is media ed by he
p esence o spe m and associa ed es icula luids in he bu sa copula ix. The numbe
o deposi ed spe ma opho es in he bu sa copula ix o ma ed emales e lec s he age
o he emale and he numbe o ma ings (Figu e 26). Fi s spe ma opho es we e ound
in he bu sa copula ix o 4 day old emales (younge emales we e no dissec ed) and
he numbe o spe ma opho es inc eased by one daily. Numbe o spe ma opho es was
no a ec ed by AT 1 gene silencing o he emale.
Resul s
74
0
1
2
3
4
5
6
7
8
9
10
0d 1d 2d 3d 4d 5d 6d 7d 8d 9d 10d
age [days]
a e age no o spe ma opho es
Ringe dsRNA AT 1
Figu e (26): E ec o AT 1 gene silencing o emales o S. ugipe da on numbe o
spe ma opho es deposi ed by he male in o he bu sa copula ix o he
emale. F eshly eme ged emales we e injec ed wi h ei he 1.5 µg dsRNA
AT 1 in 2 µl noc uid Ringe o wi h 2 µl noc uid Ringe in o he hi d
abdominal segmen . Un ea ed males we e added o ea ed emales in a
a io o 1: 1. Animals we e ea ed in he p esence o 10% suc ose and
wa e . Females o ce ain age we e dissec ed unde binocula mic oscope.
The spe ma opho es isola ed om he bu sa copula ix we e coun ed.
Noc uid Ringe n = 10, dsRNA AT 1 n = 10. Means ± S.E.M.
In he ollowing expe imen , eshly eme ged emales and males o S. ugipe da we e
injec ed wi h ei he 1.5 µg dsRNA AT 1 in 2 µl noc uid Ringe o wi h 2 µl noc uid Ringe
in o he abdomen and animals we e ea ed unde op imal condi ions. The numbe o
spe ma opho es deposi ed om he male in o he bu sa copula ix o he emale again
inc eased wi h age bu he e we e no di e ences be ween AT 1 gene silenced couples
and Ringe con ol couples (Figu e 27).
Resul s
75
0
2
4
6
8
10
12
0d 1d 2d 3d 4d 5d 6d 7d 8d 9d 10d
age [days]
a e age no o spe ma opho es
Ringe dsRNA AT 1
Figu e (27): E ec o AT 1 gene silencing o emales and males o S. ugipe da on he
numbe o spe ma opho es deposi ed in he bu sa copula ix o he
emales. F eshly eme ged emales and males we e injec ed wi h ei he 1.5
µg dsRNA AT 1 in 2 µl noc uid Ringe o 2 µl noc uid Ringe in o he hi d
abdominal segmen . T ea ed males we e added o ea ed emales in a
a io o 1: 1. Animals we e ea ed in he p esence o 10% suc ose and
wa e . The isola ed spe ma opho es we e coun ed. Noc uid Ringe n = 10,
dsRNA AT 1 n = 10. Means ± SEM.
3.2 In i o gene silencing o AT 1 in males o S. ugipe da and
e ec s on ho mone le el, e ili y and ep oduc ion o
emales ma ed wi h ea ed males
3.2.1 JH in he hemolymph o i gin males
The JH III i e in he hemolymph o i gin males o S. ugipe da was measu ed by LC-
MS. 2 day old males showed a concen a ion o 35.6 ± 11.9 pg / µl. The i e inc eased
o 54.7 ± 14.9 pg / µl in 4 day old males, s ayed mo e o less cons an in 6 day old
males (40.8 ± 9 pg/ µl), bu dec eased owa ds olde males (7 day old: 11.3 ± 11.6 pg /
Resul s
76
µl). Besides JH III he hemolymph o he males con ained conside able amoun s o JH II
and JH III, which, howe e , did no change wi h age excep on day 7 o adul li e. The
o al amoun o JH, he e o e, mainly e lec s changes in JH III. AT 1 gene silencing
induced a signi ican inc ease in JH II in 2 day old males, bu on a low absolu e le el
(2.3 ± 0.5 pg / µl compa ed wi h 5.1 ± 1 pg / µl, P < 0.01 in he con ol). Mo eo e , i
caused a d as ic educ ion o JH III on day 4 (12.7 ± 2.2 pg / µl s. 54.7 ± 14.9 pg / µl, P
< 0.005) and day 6 (16.2 ± 5.5 pg / µl s. 40.8 ± 9 pg / µl, P < 0.05) which is also seen
in o al JH concen a ion (Figu e 28).
0
10
20
30
40
50
60
70
80
90
100
JH
I
JH
II
JH
III
JH
( )
JH
I
JH
II
JH
III
JH
( )
JH
I
JH
II
JH
III
JH
( )
JH
I
JH
II
JH
III
JH
( )
JH
I
JH
II
JH
III
JH
( )
2d ♂ V 4d ♂ V 6d ♂ V 7d ♂ V 8d ♂ V
age [days]
JH homologs [pg/ µl]
Ringe dsRNA AT 1
**
****
***
*
*
Figu e (28): E ec o AT 1 gene silencing on he i e o he JH homologs in he
hemolymph o 2 o 8 day (d) old i gin (V) males o S. ugipe da. F eshly
eme ged males we e injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg
dsRNA AT 1 in 2 µl noc uid Ringe , and wa e and 10% suc ose we e
supplied. JH i e s we e measu ed by LC-MS. Means ± SEM, n = 5-7 (R),
6 (dsRNA AT 1). Mann-Whi ney U- es , as e isks indica e signi ican
di e ences be ween ea men s, * P < 0.05, ** P < 0.01, *** P < 0.005, ****
P < 0.001.
Resul s
83
± 7.7 pg 20E / µl, P < 0.05 and 59.6 ± 32.3 pg E / µl s. 15.5 ± 5.4 pg E / µl, P < 0.005)
(Figu e 35). In 4 day old emales, howe e , a signi ican inc ease in he concen a ion o
20E in he hemolymph was obse ed when emales had been ma ed daily wi h AT 1
gene silenced males (35.3 ± 4.1 pg 20E / µl s. 16.5 ± 3.7 pg 20E / µl, P < 0.005).
0
20
40
60
80
100
120
140
20E ecdysone 20E ecdysone
2d ♀ 1 M 4d ♀ 3 M
Ecdys e oids [pg/µl]
Ringe dsRNA AT 1
****
***
Figu e (35): E ec o AT 1 gene silencing in males on he hemolymph ecdys e oid
i e s o un ea ed emales o S. ugipe da a e ma ing. Newly eme ged
males we e injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg o dsRNA AT
1 in 2 µl noc uid Ringe . Un ea ed emales we e added in a a io o 1: 1 o
he ea ed males. Wa e , 10% suc ose, and il e pape we e supplied o
egg deposi ion. F ee ecdys e oids (ecdysone; 20-hyd oxyecdysone, 20E)
in he hemolymph we e de e mined on day 1 a e ma ing in 2 day old
emales (2 d ♀ 1 M), and in 4 day old emales a e h ee successi e
ma ings (4 d ♀ 3 M). Ecdys e oids we e measu ed using LC-MS. n = 10
o Ringe and dsRNA AT 1. Means ± SEM. Mann-Whi ney U- es ,
as e isks indica e signi ican di e ences be ween ea men s, * P < 0.05,
*** P < 0.005.
3.2.7 Rep oduc ion o emales ma ed wi h AT 1 gene silenced
males
Ma ed emales s a ed o lay eggs on day 2 a e o adul li e and eached a maximum o
mo e han 200 eggs pe day on day 3. O iposi ion a e dec eased in olde emales (see
also Figu e 22 A). AT 1 gene silencing o he males and coupling wi h un ea ed emales
Resul s

84
did no a ec he iming and amoun o egg laying (Figu e 36 A) excep on day 7 o
adul li e, whe e emales ma ed wi h AT 1 gene silenced males laid signi ican ly mo e
eggs han he con ol emales (144.8 ± 16.4 eggs / day s. 99.7 ± 15 eggs / day, P <
0.05). Females ma ed wi h AT 1 gene silenced males laid a o al amoun o 1252.2 ±
107.8 eggs / emale, which is no signi ican ly di e en om emales ma ed wi h Ringe
injec ed con ol males (1210.7 ± 98.8 eggs / emale) (Figu e 36B).
(A)
0
50
100
150
200
250
300
350
0 d 1d 2d 3d 4d 5d 6d 7d
age [days]
O iposi ion [eggs/ day]
Ringe dsRNA AT 1
*
Resul s
85
(B)
1100
1150
1200
1250
1300
1350
1400
1450
Ringe dsRNA AT 1
ea men
O iposi ion [eggs/ emale]
Figu e (36): E ec o AT 1 gene silencing in males on he p o ile o egg laying (A) and
on accumula ed egg deposi ion (B) o S. ugipe da emales ma ed wi h
such males. F eshly moul ed adul males we e injec ed wi h ei he 2 µl
noc uid Ringe o 1.5 µl dsRNA AT 1 in 2 µl noc uid Ringe . Un ea ed
emales we e added in 1: 1 a io o he ea ed males. Animals we e kep
pai ed in boxes, and wa e , 10% suc ose, and il e pape we e supplied
o egg deposi ion. Daily laid eggs we e coun ed. Means ± SEM; n Ringe
= 25, dsRNA AT 1 = 26). Mann-Whi ney U- es , as e isks indica e
signi ican di e ences be ween ea men s, * P < 0.05.
3.2.8 O a y weigh o emales ma ed wi h AT 1 gene silenced
males, weigh o o iposi ed eggs and ha ching
The o a y weigh o 7 day old emales ma ed wi h AT 1 gene silenced males (67.4 ±
19.7 mg) did no di e signi ican ly om he Ringe con ol (46.4 ± 10.7 mg) (Figu e 37).
Resul s
86
0
10
20
30
40
50
60
70
80
90
100
Ringe dsRNA AT 1
7 day old emale
O a y weigh [mg]
Figu e (37): E ec o AT 1 gene silencing in males on he o a y weigh o emales (day
7 o adul li e) ma ed wi h such ea ed males. F eshly moul ed males we e
injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl
noc uid Ringe . Un ea ed emales we e added o he males in 1: 1 a io.
Animals we e kep in boxes, in he p esence o wa e , 10% suc ose, and
il e pape o egg deposi ion. O a ies om 7 day old ma ed emales we e
dissec ed and weighed using p ecise balance. Means ± SEM. Noc uid
Ringe n = 8, dsRNA AT1 n = 8. Mann-Whi ney U- es , no signi ican
di e ences be ween ea men s.
The weigh o eggs laid by emales ma ed wi h Ringe injec ed con ol males o S.
ugipe da was low o young males (day 2 o adul li e) bu inc eased in olde emales.
On day 2 100 eggs weigh an a e age o 9.1 ± 3.8 mg, bu mo e ha 20 mg on day 4
(21.2 ± 4.1 mg) ( P < 0.05). Weigh o eggs laid by 2 o 7 day old emales ma ed wi h AT
1 gene silenced males did no signi ican ly di e om he Ringe con ols, bu he
inc ease in weigh om day 2 o day 3 was signi ican ly di e en (P<0.05) (Figu e 38).
Resul s
87
0
5
10
15
20
25
30
35
2d 3d 4d 5d 6d 7d
age [days]
weigh o 100 eggs [mg]
Ringe dsRNA AT 1
ns
*
Figu e (38): E ec o AT 1 gene silencing on weigh o laid eggs by un ea ed emales
ma ed wi h in AT 1 gene silenced males. F eshly eme ged males we e
injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg dsRNA AT 1 in 2 µl
noc uid Ringe . Un ea ed emales we e added o he males in 1: 1 a io.
Wa e , 10% suc ose, and il e pape o egg deposi ion we e supplied.
Daily laid eggs we e coun ed on days 2 o 7 o adul li e. Eggs o ce ain
days we e weighed in po ion o 100 using p ecise balance. Noc uid
Ringe n = 8, dsRNA AT 1 n = 8. Means ± SEM. Mann-Whi ney U- es , * P
< 0.05; ns, no signi ican .
The pe cen age o la al ha ching om eggs deposi ed by emales ma ed wi h Ringe
injec ed males was high o eggs om young emales (2 day old 56.5 ± 16.2%, 3 day
old 68.4 ± 13 %), bu hen declined (4 day old 31.5 ± 4.4 %, 5 day old 36.14 ± 3.3 %, 6
day old 34.7 ± 7.3 %, and 7 day old 44 ± 8 %). The e is a signi ican di e ence be ween
con ols a day 3 (68.4 ± 13 %) and day 4 (31.5 ± 4.4 %, P < 0.05), bu no signi ican
di e ence be ween AT 1 gene silenced day 3 (59 ± 3.6 mg) and day 4 eggs (43.9 ± 11.6
%) (P < 0.05). The pe cen age o ha ched eggs laid by 2 o 7 day old emales ma ed
wi h AT 1 gene silenced males did no di e om he espec i e Ringe con ols (Figu e
39).
