Development of novel hybrid phosphorated quinoline derivatives as topoisomerase 1B inhibitors with antiproliferative activity

Depa amen o de Química O gánica I
Facul ad de Fa macia
De elopmen o no el hyb id phospho a ed
quinoline de i a i es as opoisome ase 1B
inhibi o s wi h an ip oli e a i e ac i i y
Memo ia p esen ada po
Asie Selas Lanse os
Pa a op a al g ado de doc o con mención
Vi o ia-Gas eiz, 2022
(cc) 2022 Asie Selas Lanse os (cc by-sa 4.0)
Acknowledgemen s/ag adecimien os
El abajo ecogido en la p esen e memo ia no hubie a podido lle a se a cabo sin la asis encia,
colabo ación y o ien ación de un g an núme o de pe sonas que de una o ma u o a no solo
es u ie on p esen es, sino que con ibuye on pa a la inalización y p esen ación del mismo.
En p ime luga , me gus a ía ag adece a la D a. Concepción Alonso y al p o eso F ancisco
Palacios po ab i me las pue as del depa amen o de Química O gánica I y da me la
opo unidad de o ma pa e de su g upo de in es igación, po su apoyo inqueb an able y
(sob e odo) su paciencia. Ap o echo la ocasión pa a mos a mi más since o econocimien o a
su abajo y ayec o ia, log ando da el sal o a p oyec os de química e apéu ica de al o ni el y
o ma a jó enes in es igado es en el campo. También quisie a ag adece al es o de
compañe os de línea de in es igación (D . Ma ín, D a. Fue es, D a. Rubiales y Ángela) po su
dedicación y buen hace en el mundo de las opoisome asas. Ha sido un e dade o place o ma
pa e de es e g upo.
También me gus a ía eco da y ag adece al es o de compañe os del g upo de in es igación
que han ido pasando po más o menos iempo, pe o que odos ellos han dejado su huella (espe o
no deja me a nadie). Ad ián, Alba, Ai o , Ca la, Gonzalo, Ish aq, Julene, Kassia, Kha im, Lei e,
Maide , Sa e io, Xabi, Xabi J , Víc o Zu iñe, Zouhai , ha sido una sue e compa i labo a o io y
ca e e ía con oso os, me lle o un g an ecue do. Y no quisie a ol ida me de los p o eso es:
Ana, Begoña, Ca me, Delos, Edo a, Ja i, Mi a i, Yu e, po demos a cada día que la química
o gánica no es abu ida en absolu o. Sois un ejemplo y un g an equipo.
And now, I may mo e o English o a while o exp ess my u mos g a i ude o D . Bi gi a R.
Knudsen (Depa men o Molecula Biology and Gene ics, Aa hus Uni e si y) and D . Cinzia
Tesau o (VPCIR Biosciences), i has been such an honou o collabo a e wi h you esea ch
g oups ha I had o do i wice. I has been a challenging ad en u e in o Molecula Biology (a
bap ism o i e) wi h a happy ending and I eally enjoy all he good imes in he lab, cake-days,
bee -days and b eak as -mee ings. I will ne e o ge all he suppo ha I ecei ed om all he
membe s o he g oup, I eally needed i o hu dle all he obs acles on he way. I specially wan
o hank o all he amazing lab ma es in Aa hus: Josephine, Kamilla, Ka ol, Ka h ine Ki s ine,
Ma ia, No iko and o cou se, Adam. This PhD memo y has a s ong Danish accen .
Y po supues o, muchísimas g acias a la amilia y amigos po odo el ca iño y la ayuda que me
han dado en odo momen o. Es a A en u a hubie a sido imposible sin ellos. Muchas g acias a
mis pad es po c ee en mí y exigi me pa a que llegue a se lo que puedo se . A mis abuelos, po
oda su e nu a y apoya me has a en las peo es decisiones. A Pili, po p eocupa se siemp e po
mí. A odos mis amigos, que han su ido mis ausencias y han p ome ido b inda cuando ecupe e
pa e de mi libe ad.
Po úl imo, quisie a gua da unas úl imas líneas pa a ag adece a And ea odo su apoyo y
paciencia conmigo (ella sí que se las ha ganado). Muchas g acias po u dulzu a, po es a
siemp e ahí, po cuida me cuando se me ol ida y po suminis a me ca é y comida en los malos
momen os. Al inal as a acaba cogiéndole ca iño a las opoisome asas ú ambién.
We can speak and hink only o wha exis s. And wha exis s is unc ea ed and impe ishable o
i is whole and unchanging and comple e. I was no o no shall be di e en since i is now, all
a once, one and con inuous.
A ibu ed o Pa menides o Elea
The in es iga ion o he u h is in one way ha d, in ano he easy. An indica ion o his is ound
in he ac ha no one is able o a ain he u h adequa ely, while, on he o he hand, no one
ails en i ely, bu e e yone says some hing ue abou he na u e o all hings, and while
indi idually hey con ibu e li le o no hing o he u h, by he union o all a conside able
amoun is amassed.
A is o le, Me aphysics, book 2 ( ), chap e I
Index
Abb e ia ions, ac onyms and symbols ......................................................................................... 1
In oduc ion and objec i es .......................................................................................................... 7
1. Topoisome ase I as a a ge in an icance d ug esea ch ..................................................... 8
1.1. DNA opoisome ases ...................................................................................................... 8
1.2. Ta ge ing human ype IB opoisome ase (hTOP1B) ..................................................... 13
1.3. De elopmen o human TOP1B (hTOP1) inhibi o s as cance chemo he apeu ic d ugs
in medicinal chemis y ........................................................................................................ 17
2. Syn hesis o quinolines ........................................................................................................ 39
2.1. Majo me hods o he syn hesis o quinolines ........................................................... 48
3. Objec i es ............................................................................................................................ 67
Chap e I. Syn hesis o phospho a ed quinoline de i a i es by he [4+2] Po a o eac ion ..... 69
I-1. The ole o phospho us in medicinal chemis y and d ug disco e y ................................ 70
I-1.1. Phospho us-based ansi ion s a e in e media e analogues ..................................... 73
I-1.2. Phospho us-con aining d ugs .................................................................................... 75
I-2. The Po a o eac ion ........................................................................................................ 84
I-2.1. The mechanism o he Po a o eac ion ................................................................... 86
I-2.2. Elec ophilic ac i a ion o he diene by Lewis-acid (LA) and B øns ed-acid (BA)
ca alys s ............................................................................................................................... 87
I-2.3. Dienophiles in he Po a o eac ion .......................................................................... 89
I-2.4. Dehyd ogena ion o e ahyd oquinoline adduc s ob ained by he Po a o eac ion
o achie e ully a oma ic quinolines ................................................................................... 91
I-2.5. Summa y, a his o ical app oach o he Po a o eac ion.......................................... 93
I-3. Syn hesis o quinolinylphosphine oxide de i a i es ......................................................... 94
I-3.1. Syn hesis o (2-aminophenyl)diphenylphosphine oxide 1a ....................................... 94
I-3.2. Syn hesis o hyb id diphenylphosphine oxide subs i u ed 1,2,3,4-
e ahyd oquinolines by he Po a o eac ion ................................................................... 96
I-3.3. Syn hesis o diphenylphosphine oxide subs i u ed quinolines ................................ 104
I-3.4. Summa y o he syn he ic ou es employed o he p epa a ion o hyb id quinolin-8-
yl phosphine oxide de i a i es 6 and 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxide
de i a i es 7 ...................................................................................................................... 108
I-4. Syn hesis o hyb id dialkyl 1,2,3,4- e ahyd oquinolinylphosphona es and dialkyl
quinolinylphosphona es ........................................................................................................ 110
I-4.1. Syn hesis o anilines subs i u ed wi h dialkyl phosphona e 1b, 1c and 1d ............ 110
I-4.2. Syn hesis o dialkyl quinolin-8-ylphosphona es ....................................................... 114
I-4.3. Syn hesis o hyb id die hyl 1,2,3,4- e ahyd oquinolin-6-ylphosphona es and die hyl
quinolin-6-ylphosphona es ............................................................................................... 125

I-5. Syn hesis o hyb id dialkyl indeno[2,1-c]quinolinylphosphona es.................................132
I-5.1. Syn hesis o dialkyl e ahyd o-5H-indeno[2,1-c]quinolinylphosphona es ............. 132
I-5.2. Syn hesis o dialkyl 7H-indeno[2,1-c]quinolinylphosphona es and dialkyl 7-oxo-7H-
indeno[2,1-c]quinolinylphosphona es .............................................................................. 138
Chap e II. S udy o he in i o TOP1 inhibi o y ac i i y o he newly syn hesized quinoline
de i a i es ................................................................................................................................. 142
II-1. In oduc ion: in i o d ug sc eening o TOP1 inhibi o s .............................................. 143
II-1.1. DNA Relaxa ion assay .............................................................................................. 143
II-1.2. Nicking assay ........................................................................................................... 145
II-1.3. DNA clea age expe imen s based on syn he ic dsDNA (double s anded DNA)
subs a es speci ic o TOP1 .............................................................................................. 146
II-1.4. The REEAD assay: a DNA-based nanosenso sys em o he measu emen o TOP1
ac i i y ............................................................................................................................... 152
II-2. In i o e alua ion o he hTOP1B inhibi o y ac i i y o he newly syn hesized
compounds ............................................................................................................................ 155
II-2.1. In i o d ug sc eening o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides and
quinolin-8-yl phosphine oxides as TOP1 inhibi o s ........................................................... 156
II-2.1.1. E alua ion o TOP1 inhibi o y ac i i y by DNA elaxa ion assay .......................... 156
II-2.2. In i o d ug sc eening o dialkyl quinolinylphosphona es and dialkyl (indeno[2,1-
c]quinolinyl)phosphona es as TOP1 inhibi o s ................................................................. 167
II-3. De elopmen o he REEAD assay as a no el quan i a i e me hod o he in i o
e alua ion o he hTOP1B inhibi o y ac i i y in d ug sc eening ........................................... 181
II-3.1. The REEAD-on-a-slide app oach ............................................................................. 181
II-3.2. The Clea age/Liga ion REEAD assay (C/L REEAD) ................................................... 188
Chap e III. S udy o he in i o an ip oli e a i e ac i i y o he newly syn hesized quinoline
de i a i es ................................................................................................................................. 196
III-1. In oduc ion: Human TOP1B inhibi o s in cance chemo he apy ................................ 197
III-1.1. TOP1B inhibi o s as cance chemo he apeu ic d ugs in mul i a ge and d ug
combina ion he apies ...................................................................................................... 197
III-1.2. Enhanced d ug-deli e y sys ems o imp o e he pha macological p ope ies o
TOP1B inhibi o s ................................................................................................................ 199
III-1.3. Cu en s a us o TOP1B inhibi o s used in clinics ..................................................... 201
III-2. In oduc ion: in i o an ip oli e a i e ac i i y o TOP1 inhibi o s ........................... 204
III-2.1. Me abolic cell iabili y assays ................................................................................ 205
III-3. In i o e alua ion o he an ip oli e a i e ac i i y in human cell lines ........................ 209
III-3.1. In i o e alua ion o he an ip oli e a i e ac i i y in human cance cell lines o
1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6 and quinolin-8-yl phospine oxides 7
........................................................................................................................................... 212
III-3.2. In i o e alua ion o he an ip oli e a i e ac i i y in human cance cell lines o
dialkyl quinolinylphosphona es and dialkyl (indeno[2,1-c]quinolinyl)phosphona es ...... 217
III-4. Complemen a y an ip oli e a i e s udies o iden i y he lead compounds o he
phosphona e-subs i u ed quinoline and indenoquinoline amilies ...................................... 226
III-4.1. S udy o he an ip oli e a i e ac i i y in RPMI-8402 and CPT-K5 human cance cell
lines ................................................................................................................................... 227
III-4.2. S udy o he an ip oli e a i e ac i i y in HEK-293 and HEK-293 TOP1 KD (TOP1
knockdown) human cance cell lines ................................................................................ 232
IV. Addenda: S udy o he an ileishmanial e ec o phospho a ed quinoline de i a i es in
Leishmania in an um: in i o/ex i o cy o oxici y in L. in an um pa asi es and in i o inhibi o y
ac i i y agains Leishmania TOP1 (LTOP1) ................................................................................ 240
IV-1. In oduc ion: leishmaniasis ........................................................................................... 241
IV-1.1. Pa asi es om Leishmania species: he e hiological agen o leishmaniasis ............ 241
IV-1.2. Clinical o ms o leishmaniasis ............................................................................... 244
IV-1.3. T ea men o leishmaniasis ....................................................................................... 245
IV-1.4. LTOP1B as a d uggable a ge in an ileishmanial d ug disco e y .......................... 256
IV-2. S udy o he an ileishmanial e ec o phospho a ed quinoline de i a i es in Leishmania
in an um ................................................................................................................................ 261
IV-2.1. An ileishmanial e ec o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides and
quinolin-8-yl phosphine oxides ......................................................................................... 262
IV-2.2. An ileishmanial e ec o dialkyl quinolinyl phosphona es .................................... 266
V. Conclusions ........................................................................................................................... 272
VI. Expe imen al sec ion ........................................................................................................... 277
VI-1. Chemis y ...................................................................................................................... 278
VI-1.1 Gene al expe imen al in o ma ion ......................................................................... 278
VI-1.2. Syn hesis o quinolinylphosphine oxide de i a i es .............................................. 280
VI-1.3. Syn hesis o hyb id 1,2,3,4- e ahyd oquinolinyl and quinolinyl dialkyl
phosphona es .................................................................................................................... 296
VI-1.4.. Syn hesis o o hyb id dialkyl indeno[2,1-c]quinolinylphosphona es ................... 327
VI-2. TOP1 assays .................................................................................................................. 341
VI-2.1. Ma e ials and enzyme ........................................................................................... 341
VI-2.2. DNA elaxa ion assay ............................................................................................. 341
VI-2.3. Nicking assay .......................................................................................................... 355
VI-2.4. Clea age- eliga ion equilib ium assay ................................................................... 366
VI-2.5. REEAD assay .......................................................................................................... 366
VI-3. Cell iabili y assays ........................................................................................................ 369
VI-3.1. Cell cul u e ............................................................................................................. 369
VI-3.2. CCK-8 cell iabili y assays ....................................................................................... 370
VI-3.3. P es oBlue cell iabili y assays...............................................................................435
VI-3.4. siRNA media ed TOP1 knockdown in HEK-293 cell line ........................................ 457
VI-3.5. Wes e n blo analysis o HEK-293 cells ans ec ed wi h siRNATOP1, sc ambled siRNA
and mock con ol .............................................................................................................. 457
1
Abb e ia ions, ac onyms and symbols
8
1. Topoisome ase I as a a ge in an icance d ug esea ch
Cance is a majo heal hca e p oblem and a global dea h leading cause. Acco ding o i s la es
Cance Global Cance Obse a o y) es ima ed an incidence o 19 million new cance cases, mo e
han 50 million p e alen cases and a ound 10 million dea hs di ec ly associa ed o cance in
2020 wo ldwide 1. Fu he mo e, GLOBOCAN p edic s ha he e will be 28.9 new cance cases
by 2040 based on he ac ual end and expec ed demog aphical changes, p ima ily associa ed
o he con empla ed imp o emen o socioeconomic condi ions in de eloping coun ies and he
ela ed popula ion g ow h and enla gemen o li e expec ancy.