Resul s
88
0
10
20
30
40
50
60
70
80
90
2d 3d 4d 5d 6d 7d
age [days]
ha ched eggs [%]
Ringe dsRNA AT 1
*
ns
Figu e (39): E ec o AT 1 gene silencing o males on he ha ch a e o eggs laid by
un ea ed emales ma ed wi h AT 1 gene silenced males. F eshly ecdysed
males we e injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg dsRNA AT1
in 2 µl noc uid Ringe . Un ea ed emales we e added o he males in 1: 1
a io. Wa e , 10% suc ose, and il e pape o egg deposi ion we e
supplied. Daily laid eggs we e coun ed and ans e ed o incuba ion
con aine s. Eggs we e obse ed daily o ha ching o i s ins a la ae.
Means ± SEM). Noc uid Ringe n = 8, dsRNA AT 1 n = 8. Mann-Whi ney
U- es , as e isks indica e signi ican di e ences, * P < 0.05; ns, no
signi ican .
3.2.9 Spe ma opho es deposi ed by males
The numbe o spe ma opho es dissec ed om he bu sa copula ix o ma ed emales
e lec s he numbe o ma ings. Males o S. ugipe da deposi an a e age o one
spe ma opho e pe 24 hou s. The numbe o spe ma opho es ans e ed o he bu sa
copula ix o he emales inc eased wi h age, bu he e was no di e ence be ween AT 1
gene silenced males and Ringe con ols (Figu e 40).
Resul s

89
0
2
4
6
8
10
12
0d 1d 2d 3d 4d 5d 6d 7d 8d 9d 10d
age [days]
a e age no o spe ma opho es
Ringe dsRNA AT 1
Figu e (40): E ec o AT 1 gene silencing o males o S. ugipe da on he numbe o
spe ma opho es om he bu sa copula ix o emales ma ed wi h such
ea ed males. F eshly eme ged adul males we e injec ed wi h ei he 1.5
µg dsRNA AT 1 in 2 µl noc uid Ringe o 2 µl noc uid Ringe in o he hi d
abdominal segmen a he day o moul ing. Un ea ed emales we e added
o he males in a a io o 1: 1. Animals we e kep in boxes, in he p esence
o 10% suc ose and wa e . The isola ed spe ma opho es we e coun ed in
emales o ce ain age. Noc uid Ringe n = 10, dsRNA AT 1 n = 10. Means
± SEM.
Resul s
90
3.3 In i o gene silencing o alla os a in ype A in males o S.
ugipe da and e ec s on ma e ial ans e ed om he male
o he emale by ma ing
Fo me expe imen s on injec ion o dsRNA a ge ed agains ype-A alla os a in in o adul
emales and males o S. ugipe da had esul ed in a signi ican and speci ic knockdown
o he espec i e mRNA in b ain, o a ies, and gu (Meye ing-Vos e al., 2006; M.
Meye ing-Vos, unpublished) and a e no shown he e.
3.3.1 JH i e s in accesso y glands o i gin and ma ed males
JH, mainly JH I and JH II, we e ound in he accesso y glands (AG) o newly eclosed
males. Concen a ions we e low a he day o eme gence (see Figu e 30) bu inc eased
he ea e . Silencing o he AS A- ype gene in i gin males led o a d as ic inc ease in
he amoun o JH I (and o al JH) in he AG o 1 day old i gin males (56334 ± 4363 pg
JH ( ) / AG compa ed o 35557 ± 4363 pg JH ( ) / AG, P < 0.05 in he con ol and 40778
± 5443 pg JH I / AG compa ed o 21312 ± 3655 pg JH I / AG, P < 0.005 o he con ol)
(Figu e 41). On day 2 a e ecdysis JH concen a ions in he AG o i gin AS ype A
gene silenced males we e no di e en om he con ol.
Resul s
91
0
10000
20000
30000
40000
50000
60000
70000
JH I JH II JH III JH ( ) JH I JH II JH III JH ( ) JH I JH II JH III JH ( )
0d AG 1d AG V 2d AG V
age [days]
JH homologs [pg/ issue]
Ringe dsRNA AS A
*
***
Figu e (41): E ec o AS A- ype gene silencing on he amoun o JH homologs in male
accesso y glands (AG) o i gin (V) males o S. ugipe da. Newly eclosed
males we e injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg o dsRNA AS
A- ype in 2 µl noc uid Ringe . Males we e kep sepa a ed in boxes, and
supplied wi h wa e and 10% suc ose. JH homologs we e ex ac ed om
issues and measu ed using LC-MS. The AG we e analysed om newly
eclosed males (0 d AG), 1 day old i gin males (1 d AG V), and 2 day old
i gin males (2 d AG V). n = 12 o Ringe and dsRNA AS A- ype. Means ±
SEM. Mann-Whi ney U- es , as e isks indica e signi ican di e ences
be ween ea men s, * P < 0.05, *** P < 0.005.
Coupling o a male wi h a emale led o a ans e o JH om he male accesso y gland
o he emale bu sa copula ix (see 3.2.3). The e o e, a e ma ing, he JH i e s ongly
dec eased in he AG o con ol males, bu also in AS A- ype gene silenced males. A gap
in ma ing on day 2 esul ed in a signi ican eloading o he AG wi h JH I and JH II.
Ano he ma ing a day 2 again led o almos comple e deple ion o he AG om JH; P <
0.001). AS ype A gene silencing o he males did no a ec he changes in JH
concen a ions in he accesso y glands (Figu e 42).
Resul s
92
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
JH I JH II JH III JH
( )
JH I JH II JH III JH
( )
JH I JH II JH III JH
( )
JH I JH II JH III JH
( )
0d AG 1d AG 1 M 2d AG1 M 2d AG 2 M
age [days]
JH homologs [pg/ issue]
Ringe
dsRNA AS A
********
ns ns
****
****
Figu e (42): E ec o AS A- ype gene silencing on he amoun o JH homologs in male
accesso y glands (AG) o ma ed (M) S. ugipe da males. Newly eclosed
males we e injec ed wi h ei he 2 µl noc uid Ringe o 1.5 µg o dsRNA
AS-A ype in 2 µl noc uid Ringe . Un ea ed emales we e added o he
males in 1: 1 a io. Wa e and 10% suc ose we e supplied. The isola ed
issues we e homogenized and he JH concen a ions measu ed using
LC-MS. The AG we e analysed om 1 day old males ma ed once (1d AG
1 M), om 2 day old males ma ed once on day 1 (2 d AG 1 M) and om 2
day old males ma ed wice (2 d AG 2 M). Da a o 0 d AG a e om Figu e
41. n = 12 o Ringe and dsRNA AS A- ype. Means ± SEM. Mann-
Whi ney U- es , as e isks indica e signi ican di e ences, **** P < 0.001;
ns, no signi ican .
3.3.2 Ma e ial ans e ed om male o emale by ma ing
F eshly eme ged males con ain a he low amoun s o JH, mainly JH I and JH II, in hei
accesso y glands (AG) (see also Figu e 32). In i gin males, he amoun o JH I and JH
II in he AG inc eased d ama ically om he day o moul ing un il day 2 o adul li e (0 d
AG 2971.1 ± 999.4 pg JH I / AG compa ed o 2 d AG V 26145.1 ± 4937.5 pg JH I / AG,
P < 0.001 and 0 d AG 4516 ± 1447.5 pg JH II / AG compa ed o 2 d AG V 16293 ± 2369
pg JH II / AG, P < 0.001), bu d opped again a e ma ing (2 d AG 2 M 2676 ± 722 pg JH
I / AG, P < 0.001 and 2 d AG 2 M 1564 ± 261 pg JH II / AG, P < 0.001). AS ype A gene
Resul s
99
4.2.1 Mo ali y
In his s udy, penul ima e and las ins a la ae and adul s o S. ugipe da we e
injec ed wi h dsRNA AT 1 o noc uid Ringe a he day o hei moul ing. The injec ed
penul ima e ins a la ae o S. ugipe da no mally moul ed o he las la al s age
and no body weigh changes compa ed o he Ringe injec ed con ols we e
obse ed. Concen a ions o he JH homologs JH I, II, and III (la ae mainly con ain
JH III and only aces o JH I and JH II) as well as concen a ions o ee ecdys e oids
in he hemolymph (ecdysone, 20-hyd oxyecdysone) also did no di e be ween
ea ed and con ol animals. The e o e, i is no su p ising ha no di e ences in he
ood consump ion and mo ali y o hese la ae was obse ed ( esul s a e no
shown). In con a y, injec ions o dsRNA AT 1 in o las ins a la ae led o a
signi ican inc ease in he hemolymph JH III i e as well as in he concen a ion o 20-
hyd oxyecdysone a he end o he la al s age, bu mo ali y and ood in ake o he
animals emained una ec ed.
G ieble e al. (2008) demons a ed ha injec ion o dsRNA in o la ae o S.
ugipe da esul ed in gene ally lowe mo ali y han in o adul animals, bu ha in
bo h de elopmen al s ages he mo ali y a e s ic ly depended on he amoun o
injec ed dsRNA. Mo ali y inc eased a injec ions o 2 µg dsRNA upwa ds, bu we
used no mo e han 1.5 µg in ou expe imen s.
Injec ion o AT 1 pep ide in o penul ima e ins a la ae o S. ugipe da d as ically
educed hei weigh gain and inc eased mo ali y (Oeh e al., 2001). Injec ions o AT
1 pep ide in o las ins a la ae also educed hei weigh gain and inc eased mo ali y
in a dose-dependen manne . Howe e , injec ions o Manse-AS pep ide in o la ae o
bo h la al s ages ha dly a ec ed g ow h, de elopmen and mo ali y o he animals.
Adul i gin emales li ed o abou 14 days, whe eas un ea ed ones showed some
ea lie mo ali y han ea ed ones. Adul males li ed 6 o 8 days and ma ed emales
7 o 10 days. Injec ion o AT 1 pep ide in o adul (ma ed) emales sho ened hei
li espan and dec eased he numbe o iposi ed eggs (Oeh e al., 2001).
4.2.2 La al de elopmen
La al de elopmen is a complex p ocess, inducing beha iou al changes, al e ing o
gene le els, cellula di ision and g ow h, commi men and me amo phosis,
associa ed by a wide ange o oscilla ions in JH and ecdys e oids i e s in he
hemolymph ( o e iew see Nijhou , 1994; Ridd o d, 1996; Gäde e al., 1997).
Discussion

100
Ecdys e oids a e eleased om he p o ho acic glands, while ju enile ho mones a e
syn hesized in he co po a alla a, bo h o hem a e unde neu oho monal con ol. In
summa y, JH allows la al moul ing in esponse o ecdys e oids. High JH i e s in he
hemolymph p e en he swi ching o gene exp ession necessa y o me amo phosis.
A high JH-es e ase (JHE) peak is ound, when la ae ha e eached hei c i ical
weigh o pupa ion, possibly o emo e any emaining aces o JH (B owde , 2001).
The e o e, JH in luences ea ly ac ions o 20E which hen esul s in he p ese a ion
o he ju enile “s a us quo” (Ridd o d, 1996). Mo eo e , 20E deac i a es he
p o ho acic glands in he ea ly i h ins a o lepidop e ans by eedback inhibi ion and
his e ec is media ed by JH (Takaki and Saku ai, 2003). T ea men o las ins a
la ae wi h JH analogs s imula ed supe nume a y la al moul and me amo phosis
was delayed (K emen and Nijhou , 1998).
Ou quan i ica ion o JH i e s in he hemolymph om penul ima e ins a la ae o S.
ugipe da showed ha JH III is he p edominan JH homolog ollowed by JH II,
whe eas JH I was nea ly unde ec able. Highe amoun s o JH a e p esen in he
younge la al s ages, bu JH is absen p io o he moul om pupa o adul . The
hemoylmph JH i e d opped om he penul ima e la al s age L5/1 o he las day o
he las la al s age L6/3, which well ag ees wi h ea lie JH measu emen s by
G ieble e al. (2008). Ano he inc ease in he JH concen a ion o he hemolymph
du ing he p epupal phase was somewha highe (and ea lie ) in ou expe imen s
han desc ibed by G ieble e al. (2008), bu goes in line wi h a d as ic inc ease in he
concen a ion o ee ecdys e oids in he hemolymph o hese animals.
AT 1 gene silencing a he beginning o he penul ima e la al s age had no e ec on
hemolymph i e s o JH and ecdys e oids in he 5 h and 6 h la al s ages.
Consequen ly, he la ae moul ed as usual and de eloped no mally; hei body
weigh showed no di e ences compa ed wi h he Ringe con ol. In con as , injec ion
o AT 1 pep ide wice daily in o S. ugipe da la ae caused signi ican educ ion o
body weigh in he las la ae s age (Oeh e al., 2001), whe eas in i o injec ion o AT
1 pep ide in o six h ins a la ae o L. ole acea had no e ec on la al de elopmen
and ood consump ion (Audsely e al., 2001).