The majo pu pose o cance he apy is o speci ically inhibi he g ow h and sp ead cance cells
and in his ega d, he apies in ol ing con en ional chemo he apy, adio he apy,
immuno he apy and su ge y a e applied, along wi h he eme ging p ecision medicine
app oaches2. E en hough, chemo he apeu ic d ugs emain playing a key ole in he oncologic
ea men alone o as an essen ial pa o a a ge ed cance he apy and hence, he de elopmen
o selec i e, sa e and mo e pha macologically ac i e compounds ep esen s an ac i e a ea o
esea ch in d ug disco e y and medicinal chemis y3. Acco dingly, human DNA opoisome ase I
(TOP1) cons i u es a b oadly explo ed alida ed he apeu ic a ge and he e o e, TOP1 inhibi o
d ugs ha e eme ged as po en ial an icance agen s, highligh ing he ac ha some TOP1
inhibi o s ha e eached o he clinical app o al and a e cu en ly adminis e ed alone o as a
payload o a pha maceu ical composi ion4.
1.1. DNA opoisome ases
His o ical pe spec i e: he disco e y o opoisome ases, DNA opology-modula ing enzymes
essen ial o genome s abili y and DNA me abolism.
The double helical s uc u e o DNA is supe coiled as a means o compac ing he genome o a
s able and secu e s o ing o he gene ic in o ma ion. Main aining an app op ia e opological
1 a) Sung H, Fe lay J, Siegel RL, e al. Global Cance S a is ics 2020: GLOBOCAN Es ima es o Incidence and
Mo ali y Wo ldwide o 36 Cance s in 185 Coun ies. CA Cance J Clin. 2021;71(3):209-249.
doi:10.3322/caac.21660 b) GLOBOCAN 2020 da abase. Accessed May 3, 2022 a h ps://gco.ia c. /
2 Mollaei M, Hassan ZM, Kho shidi F, Lang oudi L. Chemo he apeu ic d ugs: Cell dea h- and esis ance-
ela ed signaling pa hways. A e hey eally as sma as he umo cells?. T ansl Oncol. 2021;14(5):101056.
doi:10.1016/j. anon.2021.101056
3 Kuma B, Singh S, Sk o so a I, Kuma V. P omising Ta ge s in An i-cance D ug De elopmen : Recen
Upda es. Cu Med Chem. 2017;24(42):4729-4752. doi:10.2174/0929867324666170331123648
4 Thomas A, Pommie Y. Ta ge ing Topoisome ase I in he E a o P ecision Medicine. Clin Cance Res.
2019;25(22):6581-6589. doi:10.1158/1078-0432.CCR-19-1089

9
s a e o DNA was assumed o be essen ial e en be o e DNA opoisome ases we e disco e ed,
ei he by DNA winding when genes ha e o be s o ed o by DNA unwinding when s and
sepa a ion is equi ed o access he gene ic in o ma ion5. In his ega d, unde s anding he
coiling and angling o he DNA du ing i s me abolic manipula ion en ailed an issue since he
deciphe ing o he double helical a chi ec u e o he genomic DNA molecule6.
The i s indica ions o a supe coiled s a e in he DNA we e epo ed by Vinog ad and
collabo a o s in 1965 while wo king wi h double-s anded DNA (dsDNA) polyoma umou
i uses7. Du ing DNA-sedimen a ion analysis, Vinog ad ound wo o ms o ci cula dsDNA wi h
di e en compac ness-deg ee. The mos compac o m o dsDNA epo ed a highe esis ance
o dena u a ion by hea ing o exposu e o ele a ed pH. Su p isingly, elec on-mic oscopy
analysis demons a ed ha he unique s uc u al di e ence be ween he wo o ms o dsDNA
was he p esence o a single-s anded b eakage in he less compac o m, p esumably by he
endonuclease ac i i y o a DNase I enzyme. In ligh o hese indings, Vinog ad and collabo a o s
i s ly sugges ed he exis ence o wo ci cula dsDNA wi h he same chemical o mula and
s e eochemis y bu a ying in how he double-helix o DNA is wounded a ound i sel in he
h ee-dimensional space ( opology), i.e. he p esence o DNA opoisome s di e en ia ed by
hei supe coiling s a e. One yea la e , Vinog ad and Lebowi z p oposed he heo y o DNA
supe coiling and es ablished he basis o he quan i a i e measu e o he DNA supe coiling
s a e8, namely he Linking numbe o Lk ( he numbe o he double-helical u ns in he linea
molecule o a ci cula dsDNA), which is de ined as he sum o he wis (coiling o indi idual
s ands o DNA a ound he axis o DNA helix) and he w i he (coiling o he axis o DNA helix
i sel in he space)9.
A ha ime, i was hough ha he elaxa ion ac i i y o supe coiled DNA was p oduced by a
sequence o endonuclease (DNase I)-DNA ligase ac i i y o wo independen enzymes. Howe e ,
in he la e 1960s Wang pu i ied an E. coli cell lysa e epo ing he pu a i e endonuclease-ligase
ac i i y in a posi i ely cha ged DEAE (die hylaminoe hyl cellulose) column and he ob ained a
single enzyme esponsible o he emo al o nega i e supe coils (Figu e 1) in a ci cula dsDNA
5 a) Wa son JD, C ick FH. The s uc u e o DNA. Cold Sp ing Ha b Symp Quan Biol. 1953;18:123-131.
doi:10.1101/sqb.1953.018.01.020
6 a) Delb ück M. On he eplica ion o desoxy ibonucleic acid (DNA). P oc Na l Acad Sci U S A.
1954;40(9):783-788. doi:10.1073/pnas.40.9.783
7 Vinog ad J, Lebowi z J, Radlo R, Wa son R, Laipis P. The wis ed ci cula o m o polyoma i al DNA.
P oc Na l Acad Sci U S A. 1965;53(5):1104-1111. doi:10.1073/pnas.53.5.1104
8 Vinog ad J, Lebowi z J. Physical and opological p ope ies o ci cula DNA. J Gen Physiol. 1966;49(6):103-
125. doi:10.1085/jgp.49.6.103
9 Whi e JH. Sel -linking and he gauss in eg al in highe dimensions. Am J Ma h. 1969;91(3):693-728. doi:
10.2307/2373348
10
by a combina ion o bo h endonuclease ac i i y (which allows he swi el o he pa en al DNA
s ands) and DNA ligase ac i i y ha seals he b eakage in he phospha e backbone10. Wang and
eloci y o he cen i uge, as a ha ime he DNA elaxa ion ac i i y was usually e alua ed by
ul acen i uga ion) and published he wo k in 1971, esul ing his E.coli
opoisome ase o be disco e ed11.
Likewise, in 1972 Champoux and cowo ke s published he inding o an enzyme isola ed om
mouse emb yonic cells wi h DNase I-DNA ligase sequen ial ac i i y, which epo ed no only o
elax nega i ely supe coiled DNA, bu also o esol e posi i ely supe coiled dsDNA subs a es12
euka yo ic opoisome ase.
Figu e 1. Gene al o e iew o nega i ely (le side, in blue) and posi i ely ( igh side, in g een) supe coiled dsDNA,
along wi h he co esponding elaxed o m o ci cula dsDNA in be ween. In he middle o he igu e (abo e) he wo
possible plec onemic supe coils a e illus a ed: by consensus, in a bidimensional plane, nega i e plec onemic
supe coils p esen a clockwise c osso e , while posi i e plec onemic supe coils a e d awn showing a coun e -
clockwise c osso e .
e isola ed om many bo h euka yo ic and p oka yo ic
sou ces (human, monkey, a , og, duck, chicken, D osophila lies, Bacillus bac e ia and yeas s,
10 Wang JC. A jou ney in he wo ld o DNA ings and beyond. Annu Re Biochem. 2009;78:31-54.
doi:10.1146/annu e .biochem.78.030107.090101
11 Wang JC. In e ac ion be ween DNA and an Esche ichia coli p o ein omega. J Mol Biol. 1971;55(3):523-
533. doi:10.1016/0022-2836(71)90334-2
12 Champoux JJ, Dulbecco R. An ac i i y om mammalian cells ha un wis s supe helical DNA--a possible
swi el o DNA eplica ion (polyoma-e hidium b omide-mouse-emb yo cells-dye binding assay). P oc Na l
Acad Sci U S A. 1972;69(1):143-146. doi:10.1073/pnas.69.1.143
11
among o he s), bu his enzyme amily did no ha e ye a sys ema ic name o desc ibe hei
enzyma ic mode o ac ion13. Ne e heless, s udies wi h hese enzymes led o he disclosu e o
hei ca aly ic mechanism, which comp ises he in oduc ion o a ansien b eak in he dsDNA
phospha e backbone ha allows he swi el o he DNA chains a ound he gap and a subsequen
esealing o he b eakage. Once disclosed he ca aly ic mechanism, he enzymes p e iously
14, a e m ha
accu a ely de ines hei selec i e unc ion in modula ing he DNA opology. Since hen,
opoisome ases ha e been desc ibed in all h ee cellula domains o li e (A chaea, Bac e ia and
Euca ya) and we e u he classi ied acco ding o hei ca aly ic mechanism and domain
o ganiza ion.
DNA opoisome ases: s uc u e, mechanism and classi ica ion
DNA opoisome ases a e ubiqui ous enzymes ha esol e DNA opological ension in he
genome du ing essen ial cellula p ocesses as DNA eplica ion, ansc ip ion, ch omosome
seg ega ion and ecombina ion. The gene al mechanism o DNA opoisome ases in ol es a
clea age o he dsDNA phospha e backbone by he ca aly ic Ty (Ty osine) esidue o he
opoisome ase, esul ing in a co alen phosphodies e linkage be ween he Ty and he e minus
o he clea ed s and (TOPCC, opoisome ase clea age complex). The scission in he dsDNA
pe mi s he DNA o swi el a ound he nick and hen he enzyme eseals he gap, lea ing he
dsDNA in ac and elaxing nega i e o /and posi i e supe coils15. Mo eo e , bac e ial DNA gy ase
( ype II opoisome ase) and e e se gy ase ( ype I opoisome ase) a e opoisome ases p esen
in bac e ia wi h he abili y o in oduce nega i e o posi i e supe coils in o he DNA,
espec i ely16.
The e a e h ee di e en nomencla u es used in he classi ica ion o DNA opoisome ases, i.e.
his o ical (I-VI), mechanis ic and e olu iona y nomencla u es. This ac may lead o con usion
bu o una ely, he phylogene ic ea u es ha allow he e olu iona y classi ica ion17 a e in
conco dance and u he suppo he cha ac e is ics used o he mechanis ic ca ego iza ion15.
13 Champoux JJ. P o eins ha a ec DNA con o ma ion. Annu Re Biochem. 1978;47:449-479.
doi:10.1146/annu e .bi.47.070178.002313
14 Ki kegaa d K, Wang JC. Esche ichia coli DNA opoisome ase I ca alyzed linking o single-s anded ings
o complemen a y base sequences. Nucleic Acids Res. 1978;5(10):3811-3820. doi:10.1093/na /5.10.3811
15 Schoe le AJ, Be ge JM. DNA opoisome ases: ha nessing and cons aining ene gy o go e n
ch omosome opology. Q Re Biophys. 2008;41(1):41-101. doi:10.1017/S003358350800468X
16 Champoux JJ. DNA opoisome ases: s uc u e, unc ion, and mechanism. Annu Re Biochem.
2001;70:369-413. doi:10.1146/annu e .biochem.70.1.369
17 Fo e e P, Gadelle D. Phylogenomics o DNA opoisome ases: Thei o igin and pu a i e oles in he
eme gence o mode n o ganisms. Nucleic Acids Res. 2009;37(3):679-692. doi: 10.1093/na /gkp032
12
Acco dingly, based on he Lk numbe al e a ion and he numbe o clea ed s ands, DNA
opoisome ases can be classi ied in o ype I and ype II sub amilies. Type I opoisome ases
(TOP1) a e ATP-independen DNA modula ing enzymes ha elax supe coil ension by
in oducing ansien single-s and b eaks (SSB) in dsDNA subs a es and change he Lk by uni s
Lk = ±1), while ype II opoisome ases (TOP2) equi e Mg2+ and coupled ATP-hyd olysis in
o de o elax supe coils (and also deca ena e/unkno ) dsDNA by in oducing double-s anded
b eaks (DSB) and al e ing he Lk Lk = ±2)16.
Type I opoisome ases (TOP1)
Acco ding o hei ca aly ic mechanism, sequence and domain o ganiza ion, ype I
opoisome ases a e u he di ided in o h ee g oups: IA, IB and IC. In he clea age s ep o
enzyma ic ca alysis, ype IA opoisome ases o m a TOP1CC (TOP1 clea age complex) in which
he ca aly ic Ty esidue o he enzyme emains co alen ly bounded (pospho y osine linkage) o
nd passes by an enzyme-b idged
s and passage mechanism h ough he ansien nick ( he s and passes wi hou swi elling
ac oss he enzyme-b idged ga e, as depic ed in Figu e 2) and inally he enzyme eliga es he
clea ed s and lea ing he DNA duplex elaxed and in ac 18. A his poin , i has o be men ioned
ha di alen me allic ca ions (mainly Mg2+) a e necessa y co ac o s o TOP1A ca alysis, in
pa icula o o ien he ee hyd oxyl g oup o he clea ed s and o he phospho y osine bound
and a ou he eliga ion19. On he con a y, in IB and IC sub amilies he Ty esidue emains
o a con olled s and o a ion mechanism in which he second s and o a es (swi els) a ound
he ansien nick, as illus a ed in he Figu e 220. TOP1B and TOP1C do no need Mg2+ ca ions o
be ac i e, e en hough i is epo ed ha bi alen me allic ca ions as Mg2+, Mn2+ and Ca2+ could
s imula e TOP1B ac i i y as much as 25- old21.
18 Dekke NH, Rybenko VV, Dugue M, e al. The mechanism o ype IA opoisome ases. P oc Na l Acad
Sci U S A. 2002;99(19):12126-12131. doi:10.1073/pnas.132378799
19 Co be KD, Be ge JM. S uc u e, molecula mechanisms, and e olu iona y ela ionships in DNA
opoisome ases. Annu Re Biophys Biomol S uc . 2004;33:95-118.
doi:10.1146/annu e .biophys.33.110502.140357
20 Cap anico G, Ma inello J, Chillemi G. Type I DNA Topoisome ases. J Med Chem. 2017;60(6):2169-2192.
doi:10.1021/acs.jmedchem.6b00966
21 S ewa L, I e on GC, Pa ke LH, Madden KR, Champoux JJ. Biochemical and biophysical analyses o
ecombinan o ms o human opoisome ase I. J Biol Chem. 1996;271(13):7593-7601.
doi:10.1074/jbc.271.13.7593
13
Figu e 2. Ca aly ic mechanism o TOP1 enzymes: ype IA opoisome ases esol e posi i e/nega i e supe coils by a
s and passage mechanism, while ype IB/C opoisome ases e ec con olled s and o a ion.
Type II opoisome ases (TOP2)
Type II opoisome ases sha e he mode o elaxing supe coils by o ming an enzyme-b idged
DSB in he DNA duplex and e ec ing a s and passage o ano he dsDNA segmen h ough he
nick, which is subsequen ly esealed16. Type II opoisome ases a e u he di ided in o IIA
(TOP2A) and IIB (TOP2B) subclasses acco ding o hei sequence and domain s uc u e. The ype
IIA opoisome ase amily comp ises he euka yo ic TOP2 (including he human TOP2 and
TOP2 iso o ms), i al/bac e iophage TOP2 and bac e ial DNA gy ase and TopoIV. On he o he
hand, he p esence o ype IIB opoisome ases is es ic ed o A chaea o ganisms, plan s and
algae15.
1.2. Ta ge ing human ype IB opoisome ase (hTOP1B)
Ta ge ing opoisome ases in d ug esea ch
The human genome encodes six DNA opoisome ases: wo ype IB (nuclea TOP1B and
mi ochond ial TOP1B), wo ype IIA (TOP2 , TOP2 ) and wo ype IA opoisome ases (TOP3

14
and TOP3 22. Among human opoisome ases, nuclea TOP1 and TOP2 a e well-es ablished and
alida ed he apeu ic a ge s o an icance d ugs. Rega ding TOP2, he chemo he apeu ic d ugs
e oposide, doxo ubicin and mi oxan one a e in e acial inhibi o s (poisons) o TOP2 ha ac by
s abilizing TOP2CC (TOP2 clea age complexes), whe eas he TOP2 ca aly ic inhibi o
dex azoxane is used as an adju an o dec ease he ca dio oxici y induced by doxo ubicin23.
Besides human opoisome ases, euka yo ic TOP1B o Leishmania genus is epo ed as an
eme ging d uggable a ge o he de elopmen o an ileishmanial agen s wi h he apeu ic
po en ial24. In like manne , mo ing on o p oka yo ic opoisome ases, bac e ial DNA gy ase (a
ype IIA opoisome ase) is he biomolecula a ge o cu en an ibio ics quinolones and
couma in. Fu he mo e, ype IA bac e ial opoisome ase has been iden i ied as a biological
a ge and consequen ly, selec i e bac e ial TOP1A inhibi o s a e unde in es iga ion o he
de elopmen o new an ibio ics agains Mycobac e ium ube culosis, Helicobac e pylo i,
Pseudomonas ae uginosa and S ep ococcus pneumoniae in ec i e agen s25. Wi hin he con ex
o his in oduc ion, he p esen sec ion will ocus mainly on human TOP1B inhibi o s, since
human (nuclea ) TOP1 has been he mos widely s udied DNA opoisome ase as a biological
a ge in medicinal chemis y26.
TOP1B ca aly ic cycle
Among ype IB opoisome ases in euka yo ic cells, human nuclea opoisome ase 1 (hTOP1) is a
b oadly s udied biological a ge in an icance d ug disco e y. Euka yo ic TOP1B emo e
nega i e and posi i e supe coils in dsDNA by means o a ca aly ic cycle comp ising 5 s eps, as
depic ed in Figu e 3: (A) Binding: he enzyme binds o he DNA duplex. (B) Clea age:
Nucleophilic a ack by he ca aly ic y osine esidue (loca ed a he posi ion 723 in humans) o a
DNA phosphodies e g oup ( anses e i ica ion eac ion) o in oduce a SSB. The eac ion esul s
in a co alen TOP1-DNA clea age complex (TOP1CC) ha allows he con olled s and o a ion
22 Pommie Y, Nussenzweig A, Takeda S, Aus in C. Human opoisome ases and hei oles in genome
s abili y and o ganiza ion [published online ahead o p in , 2022 Feb 28]. Na Re Mol Cell Biol. 2022;1-
21. doi:10.1038/s41580-022-00452-3
23 Delgado JL, Hsieh CM, Chan NL, Hiasa H. Topoisome ases as an icance a ge s. Biochem J.
2018;475(2):373-398. Published 2018 Jan 23. doi:10.1042/BCJ20160583
24 Regue a RM, Elmahallawy EK, Ga cía-Es ada C, Ca bajo-And és R, Balaña-Fouce R. DNA
Topoisome ases o Leishmania Pa asi es; D uggable Ta ge s o D ug Disco e y. Cu Med Chem.
2019;26(32):5900-5923. doi:10.2174/0929867325666180518074959
25 Seddek A, Annamalai T, Tse-Dinh YC. Type IA Topoisome ases as Ta ge s o In ec ious Disease
T ea men s. Mic oo ganisms. 2021;9(1):86. Published 2021 Jan 1. doi:10.3390/mic oo ganisms9010086
26 Ma ín-Encinas E, Selas A, Palacios F, Alonso C. The design and disco e y o opoisome ase I inhibi o s
as an icance he apies [published online ahead o p in , 2022 Ma 23]. Expe Opin D ug Disco . 2022;1-
21. doi:10.1080/17460441.2022.2055545
15
(C) o he clea ed s and. (D)Religa ion: he anses e i ica ion eac ion is e e sible and he
ansien DNA nick o med in he clea age s ep is eliga ed by TOP1 h ough he nucleopilic
a ack o he ee hyd oxyl (OH- -end o
e minus. (E) Unbinding: inally, he enzyme lea es he DNA in ac and elaxed.
Figu e 3. Ca aly ic cycle o TOP1B.
TOP1 inhibi o s: poisons o supp esso s
The c ys alliza ion o human TOP1CC s abilized by he exogenous ligand camp o hecin (CPT, a
na u al alkaloid compound wi h a selec i e TOP1B inhibi o y ac i i y) allowed i s
cha ac e iza ion by X- ay di ac ion (Figu e 4, 1T8I PDB). The s udy o he CPT-TOP1B-dsDNA
e na y complex e ealed he mode o ac ion o he na u al TOP1B inhibi o CPT and i s syn he ic
de i a i es opo ecan and SN-38, which ac ually a e clinically ele an an icance d ugs.
16
Acco dingly, based on hei mode o ac ion TOP1 inhibi o s a e mainly classi ied in o TOP1
poisons (o in e acial inhibi o s) and TOP1 supp esso s27.
Figu e 4. 1T8I PDB c ys al s uc u e o human TOP1-CPT-DNA e na y complex in 3D ob ained by X- ay di ac ion.
Ins ead o inhibi ing he enzyme in a di ec manne , TOP1 in e acial inhibi o s a ge he
mac omolecula in e ace o ca aly ic in e media es when TOP1 is co alen ly bounded o DNA
(hence he name). TOP1 in e acial inhibi o s a e also known as poisons, as hey s abilize he
o he TOP1 ca aly ic cycle28.
As depic ed in he Figu e 5, clea age and eliga ion s eps o TOP1B ca aly ic cycle a e in
equilib ium (displaced owa d eliga ion in o de o inish he cycle) as he anses e i ica ion
eac ion ca alyzed by he Ty esidue is a e e sible p ocess ha may u n backwa ds (by he
F om a pha macodynamic poin o iew, poison-like TOP1 inhibi o s a ge he ca aly ic
in e media es TOP1CCs, whe eas supp esso -like TOP1 inhibi o s ac by in e e ing in any o he
ca aly ic s ep o TOP1 cycle wi hou apping TOP1CCs (e.g. impeding he binding/unbinding o
he enzyme o hinde ing he clea age s ep)20 and a e also e e ed as ca aly ic inhibi o s in he
scien i ic li e a u e.
27 Pommie Y. DNA opoisome ase I inhibi o s: chemis y, biology, and in e acial inhibi ion. Chem Re .
2009;109(7):2894-2902. doi:10.1021/c 900097c
28 Pommie Y, Kisele E, Ma chand C. In e acial inhibi o s. Bioo g Med Chem Le . 2015;25(18):3961-3965.
doi:10.1016/j.bmcl.2015.07.032
17
Figu e 5. A schema ic o e iew o he clea age- eliga ion equilib ium in TOP1B.
In ega d o poison-like TOP1 inhibi o s, he accumula ion o apped TOP1CCs esul s in DNA
damage by collision wi h eplica ion o ks o ansc ip ion machine y, and subsequen apop osis
o he cell4. Consequen ly, he cy o oxic e ec o poisons such as CPT co ela es di ec ly wi h he
le el o in acellula ac i i y o TOP1. This ac has con e TOP1 poisons in o sui able
chemo he apeu ic d ugs since cance cells show an inc eased TOP1 ac i i y and a highe
eplica ion a e han non-cance cells29.
1.3. De elopmen o human TOP1B (hTOP1) inhibi o s as cance chemo he apeu ic d ugs
in medicinal chemis y
In he p esen sec ion, he mos ele an human TOP1B inhibi o s epo ed in he scien i ic
li e a u e a e going o be classi ied, analysing i s hose ones de i ed om na u al sou ces and
hen semisyn he ic/syn he ic TOP1 inhibi o s de eloped as cance chemo he apeu ic d ugs o
d ug candida es.
1.3.1. Na u al compounds a ge ing hTOP1B
Na u al p oduc s ep esen an impo an sou ce o an icance d ugs, highligh ing he ac ha
mo e han he hal o he d ugs used in cance chemo he apy a e based on na u al compounds30.
Rega ding na u al an icance d ugs a ge ing TOP1, he mos ep esen a i e example is
camp o hecin (CPT, 1, Figu e 6). Camp o hecin is a na u al alkaloid i s ly isola ed in 1963 om
he ba k and wood o he Chinese ee Camp o eca acumina a, which p esen ed a s ong and a
wide-spec um an icance ac i i y in se e al cy o oxici y in i o sc eenings as well as in a mouse
29 Pos ma C, Koopman M, Bu a TE, e al. DNA copy numbe p o iles o p ima y umo s as p edic o s o
esponse o chemo he apy in ad anced colo ec al cance . Ann Oncol. 2009;20(6):1048-1056.
doi:10.1093/annonc/mdn738
30 Newman DJ, C agg GM. Na u al P oduc s as Sou ces o New D ugs o e he Nea ly Fou Decades om
01/1981 o 09/2019. J Na P od. 2020;83(3):770-803. doi:10.1021/acs.jna p od.9b01285
24
chemo he apeu ic ea men s igge s he eme ging o esis ance owa d CPT59. In ligh o he
a o emen ioned d awbacks and aking in o accoun he high an icance po en ial o CPT due o
a TOP1-poison mode o ac ion, scien i ic e o s we e ini ia ed ocusing in he SAR (s uc u e-
ac i i y ela ionship) op imiza ion o he CPT s uc u e in o de o imp o e he pha macokine ic
p o ile and clinical e icacy o he na u al pa en al compound.
The main poin s o in oduce modi ica ions in he CPT sca olds a e A and B ings (Figu e 9). The
inse ion o hyd ophilic subs i uen s in posi ions C9, C10 and C11 inc eases he wa e solubili y
o he d ug, while B ing unc ionaliza ion a C7 wi h lipophilic subs i uen s enhances he
biological ac i i y and he lac one s abili y58.
Some mino modi ica ions in he E ing a e well ole a ed in o de o s abilize he lac one wi hou
dec easing he biological ac i i y (Figu e 9), while modi ica ions in C and D ings (including he
ca bonyl g oup o he py idine ing) lead o he loss o he biological e ec 60.
A- ing modi ica ions
The in oduc ion o a N-alkyl chain a C9 esul s in he imp o emen o biological ac i i y and
wa e solubili y. Following his s a egy, he inse ion o side alkyl chains wi h e ia y amines a
C9 led o he de elopmen o d ugs as opo ecan (23, Figu e 10), a clinically used TOP1 poison
wi h enhanced hyd ophilic p ope ies as he e ia y amine is cha ged a physiological pH61. In
he same way, belo ecan (24, Figu e 10) is ano he CPT de i a i e wi h a seconda y amino g oup
a C9 ha inc eases e en mo e he wa e solubili y62.
Simila ly, he inse ion o a ni o g oup in C9 ga e place o he de elopmen o he wa e
insoluble CPT de i a i e ubi ecan (25, Figu e 10), a s ong an ip oli e a i e TOP1 poison which
was ini ially o ien ed o be o ally adminis a ed. The equilib ium be ween 9-ni ocamp o hecin
(inac i e o m) and i s me aboli e 9-aminocamp o hecin (ac i e and hyd osoluble o m) was
59 Tesau o C, Mo ozzo della Rocca B, O a iani A, e al. Molecula mechanism o he camp o hecin
esis ance o Glu710Gly opoisome ase IB mu an analyzed in i o and in silico. Mol Cance .
2013;12(1):100. doi:10.1186/1476-4598-12-100
60 Huang Q, Wang L, Lu W. E olu ion in medicinal chemis y o E- ing-modi ied Camp o hecin analogs as
an icance agen s. Eu J Med Chem. 2013;63:746-757. doi:10.1016/j.ejmech.2013.01.058
61 Jaxel C, Kohn KW, Wani MC, Wall ME, Pommie Y. S uc u e-ac i i y s udy o he ac ions o camp o hecin
de i a i es on mammalian opoisome ase I: e idence o a speci ic ecep o si e and a ela ion o
an i umo ac i i y. Cance Res. 1989;49(6):1465-1469
62 Kim JH, Lee SK, Lim JL, Shin HJ, Hong CI. P e o mula ion s udies o a no el camp o hecin an icance
agen , CKD-602: physicochemical cha ac e iza ion and hyd oly ic equilib ium kine ics. In J Pha m.
2002;239(1-2):207-211. doi:10.1016/s0378-5173(02)00099-6

25
p edic ed o be displaced owa ds he amino o m, bu clinical ials we e inally in e up ed due
o a limi ed an i umo ac i i y63.
Figu e 10. A- ing modi ica ions in he CPT sca old.
10-Hyd oxycamp o hecin (10-OH-CPT) is a na u al alkaloid ha also occu s na u ally in
Camp o heca acumina a. The p esence o a hyd oxyl g oup in C10 was demons a ed o imp o e
he biological ac i i y in i o64. This hyd oxyl g oup in posi ion C10 has been main ained in some
CPT semisyn he ic analogues such as opo ecan (23, Figu e 10) and SN-38 (26, Figu e 10), while
63 Cla k JW. Rubi ecan. Expe Opin In es ig D ugs. 2006;15(1):71-79. doi:10.1517/13543784.15.1.71
64 Das B, Madhusudhan P, Reddy PV, Ani ha Y. Na u al camp o hecins. Ind J Chem. 2001;40b:453-464
26
10-OH-CPT de i a i es (27, Figu e 6) we e p epa ed by he ans o ma ion o he e ia y amine
o opo ecan hyd ochlo ide in o alkyl hiome hyl unc ionali ies in he p esence o hiols65.
De i a iza ion o he 10-OH subs i uen has led o he p epa a ion o p od ugs (compounds 28,
Figu e 10) ha p ese e he alcohol g oup. In his ega d, i ino ecan (28a) is a b oadly s udied
and clinically used d ug o med by a dipipe idino moie y linked h ough an es e bond o he
C10 posi ion o 7-e hyl-10-hyd oxycamp o hecin, which is hyd olyzed in i o o ob ain he
pa en d ug SN-38 (4, Figu e 10) a e in a enous adminis a ion66. Mo e ecen ly, a 10-OH-
CPT p od ug (F-10, 28b, Figu e 6) p o ec ed wi h a pipe idin-1-yl moie y epo ed p omising
an ip oli e a i e e ec and TOP1 inhibi ion in i o, as well as an imp o ed an i umo e ec in a
xenog a model compa ing o he e e ence SN-3867. Ano he ema kable example is he
compound 28c, a p od ug o 10-OH-CPT which was ound o be 80 imes mo e soluble han he
pa en al d ug, e en hough i was signi ican ly less cy o oxic han he unp o ec ed compound in
i o68.