The AT 1 p ep oho mone is exp essed highly in he b ains o he 5 h la al s age, bu
low in L6 la ae and du ing p epupa ion (Abdel-la ie e al., 2004a). The o e all
abundance o he AT 1 mRNA, and also o (Spo ) Manse-AS mRNA, di e s
ma kedly be ween de elopmen al s ages and issues o S. ugipe da (Abdel-la ie e
Discussion
101
al., 2004a). The ime-dependen changes o Spo -AS gene exp ession in la ae and
adul emale b ains (wi h ai ly cons an a es o AT 1 exp ession) co espond o
p e ious measu emen s o he a e o JH biosyn hesis by CA in i o (Range e al.,
2002). The exp ession o Manse-AS in he b ain should be low (and AT 1 gene
exp ession high) when JH biosyn hesis is high and ice e sa (Abdel-la ie e al.,
2004a). Thus, he changes in AT 1 mRNA con i m he JH i e s measu ed by
Wes e lund (2004) and G ieble e al. (2008), which we e high in he L5 s age and
almos diminished in L6/3, bu JH III i e was ele a ed again in L6/4 and p epupa.
Riddi o d (1972) demons a ed ha in holome abolous insec s he JH i e is high
again a he ime o las la al ecdysis (beginning o wande ing phase, ime o
pupa ion), and hen declines o a e y low o unde ec able le el in he pupa.
In con as o AT 1, Spo -AS o Manse-AS exp ession emained high un il he 6 h
la al ins a bu was low du ing pupa ion (Abdel-la ie e al., 2004a). Consis en ly, in
case o Manse-AS gene silencing in L5 la ae, he ansc ip le el was educed in
b ain and gu o las ins a la ae and his supp ession led o an inc eased JH i e in
he animals. As a esul o he ele a ed ho mone i e , he las la al s age was
p olonged. In p epupae, he JH i e dec eased, bu he animals pupa ed and mol ed
no mally (G ieble e al., 2008). These esul s may show ha in he las la al s age
o S. ugipe da exp ession o AS C- ype (Manse-AS) is mo e impo an o he
egula ion o he JH i e in he hemolymph, and he e o e o moul ing a he
app op ia e ime, han he AT 1 gene exp ession. The luc ua ion and in e ac ion o
hese wo neu opep ides du ing la al de elopmen suppo hei dual ole in an ‘on-
o ’ mechanism o con olling JH biosyn hesis (McNeil and Tobe, 2001).
4.2.3 Me amo phosis
In he Lepidop e a, la al–pupal ans o ma ion is achie ed by p ecise changes in he
hemolymph ecdys e oid i e (Suku a e al., 1998) and some neu opep ide ho mones
such as myoinhibi o y pep ide I (MIP I) and c us acean ca dioac i e pep ide (CCAP)
as well (Da is e al., 2003). Me amo phosis is ini ia ed when las ins a la ae each a
c i ical weigh , ollowed by a sudden d op in he hemolymph JH i e 24 h la e .
The eby, he b ain will ge compe en o elease PTTH du ing he succeeding
pho ophase (Nijhou and Williams, 1974a; Riddi o d and T uman, 1978). The
subsequen commi men is induced by a small impulse o ecdys e oids in he
absence o JH. The commi men pulse igge s he wande ing beha iou o he las
Discussion
102
ins a la a and enhances cells o subsequen pupal de elopmen . Ismail e al.
(2000) ha e shown ha JH acid and ecdys e oids a e equi ed o inducing he
change om la al o pupal de elopmen o he Ve son’s gland, de mal glands in M.
sex a, de i ed om epide mal cells. JH acid, he e o e, seems o be also an essen ial
me amo phic ho mone in lepidop e ans. Func ional ailu e in hese p ocesses led o
diapause o ma u e la ae (Nijhou and Williams, 1974b). La al alla ec omy caused
a one day ea lie pupa ion and adul di e en ia ion o he eyes and o ewings
(Kiguchi and Ridd o d, 1978). The e e sed happened when a JH analog (ZR 512)
was applied. Pupal commi men was delayed in a dose-dependen manne (Roun ee
and Bollenbache , 1986).
In ou s udies on S. ugipe da, commi men occu ed on day 5 a e moul ing o he
las la al s age and mos o he animals pupa ed on day 7. The AT 1 gene is
exp essed in he 6 h la al s age o S. ugipe da, whe eas exp ession is low in
p epupae (PP) and in 10 day old pupae (Abdel-la ie e al., 2004a). When L6/1 la ae
we e AT 1 gene silenced in his wo k, we measu ed some di e ences in he
hemolymph i e o JH I and JH III in L6/4 la ae compa ed wi h he con ols. The e
was a educ ion in JH I bu a d as ic s imula ion o JH III, and ha means in o al JH,
in synch ony wi h a peak o ecdys e oids in L6/4 and in he ea ly p epupa (PP1).
Whisen on e al. (1985) sugges ed ha 20E has a s imula o y e ec on JH I and JH
III biosyn hesis in he CA, bu only when glands o m a complex wi h he b ain-
co po a ca diaca. Thus om his li e a u e, i appea s ha he inc ease in CA ac i i y
is elici ed in esponse o he commi men peak o 20-hyd oxecdysone, ac ing
indi ec ly ia he b ain-co po a ca diaca (CC) and esul ing in a pos commi men
inc ease in JH i e ha is impo an o he moul o he pupa. This e-ele a ion o JH
is impo an o p o ec he de eloping pupa om imma u e adul cha ac e is ics. AT 1
gene silencing in L6/1 S. ugipe da la ae in his wo k accele a ed he commi men
impulse o one day (maximum a day 4), as well as he ime o pupa ion (maximum
a day 6). Abdel-la ie e al. (2004a) obse ed an inc ease in AT 1 gene exp ession
owa ds he pupal phase o S. ugipe da, which ag ees wi h he inc ease in JH
du ing pupal moul . La ae which pupa ed wi hou JH indeed showed adul
cha ac e is ics (Cymbo owski and S ola z, 1979). Spa ks e al. (1983) sugges ed ha
his inc ease in JH induces a second peak o JHE ac i i y p io o pupa ion which
keeps JH low o absen du ing he ollowing pupal phase.
Discussion
103
F om hese esul s and he co esponding li e a u e we conclude ha AT 1 pep ide is
equi ed o p ope iming o JH elease in las ins a la ae o S. ugipe da, which is
c ucial o ans o ma ion o he pupa. Howe e , AT 1 gene silencing o he la ae did
no a ec he ime o eme gence o he adul s, which occu ed a day 9 a e pupa ion
o he emales and a day 10 o he males in bo h gene silenced and con ol
animals.
4.2.4 Adul moul ing
Ju enile ho mone (JH) is a key ho mone in egula ion o he insec li e cycle
main aining he la al s a e du ing moul s (Riddi o d, 2008). Howe e , absence o JH
is obse ed du ing he pupal s age (Bombyx mo i; Kinjoh e al., 2007) and
lepidos a in-1, a ype-A alla os a in, disappea ed ea ly in me amo phosis (M. sex a;
Da is e al., 1997).
Ecdys e oids in he absence o JH ac i a e wo classes o genes: one esponsible o
he adul pheno ype and he o he pe mi ing a modi ica ion in he espond o
ecdys e oids (Wang e al., 1995), hus inducing he his olysis o nea ly all la al
issues and he di e en ia ion o he adul s uc u es. Bake e al. (1987) did no ind a
sexual dimo phism in iming o magni ude o JH, JH acid, and ecdys e oid i e s o JH
es e ase ac i i y du ing la al-adul de elopmen o M. sex a, bu in ou expe imen s,
emales o S. ugipe da eme ged one day ea lie han he males. AT 1 gene silencing
o newly eclosed 6 h ins a la ae did no a ec he du a ion o he pupal s age in bo h
sexes.
Ou esul s show a clea ci cadian hy hm o adul eclosion in emales and males o
S. ugipe da. In bo h sexes, adul eme gence was maximal in he ea ly sco ophase.
Adul eme gence hy hm unde (semi)na u al condi ions has been epo ed
p e iously (De e al., 2012). D. melanogas e lies showed a obus hy hm in adul
eme gence, which is coupled ei he o humidi y/ empe a u e o o ligh cycles and
shows seasonal a ia ions. Physiological ci cadian hy hms in insec s ha e been well
documen ed in ela ion o ho mone p oduc ion, pa icula ly ho mones con olling
pos emb yonic de elopmen (Lazza i and Insaus i, 2008). Ho mones such as he
PTTH, ecdys e oids and JH o m a key componen o he ci cadian sys em and a e
p oduced in a hy hmic ashion.
AT 1 gene silencing o 6 h ins a la ae o S. ugipe da did no abolish he ci cadian
hy hm o adul eme gence, bu he maximum o eclosion was shi ed o he la e
Discussion
104
pho ophase. Howe e , simila esul s we e ob ained by me e Ringe injec ion
(con ols) and we assume ha he injec ion s ess migh be esponsible o he sligh
ime-shi in adul eme gence.
4.2.5 Ma ing and ep oduc ion
Gonado opic ho mones (JH and 20E) con ol i ellogenesis, oogenesis and egg
p oduc ion in adul insec s and dopamine may media e hei in e play (G un enko and
Rauschenbach, 2008). In he Lepidop e a, di e ences exis in he ype o ho mones
(ju enile ho mones o ecdys e oids) con olling i ellogenesis, depending on hei
ime o ac ion (las la al ins a , pupa, adul s age) (Ramaswamy e al., 1997).
Many endogenous and exogenous ac o s a ec he ep oduc ion o mo hs
(Ramaswamy e al., 1997). The lepidop e an emale ma ing sys em a ies om s ic
monoand y o s ong polyand y. In he polyand ic S. ugipe da, i ellogenesis akes
place a e adul eme gence and elies on JH as gonado opic signal, while bo h
ecdys e oids and JH a e c ucial o yolk p o ein syn hesis and egg ma u a ion in o he
species.
Se e al mechanisms ha e been sugges ed o he occu ence o polyand y. In he
case o polyand y, males ans e nu ien s in addi ion o he spe m wi h hei
spe ma opho e o he emale. An addi ional eason o polyand y is ha i gin
emales lack hei gonado opic signal and eggs ha ha e been p oduced al eady will
be eabso bed. Du ing copula ion, he male ei he igge s a neu al o humo al
esponse in he emale, hus s imula ing elease o he endogenous gonado opic
signal JH, o JH i sel is ans e ed om he male o he emale du ing ma ing, as i is
in S. ugipe da. Females gain om mul iple ma ing in e ms o inc eased li e ime
o sp ing p oduc ion (A nq is and Nilsson, 2000), and he ans e o addi ional
spe m will inc ease he gene ic a iabili y.
In ou expe imen s, he i gin emales laid abou hal as much eggs as ma ed once.
The swi ch om a i gin emale o a ma ed emale is media ed by he spe m and he
seminal luid in i s bu sa copula ix ha can e ilize he eggs. Mo eo e , a ious o he
subs ances, including JH, a e ans e ed om he male o he emale wi h spe m
du ing copula ion (Edwa d e al., 1995). Howe e , he amoun o JH p esen in a
ma ed insec emale no only depends on he amoun o JH ans e ed om he male
o he emale, bu he CA ac i i y in he emale depends on bo h in e nal and
en i onmen al ac o s, such as he age and de elopmen al s age o he animal,
Discussion

105
pho ope iod, eeding, o nu i ional s a us (Li e al., 2003). Fo ins ance, long day
condi ions induced he p oduc ion o CA s imula o y subs ances (alla o opin) in he
median neu osec e o y cells o he b ain, esul ing in high ac i i y o he CA unde
long day condi ions (Schis oce ca g ega ia; P a and Tobe, 1974), whe eas unde
sho day condi ions he a e o JH biosyn hesis g adually dec eased and became
unde ec able jus p io o a diapause (Lep ino a sa decemlinea a; De Ko e al.,
1987).
In his s udy, we obse ed S. ugipe da emale o sp ing p oduc ion including ime o
copula ion, ma ing in e als, numbe o deposi ed spe ma opho es, and he na u e o
he luid ans e ed om he male accesso y ep oduc i e glands o he bu sa
copula ix o he emale du ing ma ing. Since JH ep esen s a majo componen o
he ans e ed seminal luid, we measu ed whe he gene silencing o ei he he
alla o opin (AT) 1 p ep oho mone o he ype A alla os a in p ep oho mone a ec s
he ep oduc ion a e o he emales.
Animals we e ea ed unde cons an empe a u e and pho ope iodic condi ions
simila o hose encoun e ed in summe in hei na u al habi a . Adul emales s a ed
eeding ac i i ies sho ly be o e he i s sco ophase, and i s ma ing was obse ed
abou 24 hou s a e eme gence and las ed o 1.5 o 2 hou s. AT 1 gene silencing in
he emales e a ded i s ma ing o abou 1 hou . Females ma ed each 24 + 3 hou s,
which was con i med by coun ing he spe ma opho es in he bu sa copula ix. AT 1
gene silencing o emales and males did no a ec he numbe o spe ma opho es
ans e ed o he emale. Howe e , gene silencing agains Manse-AS and Spo -AT
2 o males educed he numbe o spe ma opho es ans e ed o he bu sa copula ix
o he emales compa ed o con ols (G ieble , 2009). Fi s o iposi ion occu ed in he
succeeding sco ophase abou 45 o 55 hou s a e moul ing and 24 hou s a e
ma ing. Ma ed emales s a ed some ea lie wi h egg laying han i gin animals.