Inspi ed by he s a egy o p o ec ing 10-OH in CPT de i a i es, some g oups ha e ocused in
he p epa a ion o CPT de i a i es combining subsi u ions in C9 and C10 (compounds 29, Figu e
10). In his con ex , 1,3-oxazine- used camp o hecins (29a) we e ound o p esen imp o ed in
i o cy o oxici ies compa ed o he e e ences CPT and opo ecan69, while 9,10-[1,3]-
dioxocamp o hecin 29b showed simila biological beha iou wi h an enhanced pha macokine ic
p o ile70. Rega ding hexacyclic analogues o CPT, he inse ion o halogena ed subs i uen s and
an ex a alicyclic ing o he AB quinoline ing sys em led o he de elopmen o exa ecan (30,
65 Tan H, Wang G, Li J, e al. Syn hesis o no el 10-hyd oxycamp o hecin de i a i es u ilizing opo ecan
hyd ochlo ide as o ho-quinoneme hide p ecu so . Bioo g Med Chem. 2015;23(1):118-125.
doi:10.1016/j.bmc.2014.11.020
66 Bailly C. I ino ecan: 25 yea s o cance ea men . Pha macol Res. 2019;148:104398.
doi:10.1016/j.ph s.2019.104398
67 Fan S, Cao YX, Li GY, e al. F10, a new camp o hecin de i a i e, was iden i ied as a new o ally-
bioa ailable, po en an i umo agen . Eu J Med Chem. 2020;202:112528.
doi:10.1016/j.ejmech.2020.112528
68 Leu YL, Chen CS, Wu YJ, Che n JW. Benzyl e he -linked glucu onide de i a i e o 10-
hyd oxycamp o hecin designed o selec i e camp o hecin-based an icance he apy. J Med Chem.
2008;51(6):1740-1746. doi:10.1021/jm701151c
69 Wang S, Li Y, Liu Y, Lu A, You Q. No el hexacyclic camp o hecin de i a i es. Pa 1: syn hesis and
cy o oxici y o camp o hecins wi h an A- ing used 1,3-oxazine ing. Bioo g Med Chem Le .
2008;18(14):4095-4097. doi:10.1016/j.bmcl.2008.05.103
70 Rod íguez-Be na G, Mangas-Sanjuán V, Gonzalez-Al a ez M, e al. A p omising camp o hecin de i a i e:
Semisyn hesis, an i umo ac i i y and in es inal pe meabili y. Eu J Med Chem. 2014;83:366-373.
doi:10.1016/j.ejmech.2014.06.050
27
Figu e 10)71, a highly wa e soluble CPT de i a i e ound o be mo e ac i e han CPT, opo ecan
and SN-38 in i o and in i o72.
B- ing modi ica ions
The inse ion o lipophilic side chains in C7 as alkyl g oups has been demons a ed o enhance
he biological ac i i y o TOP1. Acco dingly, longe and bulkie alkyl chains inc eases he lipid
solubili y o he molecule, leading o a ou able lipophilic in e ac ions wi h he TOP1-DNA
clea age complex, which co ela es wi h a highe ac i i y73.
Silyl-subs i u ed CPT analogues (31, Figu e 11) we e desc ibed as a no el class o TOP1
inhibi o s74. Among hem, he 7-silyl subs i u ed de i a i es cosi ecan (31a) and sila ecan (31b)
we e epo ed as po en TOP1 poisons wi h imp o ed pha macokine ic p o ile.
71 Mi sui I, Kumazawa E, Hi o a Y, Aonuma M, Sugimo i M, Ohsuki S, Uo o K, Ejima A, Te asawa H, Sa o K.
A new wa e -soluble camp o hecin de i a i e, DX-8951 , exhibi s po en an i umo ac i i y agains human
umo s in i o and in i o. Jpn J Cance Res. 1995;86:776-782
72 a) Kumazawa E, Tohgo A. An i umou ac i i y o DX-8951 : a new camp o hecin de i a i e. Expe Opin
In es ig D ugs. 1998;7(4):625-632. doi:10.1517/13543784.7.4.625. b) Li F, Jiang T, Li Q, Ling X.
Camp o hecin (CPT) and i s de i a i es a e known o a ge opoisome ase I (Top1) as hei mechanism o
ac ion: did we miss some hing in CPT analogue molecula a ge s o ea ing human disease such as
cance ?. Am J Cance Res. 2017;7(12):2350-2394
73 Liang X, Wu Q, Luan S, e al. A comp ehensi e e iew o opoisome ase inhibi o s as an icance agen s
in he pas decade. Eu J Med Chem. 2019;171:129-168. doi:10.1016/j.ejmech.2019.03.034
74 Josien H, Bom D, Cu an DP, Zheng Y, Chou T. 7-silylcamp o hecins (sila ecans): A new amily o
camp o hecin an i umo agen s. Bioo g Med Chem Le . 1997;7(24):3189-3194. doi: 10.1016/S0960-
894X(97)10181-0
28
Figu e 11. B- ing and E- ing modi ica ions in he CPT sca old.
In like manne , he unc ionaliza ion wi h O-subs i u ed oxime subs i uen s a C7 (32, Figu e 11)
led o he de elopmen o he lipophilic de i a i e gima ecan (32a), an O- e -bu yl oxime
subs i u ed analogue ha epo ed an inc eased biological ac i i y on human umo xenog a
model in i o75. Ne e heless, no only lipophilic eplacemen s esul ed in success ul
modi ica ions, bu also nami ecan (32b), an O-(2-aminoe hyl)-subs i u ed oxime de i a i e,
esul ed in an enhanced pha macokine ic p o ile wi h a main ained biological ac i i y76.
75 DE Cesa e M. High E icacy o In a enous Gima ecan on Human Tumo Xenog a s. An icance Res.
2018;38(10):5783-5790. doi:10.21873/an ican es.12917
76 Be e a GL, Zuco V, De Cesa e M, Pe ego P, Za a oni N. Nami ecan: a hyd ophilic camp o hecin wi h a
p omising p eclinical p o ile. Cu Med Chem. 2012;19(21):3488-3501.
doi:10.2174/092986712801323252
29
E- ing modi ica ions
The mos limi ing d awback o CPTs is i s poo chemical s abili y due o he opening o he -
lac one ing. Hyd olysis o he lac one esul s in he opening o he six membe ed ing,
gene a ing a wa e -soluble ca boxyla e (Scheme 1)77. Hence, he displacemen o he lac one
(ac i e o m) owa ds he ca boxyla e (inac i e o m) hinde s he plasma s abili y. Mo eo e ,
he inac i e ca boxyla e o m binds eadily o human se um albumin, making i inaccessible o
cellula up ake and dec easing e en mo e he bioa ailabili y o he d ug78.
Scmeme 1. Hyd olysis o he -lac one ing o CPT a physiological condi ions.
In his ega d, he expansion o he lac one ing o a 7-membe ed sys em has led o he disco e y
o he mo e ac i e amily o homocamp o hecins (hCPT). The inse ion o a me hylene g oup
be ween he C20 and he ca boxyl g oup inc eases he chemical s abili y by a oiding he
con e sion o he lac one in o ca boxyla e79. The i s hCTP selec ed o clinical s udies was
di lomo ecan (33, Figu e 11). O al di lomo ecan showed a a ou able pha macokine ic p o ile
and a main ained biological ac i i y, e en hough he u ina y exc e ion was e y low. This d ug
candida e exposed a high bioa ailabili y bu conside ably a iabili y be ween he pa ien s80.
The lac one unc ion in he S con o ma ion was belie ed o be c ucial o he TOP1 inhibi o y
ac i i y. Su p isingly, he educ ion o he E ing size has been explo ed81, which led o a se ies
77 Fassbe g J, S ella VJ. A kine ic and mechanis ic s udy o he hyd olysis o camp o hecin and some
analogues. J Pha m Sci. 1992;81(7):676-684. doi:10.1002/jps.2600810718
78 Bu ke TG, Mi Z. P e e en ial binding o he ca boxyla e o m o camp o hecin by human se um albumin.
Anal Biochem. 1993;212(1):285-287. doi:10.1006/abio.1993.1325
79 a) La e gne O, Dema quay D, Bailly C, e al. Topoisome ase I-media ed an ip oli e a i e ac i i y o
enan iome ically pu e luo ina ed homocamp o hecins. J Med Chem. 2000;43(11):2285-2289.
doi:10.1021/jm000129j. b) Tangi ala RS, An ony S, Agama K, e al. Syn hesis and biological assays o E- ing
analogs o camp o hecin and homocamp o hecin. Bioo g Med Chem. 2006;14(18):6202-6212.
doi:10.1016/j.bmc.2006.05.073
80 Gelde blom H, Salaza R, Ve weij J, e al. Phase I pha macological and bioa ailabili y s udy o o al
di lomo ecan (BN80915), a no el E- ing-modi ied camp o hecin analogue in adul s wi h solid umo s. Clin
Cance Res. 2003;9(11):4101-4107
81 a) Hau e aye P, Cime iè e B, Pie é A, e al. Syn hesis and pha macological e alua ion o no el non-
lac one analogues o camp o hecin. Bioo g Med Chem Le . 2003;13(16):2731-2735. doi:10.1016/s0960-
894x(03)00534-1. b) Li M, Tang W, Zeng F, Lou L, You T. Semi-syn hesis and biological ac i i y o gamma-

30
o biologically ac i e CPT de i a i es wi h a 5-membe ed ke one ing. Among his amily o -
lac ones, compound 34 (Figu e 11) p esen ed a s ong in i o TOP1 ac i i y, compa able o
opo ecan and SN-38.
In o de o a oid he ans o ma ion o he lac one in o he inac i e ca boxylic acid, se e al o he
s a egies ha e been u he de eloped ocusing on he p o ec ion o he hyd oxyl g oup p esen
in he C20 o he CPT s uc u e. Such is he case o XMT-1001 (35a, Figu e 11), a CPT p od ug
unc ionalized wi h a PHF polyace al polyme (poly-1-hyd oxyme hyle hylene
hyd oxyme hyl o mal), was de eloped ia es e i ica ion o he hyd oxyl g oup o he lac one82.
XMT-1001 showed a wide he apeu ic window and an imp o ed d ug exposu e han CPT in
human umo xenog a models. Likewise, -amino acid es e p od ugs o CPT
(35b, Figu e 11) was succes ully explo ed ob aining a p edic able and sui able hyd olysis o he
es e bond and he consequen elease o CPT in physiological condi ions, which esul ed o be
pH dependan and p opo ional o he R side chain leng h.83. Fu he mo e, CPT p od ugs wi h
oluminous subs i uen s linked o he CPT sca old in C20 by ca bama e unc ionali ies
(compounds 36, Figu e 11) we e in es iga ed. Acco dingly, a amily o pegyla ed
sul onilamidines84 and a second se o sul onilamidines unc ionalized wi h phenyl subs i uen s85
we e ound o p esen mo e po en in i o an ip oli e a i e e ec han he e e ence d ugs CPT
and opo ecan.
1.3.2.2. Non-CPT de i a i es
Aside om CPT de i a i es, he e a e o he ele an amilies o syn he ic compounds desc ibed
as TOP1 inhibi o s, which in some cases ha e been de eloped s a ing om na u al d ugs
ob aining selec i e, po en and chemically s able syn he ic de i a i es. In he p esen sec ion,
lac ones analogs o camp o hecin. Bioo g Med Chem Le . 2008;18(24):6441-6443.
doi:10.1016/j.bmcl.2008.10.074
82 Yu ko e skiy AV, F am RJ. XMT-1001, a no el polyme ic camp o hecin p o-d ug in clinical de elopmen
o pa ien s wi h ad anced cance . Ad D ug Deli Re . 2009;61(13):1193-1202.
doi:10.1016/j.add .2009.01.007
83 Deshmukh M, Chao P, Ku sche HL, Gao D, Sinko PJ. A se ies o alpha-amino acid es e p od ugs o
camp o hecin: in i o hyd olysis and A549 human lung ca cinoma cell cy o oxici y. J Med Chem.
2010;53(3):1038-1047. doi:10.1021/jm901029n
84 Song ZL, Chen HL, Wang YH, e al. Design and syn hesis o no el PEG-conjuga ed 20(S)-camp o hecin
sul onylamidine de i a i es wi h po en in i o an i umo ac i i y ia Cu-ca alyzed h ee-componen
eac ion. Bioo g Med Chem Le . 2015;25(13):2690-2693. doi:10.1016/j.bmcl.2015.04.060
85 Song ZL, Wang MJ, Li L, e al. Design, syn hesis, cy o oxic ac i i y and molecula docking s udies o new
20(S)-sul onylamidine camp o hecin de i a i es. Eu J Med Chem. 2016;115:109-120.
doi:10.1016/j.ejmech.2016.02.070
31
he mos ep esen a i e amilies o semisyn he ic/syn he ic TOP1 inhibi o s will be sligh ly
exposed, a ending o a classi ica ion based on he cen al co e o he chemical s uc u e.
Indenoisoquinolines
Pommie , Cushman and collabo a o s de eloped indeno[1,2-c]isoquinoline de i a i es as s ong
TOP1 inhibi o s86. These indenoisoquinolines a e p obably he mos ema kable examples o
non-CPT like TOP1 poisons, which e ain be e he biological esponse owa d CPT- (and CPT
de i a i es-) esis an mu an o ms o TOP187. Among his amily o indenoisoquinolines, he
expe imen al d ugs indo ecan (LMP400), indimi ecan (LMP776) and LMP744 (Figu e 12) headed
o phase I and II clinical ials o he ea men o solid umo s as hey a e chemically mo e
s able, s abilize TOP1CCs mo e pe sis en ly and p esen an enla ged plasma-li e han CPT and
CPT de i a i es86.
Figu e 12. Indenoisoquinoline sca old con aining TOP1 inhibi o s.
A oma hecins
In like manne , Pommie and cowo ke s de eloped he so-called a oma hecins (Figu e 13), a se
o s able molecules ha we e ou lined as o mal composi es o CPT and indenoisoquinolines88.
These compounds possess a ema kable inhibi ion o TOP1 ia s abilizing TOP1CCs and a ela ed
an icance po en ial. The s uc u e o a oma hecins comp ises a benzo[6,7]indolizine
amewo k used o a quinolinone mo i , whe e subs i u ions in posi ion 14 a e well ole a ed
86 Cinelli MA, Reddy PV, L PC, e al. Iden i ica ion, syn hesis, and biological e alua ion o me aboli es o
he expe imen al cance ea men d ugs indo ecan (LMP400) and indimi ecan (LMP776) and
in es iga ion o isome ically hyd oxyla ed indenoisoquinoline analogues as opoisome ase I poisons. J
Med Chem. 2012;55(24):10844-10862. doi:10.1021/jm300519w
87 An ony S, Jaya aman M, Laco G, e al. Di e en ial induc ion o opoisome ase I-DNA clea age complexes
by he indenoisoquinoline MJ-III-65 (NSC 706744) and camp o hecin: base sequence analysis and ac i i y
agains camp o hecin- esis an opoisome ases I. Cance Res. 2003;63(21):7428-7435.
88 Cinelli MA, Mo ell AE, Dexheime TS, e al. The s uc u e-ac i i y ela ionships o A- ing-subs i u ed
a oma hecin opoisome ase I inhibi o s s ongly suppo a camp o hecin-like binding mode. Bioo g Med
Chem. 2010;18(15):5535-5552. doi:10.1016/j.bmc.2010.06.040
32
and allow he inse ion o hyd ophilic subs i uen s o enhance he wa e solubili y wi h a
main ained o imp o ed biological ac i i y89.
Figu e 13. Gene al s uc u e o a oma hecins, a amily o TOP1 inhibi o s.
Benzophenan h idines
We p e iously p esen ed ni idine as a na u al qua e na y-ammonium alkaloid wi h se e al
oxici ies ha limi clinical s udies (in sec ion 3.1, ide sup a). In o de o o e come hese
chemical d awbacks, La Voie e al. success ully de eloped neu al benzo[i]phenan h idine
de i a i es ha inhibi only TOP1 o bo h enzymes TOP1 and TOP2. In his ega d, u he
in es iga ions p o ed ha 2,3-me hylenedioxy and 8,9-dime hoxy subs i u ion pa e ns (1,
Figu e 14) esul c ucial o dual TOP1/TOP2 inhibi ion, while 2,3-dime hoxy- and 8,9-
me hylenedioxy- subs i u ed benzo[i]phenan h idine de i a i e 2is a selec i e TOP1 inibi o 90.
Figu e 14. Benzophenan h idine sca old con aining TOP1 inhibi o s.
Naph hy idines
SAR s udies o he op imiza ion o he N-he e ocyclic co e o he p e ious men ioned amily o
dibenzo[i]phenan idines led o La Voie´s g oup o de elop a se o used dibenzonaph hy idines
as TOP1 poisons. Among hese, he dibenzo[c,h][1,6]naph hy idine analog Genz-644282 (37,
89 Cinelli MA, Mo ell A, Dexheime TS, Sche ES, Pommie Y, Cushman M. Design, syn hesis, and biological
e alua ion o 14-subs i u ed a oma hecins as opoisome ase I inhibi o s. J Med Chem. 2008;51(15):4609-
4619. doi:10.1021/jm800259e
90 Makhey D, Li D, Zhao B, e al. Subs i u ed benzo[i]phenan h idines as mammalian opoisome ase-
a ge ing agen s. Bioo g Med Chem. 2003;11(8):1809-1820. doi:10.1016/s0968-0896(03)00053-1
33
Figu e 15) esul ed a p omising d ug candida e which a i ed o clinical s udies91. In ega d o
he dibenzonaph hy idine co e, Cushman and collabo a o s success ully explo ed
dibenzo[c,h][1,6]naph hy idinones (38, Figu e 15) as an icance agen s and TOP1 inhibi o s ha
ac by apping TOP1CCs92.
Figu e 15. 1,6-Naph hy idine sca old con aining TOP1 inhibi o s.
Besides he dibenzonaph hy idine amily, naph hy idine-based sca olds ha e been b oadly
s udied as opoisome ase I inhibi o s. Fo ins ance 2,4-disubs i u ed 1,5-naph hy idines93 (39,
Figu e 16) and used 7H-indeno[2,1-c][1,5]naph hy idines94 (40) we e epo ed as TOP1 ca aly ic
inhibi o s wi h in i o an ip oli e a i e e ec owa d human cance cell lines. Du ing he
de elopmen o a nanosenso o measu ing TOP1 ac i i y in a no el d ug-sc eening sys em,
hese used indenonaph hy idines we e ound o in e e e in he TOP1 ac i i y by blocking he
TOP1 enzyme DNA complex dissocia ion, inhibi ing he pos -liga ion s ep o ca alysis95. In an
a emp o expand on he p e ious wo k, he p epa a ion o a new gene a ion o no el used
naph hy idine de i a i es was in es iga ed, b oadening he size o he polyhe e ocyclic cen al
91 Ruchelman AL, Hough on PJ, Zhou N, Liu A, Liu LF, LaVoie EJ. 5-(2-
aminoe hyl)dibenzo[c,h][1,6]naph hy idin-6-ones: a ia ion o n-alkyl subs i uen s modula es sensi i i y
o e lux anspo e s associa ed wi h mul id ug esis ance. J Med Chem. 2005;48(3):792-804.
doi:10.1021/jm049447z
92 Kisele E, Dexheime TS, Pommie Y, Cushman M. Design, syn hesis, and e alua ion o
dibenzo[c,h][1,6]naph hy idines as opoisome ase I inhibi o s and po en ial an icance agen s. J Med
Chem. 2010;53(24):8716-8726. doi:10.1021/jm101048k
93 Alonso C, Fue es M, González M, Rod íguez-Gascón A, Rubiales G, Palacios F. Syn hesis and biological
e alua ion o 1,5-naph hy idines as opoisome ase I inhibi o s. A new amily o an ip oli e a i e agen s.
Cu Top Med Chem. 2014;14(23):2722-2728. doi:10.2174/1568026614666141215152441
94 Alonso C, Fue es M, González M, e al. Syn hesis and biological e alua ion o indeno[1,5]naph hy idines
as opoisome ase I (TopI) inhibi o s wi h an ip oli e a i e ac i i y. Eu J Med Chem. 2016;115:179-190.
doi:10.1016/j.ejmech.2016.03.031
95 Ande sen MB, Tesau o C, Gonzalez M, e al. Ad an ages o an op ical nanosenso sys em o he
mechanis ic analysis o a no el opoisome ase I a ge ing d ug: a case s udy. Nanoscale. 2017;9(5):1886-
1895. doi:10.1039/c6n 06848k
40
Figu e 21. F amewo ks o quinoline (1) and oxidized (2) o educed o ms (3,4,5) he eo .
Along wi h he ully a oma ic and neu al quinoline s uc u e 49, he amewo ks co esponding
o oxidized (50) o educed o ms (51, 52, 53) a e collec ed in he Figu e 21. These al e na i e
educed hyd oquinolines a e common mo i s p esen in many bioac i e compounds114, while
quinoline N-oxides a e e ealed as use ul p ecu so s o syn he ic modi ica ions o quinolines115.
Fu he mo e, he closely ela ed quinolones (quinolinones, i.e. de i a i es wi h a ca bonyl g oup
in he quinoline sca old) also occu in na u al p oduc s and esul essen ial o he biological
ac i i y o nume ous compounds116 (Figu e 22, see he quinolinones 54, 55, 56 and 57). The main
quinolones a e he 2-quinolone 54 (Figu e 22) and 4-quinolone 55, and bo h main ain a ke o-
enol au ome y wi h he co esponding hyd oxiquinoline, being he quinolone o m he majo
au ome .
114 Mu huk ishnan I, S idha an V, Menéndez JC. P og ess in he chemis y o e ahyd oquinolines. Chem
Re . 2019;119(8):5057-5191. doi: 10.1021/acs.chem e .8b00567
115 G ibble GW, Kishbaugh TLS. Chap e 6.1 - six-membe ed ing sys ems: Py idine and benzo de i a i es.
Ad He e ocycl Chem. 2016;28:391-437. doi: h ps://doi.o g/10.1016/B978-0-08-100755-6.00012-0
116 a) Win e RW, Kelly JX, Smilks ein MJ, Dodean R, Hin ichs D, Riscoe MK. An imala ial quinolones:
syn hesis, po ency, and mechanis ic s udies. Exp Pa asi ol. 2008;118(4):487-497.
doi:10.1016/j.exppa a.2007.10.016. b) Pham TDM, Zio a ZM, Blasko ich MAT. Quinolone an ibio ics. Med
Chem Commun. 2019;10(10):1719-1739. h p://dx.doi.o g/10.1039/C9MD00120D. doi:
10.1039/C9MD00120D. c) Aly AA, El-She e EM, Mou ad AE, Bakhee MEM, B äse S. 4-Hyd oxy-2-
quinolones: syn heses, eac ions and used he e ocycles. Mol Di e s. 2020;24(2):477-524.
doi:10.1007/s11030-019-09952-5

41
Figu e 22. F amewo k o quinolones and au ome ic equilib ium wi h hyd oxyquinolines.
Quinoline: na u al sou ces, chemical applica ions and bioac i e compounds
Quinoline is conside ed a p i ileged sca old due o i s na u al abundance, biological signi icance
and wide ange o applica ions. Thus, he quinoline co e is p esen in many di e en na u al
sou ces, such as he an imala ial quinine alkaloids (58, Figu e 23) ob ained om Cinchona spp.117
Rema kably, Cinchona alkaloids quinine and quinidine a e also epo ed as he i s
o ganoca alys s used in asymme ic o ganic syn hesis in 1912118. In like manne , he
indoloquinoline alkaloid c yp olepine (60), ob ained om he A ican plan C yp olepis
sanguinolen a, has shown an imala ial and an ip oli e a i e ac i i y in i o. The neu o oxin
gephi o oxin (61) is a decahyd oquinoline alkaloid isola ed om he skin o Dend oba es
his ionicus ogs (na i e om Colombia)119. Ve anamine (62), a -ca boline alkaloid isola ed
om he ma ine sponge Ve ongula igida (Flo ida, USA), showed bo h in i o and in i o
an idep essan ac i i y ia inhibi ion o se o onin ecep o 2B (5-HT2B) and sigma-1 ecep o
1R )120. Likewise, he p e iously men ioned camp o hecin (1), a pen acyclic alkaloid isola ed
117 Shang XF, Mo is-Na schke SL, Liu YQ, e al. Biologically ac i e quinoline and quinazoline alkaloids pa
I. Med Res Re . 2018;38(3):775-828. doi:10.1002/med.21466
118 B edig G, Fiske WS. Bei äge zu chemischen Physiologie und Pa hologie. Biochem Z. 1912;46:7
119 Wijnsma R, Ve poo e R. CHAPTER 19 - Quinoline alkaloids o cinchona. In: CONSTABEL F, VASIL IK, eds.
Phy ochemicals in plan cell cul u es. Academic P ess; 1988:335-355. h ps://doi.o g/10.1016/B978-0-12-
715005-5.50026-1
120 Kochanowska-Ka amyan A, A aujo HC, Zhang X, e al. Isola ion and syn hesis o e anamine, an
an idep essan lead om he ma ine sponge e ongula igida. J Na P od. 2020;83(4):1092-1098. doi:
10.1021/acs.jna p od.9b01107
42
om Camp o heca acumina a, is a b oadly s udied an icance agen ia in e acial inhibi ion o
TOP14.
Figu e 23. Na u al bioac i e compounds con aining a quinoline-based cen al co e.
Besides na u al occu ing quinolines, hey can be ound in many syn he ic compounds wi h
a ious chemical and indus ial applica ions, as shown in he Figu e 24. Quinoline sca olds a e
commonly used as ligands121 o me allic ca alys s in c oss-coupling eac ions and asymme ic
syn hesis, such is he case o he so-called APAC ligand (63, Figu e 24). Mo eo e , quinoline-
con aining dyes ha e been o ien ed o a ious applica ions. The wa e -soluble colo an 64 (E-
104 in Eu ope, D&C yellow no. 10 in USA) is mainly applied as a colo an in ood indus y122,
whe eas he wa e insoluble dye 65 (D&C yellow no. 11 in USA) is used as colou ing agen in
cosme ics123. Likewise, pho o ol aic dyes (such as he compound 66) wi h quinoline skele ons
ep esen a signi ican class o chemical ma e ials o p oduce pho o ol aic cells124. Fu he mo e,
121 Rome o EA, Chen G, Gembicky M, Jazza R, Yu J, Be and G. Unde s anding he ac i i y and
enan ioselec i i y o ace yl-p o ec ed aminoe hyl quinoline ligands in palladium- -C(sp3) H
bond a yla ion eac ions. J Am Chem Soc. 2019;141(42):16726-16733.
h ps://doi.o g/10.1021/jacs.9b06746. doi: 10.1021/jacs.9b06746
122 Weisz A, James IC, Mazzola EP, Ridge CD, Ijames CF, Ma key SP. Iden i ica ion o 1',5'-
naph hy idinoph halone and i s quan i ica ion in he colo addi i e D&C Yellow No. 10 (Quinoline Yellow)
using high-pe o mance liquid ch oma og aphy. Food Addi Con am Pa A Chem Anal Con ol Expo Risk
Assess. 2018;35(3):439-447. doi:10.1080/19440049.2017.1416183
123 Cheque FM, Venâncio Vde P, de Souza P ado MR, e al. The cosme ic dye quinoline yellow causes DNA
damage in i o. Mu a Res Gene Toxicol En i on Mu agen. 2015;777:54-61.
doi:10.1016/j.m gen ox.2014.11.003
124 Lewinska G, Sane a J, Ma szalek KW. Applica ion o quinoline de i a i es in hi d-gene a ion
pho o ol aics. J Ma e Sci : Ma e Elec on. 2021;32(14):18451-18465. h ps://doi.o g/10.1007/s10854-
021-06225-6. doi: 10.1007/s10854-021-06225-6
43
a ed luo escen biosenso based on a BODIPY (4,4-di luo o-4-bo a-3a,4a-diaza-s-indacene)
skele on 67125 has been de eloped o he de ec ion o i idium(III) in biological sys ems, as a
sensi i e bioimaging ool wi h medical applica ions.
Figu e 24.Rep esen a i e examples o quinoline-con aining compounds wi h chemical and indus ial signi icance.
The quinoline sca old in medicinal chemis y and pha macology
Quinolines a e s uc u es o pa icula signi icance in he a ea o medicinal chemis y. In his
sense, quinine (58, Figu e 25) is he oldes known d ug based on a quinoline sca old and
om he XVII cen u y, when in 1630 Spanish Jesui missiona ies es ablished in Sou h Ame ica
epo ed he use o powde ed cinchona ba k o ea paludal e e . His o ically, he na i e Indian
popula ion had used in usions o cinchona ba k powde as an an imala ial medicine and hey
ans e ed his knowledge o he Spania ds o he ex en ha he Coun ess o Chinchón
(F ancisca En íquez de Ri e a), he wi e o he Vice oy o Pe u, was cu ed wi h cinchona. La e
in 1640, she in oduced he cinchone ba k in Eu ope and in 1742, Linnaeus named he ee
Cinchona o icinalis Cinchona
misspelling by Linnaeus)126. Quinine alkaloid was i s ly isola ed in 1820 by J. Pelle ie and J.B.
125 Qu X, Bian Y, Li J, Pan Y, Bai Y. A ed luo escen BODIPY p obe o i idium (III) ion and i s applica ion in
li ing cells. R Soc Open Sci. 2019;6(1):181090. doi:10.1098/ sos.181090
126 B uce-Chwa LJ. Th ee hund ed and i y yea s o he Pe u ian e e ba k. B Med J (Clin Res Ed).
1988;296(6635):1486-1487. doi:10.1136/bmj.296.6635.1486
44
Ca en ou om Cinchona spp. ees and a o emen ioned pu i ied quinine eplaced he classic
ba k powde . Quinine has been he only e ec i e an imala ial agen un il he 1920´s, when a
new gene a ion o syn he ic quinine de i a i es we e de eloped, highligh ing he launch o
chlo oquine 68 e.g. hyd oxychlo oquine 69,
pipe aquine 70, me loquine 71, and p imaquine 72).
Figu e 25. Quinoline co e-based an imala ial agen s.
I is no ewo hy o men ion ha he pha macological use o quinine emains nowadays, almos
400 yea s a e he i s p o ed his o ical e idence. A p esen , he main i s line d ugs o he
ea men o mala ia a e chlo oquine and a emisin de i a i es, bu quinine and chlo oquine a e
indica ed in some clinical si ua ions such as d ug esis ance scena ios o p egnancy127. The
mechanism o ac ion o quinoline-based an imala ial d ugs (quinine and syn he ic de i a i es)
emains unclea , bu is accep ed ha hey accumula e in o he ood acuoles and ac by
inhibi ing he diges ion o haemoglobin du ing he blood s ages o mala ia pa asi es, leading o
pa asi e dea h128. Fu he mo e, chlo oquine was e ealed as an an i-in lamma o y agen and is
cu en ly used in in lamma o y heuma ic diseases such as heuma oid a h i is o lupus
e y hema osus129, and mo e ecen ly has been ied as an an i i al agen o ea acu e
in ec ions wi h SARS-CoV-2130.
127 WHO Guidelines o mala ia. h ps://www.who.in /publica ions/i/i em/guidelines- o -mala ia.
Accessed Decembe 28, 2021
128 Tse EG, Ko sik M, Todd MH. The pas , p esen and u u e o an i-mala ial medicines. Mala J.
2019;18(1):93. doi:10.1186/s12936-019-2724-z
129 Sch ezenmeie E, Dö ne T. Mechanisms o ac ion o hyd oxychlo oquine and chlo oquine: implica ions
o heuma ology. Na Re Rheuma ol. 2020;16(3):155-166. doi:10.1038/s41584-020-0372-x
130 Tou e F, de Lamballe ie X. O chlo oquine and COVID-19. An i i al Res. 2020;177:104762.
doi:10.1016/j.an i i al.2020.104762
45
Besides an imala ial agen s, he quinoline ing sys em is p esen in se e al o he clinically
app o ed d ugs and he mos ep esen a i e examples a e desc ibed he ein ( he chemical
s uc u es a e collec ed in he Figu e 26):
Pi a as a in (73, Figu e 26) belongs o he d ug class called s a ins, which ac dec easing low-
densi y lipop o ein choles e ol (LDL-C) le els ia compe i i e inhibi ion o 3-hyd oxy-3-
me hylglu a yl coenzyme A (HMG-Co-A)131. Pi a as a in was he la es s a in launched o he
ma ke .