Mo eo e , ma ed emales laid abou wice he numbe o eggs han i gin emales,
al hough he o iposi ion pe iod was abou 2 days longe o i gin han o ma ed
animals. AT 1 gene silencing in eshly ecdysed emales had no e ec on he numbe
o eggs deposi ed by i gin animals, whe eas he numbe o laid eggs was
signi ican ly inc eased in ma ed emales. S. Mülle (2012, unpublished) has ecen ly
demons a ed ha he ype o adul ood my a ec he hy hm o egg deposi ion.
The esh weigh o he eggs was highe when eggs had been deposi ed om olde
emales (6 o 8 days a e ecdysis) han om younge ones. These hea ie eggs,
Discussion
106
howe e , showed lowe ha ching a es han hose deposi ed by younge emales.
Such a phenomenon ha eggs om olde emales a e mo e o en in e ile had been
obse ed in se e al o he insec species and may be a esul o inc easing eac i e
oxygen species (ROS) in olde emales.
Zeng e al. (1997) demons a ed ha a highe JH i e in ma ed emales is he main
eason o high i ellogenin and egg p oduc ion in he mo h H. i escens, bu
applica ions o JH o i gin emales could no mimic ma ing. In ano he mo h, Cydia
pomonella, an inc ease in cho iogenesis was induced by JH ea men (Webb e al.,
1999). In M. sex a, egg de elopmen was s imula ed by ma ing as well as by an
adequa e ood supply (Sasaki and Riddi o d, 1984).
Since i ellogenesis and egg p oduc ion in S. ugipe da ely on he JH i e o he
emales (Range e al., 2002), we measu ed he amoun o JH I, II, and III in he
hemolymph o adul emales, bo h in AT 1 gene silenced and in Ringe injec ed
con ols, on ce ain days. JH III biosyn hesis in i o (Range e al., 2002) as well as
JH i e s we e low in newly eclosed adul emales, inc eased as oocy es de eloped
and became maximal a he ime o o iposi ion, bu we e lowe again in olde
emales. Al hough JH III was he p edominan homolog also in adul emales, i e s o
JH I and JH II we e much highe han in he la ae. Absolu e amoun s o JH we e
much highe in he hemolymph o ma ed emales han in unma ed animals, bu he
a ia ion o he JH i e in ime was no di e en be ween he wo expe imen al
g oups. AT 1 gene silencing o eshly ecdysed adul emales led, as expec ed, o a
signi ican dec ease in he concen a ion o JH III in he hemolymph o young (2 day
old) ma ed emales, bu an inc ease in olde animals (day 7). In i gin emales, such
an AT 1 gene silencing e ec was no obse ed be o e days 6/7 a e ecdysis,
whe eas in olde animals (day 8), again an inc ease in JH (JH II in his case) was
obse ed. Consequen ly, AT 1 gene silenced emales s a ed egg deposi ion ea lie
han con ols. The di e ences in JH concen a ions be ween i gin and ma ed
emales oge he wi h he changes in he ci cadian hy hm o eme gence ollowing AT
1 gene supp ession, can explain, a leas in pa , he di e ences in egg o iposi ion o
he emales om ou expe imen al g oups when we assume ha JH is he majo
gonado opic ho mone in S. ugipe da.
Discussion
107
In he ollowing chap e , he ole o JH du ing he ep oduc i e pe iod o emale S.
ugipe da as well as he egula ion o JH biosyn hesis by alla o egula ing
neu opep ides du ing his de elopmen al pe iod will be discussed in mo e de ails.
4.3 E ec o AT 1 gene silencing on S. ugipe da emale
ep oduc ion
Vi ellogenesis and egg e en ion a e independen physiological p ocesses o egg
laying. Yolk p o eins and he cDNA o yolk p o eins we e isola ed om many insec
species and he gene exp ession in he a body and o a y was quan i ied (Chen e
al., 2012).
Vi ellogenesis, he p ocess o yolk p o ein (YP) syn hesis and yolk up ake in o he
oocy es, is con olled by JH and ecdys e oids in e ac ing wi h memb ane ecep o s o
he ollicle cells (Koeppe e al., 1985; Da ey e al., 1993). In mos cases JH alone is no
su icien o up- egula e he exp ession o he Vg genes, bu ecdys e oids and
nu ien s a e necessa y (Ma e al., 1988; Panai o and Sco , 2006). In he Dip e a, a
peak o ecdysone is no iced du ing i ellogenesis (G au e al., 1995).
The o a ies a e he majo sou ce o ci cula ing ecdys e oids, bu a leas in some
cases he o a ies can also syn hesize JH III om a nesoic acid (Bellés e al., 1987,
Bo o sky e al., 1994a; Bo o sky e al., 1994b; Romana e al., 1995). A model
sys em o he ela ionship be ween JH p oduc ion and oocy e g ow h and ma u a ion
was p esen ed by S ay and co-wo ke s (S ay and Tobe, 1978; Tobe, 1980; S ay e
al., 1983). In cock oaches and many o he insec species, he young de elopmen al
s ages o he o a y a e di ec ly esponsible o an inc ease in JH biosyn hesis by he
CA (Ranking and S ay, 1984). JH, ci cula ing in he hemolymph, syn hesized by he
CA, is equi ed o oocy e ma u a ion and o he p oduc ion o i ellogenins in he a
body and hei up ake in o he g owing o a ies. All de elopmen al changes seem o
be a ec ed by nu i ional signals and may dependen on a ma ing s imulus
(Engelmann, 1979; Ha le e al., 2000; Li e al., 2003b). The ac ion o JH will depend
on he p esence o he espec i e alla o egula ing neu opep ides (Yin and S o olano,
1997). An imbalance in he gonado opins may lead o ep oduc i e de ec s such as
o iposi ion a es o deg ada ion o i ellogenic oocy es (G un enko e al., 2005;
G un enko and Rauschenbach, 2008).
In he o de o he Lepidop e a some di e ences exis in he iming and he ype o
ho mones in ol ed in i ellogenesis (see abo e). In S. ugipe da, a single emale-
Discussion
108
speci ic p o ein, likely o be he S. ugipe da i ellogenin (Vg), appea ed
app oxima ely 5 h a e adul eclosion in he hemolymph o i gin emales (So ge e
al., 2000). This p o ein was also p esen in egg ex ac s, bu absen in male
hemolymph. Vi ellogenic oocy es became isible 36 o 48 h a e eme gence and egg
deposi ion began on day 3 o adul li e. Vi ellogenesis s ic ly depended on JH, bu
was modi ied by he p esence o ee ecdys e oids.
In his wo k, we measu ed ju enile ho mone and ecdys e oid i e s in he hemoymph
o 2, 4, 6, 7 and 8 day old i gin and ma ed AT 1 gene silenced and con ol emales
o S. ugipe da. In he hemolymph o i gin and ma ed emales JH III was he
p edominan homolog ollowed by JH II, whe eas JH I was ha dly de ec able. In i gin
emales, hemolymph JH i e s we e low a eme gence, bu inc eased he ea e and
eached a maximum on day 2, he ime o i s egg laying. AT 1 gene silencing in
i gin emales had no e ec on he o al numbe o deposi ed eggs. This is in line wi h
he obse a ion ha no clea e ec o he gene supp ession on hemolymph JH in
young i gin emales was measu ed, whe eas he amoun o ee ecdys e oids was
inc eased on day 4 and day 8 a e eme gence. A e ma ing, JH i e s inc eased
signi ican ly. 48 hou s a e eme gence JH i e was 3- imes highe han ha in 2 day
old i gin emales, i.e. ma ing s imula ed JH p oduc ion, esul ing in a signi ican
inc ease in egg p oduc ion. Thus, ma ing p o ided co ec s imuli o enhanced
oogenesis and egg laying, and his was co ela ed wi h a d as ic ele a ion in he
hemolymph JH i e . Simila esul s we e ob ained by Edwa ds e al. (1995), who
ha e demons a ed ha i gin emales o L. ole acea exhibi much lowe JH i e s
han ma ed emales. The e o e, one would expec ha he AT 1 pep ide, which was
shown o ha e alla o opic ac ion in i o on JH biosyn hesis in he CA, would be
impo an in inc easing he JH i e and egg p oduc ion in adul emales.
Consis en ly, in young adul ma ed emales (day 2) o S. ugipe da, AT 1 gene
silencing induced a signi ican educ ion o JH III o nea ly a qua e o ha in ma ed
con ol emales, whe eas 20-hyd oxyecdysone was ele a ed. Su p isingly, howe e ,
o al o iposi ion signi ican ly inc eased compa ed o con ols, abou 3- old o he
numbe o eggs deposi ed by i gin un ea ed emales, and wice o ha o ma ed
con ols. The p o ile o deposi ed eggs shows ha mos o his inc ease in egg
deposi ion occu ed be ween days 2 and 5 o adul li e. In 7 day old emales ano he
signi ican peak o egg laying coincided wi h an ele a ion o hemolymph JH III and
ecdys e oids, and may be a esul o “ eju ena ion”.
Discussion
115
5 Summa y
The all a mywo m, Spodop e a ugipe da, is an ag icul u al impo an pes species.
In o me s udies, ou alla o egula ing neu opep ides had been cloned om S.
ugipe da, AT 1 o Manse-AT, Manse-AS, AS A- ype and Spo - AT 2, bu only one
has been ex ac ed om he b ain o he mo hs, Manse-AT. The unc ioning o he
pleio opic alla o egula ing neu opep ides in la ae and adul a mywo ms is s ill
un esol ed.
In he p esen s udy, we analysed he de elopmen o penul ima e and las ins a
la ae, me amo phosis, ma ing beha iou , and e ili y o he mo hs o S. ugipe da,
ega ding o he ole o alla o egula ing neu opep ides, wi h special emphasis on
Spo -AT 1 (Manduca sex a alla o opin) and AS A- ype (FGLamides) alla os a ins in
hese p ocesses.
RNA in e e ence (RNAi) has been p o ed o induce a sys emic and speci ic gene
knockdown in la ae and adul s o S. ugipe da, and has been used o he analysis
o gene unc ions. Ju enile ho mone (JH) and ecdys e oid i e s (ecdysone, E and
20-hyd oxyecdysone, 20E) in he hemolymph o he animals as well as he amoun s
o JH in he male accesso y glands and in he emale bu sa copula ix we e
measu ed by liquid ch oma og aphy-mass spec ome y (LC-MS).
AT 1 gene knockdown in eshly ecdysed las ins a la ae induced accele a ion o
p epupal commi men and pupa ion o abou 24 hou s compa ed o Ringe ea ed
con ols, whe eas du a ion o he pupal s age was no a ec ed. Adul eme gence
showed a clea ci cadian hy hm wi h maximal numbe o ecdysing mo hs a he end
o he pho ophase and beginning o sco ophase.
The ju enile ho mone i e in he hemolymph o penul ima e (L5) and las ins a
la ae (L6) d opped om a high alue a L5/3 o a low alue a L6/3, bu inc eased
again owa ds pupa ion (L6/4 and PP 1). JH III was he main JH homolog in all la ae
and only aces o JH I and JH II we e de ec ed. AT 1 gene silencing a he beginning
o he las la al s age led o a signi ican inc ease in he amoun o JH III and 20E in
he hemolymph o wande ing la a (L6/4). AT 1 gene knockdown did no a ec he
inc ease in body weigh du ing la al de elopmen .
Summa y

116
In emale adul mo hs, ma ing led o a signi ican inc ease in hemolymph JH i e s
compa ed o i gin animals. Besides JH III he hemolymph o adul emales con ains
conside able amoun s o JH I and JH II. Co espondingly o changing JH i e s,
ma ed emales laid abou wice numbe o eggs han i gin animals. AT 1 gene
silencing immedia ely a e eme gence dec eased he amoun o JH bu inc eased
he i e o ee ecdys e oids in he hemoylmph o i gin animals, whe eas he numbe
o p oduced eggs was only sligh ly a ec ed. In con as , AT 1 gene silencing in
combina ion wi h ma ing led o a signi ican inc ease in egg p oduc ion and
o iposi ion. Egg ha ching a es we e high o eggs laid by young emales, bu low o
eggs om olde emales.
Quan i ica ion o he amoun o JH in he male accesso y ep oduc i e glands as well
as in he emale bu sa copula ix ollowing ma ing clea ly con i med a ans e o JH,
mainly JH I and JH II, om he male o he emale du ing coupling. Abou 24 hou s
a e ma ing, JH disappea ed om he emale bu sa copula ix and could be ound in
he hemolymph. F om hese esul s we conclude ha JH om he males ac s as ue
gonado opin in emales o S. ugipe da. AT 1 gene silencing in eshly eme ged
males had only sligh e ec s o he ans e o JH om he male o he emale du ing
ma ing, and he numbe o eggs laid by emales ma ed wi h such ea ed males was
no a ec ed.