Figu e 26. Clinically app o ed d ugs based on a quinoline sca old.
131 Chan P, Shao L, Tomlinson B, Zhang Y, Liu ZM. An e alua ion o pi a as a in o he ea men o
hype choles e olemia. Expe Opin Pha maco he . 2019;20(1):103-113.
doi:10.1080/14656566.2018.1544243

46
Saquina i (74) has been he i s p o ease inhibi o app o ed o he ea men o HIV in ec ion
in 1995, ac ing as an inhibi o o HIV p o ease. Saquina i showed a high a ini y owa ds he
HIV i us p o ease, wi h limi ed e ec on human s uc u ally ela ed p o eases132.
Mon elukas (75) is a cys einyl leuko iene ecep o 1 (CysLT1R) e e sible an agonis 133, which
has been widely used in as hma as a complemen a y d ug in he apies in ol ing inhala ed
co icos e oids o -2 ad ene gic agonis s.
Cabozani ib (76) is a mul ikinase inhibi o used in me as a ic enal cell ca cinoma and medulla y
hy oid cance 134. Mo e ecen ly, i has been app o ed as a second line ea men o
hepa ocellula ca cinoma by Eu opean Medicines Agency (EMA) and FDA in 2018 and 2019
espec i ely135.
I ino ecan (28a) and opo ecan (23) a e TOP1 inhibi o s cu en ly used as a second-line
chemo he apeu ic agen s in ad anced cance s4 (p e iously shown in sec ion 1.3.2.1. o he
in oduc ion, Figu e 10).
Besides clinically app o ed d ugs including ully a oma ic quinoline co es in hei
pha macopho e, he e a e some o he he apeu ic agen s con aining closely ela ed quinoline
de i a i e-sca olds, mainly quinolones o hyd ogena ed o ms o quinoline (Figu e 27). This is
he case o luo oquinolones, a class o b oad-spec um bac e icidal an ibio ics cu en ly used
in espi a o y, ocula and u ina y ac in ec ions (cip o loxacin, le o loxacin and moxi loxacin,
s uc u es 77, 78 and 79 in he Figu e 27). Fluo oquinolones a e selec i e inhibi o s o he
bac e ial ype II opoisome ases TopIV and DNA gy ase, causing he in e up ion o he DNA
syn hesis136.
132 la Po e CJ. Saquina i , he pionee an i e o i al p o ease inhibi o . Expe Opin D ug Me ab Toxicol.
2009;5(10):1313-1322. doi:10.1517/17425250903273160
133 Diaman Z, Man zou anis E, Bje me L. Mon elukas in he ea men o as hma and beyond. Expe
Re Clin Immunol. 2009;5(6):639-658. doi:10.1586/eci.09.62
134 Ma ínez Chanzá N, Xie W, Asim Bilen M, e al. Cabozan inib in ad anced non-clea -cell enal cell
ca cinoma: a mul icen e, e ospec i e, coho s udy. Lance Oncol. 2019;20(4):581-590.
doi:10.1016/S1470-2045(18)30907-0
135 Pe soneni N, Rimassa L, P essiani T, Smi oldo V, San o o A. Cabozan inib o he ea men o
hepa ocellula ca cinoma. Expe Re An icance The . 2019;19(10):847-855.
doi:10.1080/14737140.2019.1674141
136 Luan G, D lica K. Fluo oquinolone-gy ase-DNA clea ed complexes. In: D ole M, ed. DNA
opoisome ases: Me hods and p o ocols. New Yo k, NY: Sp inge New Yo k; 2018:269-281.
h ps://doi.o g/10.1007/978-1-4939-7459-7_19
47
Figu e 27. O he quinoline-de i ed sca olds in clinically app o ed d ugs.
Acco dingly, indaca e ol (80) is a 2-quinolone con aining b onchodila o used o he ea men
o COPD (Ch onic Obs uci e Pulmona y Disease). Indaca e ol ac s as a ul along-ac ing agonis
o -2 ad ene gic ecep o s in he smoo h muscle, allowing a daily adminis a ion egime137.
A ipip azole (81) is an a ypical an ipsycho ic used in he ea men o schizoph enia, bipola
diso de , Tou e e´s diso de , bipola mania and dep ession. The an ipsycho ic e ec o
a ipip azole is due o he agonism o dopamine ecep o D2 and se o onin ype 1 ecep o 5-
HT1138.
Quinagolide (82) is a non-e go (non e goline de i a i e) used in hype p olac inemia he apy,
ac ing as a selec i e agonis o dopamine D2 ecep o s a pha maceu ical concen a ions139.
137 Rossi A, Polese G. Indaca e ol: a comp ehensi e e iew. In J Ch on Obs uc Pulmon Dis. 2013;8:353-
363. doi:10.2147/COPD.S21625
138 Kingho n WA, McE oy JP. A ipip azole: pha macology, e icacy, sa e y and ole abili y. Expe Re
Neu o he . 2005;5(3):297-307. doi:10.1586/14737175.5.3.297
139 Ba lie A, Jaque P. Quinagolide--a aluable ea men op ion o hype p olac inaemia. Eu J Endoc inol.
2006;154(2):187-195. doi:10.1530/eje.1.02075
48
2.1. Majo me hods o he syn hesis o quinolines
2.1.1. Me al- ee syn hesis o quinolines
2.1.1.1. Aniline-based con en ional syn heses o quinolines
Con en ional syn heses include he oldes and well es ablished me hods o he p epa a ion o
quinolines, om Sk aup (1880) o Po a o (1963). These syn he ic s a egies e ol e a ound
nucleophile addi ions o p ima y (and in some cases seconda y) amines o di e se elec ophilic
species (ca bonyls, elec on de icien alkenes such as -ca bon o , -unsa u a ed ca bonyls
e c.). In mos o he con en ional me hods he syn hesis is conduc ed by an aniline and an
annula ion pa ne which ac s as elec ophilic a ge (Scheme 2). The eac ion unde goes a
cycliza ion o yield he quinoline, bu in some cases he annula ion p oduc is he non-a oma ic
dihyd o/ e ahyd oquinoline. These semi-hyd ogena ed de i a i es can be u he subjec ed o
oxida ion, which allows he o ma ion o he co esponding a oma ic quinoline.
Scheme 2. Aniline-based con en ional syn heses o quinolines.
49
Sk aup (1) -1880-
In he Sk aup syn hesis o quinolines ( ou e 1, Scheme 2), p ima y anilines a e hea ed wi h
glyce ol (e en subs i u ed glyce ols) and a s ong acid in he p esence o an oxidan 140. Acid-
ca alyzed dehyd a ion o glyce ol p oduces ac oleine in si u, which ecei es a nucleophilic 1,4
addi ion o he aniline and cycliza es o o m a hyd oquinoline. In he las s ep, he
hyd oquinoline is con e ed o he quinoline by oxida ion. Sk aup´s ou e equi es he use o a
s ong acid ha may di icul he isola ion o he inal p oduc s om he c ude and ha e o deal
wi h low yields141.
Combes (2) -1888-
Combes epo ed he syn hesis o quinolines in ol ing he acid-ca alyzed condensa ion o -
dike ones and aniline o o m an enamine in e media e ollowed by a cycliza ion142 (2, Scheme
2). The use o unsyme ic -dike ones gi es a mix u e o egioisome s and i may complica e he
sepa a ion p ocess o he eac ion p oduc s.
Con ad-Limpach (3) -1887-
Con ad and Limpach disclosed a s aigh o wa d ou e o a o d quinolines subs i u ed wi h a
hyd oxyl g oup in C4, ia acid- -ke oes e s ollowed by
ing closu e o he enamine in e media e143 (3, Scheme 2). When he eac ion is pe o med a
high empe a u es, i may de i e o he Con ad-Limpach-Kno quinolone syn hesis ob aining
he consequen quinol-4-one144.
Doebne -Von Mille (4) -1881-
In 1881 Doebne and Von Mille disclosed an al e na i e me hod o he Sk aup´s syn hesis. In
his p ocedu e, anilines unde go annula ion wi h , -unsa u a ed ke ones o aldehydes in he
140 1. Manske RHF, Kulka M. The sk aup syn hesis o quinolines. O g Reac . 2011:59-98.
h ps://doi.o g/10.1002/0471264180.o 007.02
141 AlMa zouq DS, Elnagdi NMH. Glyce ol and Q-Tubes: G een Ca alys and Technique o Syn hesis o
Poly unc ionally Subs i u ed He e oa oma ics and Anilines. Molecules. 2019; 24(9):1806.
h ps://doi.o g/10.3390/molecules24091806
142 Be gs om FW. He e ocyclic ni ogen compounds. pa IIA. hexacyclic compounds: Py idine, quinoline,
and isoquinoline. Chem Re . 1944;35(2):77-277. h ps://doi.o g/10.1021/c 60111a001
143 Con ad M, Limpach L. Syn hesen on chinolinde i a en mi els ace essiges e . Chem Be . 1891;
24:2990. h ps://doi.o g/10.1002/cbe .188702001215
144 Heindel ND, Becha a IS, Lemke TF, Fish VB. Cycliza ion o aniline-ace ylenedica boxyla e adduc s.
imp o ed syn hesis o 8-ni o-2-ca bome hoxy-4(1H)-quinolones. J O g Chem. 1967;32(12):4155-4157.
h ps://doi.o g/10.1021/jo01287a127
56
Scheme 9. T iphenylphosphine ca alyzed he e oannula ion be ween N- osyla ed 2-aminobenzaldehydes and
ace ylenes ou lined by Kwon e al.
In 2017, an al e na i e me hod o he P i zinge eac ion o ganoca alyzed by CTAOH
(ce yl ime hyl-ammonium hyd oxide) was de eloped by Shanka ling e al., in ol ing he
he e oannula ion o isa ins and ke ones unde mild basic and ul asonic condi ions161 (Scheme
10). The combina ion o CTAOH and ul asonic i adia ion led o he o ma ion o 2-subs i u ed
4-ca boxyl quinolines in high yields and as eac ion a es. Addi ionally, he su ac an cha ac e
o CTAOH allows he use o wa e as he sol en as he eac an s a e solubilized in micelles.
Scheme 10. CTAOH ca alyzed P izinge eac ion disclosed by Shanka ling e al.
O ganoca alys s media ed syn hesis o quinolines
Besides ca alys s based on hei acidic/basic na u e, he e a e some o he s a egies in ol ing
o ganoca alysis wi h na u al occu ing aminoacids as L-p oline o o ganoca alyzed one-po
app oaches o sequen ial/cascade eac ions o a o d he quinoline amewo k. In he p esen
sec ion, some ep esen a i e examples will be exposed.
The s udy o L-p oline in o ganoca alysis is an ac i e a ea o esea ch, ei he playing he ole o
he ca alys pe se o ac ing as a ligand o a ansi ion-me al ca alys . P oline is an accessible
aminoacid a ailable in bo h enan iome ic o ms (L o R) and consequen ly, i has been widely
161 Mo e PA, Shanka ling GS. Ene gy e icien P i zinge eac ion: A no el s a egy using a su ac an
ca alys . New J Chem. 2017;41(21):12380-12383. h p://dx.doi.o g/10.1039/C7NJ01937H

57
used in asymme ic syn hesis. Mo eo e , i is also conside ed a bi unc ional o ganoca alys as is
composed o bo h acidic (ca boxyla e) and basic (seconda y amine) moie ies162. In 2012, Panahi
and cowo ke s p esen ed a L-p oline-ca alyzed mul icomponen me hod o he syn hesis o 2-
amino-3-cyano-4-a ylquinoline de i a i es, in ol ing a he e oannula ion eac ion be ween
anilines, benzaldehydes and malononi ile (Scheme 11)163.
Scheme 11. L-P oline ca alyzed mul icomponen eac ion disclosed by Panahi e al.
Likewise, one-po cascade eac ions s ablish highly e icien s aigh o wa d syn he ic
me hodologies. In his ega d, Shi and collabo a o s p esen ed a one-po syn hesis o 2- and 3-
(di)subs i u ed quinolines h ough a sequen ial Michael/S audinge /aza-Wi ig eac ion164
(Scheme 12). The p ocess s a s wi h a Michael addi ion o ca bonyl de i a i es o o-azido- -
ni os y enes, which is ollowed by a S audinge eac ion wi h iphenylphosphine and a
subsequen in amolecula aza-Wi ig eac ion o yield he co esponding quinolines, upon
dehyd ogena ion by eleasemen o ni ome hane.
162 Ja o ER, Mille SJ. Amino acids and pep ides as asymme ic o ganoca alys s. Te ahed on.
2002;58(13):2481-2495. doi: h ps://doi.o g/10.1016/S0040-4020(02)00122-9
163 Khala i-Nezhad A, Sa ikhani S, Shahidzadeh ES, Panahi F. L-p oline-p omo ed h ee-componen
eac ion o anilines, aldehydes and ba bi u ic acids/malononi ile: Regioselec i e syn hesis o 5-
a ylpy imido[4,5-b]quinoline-diones and 2-amino-4-a ylquinoline-3-ca boni iles in wa e . G een Chem.
2012;14(10):2876-2884. doi: 10.1039/C2GC35765H
164 Yu Z, Zheng H, Yuan W, Tang Z, Zhang A, Shi D. An unexpec ed one-po syn hesis o mul i-subs i u ed
quinolines ia a cascade eac ion o Michael/S audinge /aza-Wi ig/a oma iza ion o o ho-azido- -ni o-
s y enes wi h a ious ca bonyl compounds. Te ahed on Le . 2013;69(38):8137-8141. doi:
h ps://doi.o g/10.1016/j. e .2013.07.050
58
Scheme 12. L-P oline ca alyzed Michael/S audinge /aza-Wi ig cascade eac ion disclosed by Shi e al.
In 2019, Cheng and collabo a o s disclosed a one-po a oposelec i e F iedlände syn hesis o
quinolines by annula ion o -aminoa yl ke ones and -dica bonyl de i a i es ca alyzed by CPA
(Chi al Phospho ic Acid), as illus a ed in he Scheme 13. Axially chi al 4-a ylquinolines we e
ob ained in high yields and enan ioselec i i ies (mo e han 90% in bo h cases), ep esen ing a
ema kable applica ion o he de elopmen o no el asymme ic ca alys s165.
Scheme 13. CPA ca alyzed one-po a oposelec i e F iedlände eac ion disclosed by Cheng e al.
165 Shao Y, Dong M, Wang Y, Cheng P, Wang T, Cheng D. O ganoca aly ic a oposelec i e F iedlände
quinoline he e oannula ion. O g Le . 2019;21(12):4831-4836.
h ps://doi.o g/10.1021/acs.o gle .9b01731
59
2.1.2. Me al ca alyzed syn hesis o quinolines
T ansi ion-me al ca alyzed coupling eac ions p o ides apid and obus ools o c ea e o
des oy single o mul iple bonds in a unique syn he ic ope a ion. Acco dingly, in he p esen
sec ion ep esen a i e examples will be b ie ly exposed, in ol ing ansi ion me al sal s o
complexes o achie e highly unc ionalized quinolines by simple, quick and s aigh o wa d
me hodologies.
T ansi ion-me al ca alyzed F iedlände eac ions
As shown in he p e ious sec ion (2.2.1.), he de elopmen o modi ied F iedlände a ia ions is
he eby a ac ing inc easing a en ion, and me al-ca alyzed o ganic syn hesis is no an
excep ion. Two main s a egies ha e been epo ed in he scien i ic li e a u e:
A) Con en ional F iedlände he e oannula ion o 2-aminophenyl ca bonyls wi h ac i a ed
ca bonyl de i a i es (aldehydes o ke ones) ca alyzed by me als. Hence, an y ium(III) i la e
ca alyzed F iedlände eac ion a oom empe a u e was desc ibed by Gibbs and collabo a o s
in 2005166 (Scheme 14, ou e A).
B) Oxida i e and/o educ i e Fiedlände app oaches o un eac i e F iedlände p ecu so s (e.g.
ni o g oups ha need o be con e ed in o amino moie ies by hyd ogen ans e o alcohols
ha a e oxidized o ca bonyls). The me al ca alys plays a dual ole: ac s as an oxidan / educ an
o ans o m he p ecu so in o he eac i e subs a e, and addi ionally ca alyzes he F iedlände
eac ion. This ep esen s an in e es ing s a egy due o a highe chemical s abili y o he
p ecu so s, which may be di ec ly con e ed in o quinolines in one unique ac ion. In his ega d,
Mille e al. desc ibed a educ i e F iedlände eac ion be ween 2-ni obenzaldehydes and
enolizable ca bonyls ca alyzed by in(II) chlo ide and zinc(II) chlo ide (Scheme 14, ou e B), which
in ol es he educ ion o he ni o de i a i e ollowed by a condensa ion in a single ope a ion167.
In he same way, Vande Mie de and collabo a o s disclosed an oxida i e F iedlände a ian o
2-aminobenzyl alcohol (which equi es o be oxidized o he co esponding aldehyde o m) wi h
ac i a ed ke ones, ca alyzed by a second gene a ion G ubbs ca alys and KO Bu168 (Scheme 14,
ou e C). Wu e al. p esen ed an oxida i e/ educ i e F iedlände syn hesis ca alyzed by
166 De SK, Gibbs RA. A mild and e icien one-s ep syn hesis o quinolines. Te ahed on Le .
2005;46(10):1647-1649. doi: h ps://doi.o g/10.1016/j. e le .2005.01.075
167 McNaugh on BR, Mille BL. A mild and e icien one-s ep syn hesis o quinolines. O g Le .
2003;5(23):4257-4259. doi:10.1021/ol035333q
168 Vande Mie de H, Van De Voo P, De Vos D, Ve poo F. A u henium-ca alyzed app oach o he
F iedlände quinoline syn hesis. Eu J O g Chem. 2008;2008(9):1625-1631. doi:
h ps://doi.o g/10.1002/ejoc.200701001
60
Ru(PPh3)3Cl2(Scheme 14, ou e D), in which he ca alys educes he 2-ni obenzaldehyde o 2-
aminobenzaldehyde and also oxidizes he 2-aminobenzyl alcohol o he ca bonyl o m. Finally,
F iedlände annula ion leads o he desi ed quinolines169.
Scheme 14. T ansi ion-me al ca alyzed Fiedlände eac ions.
Palladium(II), i on(III), zinc(II) and CuB -ZnI2 ansi ion-me al ca alyzed eac ions
In 2014, O ellana e al. desc ibed a one-po p o ocol o a o d a se ies o 2- and 3-quinoline
de i a i es. Palladium ca alyzed condensa ion be ween 2-b omoanilines and cyclop opanols
and he subsequen oxida ion o he c oss-coupling p oduc s lead o he o ma ion o he
co esponding quinolines (Scheme 15, ou e A). Fu he mo e, 2-b omoaniline ac s as he
oxidan agen in he Pd ca alyzed condensa ion-oxida ion sequence and acco dingly 2
equi alen s he eo a e equi ed170.
169 Li H, Wang C, Zhu S, Dai C, Wu Y. Ru henium(II)-ca alyzed hyd ogen ans e /annula ion cascade
p ocesses be ween alcohols and 2-ni obenzaldehydes. Ad Syn h Ca al. 2015;357(2-3):583-588. doi:
h ps://doi.o g/10.1002/adsc.201400898
170 Nikolae A, Ni hiy N, O ellana A. One-s ep syn hesis o quinolines ia palladium-ca alyzed c oss-
coupling o cyclop opanols wi h unp o ec ed o ho-b omoanilines. Synle . 2014;25(16):2301-2305. doi:
10.1055/s-0034-1378613
61
In he same way, Sun and co-wo ke s epo ed an e icien one-po quinoline syn hesis ia
Pd(OAc)2 ca alyzed oxida i e cycliza ion be ween anilines and a yl allyl alcohols171 (Scheme 15,
ou e B).
Scheme 15. Palladium(II) ca alyzed syn hesis o quinolines.
Liu and co-wo ke s de eloped an i on(III) ca alyzed oxida i e c oss coupling eac ion o N-alkyl
anilines wi h s y enes/ace ylenes in he p esence o di- e -bu yl pe oxide [( BuO)2] o gene a e
2,4-disubs i u ed quinolines172 (Scheme 16).
Scheme 16. I on(III) ca alyzed syn hesis o quinolines disclosed by Liu e al.
A simple, e icien and sol en - ee zinc(II) i la e ca alyzed MCR me hod was disclosed by
Chandak e al. in 2016. Anilines, aldehydes and ace ylenes unde wen a andem condensa ion-
cycliza ion eac ion ia Zn(OT )2 induced C-H ac i a ion o a o d 2,4-disubs i u ed quinolines 173,
as shown in he Scheme 17.
171 Xu J, Sun J, Zhao J, Huang B, Li X, Sun Y. Palladium-ca alyzed syn hesis o quinolines om allyl alcohols
and anilines. RSC Ad . 2017;7(58):36242-36245. doi: 10.1039/C7RA06425J
172 Liu P, Li Y, Wang H, Wang Z, Hu X. Syn hesis o subs i u ed quinolines by i on-ca alyzed oxida i e
coupling eac ions. Te ahed on Le . 2012;53(49):6654-6656. doi:
h ps://doi.o g10.1016/j. e le .2012.09.090
173 Sa ode PB, Baheka SP, Chandak HS. Zn(OT )2-media ed CH ac i a ion: An expedi ious and sol en - ee
syn hesis o a yl/alkyl subs i u ed quinolines. Te ahed on Le . 2016;57(51):5753-5756. doi:
h ps://doi.o g/10.1016/j. e le .2016.10.113

62
Scheme 17. Zinc(II) cayalyzed syn hesis o quinoline p esen ed by Chandak e al.
In 2016, Mai i and co-wo ke s p esen ed a sol en - ee MCR app oach ia Zn(II)-Cu(I) combo-
ca alyzed oxida i e cycliza ion o anilines, aldehydes and ace ylenes o ob ain 2,4-quinoline
de i a i es in mode a e o high yields (61-82 %)174 (Scheme 18).
Scheme 18. Zinc-coppe ca alyzed oxida i e MCR eac ion disclosed by Mai i e al.
174 Mondal RR, Khama ui S, Mai i DK. CuB ZnI2 combo-ca alysis o mild CuI CuIII swi ching and sp2 C
H ac i a ed apid cycliza ion o quinolines and hei suga -based chi al analogues: A UV Vis and XPS s udy.
ACS Omega. 2016;1(2):251-263. doi: 10.1021/acsomega.6b00185
63
2.1.3. Miscellaneous me hods o he syn hesis o quinolines
Besides he expounded me hods o he p epa a ion o quinolines, he e a e some app oaches
ha we e no classi ied in o he a o emen ioned ca ego iza ion (namely con en ional me hods,
acid/base/aminoacid ca alyzed app oaches and me al-ca alyzed eac ions) and some o he
mos ep esen a i e examples a e going o be exposed.
Halogen-ca alyzed syn hesis o quinolines
A sol en - ee and b omodime hylsul onium b omide (BDMS) ca alyzed Fiedlände syn hesis
was published by Vi al Rao and collabo a o s in 2012. He e oannula ion o 2-aminoa yl ke ones
wi h enolizable ke ones in he p esence o 10 mol% BDMS (as b omine sou ce) led o he
o ma ion o 2-, 3- and 4-subs i u ed quinolines175 (Scheme 19).
Scheme 19. B omine ca alyzed Fiedlände eac ion disclosed by Vi al Rao e al.
Acco dingly, Cheon and collabo a o s de eloped an iodide (I2) ca alyzed di ec app oach o he
p epa a ion o 2-quinoline de i a i es176. Te abu ylammonium iodide (TBAI) is used as sou ce
o I2 and plays he ole o a nucleophilic ca alys . The eac ion p oceeds ia nucleophilic
iodina ion o he elec ophilic -ca bon o 2-aminos y yl ke ones, leading o he o ma ion o s-
ans -iodoke ones, which unde go con o ma ional change and sequen ial condensa ion-
elimina ion o HI o yield he co esponding quinolines (Scheme 20).
175 Venka esham R, Manjula A, Vi al Rao B. (B omodime hyl)sul onium b omide ca alyzed sol en - ee
F iedlande syn hesis o subs i u ed quinolines. J He e oc Chem. 2012;49(4):833-838. doi:
h ps://doi.o g/10.1002/jhe .873
176 Lee SY, Jeon J, Cheon C. Syn hesis o 2-subs i u ed quinolines om 2-aminos y yl ke ones using iodide
as a ca alys . J O g Chem. 2018;83(9):5177-5186. doi: 10.1021/acs.joc.8b00552
64
Scheme 20. Iodine ca alyzed me hodology p esen ed by Cheon e al.
Radical-media ed syn hesis o quinolines
Al e na i ely, adical-media ed he e oannula ions suppose a s aigh o wa d app oach o
ob ain quinolines wi h high a om (and s ep) economy. These ansien and highly eac i e adical
in e media es a e usually is si u gene a ed by emo ing a hyd ogen om he subs a e wi h
s ong bases, pe oxides o by swi ching he ansi ion s a e o a me allic ca alys .
In 1984, Tundo and collabo a o s disclosed a di ec me hod o he p epa a ion o 2,4-
disubs i u ed quinolines h ough a he e oannula ion eac ion be ween a yliminyl adicals and
alkynes177. A yliminium adicals we e gene a ed in si u om dia yl imines in he p esence o
DPDC (di-isop opyl pe oxydica bona e), which unde wen a sequence o alkyla ion and
cycliza ion o ob ain he desi ed quinolines (Scheme 21). This ep esen s a ela i ely ancien
example ha employs a highly explosi e and haza dous pe oxide (DPDC), bu esul s illus a i e
o he adical-media ed app oach. As ime wen on, sa e me hodologies wi h mild eac ion
condi ions we e disclosed and hence, some ecen syn heses a e going o be exposed.
177 Lea dini R, Pedulli GF, Tundo A, Zana di G. A oma ic annela ion by eac ion o a ylimidoyl adicals wi h
alkynes: A new syn hesis o quinolines. J Chem Soc Chem Commun. 1984(20):1320-1321. doi:
10.1039/C39840001320
65
Scheme 21. He e oannula ion eac ion be ween a yliminyl adicals and alkynes disclosed by Tundo e al.
In 2016, Li and co-wo ke s de eloped an in amolecula oxida i e adical he e oannula ion o o-
cyanoa ylac ylamides and -ke o acids, using sil e (I) ni a e (Scheme 22, ou e A) o po assium
pe sul a e ( ou e B) as oxidan agen . The eac ion p oceeds ia an addi ion/cycliza ion cascade
o ob ain 3-ca boxyl-2,4-quinolines in mode a e o high yields178.
Likewise, in 2020 Mei, Zhu, Han and collabo a o s p esen ed an oxida i e adical eac ion
be ween o-cyanoa ylac ylamide and a oma ic hiols in he p esence o DCP (dicumyl pe oxide),
o a o d 3- hiome hyla ed 2,4-quinolones (Scheme 22, ou e C) 179.
178 Wang S, Fu H, Shen Y, Sun M, Li Y. Oxida i e adical addi ion/cycliza ion cascade o he cons uc ion
o ca bonyl-con aining quinoline-2,4(1H,3H)-diones. J O g Chem. 2016;81(7):2920-2929. doi:
10.1021/acs.joc.6b00210
179 Yin Z, Yu Y, Li C, Mei H, Zhu K, Han J. Sul u a ion- igge ed adical cycliza ion o o-cyanoa ylac ylamides
o 3- hiome hyla ed quinoline-2,4-dione. Chemis ySelec . 2020;5(46):14534-14537.
h ps://doi.o g/10.1002/slc .202003999
72
Table 2. P incipal P(V)-based o ganophospho us unc ionali ies.
Phospho us con aining isos e es may be used o eplace a simila moie y o an ac i e molecule
and modi y he biological ac i i y. Fo ins ance, isos e s o neu o ansmi e s -aminobu i ic acid
(GABA) and glu amic acid bea ing phosphonic/phosphinic acid ins ead o ca boxylic acid esul ed
in a subs an ial modi ica ion o pha macodynamic p ope ies: e en he a ini y was gene ally
main ained, in insic ac i i y and selec i i y a ied conside ably. In his ega d, he na u al ligand
GABA (83, Figu e 30) is a well-known agonis o GABAA and GABAB ecep o s, bu he
eplacemen o he ca boxyla e by mono/di-alkylphosphine moie ies 84 ga e place o a po en
and selec i e agonis e ec owa ds GABAB me abo opic ecep o s185. Likewise, L-glu amic acid
(85, Figu e 30) is an endogenous agonis o bo h me abo opic (mGluR) and iono opic (iGluR)
ecep o s while he co esponding phosphona e isos e e 86 selec i ely ac i a es g oup III
mGluRs186.
185 F oes l W, Mickel SJ, Hall RG, e al. Phosphinic acid analogues o GABA. 1. New po en and selec i e
GABAB agonis s. J Med Chem. 1995;38(17):3297-3312. doi:10.1021/jm00017a015
186 Wa kins JC, K ogsgaa d-La sen P, Hono é T. S uc u e-ac i i y ela ionships in he de elopmen o
exci a o y amino acid ecep o agonis s and compe i i e an agonis s. T ends Pha macol Sci.
1990;11(1):25-33. doi:10.1016/0165-6147(90)90038-a

73
Figu e 30. S uc u es o he neu o ansmi e s GABA and glu amic acid, along wi h hei co esponding
phosphinic/phosphonic acid isos e es.
I-1.1. Phospho us-based ansi ion s a e in e media e analogues
F om a biochemical pe spec i e, enzymes a e p o eins ha ca alyze speci ic chemical eac ions
in li ing o ganisms by subs an ially accele a ing he con e sion o subs a es (S) in o p oduc s
(P) wi hou being hemsel es consumed o pe manen ly al e ed. Ca alysis media ed inc emen
o he eac ion a e a ises om a dec ease in he ac i a ion ene gy o he eac ion, and his ac
can be explained by he ansi ion-s a e heo y pos ula ed by Pauling187. Du ing he p og ess o
a eac ion, he ansi ion-s a e ep esen s a empo a y and sho -li ing con igu a ion wi h he
highes alue o ee-ene gy188. Pauling p oposed ha he eac ion a e o an enzyma ic ac i i y
is de e mined by he deg ee o he enzyme- ansi ion-s a e complex s abili y (a highe s abili y
leads o a as e eac ion), and in his ega d, enzymes ac by s abilizing hese ansi ion-s a e
complexes (see he diag am depic ed in Figu e 31)189. Acco dingly, su oga es ha s abilize he
ansi ion-s a e complex wi h a highe a ini y han in insic ligands a e known as ansi ion-s a e
analogues ha p esen a highe a ini y owa ds he enzyme, esul ing in A) po en enzyma ic
inhibi o s (d ug candida es) o B) obus ools o s uc u al, mechanis ic and kine ic s udies o
he espec i e enzyma ic ac i i y.