Injec ion o dsRNA a ge ed agains he p ep oho mone o he A- ype alla os a ins
(FGLamides) in o eshly eme ged males also did no a ec he amoun o JH
ans e ed om he male o he emale du ing coupling.
Summa y
117
6 Zusammen assung
De Hee wu m, Spodop e a ugipe da, s ell einen wich igen Schädling in de
Landwi scha da . In ühe en Un e suchungen haben wi ie alla o egulie ende
Neu opep id-P äp oho mone klonie , AT 1 ode Manse-AT, Manse-AS, AS om Typ
A und Spo -AT 2. Nu eines de Pep ide (Manse-AT) konn e aus dem
Obe schlundganglion de Fal e ex ahie we den. Die Funk ionen de pleio open
alla o egulie enden Neu opep ide bei La en und adul en Fal e n sind wei gehend
unkla .
In de o liegenden A bei wu de die En wicklung im o le z en und le z en
La ens adium, die Me amo phose, sowie das Paa ungs e hal en und die Fe ili ä
de adul en Fal e bezüglich de Rolle alla o egulie ende Neu opep ide un e such ,
mi besonde e Be ücksich igung on Spo -AT 1 (Manduca sex a Alla o opin) und
Alla os a inen om Typ A (FGLamide) au diese P ozesse.
RNA In e e enz (RNAi) wu de als Me hode mi sys emischem E ek und spezi ische
Wi kung bei La en und Adul en e aluie und zu Un e suchung de Funk ionen
alla o egulie ende Neu opep ide eingese z . Ju enilho mone (JH) und eie
Ecdys e oide (Ecdyson, E und 20-Hyd oxyecdyson, 20E) in de Hämolymphe de
Tie e sowie in den männlichen Akzesso ischen D üsen und in de Bu sa copula ix
de Weibchen wu den mi els Flüssigkei sch oma og aphie-Massenspek ome ie
(LC-MS) quan i izie .
Supp ession de Exp ession on AT 1 im le z en La ens adium beschleunig e den
Übe gang om le z en La ens adium zu Puppenen wicklung sowie die Ve puppung
um 24 S unden gegenübe Kon oll ie en. Die Daue des Puppens adiums wu de
hingegen nich beein luss . Die adul en Tie e schlüp en in einem deu lichen
Tages hy hmus, mi höchs en Schlup a en zum Ende de Lich phase und zu Beginn
de Dunkelphase.
De JH-Tie in de Hämolymphe on La en des o le z en (L5) und le z en (L6)
La ens adiums äll on einem hohen We am 3. Tag des 5. La ens adiums (L5/3)
kon inuie lich bis zum 3. Tag des 6. La ens adiums (L6/3) ab, s eig zu
Wande phase und P äpuppe hin abe wiede an (L6/4 und PP1). JH III s ell das
Zusammen assung
118
wich igs e JH-Homologe in den La en da , JH I und JH II e en nu in Spu en au .
AT 1 Knockdown zu Beginn des le z en La ens adiums üh e zu einem signi ikan en
Ans ieg an JH III und 20E in de Hämolymphe de Wande la e (L6/4), beein luss e
abe nich das Wachs um de La en.
Bei adul en Weibchen üh e Ve paa ung zu einem signi ikan en Ans ieg im JH-Ti e
de Hämolymphe im Ve gleich zu un e paa en Tie en. Neben JH III inde man in
e paa en Tie en be äch liche Mengen an JH I und JH II. En sp echend den
Ve ände ungen im JH-Ti e legen e paa e Weibchen e wa doppel so iele Eie ab
wie un e paa e Tie e. AT 1 Geninak i ie ung unmi elba nach de Adul häu ung
üh e bei un e paa en Weibchen zu einem Ab all im JH-Ti e de Hämolymphe,
abe zu einem Ans ieg im Gehal an eien Ecdys e oiden. Die Eip oduk ion wu de
nich beein luss . Bei e paa en Tie en ha e AT 1 Gensupp ession hingegen einen
signi ikan en Ans ieg bei de Eiablage zu Folge. Aus on jungen Weibchen
abgeleg en Eie n schlüp en signi ikan meh E s la en als aus Eie n, die on äl e en
Weibchen s amm en.
Aus de Menge an JH in den männlichen Akzesso ischen D üsen und in de
weiblichen Bu sa copula ix o und nach de Ve paa ung kann ein T ans e on JH I
und JH II om Männchen zum Weibchen bei de Kopula abgelei e we den. E wa 24
S unden nach de Ve paa ung e schwand JH wiede aus de Bu sa copula ix und
auch e in de Hämolymphe de Weibchen au . Aus diesen E gebnissen kann
ge olge we den, dass JH aus den Männchen als ech es Gonado opin bei den
Weibchen ungie .
AT 1 und AS-Typ A (FGLamide) Gens illegung bei isch geschlüp en Männchen
beein luss en den JH-T ans e om Männchen zum Weibchen nu ge ing ügig und
ha e keinen Ein luss au die Eip oduk ion und –ablage de Weibchen.
Zusammen assung
xiii
7 Re e ences
Abdel-la ie M., Meye ing-Vos M., and Ho mann K.H. (2003). Molecula
cha ac e isa ion o cDNAs om he all a mywo m Spodop e a ugipe da encoding
Manduca sex a alla o opin and alla os a in p ep oho mone pep ides. Insec
Biochemis y and Molecula Biology 33: 467–476.
Abdel-la ie M., Meye ing-Vos M., and Ho mann K.H. (2004a). Exp ession and
localiza ion o he Spodop e a ugipe da alla o opin (Spo -AT) and alla os a in
(Spo -AS) genes. A chi es o Insec Biochemis y and Physiology 55: 188-199.
Abdel-la ie M., Meye ing-Vos M., and Ho mann K.H. (2004b). Type-A alla os a ins
om he all a mywo m, Spodop e a ugipe da: Molecula cloning, exp ession and
issue-speci ic localiza ion. A chi es o Insec Biochemis y and Physiology 56: 120-
120-132.
Abdel-la ie M., Meye ing-Vos M., and Ho mann K.H. (2004c). Cha ac e iza ion o a
no el pep ide wi h alla o opic ac i i y in he all a mywo m Spodop e a ugipe da.
Regula o y Pep ides 122: 69-78.
Abdel-la ie M., and Ho mann K.H. (2010). Neu opep ide egula o s o he ju enile
ho mone biosyn hesis (in i o) in he bee le, Teneb io moli o (Coleop e a:
Teneb ionidae). A chi es o Insec Biochemis y and Physiology 74: 135- 146.
Adams T.S., and Filipi P.A. (1988). In e ac ion be ween ju enile ho mone, 20-
hyd oxyecdysone, he co pus ca diacum alla um complex, and he o a ies in
egula ion o i ellogenin le els in he house ly, Musca domes ica. Jou nal o Insec
Physiology 34: 11-19.
Allen C.E., Zwaan B.J., and B ake ield P.M. (2011). E olu ion o sexual dimo phism
in he Lepidop e a. Annual Re iew o En omology 56: 445-464.
A nq is R., and Nilsson T. (2000). The e olu ion o polyand y: Mul iple ma ing and
emale i ness in insec s. Animal Beha iou 60: 145–164.
Auboeu D., and Vidal H. (1997). The use o he e e se ansc ip ion-compe i i e
polyme ase chain eac ion o in es iga e he in i o egula ion o gene exp ession in
small issue samples. Analy ical Biochemis y 245: 141–148.
Audsley N., Wea e R.J., and Edwa ds J.P. (1998). Enzyme linked immunoso ben
assay o Manduca sex a alla os a in (Mas-AS), isola ion and measu emen o Mas-
AS immuno eac i e pep ide in Lacanobia ole acea. Insec Biochemis y and
Molecula Biology 28: 775–784.
Audsley N., Mcin osh C., and Philips J. E. (1992). Isola ion o a neu opepi ide om
locus co pus ca diacum which in luences ileal anspo . Jou nal o Expe imen al
Biology 173: 261–274.
xi
Audsley N., Wea e R.J., and Edwa ds J.P. (2000a). Ju enile ho mone biosyn hesis
by co po a alla a o la al oma o mo h, Lacanobia ole acea, and egula ion by
Manduca sex a alla os a in and alla o opin. Insec Biochemis y and Molecula
Biology 30: 681–689.
Audsley N., Du e H., Tho pe A., and Wea e R.J. (2000b). Mo phological and
physiological compa isons o wo ypes o alla os a in in he b ain and e oce eb al
complex o he oma o mo h, Lacanobia ole acea (Lepidop e a: Noc uidae). The
Jou nal o Compa a i e Neu ology 424: 37–46.
Audsley N., Wea e R.J., and Edwa ds J. (2001). In i o e ec s o Manduca sex a
alla os a in and alla o opin on la ae o he oma o mo h, Lacanobia ole acea.
Physiological En omology 26: 181-188.
Audsley N., and Wea e R. (2003a). Iden i ica ion o neu opep ides om b ains o
la al Manduca sex a and Lacanobia ole acea using MALDI-TOF mass spec ome y
and pos -sou ce decay. Pep ides 24: 1465–1474.
Audsley N., and Wea e R.J. (2003b). A compa ison o he neu opep ides om he
e oce eb al complex o adul male and emale Manduca sex a using MALDI-TOF
mass spec ome y. Regula o y Pep ides 116: 127– 137.
Aue swald L., Bi gül N. l., Gaede G., K eienkamp H.-J., and Rich e D. (2001). On
s uc u al, unc ional, and e olu iona y cha ac e iza ion o no el membe s o he
alla os a in ecep o amily om insec s. Biochemical and Biophysical Resea ch
Communica ions 282: 904–909.
Bake F.C., Tsali L.W., Reu e C.C., and Schooley D.A. (1987). In i o luc ua ion o
JH, JH acid, and ecdys e oid i e , and JH es e ase ac i i y, du ing de elopmen o
i h s adium Manduca sex a. Insec Biochemis y 17: 989-996.
Bellés X., Messegue C.A., and Piulachs M.D. (1987). In i o biosyn hesis o JH III
by he copo a alla a o adul emales o Bla ella ge manica (L). Insec Biochemis y
17: 1007-1010.
Bellés X., Maes o J.L., Piulachs M.D., Johnsen A.H., Du e H., and Tho pe A.
(1994). Alla os a ic neu opep ides om he cock oach Bla ella ge manica (L.)
(Dic yop e a: Bla ellidae). Iden i ica ion, immunolocaliza ion and ac i i y. Regula o y
Pep ides 53: 237–247.
Bellés X. (2010). Beyond D osophila: RNAi in i o and unc ional genomics in
insec s. Annual Re iew o En omology 55: 111-128.
Bendena W.G., Ga side. S., Yu C.G., and Tobe S.S. (1997). Alla os a ins: Di e si y
in s uc u e and unc ion o an insec neu opep ide amily. Annals New Yo k Academy
o Sciences 814: 53- 66.
Blackbu n M.B., Wagne R.M., Kochansky J.P., Ha ison D.J., Thomas-Laemon P.,
and Raina A.K. (1995). The iden i ica ion o wo myoinhibi o y pep ides, wi h

x
sequence simila i ies o he galanins, isola ed om he en al ne e co d o
Manduca sex a. Regula o y Pep ides 57: 213-219.
Blackbu n M.B., Ja e H., Kochansky J., and Raina A.K. (2001). Iden i ica ion o ou
addi ional myoinhibi o y pep ides (MIPs) om he en al ne e co d o Manduca
sex a. A chi es o Insec Biochemis y and Physiology 48:121–128.
Bogus M.I., and Cymbo owski Y.B. (1984). Induc ion o supe nume a y moul s in
Galle ia mellonella: E idence o an alla o opic unc ion o he b ain. Jou nal o
Insec Physiology 30: 557-561.
B oeck J.V. (2001). Neu opep ides and hei p ecu so s in he ui ly, D osophila
melanogas e . Pep ides 22: 241-254.
Bo o sky D., Ca lson D.A., Hancock R., Rembold G.H., and Handel E.V. (1994a).
De no o biosyn hesis o ju enile ho mone III and I by he accesso y glands o he
male mosqui o. Insec Biochemis y and Molecula Biology 24: 437- 444.
Bo o sky D., Ca lson D. A., Uj i y I., and P es wich G. D. (1994b). Biosyn hesis o
(IOR)-ju enile ho mone III om a nesoic acid by Aedes aegyp i o a y. A chi es o
Insec Biochemis y and Physiology 27:11-25.
Bo s D.W., Lau e H., Ma ew L., Chang E.S., He z W., Bake F.C., and Schooly
D.A. (1987). Me hyl a nesoa e and i s ole in c us acean ep oduc ion and
de elopmen . Insec Biochemis y 17: 1123-1127.
B owde M.H., D'Amico L.J., and Nijhou H.F. (2001). The ole o low le els o
ju enile ho mone es e ase in he me amo phosis o Manduca sex a. Jou nal o Insec
Science 1: 11.
B own M.R., C im J.W., A a a R.C., Cai H.N., Chun C., Shen P. (1999). Iden i ica ion
o a D osophila b ain-gu pep ide ela ed o he neu opep ide Y amily. Pep ides 20:
1035–1042.
B own M.R., Siegla D.H., and Rees H.H. (2009). Gonadal ecdys e oidogenesis in
A h opoda: Occu ence and egula ion. Annual Re iew o En omology 54: 105-125.
Bus in S.A. (2000). Absolu e quan i ica ion o mRNA using eal- ime e e se
ansc ip ion polyme ase chain eac ion assays. Jou nal o Molecula Endoc inology
25: 169-193.
Chen S.-L., Lin C.-P., and Lu K.-H. (2012). cDNA isola ion, exp ession, and
ho monal egula ion o yolk p o ein genes in he o ien al ui ly, Bac oce a do salis
(Hendel) (Dip e a: Teph i idae). Jou nal o Insec Physiology 58: 763–770.
Cispe G., Ze a A.J., and Bo s D.W. (2000). Ju enile ho mone i e and mo ph-
speci ic ep oduc ion in he wing polymo phic c icke , G yllus i mus. Jou nal o Insec
Physiology 46: 585–596.
x i
Cispe G., Ze a A.J., and Bo s D.W. (2000). Ju enile ho mone i e and mo ph-
speci ic ep oduc ion in he wing polymo phic c icke , G yllus i mus. Jou nal o Insec
Physiology 46: 585–596.
Cla k L., Lange A.B., Zhang J.R., and Tobe S.S. (2008). The oles o Dippu-
alla os a in in he modula ion o ho mone elease in Locus a mig a o ia. Jou nal o
Insec Physiology 54: 949-958.
Co ne e R., Koshikawa S., and Miu a T. (2008). His ology o he ho mone-p oducing
glands in he dampwood e mi e Hodo e mopsis sjos ed i (Isop e a, Te mopsidae): A
ocus on soldie di e en ia ion. Insec es Sociaux 55: 407-416.
Cusson M., Delisle J., and Mille D. (1999). Ju enile ho mone i e s in i gin and
ma ed Cho is oneu a umi e ana and C. osaceana emales: Assessmen o he
capaci y o males o p oduce and ans e JH o he emale du ing copula ion. Jou nal
o Insec Physiology 45: 637–646.
Cymbo owski B., and S ola z G. (1979). The ole o ju enile ho mone du ing la al-
pupal ans o ma ion o Spodop e a li o alis: Swi cho e in he sensi i i y o he
p o ho acic gland o ju enile ho mone. Jou nal o Insec Physiology 25: 939-942.
Da ey K.G., Se ala V.L., and Go don D.R.B. (1993). The ac ion o ju enile ho mone
and an igonado opin on he ollicle cells o Locus a mig a o ia. In e eb a e
Rep oduc ion and De elopmen 23: 189–193.
Da ey K.G. (1997). Ho monal con ols on ep oduc ion in emale He e op e a.
A chi es o Insec Biochemis y and Physiology 35: 443–453.
Da ey M., Du e H., Tho pe A., and Eas P. (1999). Cha ac e isa ion o he
helicos a in pep ide p ecu so gene om Helico e pa a mige a (Lepidop e a:
Noc uidae). Insec Biochemis y and Molecula Biology 29: 1119–1127.
Da ey K.G. (2000). The modes o ac ion o ju enile ho mones: some ques ions we
ough o ask. Insec Biochemis y and Molecula Biology 30: 663–669.
Da is N.T., Veens a J.A., Feye eisen R., and Hildeb and J.G. (1997). Alla os a in-
like-immuno eac i e neu ons o he obacco ho nwo m. Manduca sex a, and isola ion
and iden i ica ion o a new neu opep ide ela ed o cock oach alla os a ins. The
Jou nal o Compa a i e Neu ology 385: 265- 284.
Da is N.T., Blackbu n M.B., Golube a E.G., and Hildeb and J.G. (2003). Localiza ion
o myoinhibi o y pep ide immuno eac i i y in Manduca sex a and Bombyx mo i, wi h
indica ions ha he pep ide has a ole in moul ing and ecdysis. The Jou nal o
Expe imen al Biology 206: 1449- 1460.
De J., Va ma V., Sha ma V.K. (2012). Adul eme gence hy hm o ui lies
D osophila melanogas e unde semi-na u al condi ion. Jou nal o Biological Rhy hms
27:280–286.
x ii
De Ko C.A.D., and G ange N.A. (1981). Regula ion o he ju enile ho mone i e .
Annual Re iew o En omology 26:1-28.
De Ko C.A.D., Khan M.A., and Koopmanschap A.B. (1987). Ju enile ho mone and
he con ol o adul diapause in he Colo ado po a o bee le, Lep ino a sa
decemlinea a. Insec Biochemis y 17: 985-988.
Dub o sky E.B., D b o skaya V.A., and Be ge E.M. (2002). JH signalling du ing
oogenesis in D osophila melanogas e . Insec Biochemis y and Molecula Biology
32: 1555-1565.
Du e H., Johnsen A.H., Maes o J.L., Sco A.G., C ook N., Wins anley D., and
Tho pe A. (1997a). Iden i ica ion, issue localisa ion and physiological e ec in i o o
a neu oendoc ine pep ide iden ical o a dip e an Leu-calla os a in in he codling mo h
Cydia pomonella (To icidae: Lepidop e a). Cell and Tissue Resea ch 289: 73–83.
Du e H., Johnsen A.H., Maes o J.L., Sco A.G., Ja os P.P., and Tho pe A. (1997b).
Isola ion and iden i ica ion o mul iple neu opep ides o he alla os a in supe amily in
he sho e c ab Ca cinus maenas. Eu opean Jou nal o Biochemis y 250: 727-734.
Du e H., Johnsen A.H., Sco A.G., and Tho pe A. (2002). Alla os a ins o he ige
p awn, Penaeus monodon (C us acea: Penaeidea). Pep ides 23: 1039–1051.
Edwa ds J.P., Chambe s l.J., P ice N.R., and Wilkin J.P.G. (1987). Ac ion o a
ju enile ho mone analogue on he ac i i y o Pe iplane a ame icana co po a alla a in
i o and on ju enile ho mone III le els in i o. Insec Biochemis y 17: 1115—1118.
Edwa ds J.P., Co bi T.S., Mca dle, H.F. Sho J.E., and Wea e R.J. (1995).
Endogenous le els o insec ju enile ho mones in la al, pupal and adul s ages o
he oma o mo h, Lacanobia ole acea. Jou nal o Insec Physiology 41: 641-651.
Edwa ds J.P., Audsley N., Ma is G.C., Cusson M., and Wea e R.J. (2001). The ole
o alla os a ic and alla o opic neu opep ides in he egula ion o ju enile ho mone
biosyn hesis in Lacanobia ole acea (Lepidop e a: Noc uidae). Pep ides 22: 255–261.
Elbashi S.M., Lendeckel W., and Tuschl T. (2001). RNA in e e ence is media ed by
21- and 22 nucleo ide RNAs. Genes and De elopmen 15: 188-200.
Ele he ianos I., Millichap P.J., F ench-Cons an R.H., and Reynolds S.E. (2006).
RNAi supp ession o ecogni ion p o ein media ed immune esponses in he obacco
ho nwo m Manduca sex a causes inc eased suscep ibili y o he insec pa hogen
Pho o habdus. De elopmen al and Compa a i e Immunology 30: 1099-1107.
Elekonich M.M., and Ho odyski F.M. (2003). Insec alla o opins belong o a amily
o s uc u ally- ela ed myoac i e pep ides p esen in se e al in e eb a e phyla.
Pep ides 24: 1623–1632.
Ellio K.L., Hehman G.L., and S ay B. (2009). Isola ion o he gene o he p ecu so
o Phe-Gly-Leu-amide alla os a ins in he e mi e Re iculi e mes la ipes. Pep ides
30: 855-860.
x iii
Engelmann F. (1979). Insec i ellogenin: iden i ica ion, biosyn hesis, and ole in
i ellogenesis. Ad ances in Insec Physiology 14: 49–108.
Fasco M.J. (1997). Quan i a ion o es ogen ecep o mRNA and i s al e na i ely
spliced mRNAs in b eas umo cells and issues. Analy ical Biochemis y 245: 167–
178.
Fei H., Ma in T.R., Jaskowiak K.M., Ha le J.D., Whi man D.W., and Bo s W.D.
(2005). S a a ion a ec s i ellogenin p oduc ion and mRNA le el in g asshoppe ,
Romalea mic op e a. Jou nal o Insec Physiology 51: 435-443.
Fusé M., Zhang J.R., Pa idge E., Nachman R.J., O cha d I., Bendena W.G., and
Tobe S.S. (1999). E ec s o an alla os a in and a myosupp essin on midgu
ca bohyd a e enzyme ac i i y in he cock oach Diplop e a punc a a. Pep ides 20:
1285–1293.
Ga side C.S., Koladich P.M., Bendena W.G., and Tobe S.S (2002). Exp ession o
alla os a in in he o iduc s o he cock oach Diplop e a punc a a. Insec Biochemis y
and Molecula Biology 32: 1089-1099.
Gaede G., Ho mann K. H., and Sp ing J. H. (1997). Ho monal egula ion in insec s:
Fac s, gaps, and u u e di ec ions. Physiological Re iews 77: 963-1032.
Gaede G., and Ho mann K.H. (2005). Neu opep ides egula ing de elopmen and
ep oduc ion in insec s. Physiological En omology 30: 103–121.
Gilbe L.I., Rybczynski R., and Wa en J.T. (2002). Con ol and biochemical na u e
o he ecdys e oidogenic pa hway. Annual Re iew o En omology 47: 883-916.
G ieble M., Wes e lund S.A., Ho mann K.H., and Meye ing-Vos M. (2008). RNA
in e e ence wi h he alla o egula ing neu opep ide genes om he all a mywo m
Spodop e a ugipe da and i s e ec s on he JH i e in he hemolymph. Jou nal o
Insec Physiology 54: 997– 1007.
G ieble M. (2009). Auswi kungen de RNA-In e e enz au alla o egulie ende
Neu opep ide und Lokalisa ion de B- Typ Alla os a ine bei Spodop e a ugipe da.
Disse a ion zu E langung des Dok o g ades an de Fakul ä ü Biologie, Chemie
und Geowissenscha en de Uni e si ä Bay eu h.
G au V., Pis J., and La on R. (1995). O a y-speci ic in e ac ion o ecdysone 22-
phospha e wi h p o eins in adul D osophila melanogas e (Dip e a: D osophilidae).
Eu opean Jou nal o En omology 92: 189-196.
G un enko, N.E., Khleboda o a, T.M., G enbek, L.G., Sukhano a, M.Z., Zakha o ,
I.K., Raushenbakh, I.Y. (1996). Gene ic con ol o ju enile ho mone me abolism in
D osophila melanogas e . Gene ika, Moscow 32(2): 228--232.
G un enko N.E., Ka po a E.K., Adonye a N.V., Chen so a N.A., Faddee a N.V.,
Aleksee A.A., and Rauschenbach I.Y. (2005). Ju enile ho mone, 20-
hyd oxyecdysone and dopamine in e ac ion in D osophila i ilis ep oduc ion unde
no mal and nu i ional s ess condi ions. Jou nal o Insec Physiology 51: 417–425.
xx
es ablishes i s ole as Bacillus hu ingiensis oxin ecep o . The Jou nal o Biological
Chemis y 277: 46849-46851.
Ramaswamy S.B., Shu S., Pa k Y., and Zeng F. (1997). Dynamics o ju enile
ho mone-media ed gonado opism in he Lepidop e a. A chi es o Insec
Biochemis y and Physiology 35: 539–558.
Ramaswamy S.B., Mba a G.N., and Cohen N.E. (1990). Necessi y o ju enile
ho mone o cho iogenesis in he mo h, Helio his i escens (Noc uidae). In e eb a e
Rep oduc ion and De elopmen 17: 27-33.
Ramaswamy S. B., Shu S. , Mba a G. N., Rachinsky A., Pa k Y. I., C igle L., Donald
S., S ini asan A. (2000). Role o ju enile ho mone-es e ase in ma ing-s imula ed egg
de elopmen in he mo h Helio his i escens. Insec Biochemis y and Molecula
Biology 30: 785–791.
Range S., Oeh U., and Lo enz M. W.(2002). Ju enile ho mone biosyn hesis in he
all a mywo m Spodop e a ugipe da (Lepidop e a: Noc uidae). Compa a i e
Biochemis y and Physiology B Biochemis y and Molecula Biology 132: 191-202.
Rankin S.M., and S ay B. (1984). The changing e ec o he o a y on a es o
ju enile ho mone syn hesis in Diplop e a punc a a. Gene al and Compa a i e
Endoc inology 54: 382–388.
Red e n C.P.F. (1982). 20-Hy oxyecdysone and o a ian de elopmen in Anopheles
s ephphensi. Jou nal o Insec Physiology 28: 97-109.
Rees H.H., and Isaac R.E. (1985). Biosyn hesis and me abolism o ecdys e oids and
me hods o isola ion and iden i ica ion o he ee and conjuga ed compounds.
Me hods in Enzymolgy 111: 377-410.
Riddi o d L.M. (1972). Ju enile ho mone and insec emb yonic de elopmen : i s
po en ial ole as an o icide. In Insec Ju enile Ho mones, Chemis y and Ac ion, ed.
J.J. Menn, M. Be oza. Academic P ess, New Yo k, pp. 95–111.
Riddi o d L.M., and T uman J.W. (1978). Biochemis y o insec ho mones and
insec g ow h egula o s. In Biochemis y o Insec s, ed. M. Rocks ein. Academic
P ess, New Yo k, pp. 307- 357.
Riddi o d L.M., and T uman J.W. (1993). Ho mone ecep o s and he egula ion o
insec me amo phoses. Ame ican Zoologis 33: 340-347.
Riddi o d L.M. (1996). Ju enile ho mone: The s a us o i s “S a us Quo” ac ion.
A chi es o Insec Biochemis y and Physiology 32: 271-286.
Riddi o d L.M. (2008). Ju enile ho mone ac ion: A 2007 pe spec i e. Jou nal o
Insec Physiology 54: 895–901.
Ri ie K.M., Rasmussen R.P., and Wi we C.T. (1997). P oduc di e en ia ion by
analysis o DNA mel ing cu es du ing he polyme ase chain eac ion. Analy ical
Biochemis y 245: 154–160.

xx i
Romana I., Pascual N., and Bellés X. (1995). The o a y is a sou ce o ci cula ing
ecdys e oids in Bla ella ge manica (Dic yop e a: Bla ellidae). Eu opean Jou nal o
En omology 92: 93-103.
Roun ee B.D., and Bollenbache W.E. (1986). The elease o p o h o acico opic
ho mone in he obacco ho nwo m, Manduca sex a, is con olled in insically by
ju enile ho mone. The Jou nal o Expe imen al Biology 120: 41- 58.
Saku ai S., Kaya M., Sa ake S. (1998). Hemolymph ecdys e oid i e and
ecdys e oid-dependen de elopmen al e en s in he las -la al s adium o he
silkwo m, Bombyx mo i: ole o low ecdys e oid i e in la al-pupal me amo phosis
and a eapp aisal o he head c i ical pe iod. Jou nal o Insec Physiology 44: 867-
881.
Samb ook J., F i sch E. F., and Mania is T. (1989). Molecula cloning (1) and (2). A
Labo o o y Manual (Second Edi ion). Gold Sp ing Ha bo Labo a o y P ess.
Sasaki M., and Riddi o d L.M. (1984). Regula ion o ep oduc i e beha iou and
egg ma u a ion in he obacco hawk mo h, Manduca sex a. Physiological En omology
9: 315-327.
Sco M.P. (2006). The ole o ju enile ho mone in compe i ion and coope a ion by
bu ying bee les. Jou nal o Insec Physiology 52: 1005–1011.
Sehnal F., Fonagy A., Akai G.Y.H., and Kallenbo n H.G. (1988). P o h oacic glands
and ecdys e oids in Galle ia mellonella la ae. Jou nal o Insec Physiology 34: 609-
614.
Sha p P. A., Sugden B., and Samb ook J. (1973). De ec ion o wo es ic ion
endonuclease ac i i ies in Haemophilus pa ainjuensae using analy ical aga ose-
e hidium b omide elec opho esis. Biochemis y 12: 3055- 3063.
Shiao Y.-H. (2003). A new e e se ansc ip ion-polyme ase chain eac ion me hod
o accu a e quan i ica ion. BMC Bio echnology 3-22.
Shionoya M. , Ma subayashi H., Asahin M., Kuniyoshi H., Naga a S., Riddi o d L. M.,
and Ka aoka H. (2003). Molecula cloning o he p o ho acico opic ho mone om he
obacco ho nwo m, Manduca sex a. Insec Biochemis y and Molecula Biology 33:
795–801.
Shu S., Pa k Y.I., Ramaswamy S.B., and S ini asan A. (1997). Hemolymph ju enile
ho mone i e s in pupal and adul s ages o Sou hwes e n co n bo e [Dia aea
g andiosella (Py alidae)] and ela ionship wi h egg de elopmen . Jou nal o Insec
Physiology 43: 719–726.
Shu S., Pa k Y.I., Ramaswamy S., and S ini asan A. (1998). Tempo al p o iles o
ju enile ho mone i e s and egg p oduc ion in i gin and ma ed emales o Helio his
i escens (Noc uidae). Jou nal o Insec Physiology 44: 1111–1117.
Siegen hale C., Ma oy P., Hedige M., Duebendo e A., and Bopp D. (2009).
Ho mones and sex-speci ic ansc ip ion ac o s join ly con ol yolk p o ein syn hesis
xx ii
in Musca domes ica. In e na ional Jou nal o E olu iona y Biology A icle ID 291236:
291-236.
Smi h W., P ies e J., and Mo ais J. (2003). PTTH-s imula ed ecdysone sec e ion is
dependen upon y osine phospho yla ion in he p o ho acic glands o Manduca
sex a. Insec Biochemis y and Molecula Biology 33: 1317–1325.
So ge D., Nauen R., Range S., and Ho mann K.H. (2000). Regula ion o
i ellogenesis in he all a mywo m, Spodop e a ugipe da (Lepidop e a: Noc uidae).
Jou nal o Insec Physiology 46: 969–976.
Spa ks T.C., Hammock B.D., and Riddi o d L. M. (1983). The hemolymph ju enile
ho mone es e ase o Manduca sex a (L.) inhibi ion and egula ion. Insec
Biochemis y 13: 529-541.
S a a A.N., and B own B.E. (1976). S uc u e o pen apep ide p oc olin, a
p oposed neu o ansmi e in insec s. Li e Sciences 17: 1253- 1256.
S ay B., and Tobe S.S. (1978). Con ol o ju enile ho mone biosyn hesis du ing he
ep oduc i e cycle o a i ipa ous cock oach. E ec s o unila e al alla ec omy,
implan a ion o supe nume a y co po a alla a, and o a iec omy. Gene al and
Compa a i e Endoc inology 34:276-286.
S ay B., Tobe S.S., Mundall E.C., and Rankin S. (1983). O a ian s imula ion o
ju enile ho mone biosyn hesis in he i ipa ous cock oach, Diplop e a punc a a.
Gene al and Compa a i e Endoc inology 52: 341–349.
S ay B., Joshi S., and Woodhead A.P. (1991). Sensi i i y o alla os a ins o co po a
alla a om la al and adul emale Diplop e a punc a a. Jou nal o Insec Physiology
37: 63-70.
S ay B., and Woodhead A.P. (1993). Neu opep ide egula o s o insec co po a
alla a. Ame ican Zoologis 33: 357-364.
S ay B., Fai bai n S., and Yu C.G. (1996). Role o alla os a ins in he egula ion o
ju enile ho mone syn hesis. A chi es o Insec Biochemis y and Physiology 32: 287-
297.
S ay B. (2000). A e iew o he ole o neu osec e ion in he con ol o ju enile
ho mone syn hesis: a ibu e o Be a Scha e . Insec Biochemis y and Molecula
Biology 30: 653–662.
S ay B., and Tobe S.S. (2007). The ole o alla os a ins in ju enile ho mone
syn hesis in insec s and c us aceans. Annual Re iew o En omology 52: 277–299.
Su he land T.D., and Feye eisen R. (1996). Endoc inological a ge o cock oach
alla os a in in he pa hway o ju enile ho mone biosyn hesis. Molecula and Cellula
Endoc inology 120: 115-123.
xx iii
Swe e s L., Jisheng L., Hu enne H., and Smagghe G. (2011). Sea ch o limi ing
ac o s in he RNAi pa hway in silkmo h issues and he Bm5 cell line: he RNA-
binding p o eins R2D2 and anslin. Plos One 6: 20250.
Takaki K., and Saku ai S. (2003). Regula ion o p o ho acic gland ecdys e oidogenic
ac i i y leading o pupal me amo phosis. Insec Biochemis y and Molecula Biology
33: 1189–1199.
Tanaka S. (1994). Endoc ine con ol o o a ian de elopmen and ligh muscle
his olysis in a wing dimo phic c icke , Modiog yllus con i ma us. Jou nal o Insec
Physiology 40: 483-490.
Tao T., Xue-yuan L., and Li-hang Q. (2010). RNA in e e ence and i s applica ions on
silencing o insec icide- esis an genes in insec s. Co on Science 22: 617- 624.
Taub-Mon emayo a T.E., Min K., Chena Z., Ba le a T., and Rankin M.A. (2005). JH
III p oduc ion, i e s and deg ada ion in ela ion o ep oduc ion in male and emale
An honomus g andis. Jou nal o Insec Physiology 51: 427– 434.
Teal P.E.A. (2002). E ec s o alla o opin and alla os a in on in i o p oduc ion o
ju enile ho mones by he co po a alla a o i gin emales o he mo hs o Helio his
i escens and Manduca sex a. Pep ides 23: 663–669.
Te enius O., Papanicolaou A., Ga bu J.S., Ele he ianos I., Hu enne H.,
Kanginakud u S., Alb ech sen M., An C. , Ayme ic J.-L., Ba hel A., e al. (2011).
RNA in e e ence in Lepidop e a: An o e iew o success ul and unsuccess ul
s udies and implica ions o expe imen al design. Jou nal o Insec Physiology 57:
231–245.
Thompson D.M., Khalil S.M.S., and Je e sa L.A. (2005). In i o ole o 20-
hyd oxyecdysone in he egula ion o he i ellogenin mRNA and egg de elopmen in
he Ame ican dog ick, De macen o a iabilis (Say). Jou nal Insec Physiology 51:
1105–1116.
Tian L., Ji B.-Z. , Liu S.-W, He C.-L. , Jin F., Gao J., S anley D., and Sheng (2010).
JH biosyn hesis by ep oduc i e issues and co po a alla a in adul longho ned
bee les, Ap iona ge ma i. A chi es o Insec Biochemis y and Physiology 75: 275-86.
Tobe S.S. (1980). Regula ion o he co po a alla a in adul emale insec s. In: Insec
Biology in he Fu u e, eds. M. Locke, D.S. Smi h. Academic P ess, New Yo k, pp.
345–367.
Tobe S.S., Gi a die J., and Gi a die A. (1982). Enhancemen o ju enile ho mone
biosyn hesis in locus s ollowing elec os imula ion o ce eb al neu osec e o y cells.
Jou nal o Insec Physiology 28: 867-871.
T uesdell P.F., Koladich P.M., Ka aoka H., Kojima K., Suzuki A., McNeil J.N.,
Mizoguchi A., Tobe S.S., and Bendena W. (2000). Molecula cha ac e iza ion o a
cDNA om he ue a mywo m Pseudale ia unipunc a encoding Manduca sex a
alla o opin pep ide1. Insec Biochemis y and Molecula Biology 30: 691–702.
xxix
Tu M.P., Yin C.-M., and Ta a M. (2005). Mu a ions in insulin signalling pa hway al e
JH syn hesis in D osophila melanogas e . Gene al and Compa a i e Endoc inology
142: 347-356.
Veens a J.A., and Cos es L. (1999). Isola ion and iden i ica ion o a pep ide and i s
cDNA om he mosqui o Aedes aegyp i ela ed o Manduca sex a alla o opin.
Pep ides 20: 1145-1151.
Venka esh K., C aw o d C.L., and Roe R.M. (1988). Cha ac e iza ion and he
de elopmen al ole o plasma ju enile ho mone es e ase in he adul cabbage loope ,
T ichoplusla ni. Insec Biochemis y 18: 53-61.
Wang C., Du a-Gup a A., and Kuma an K. (1995). S age speci ic ecdys e oid
esponse o la al hemolymph p o ein genes in Galle ia melonella (Lepidop e a:
Py alidae). Eu opean Jou nal o En omology 92: 215-216.
Wang J., Meye ing-Vos M., and Ho mann K.H. (2004). Cloning and issue-speci ic
localiza ion o c icke - ype alla os a ins om G yllus bimacula us. Molecula and
Cellula Endoc inology 227: 41-51.
Wasielewski O., Skonieczna M., and Kod ik D. (2009). Role o alla os a in-like
ac o s om b ain o Teneb io moli o emales. A chi es o Insec Biochemis y and
Physioloy 71: 223–235.
Wa son R. D., Agui N., Hai e M.E., and Bollenbache W.E. (1987). Ju enile ho mone
coo dina es he egula ion o he hemolymph ecdys e oid i e du ing pupal
commi men in Manduca sex a. Insec Biochemis y 17: 955-959.
Webb T. J., Shu S., Ramaswamy S.B., and Do n S. (1999). In luence o ju enile
ho mone and ma ing on oogenesis and o iposi ion in he codling mo h, Cydia
pomonella. A chi es o Insec Biochemis y and Physiology 41:186–200.
Wes e lund S.A. (2004). Measu ing ju enile ho mone and ecdys e oid i e s in insec
heamolymph simul aneously by LC-MS: The basis o de e mina ing he
e ec i eness o plan -de i ed alkaloids as insec g ow h egula o s. Disse a ion,
Uni e si y o Bay eu h.
Wes e lund S.A., and Ho mann K.H. (2004). Rapid quan i ica ion o ju enile
ho mones and hei me aboli es in insec haemolymph by liquid ch oma og aphy
mass spec ome y (LC-MS). Analy ical and Bioanaly ical Chemis y 379: 540-543.
Whisen on L.R., Bowen M.E, G ange N.A., Gilbe L.I., and Bollenbache W.E.
(1985). B ain-media ed 20-hyd oxyecdysone egula ion o ju enile ho mone
syn hesis by he co po a alla a o he obacco ho nwo m, Manduca sex a. Gene al
and Compa a i e Endoc inology 58: 311-318..
Whi ing P., Spa ks S., and Dinan L. (1997). Endogenous ecdys e oid le els and
a es o ecdysone acyla ion by in ac o a ies in i o in ela ion o o a ian
de elopmen in adul emale house c icke s, Ache a domes icus. A chi es o Insec
Biochemis y and Physiology 35: 279–299.
xxx
Whya d S., Singh A.D., and Wong S. (2009). Inges ed double-s anded RNAs can
ac as species-speci ic insec icides. Insec Biochemis y and Molecula Biology 39:
824-832.
Wi ek G., and Ho mann K.H. (2001). Immunological e idence o FGLamide- and
W2W9-alla os a ins in he o a y o G yllus bimacula us (Ensi e a, G yllidae).
Physiological En omology 26: 49-57.
Woodhead A.P., S ay B., Seidel S.L., Khan M.A., and Tobe S.S. (1989). P ima y
s uc u e o ou alla os a ins: neu opep ide inhibi o s o ju enile ho mone syn hesis.
P oceedings o he Na ional Academy o Sciences USA 86: 5997-6001.
Wya G.R., Coog K.E., Fi ko H., and Dhadialla T.S. (1987). Ju enile ho mone ac ion
on locus a body. Insec Biochemis y 17: 1071-1073.
Yagi K.J., Kwok R., Chan K.K. Se e R.R., Myles T.G., Tobe S.S., and S ay B.
(2005). Phe-Gly-Leu-amide alla os a in in he e mi e Re iculi e mes la ipes: Con en
in b ain and co pus alla um and e ec on ju enile ho mone syn hesis. Jou nal o
Insec Physiology 51: 357-365.
Yagi K.J., Ellio K.L., Teesch L., Tobe S.S., and S ay B. (2008). Isola ion o
cock oach Phe–Gly–Leu–amide alla os a ins om he e mi e Re iculi e mes la ipes
and hei e ec on ju enile ho mone syn hesis. Jou nal Insec Physiology 54: 939–
948.
Yamamo o K.R., Chada e ian A., and Pelleg ini M. (1988). Ju enile ho mone ac ion
media ed in male accesso y glands o D osophila by calcium and kinase C. Science
239: 916-919.
Yin C., and S o olano J.G. (1997). Ju enile ho mone egula ion o ep oduc ion in
he cyclo haphous Dip e a wi h emphasis on oogenesis. A chi es o Insec
Biochemis y and Physiology 35: 513–537.
Zamo ano P.L., Mahesh V.B., and B ann D.W. (1996). Quan i a i e RT-PCR o
neu oendoc ine s udies. Neu oendoc inology 63: 397–407.
Zeng F., Shu S., Pa k Y.I., and Ramaswamy S.B. (1997). Vi ellogenin and egg
p oduc ion in he mo h, Helio his i escens. A chi es o Insec Biochemis y and
Physiology 34: 287–300.

xxxi
8 Appendix
8.1 Sequences o iso o m A cDNA o alla o opins o S. ugipe da
5’ GTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCC 51
AAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCCAACGCGTT 102
GGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGA 153
TTGCAGTGGTATCAACGCAGAGTACGCGGGGACTTGTGTACAGCCGTCTCA 204
GCGCGCAACACGCGCTCCTCTCGCACCAGTGTTACAGTGCACTAATCGAAC 255
__________AT5p ___
TCTTTCGGACTAATTCAACTCGCAGCAATGAACATTTCAATGCATTTGGCG 306
M N I S M H L A 8
_____
GTAGCAGTGGCGGCGGCGGCTTGTCTGTGCGTGTGCGCAGCGGCGCCCGAG 357
V A V A A A A C L C V C A A ↓A P E 25
AATCGACTCGCGCGCACCAAACAACAGCGCCCCACCCGCGGCTTCAAGAAT 408
N R L A R T K Q Q R P T R G F K N 42
_____AT5p R________
GTCGAGATGATGACCGCCAGGGGATTCGGCAAGCGGGACAGGCCACACACT 459
V E M M T A R G F G K R D R P H T 59
CGGGCTGAGCTTTACGGTTTGGACAACTTCTGGGAGATGCTGGAGGCTACA 510
R A E L Y G L D N F W E M L E A T 76
CCTGAGAGGGAAGGACAGGAGAATGATGAGAAGACTTTGGAAAGCATTCCT 561
P E R E G Q E N D E K T L E S I P 93
TTGGACTGGTTCGTGAACGAGATGCTGAACAATCCAGATTTCGCGCGATCT 612
L D W F V N E M L N N P D F A R S 110
GTGGTCCGCAAGTTCATTGACCTCAATCAGGACGGCATGCTATCATCGGAG 663
V V R K F I D L N Q D G M L S S E 127
GAGCTATTAAGGAACGTCGTTTAAATACATATTTAGTTAATTACCTATAAC 714
E L L R N V V --- 134
TTGAGAGCCCTATCATTTGATCTGTAACTGCATGCAAAGTAAATATATGAA 765
TATATATCATTAAAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ‘3 811
Figu e (A1): Spo -AT sequence da a. Nucleo ide and deduced amino acids sequences o S.
ugipe da. AT1 iso o m A cDNA. The sequences a e numbe ed a he igh .
The Spo -AT pep ide amino acids sequence is shown in bold ype. Possible
p o eoly ic clea age si es a e in boxes and he glycine esidue equi ed o amida ion
is unde lined. The polyadenyla ion signal is shown in bold ype and unde lined; ---
ep esen s he s op codon. A signal pep ide clea age si e is indica ed by a downwa d
a ow (Abdel-la ie e al., 2003). The used p ime s AT5p and AT5p R a e ma ked in
ed.
xxxii
5’– TAATACGACTCACTATAG GGC TTC AAG AAT GTC GAG ATG ATG 42
G F K N V E M M 7
ACC GCC AGG GGA TTC GGC AAG CGG GAC AGG CCA CAC ACT 82
T A R G F G K R D R P H T 20
CGG GCT GAG CTT TAC GGT TTG GAC AAC TTC TGG GAG ATG 121
R A E L Y G L D N F W E M 33
CTG GAG GCT ACA CCT GAG AGG GAA GGA CAG GAG AAT GAT 160
L E A T P E R E G Q E N D 46
GAG AAG ACT TTG GAA AGC ATT CCT TTG GAC TGG TTC GTG 199
E K T L E S I P L D W F V 59
AAC GAG ATG CTG AAC AAT CCA GAT TTC GCG CGA TCT GTT 238
N E M L N N P D F A R S V 72
GTC CGC CCTATAGTGAGTCGTATTA `3 262
V R 74
Figu e (A2): Nucleo ide and amino acid sequences used o ansc ip c ea ion o Spo -AT
iso o m A agmen s.
The agmen was de i ed om Spo -AT iso o m A cDNA (s. Fig. 15; Abdel-la ie e
al., 2003). The sequences a e numbe ed a he igh . The used p ime T7-ATF7 and
T7-AT 9 a e ma ked in blue. The T7 minimal sequences a e shown in bold ype.
xxxiii
8.2 Sequences o alla os a in A cDNA om S. ugipe da
5’CTAATACGACTCACTATAGGGCAAGCAGTGGTAAACGCAGAGTACGCGGGG 51
ACAGCTGTTAGCTGGCGGGCTTCAAGCACGCCGCATTAACATCGCGTGTGC 102
CAAACCTTACGTGACTACGAACACATAAGAATGCTGTACCCATCAATTCCG 153
M L Y P S I P 7
GTTTGCTTCCTCGTGATTGGAGTAGCACTCTGCGCTCCAGAGAGGATGCAG 204
V C F L V I G V A L C↓ A P E R M Q 24
AACGAACCAGACCCTCACGACACTCCGGTGCATGAGGGCACTGAGCCACAC 255
N E P D P H D T P V H E G T E P H 41
AGTGACCACATTGCCCCTCTTGAGAAGAGATCCCCTCACTACGACTTTGGG 306
S D H I A P L E K R S P H Y D F G 58
Spo -AST A-1
TTGGGCAAGAGGGCTTACAGCTACGTGTCAGAATATAAACGACTACCTGTC 357
L G K R A Y S Y V S E Y K R L P V 75
Spo -AST A-2
TACAACTTTGGACTGGGCAAGAGATCCAGGCCCTACTCCTTTGGCCTGGGC 408
Y N F G L G K R S R P Y S F G L G 92
Spo -AST A-3
AAACGTTCAGTTGACGAGGACCAGTCCAGCGAGAGCCAGCCTCTGACCAGC 459
K R S V D E D Q S S E S Q P L T S 109
GACCTGGACCAAGCTGCCTTAGCTGAATTCTTCGATCAGTATGATGATGCC 510
D L D Q A A L A E F F D Q Y D D A 126
Space -I
GGTTACGAGAAGCGCGCTCGACCTTACAGCTTTGGCCTCGGCAAACGCTTC 561
G Y E K R A R P Y S F G L G K R F 143
Spo -AST A-4
GCTGACGACGAAACTTCCGAAGAAAAGCGGGCAAGGGCATACGACTTTGGA 612
A D D E T S E E K R A R A Y D F G 160
Space -II Spo -AST A-5
CTGGGCAAGCGGCTACCGATGTACAACTTTGGTTTGGGCAAGCGAGCGAGG 663
L G K R L P M Y N F G L G K R A R 177
Spo -AST A-6
AGCTACAACTTTGGCTTGGGCAAGCGATTGAGCAGCAAATTCAACTTTGGT 714
S Y N F G L G K R L S S K F N F G 194
Spo -AST A-7 Spo -AST A-8
TTAGGCAAAAGGGAGAGGGACATGCACGGTTTCAGTTTCGGCCTGGGCAAA 765
L G K R E R D M H G F S F G L G K 211
Spo -AST A-9
AGGGTCCATAAGTTTACGGCCGAAATATGGACTTCTGTTGAGGTCTTAAAT 816
R V H K F T A E I W T S V E V L N 228
AAAATTCTATAATCGTCCTAATTGAATTTAATATGAATAAAGAATAACTTA 867
K I L --- 231
CTTAACAATGTTAATGTCCATGGGCGGCGCTGATCGCTTACCATCAGGTGA 918
CTCGTTTGCTCGTTTGCCTCCTATTCCAGAAAAAAAAAAAAAAAAAAAAAA 969
AAAAAAA’3 976
Figu e (A3): Nucleo ide and amino acid sequences o alla os a in A cDNA om S. ugipe da.
The sequences a e numbe ed a he igh (Abdel-la ie e al., 2004b).
xxxi
9 Lis o Abb e ia ions
AT 1 Manduca sex a alla o opin
Amp ampicillin
AS alla os a in
AG accesso y sex gland
AT alla o opin
Bp base pai
β-ac in be a-ac in
C- ca bon
°C Celsius deg ee
CA co po a alla a
CaCl2 calcium chlo ide
CC co po a ca diaca
cDNA complemen a y DNA
cm cen ime e
cAMP cyclic adenosine monophosopha e
c /CT cycle h eshold
d day
0 d eshly moul ed animal, day 0
DEPC die hyl py oca bona
dGTP 2'-desoxyguanosin 5'- iphospha
Dippu-AST Diplop e a punc a a alla os a in
DNA 2' – deoxy ibonucleic acid
DNase deoxy ibonuclease
dATP 2'-desoxyadenosin 5'- iphospha
dCTP 2'-desoxycy idin 5'- iphospha
dNTP mix u e o dATP, dCTP, dGTP, dTTP
dsDNA double s and deoxy ibonucleic acid
dsRNA double s and 2`- ibonucleic acid
dTTP 2'-desoxy hymidin 5'- iphospha
dUTP 2'-desoxyu idin 5'- iphospha
E 75A pu a i e JH ecep o
E. coli Esche ichia coli