187 Pauling L. Na u e o o ces be ween la ge molecules o biological in e es . Na u e.
1948;161(4097):707-709. doi:10.1038/161707a0
188 Sch amm VL. Enzyma ic ansi ion s a e heo y and ansi ion s a e analogue design. J Biol Chem.
2007;282(39):28297-28300. doi:10.1074/jbc.R700018200
189 Pauling L. Molecula A chi ec u e and Biological Reac ions. Chem Eng News. 1946;24:1375
74
Figu e 31. Ene gy diag am showing how he ac i a ion ene gy needed o a chemical eac ion (con e sion o he
subs a e/s in o a p oduc ) is educed when an enzyme s abilizes he ansi ion-s a e in e media e.
O e he las 50 yea s phospho a ed ansi ion-s a e analogues ha e been success ully explo ed
in medicinal chemis y. Fo ins ance, Gobec and collabo a o s p esen ed a se o phosphona e
con aining ansi ion-s a e analogues o an igen 85C, an enzyme o Mycobac e ium Tube culosis
wi h mycolyl ans e ase ac i i y (Figu e 32)190. An igen 85C is a p o ein complex ha ca alyzes
he ans e o mycolic acid om one molecule o , - ehalose monomycola e (TMM) o
ano he TMM, leading o he o ma ion o , - ehalose dimycola e (TDM), essen ial s ep o
he cell wall syn hesis191. The e ahed al phosphona e ansi ion-s a e analogue shown in
Figu e 32 was ound o s abilize mo e e icien ly he ansi ion-s a e o he eac ion ca alysed by
an igen 85 C han he in insic ehalose, he e o e esul ing in a high a ini y and s ong
inhibi ion o he enzyme ia a phospha e-based ansi ion-s a e-complex.
190 Gobec S, Plan an I, M a ljak J, e al. Design, syn hesis, biochemical e alua ion and an imycobac e ial
ac ion o phosphona e inhibi o s o an igen 85C, a c ucial enzyme in ol ed in biosyn hesis o he
mycobac e ial cell wall. Eu J Med Chem. 2007;42(1):54-63. doi:10.1016/j.ejmech.2006.08.007
191 Jackson M, Raynaud C, Lanéelle MA, e al. Inac i a ion o he an igen 85C gene p o oundly a ec s he
mycola e con en and al e s he pe meabili y o he Mycobac e ium ube culosis cell en elope. Mol
Mic obiol. 1999;31(5):1573-1587. doi:10.1046/j.1365-2958.1999.01310.x
75
Figu e 32. A ansi ion-s a e analogue bea ing a phosphona e unc ionali y.
I-1.2. Phospho us-con aining d ugs
In ega ds o d ug disco e y, he phospho us moie y can be in eg a ed in o he pha macopho e
s uc u e, o con a ily he P-g oup can play i s ole as he p o-moie y o a p od ug ha gi es
place o he co esponding pa en d ug a e in i o bioac i a ion. The e a e some excep ions
ha do no i ully wi hin his classi ica ion, o ins ance, in nucleo(s) ide analogues as he
P oTide app oach he P-g oup eme ges masked as a phospha e su oga e which is pa o he
pha macopho e, bu a he same ime ac s as a p o-moie y-like g oup in ol ed in he me abolic
ac i a ion o he p od ug (see he P oTides, e e ence). In his sec ion, a ep esen a i e selec ion
o phospho a ed d ugs will be b ie ly exposed, along wi h P-con aining ino ganic molecules as
coun e -ions and excipien s in d ug o mula ions.
I-1.2.1. Phospho us as pa o he pha macopho e
He ein, we ocus ou a en ion on pha macologically ele an d ugs con aining a phospho a ed
unc ionali y as pa o he pha macopho e.
(Phosphona e)-Fos omycin
Fos omycin (87, Figu e 33) is a b oad-spec um an ibio ic e ec i e owa ds bo h G am-posi i e
and G am-nega i e bac e ia. Fos omycin ac s as a bac e icidal analogue o
phosphoenolpy u a e (PEP) ha i e e sibly inhibi s he UDP-N-ace ylglucosamine
enolpy u yl ans e ase (Mu A), esul ing in a blockade o he biosyn hesis o pep idoglycan192.
Fos omycin is cu en ly o mula ed in sal o ms o o al (wi h calcium o ime hamine coun e -
ions) and in a enous (wi h sodium coun e -ions) adminis a ion193.
192 Kwan ACF, Beahm NP. Fos omycin o bac e ial p os a i is: a e iew. In J An imic ob Agen s.
2020;56(4):106106. doi:10.1016/j.ijan imicag.2020.106106
193 A eche-Eguizabal L, Domingo-Echabu u S, U u ia-Losada A, G au-Ce a o S. Fos omycin: Sal is wha
eally ma e s. En e m In ecc Mic obiol Clin (Engl Ed). 2021;39(4):206-207.
doi:10.1016/j.eimc.2020.06.006
76
(Phosphine oxide)-B iga inib
Ou o phosphine oxide con aining d ugs, b iga inib (88, Figu e 33) is a second gene a ion
anaplas ic lymphoma kinase (ALK) inhibi o app o ed by he FDA in 2017 o ALK+ non-small cell
lung cance 194. B iga inib p esen s an enhanced CNS pene a ion and consequen ly an imp o ed
an i- umo e ec on b ain me as asis, a p omising ad an age conside ing ha lung cance s end
o sp ead by me as asis since a e loca ed in a highly ascula ized issue195.
(Phosphina e)-Fosinop il
Fosinop il (89, Figu e 33) is an angio ensin con e ing enzyme (ACE) inhibi o used in he
ea men o hype ension and ch onic hea ailu e. Fosinop il is he only ACE inhibi o
con aining a phospho a ed moie y, which is in ac a phosphina e es e p od ug which is
ac i a ed in i o o gi e place o he co esponding ac i e phosphinic acid de i a i e osinop ila
(90)196.
(S and F con aining phospha es)-Dy los and eco hiopa e iodide
Dy los (91, Figu e 33) and eco hiopa e iodide (92) a e bo h ace ylcholines e ase (ACHE)
inhibi o s based on luo ine/sulphu con aining phospha es (phospho o luo ida e o dy los and
phospho o hia e o eco hiopa e iodide), which a e cu en ly used in ch onic ocula
hype ension (ini ially we e used in humans and la e in e e ina y medicine)184.
194 FDA esou ces page. h ps://www. da.go /d ugs/ esou ces-in o ma ion-app o ed-d ugs/b iga inib.
Accessed Decembe 28, 2021.
195 Rigaud C, Dou he M. Chap e 4 - managemen o ALK posi i e pa ien s wi h umo s o he han lung
cance . In: F iboule L, ed. The apeu ic s a egies o o e come ALK esis ance in cance . Vol 13. Academic
P ess; 2021:71-86. doi:10.1016/B978-0-12-821774-0.00008-5
196 Da is R, Coukell A, McTa ish D. Fosinop il. A e iew o i s pha macology and clinical e icacy in he
managemen o hea ailu e. D ugs. 1997;54(1):103-116. doi:10.2165/00003495-199754010-00012
77
Figu e 33. D ugs bea ing a phospho a ed g oup in he pha macopho e.
(Phospha e)-Nucleo(s) ide phospha e/phosphona e p od ugs
Nucleo(s) ide p od ugs a e pha macologically inac i e bu pha macokine ically sui able d ugs
ha a e me abolically ac i a ed in i o. Ou o his ca ego y, is no ewo hy o highligh he
nucleo ide p od ugs (P oTides, p od ugs o nucleo ides) in oduced by McGuigan and
collabo 197.
In he P oTide app oach (Figu e 34), he phospho us moie y is no pa o he p o ec i e g oup.
Con a ily, he phospho us is pa o an enmasked phospha e o a nucleo(s) ide as a
a yloxyphospho (n)amida e o m, which plays a p ima y ole in he bioac i a ion by consecu i e
197 McGuigan C, Tsang HW, Su on PW, De Cle cq E, Balza ini J. Syn hesis and an i-HIV ac i i y o some
no el chain-ex ended phospho amida e de i a i es o d4T (s a udine): es e ase hyd olysis as a apid
p edic i e es o an i i al po ency. An i i Chem Chemo he . 1998;9(2):109-115.
doi:10.1177/095632029800900202

78
ac ion o in insic me abolic enzymes. A e eleasing he wo masking p o ec i e g oups ( he
a yloxy es e i s and he amino acid moie y la e ), he esul ing monophospha e nucleo(s) ide
is phospho yla ed ( wice) o ob ain he ac i e nucleo(s) ide iphospha e198.
Figu e 34. P oTide d ugs con aining an a yloxyphospho (n)amida e sca old.
Phospha e P oTide: So osbu i
So osbu i (93, Figu e 34) in a guanosine analogue p od ug, composed o a guanosine
monophospha e de i a i e p o ec ed wi h a phenol e he and a L-alanine esidue in he
phospha e moie y. So osbu i is ac i a ed in he li e by means o sequen ial s eps in ol ing he
combina ion o a ious enzymes as shown in Scheme 24: hyd olysis o ca boxyl es e s by
ca hepsin A (Ca A) and ca boxyles e ase 1 (CES 1), phospho aminidase ac i i y o hHin 1
hyd olase, and inally phospho yla ion eac ion by bo h UMP-CMPK and NDPK kinases199. The
co esponding ac i e guanosine iphospha e analogue (94) is a di ec an i i al used o ea he
hepa i is C i us (HCV) ia inhibi ion o HCV polyme ase.
198 Slusa czyk M, Se pi M, Pe usa i F. Phospho amida es and phosphonamida es (P oTides) wi h an i i al
ac i i y. An i i Chem Chemo he . 2018;26:2040206618775243. doi:10.1177/2040206618775243
199 Dousson CB. Cu en and u u e use o nucleo(s) ide p od ugs in he ea men o hepa i is C i us
in ec ion. An i i Chem Chemo he . 2018;26:2040206618756430. doi:10.1177/2040206618756430
79
Scheme 24. In i o bioac i a ion o so osbu i .
Phosphona e P oTide: Teno o i ala enamide
Teno o i ala enamide uma a e (TAF, chemical s uc u e 97 in Figu e 34, ide sup a) is o med
by an a yloxy os onamida e o alanine linked o an adenosine de i a i e which lacks he ibose
moie y. The me abolic bioac i a ion o TAF gi es place o eno o i , a dAMP analogue wi h
an i e o i al ac i i y. TAF is cu en ly used o he ea men o in ec ions wi h hepa i is B i us
(HBV) and human immunode iciency i us (HIV)198.
Bisphosphona es
Bisphosphona es a e bone seeking agen s clinically used in diseases in ol ing bone loss such as
os eopo osis o Page ´s disease, and a e s uc u ally composed o wo phosphona e g oups
(P(O)(OH)2) linked o a cen al C a om (A, Figu e 35; e.g. sodium isend ona e 97)200.
Bisphosphona es a e analogues o py ophospha e (B, Figu e 35; e.g. e iod ona e disodium 98)
wi h an imp o ed chemical s abili y p o ided by he C a om in be ween, which con e s
esis ance o he ac i i y o in es inal phospha ases, he e o e bisphosphona es a e sui able
d ugs o o al adminis a ion201.
200 Caw h ay J, Wasan E, Wasan K. Bone-seeking agen s o he ea men o bone diso de s. D ug Deli
T ansl Res. 2017;7(4):466-481. doi:10.1007/s13346-017-0394-3
201 Buche R, Millán JL, Magne D. Mul isys emic unc ions o alkaline phospha ases. Me hods Mol Biol.
2013;1053:27-51. doi:10.1007/978-1-62703-562-0_3
80
Figu e 35. Compa ison be ween he main s uc u es o bisphosphona es and py ophospha es wi h an example o each.
Bisphosphona es p e e ably bind o Ca2+ ions wi h high a ini y and hence, once abso bed hey
a e accumula ed in high concen a ions in he bone issue. When os eoclas s des oy he bone,
bisphosphona es a e eleased and selec i ely in e nalized by he same os eoclas s, esul ing in
he induc ion o os eoclas apop osis by ollowing di e en molecula pa hways (depending on
he s uc u e o he bisphosphona e). The inal pha macological esul is a educ ion o he
os eoclas ic bone eso p ion200.
I-1.2.2. Phospho us as pa o he p o-moie y
As men ioned be o e, a conside able pa o me abolism in ol es bio ans o ma ion o
phospha e es e s. Hence, unp o ec ed phospha e-con aining compounds a e likely o be quickly
ans o med in i o and his may explain hei wide use as p o-moie ies in he p epa a ion o
es e p od ugs o imp o e he wa e solubili y o o ally and in a enously adminis e ed d ugs.
Phospha e p od ugs a e ac i a ed by phospha ases such as alkaline phospha ases p esen in
plasma and en e ocy es o he in es inal ba ie ia hyd olysis o he phospha e es e s202, among
o he s.
202 Hu unen KM, Raunio H, Rau io J. P od ugs-- om se endipi y o a ional design. Pha macol Re .
2011;63(3):750-771. doi:10.1124/p .110.003459
81
S e oid-de i ed sodium phospha es
Dexame hasone (DXM) is a long ac ing glucoco icoid used in in lamma o y/alle gic diso de s,
ce eb al edema and in he managemen o ci cula o y shock such as sep ic shock203.
Dexame hasone sodium phospha e is a p od ug o he ac i e DXM p o ec ed wi h a phospha e
g oup and o mula ed in a sodium sal o m in o de o allow in a enous adminis a ion. The
employmen o (disodium) phospha e as he p o ec i e g oup compa ing wi h o he p o-
moie ies (as hemisuccina es) con e s o DXM a high deg ee o solubili y and chemical s abili y in
aqueous en i onmen , as well as a as e biocon e sion by alkaline phospha ases o he wa e
soluble p od ug in o he ac i e o m ( ee DXM)204. Besides DXM, he e a e o he co icos e oid
es e phospha es used in clinics as p ednisolone sodium phospha e202 and hyd oco isone
sodium phospha e205. The s uc u es o dexame hasone/p ednisolone/hyd oco isone (99, 100,
101) sodium phospha e a e depic ed in Figu e 36.
Figu e 36. S uc u es o dexame hasone, p ednisolone and hyd oco isone o mula ed in hei sodium phospha e sal
o m.
203 1. Flowe RJ, Ga ins F. Dexame hasone. In: Enna SJ, Bylund DB, eds. xPha m: The comp ehensi e
pha macology e e ence. New Yo k: Else ie ; 2008:1-6. doi:10.1016/B978-008055232-3.61572-7
204 Rohdewald P, Möllmann H, Ba h J, Rehde J, De endo H. Pha macokine ics o dexame hasone and
i s phospha e es e . Biopha m D ug Dispos. 1987;8(3):205-212. doi:10.1002/bdd.2510080302
205 Shanka -Ha i M, San hakuma an S, P e os AT, e al. De ining pheno ypes and ea men e ec
he e ogenei y o in o m acu e espi a o y dis ess synd ome and sepsis ials: seconda y analyses o h ee
RCTs. Sou hamp on (UK): NIHR Jou nals Lib a y; July 2021.
88
ac i a e he e hylene. These wo scena ios equi e he elec ophilic ac i a ion o he imine by
coo dina ing a Lewis-acid ca alys o he ni ogen a om, which emo es elec onic densi y om
he iminic ca bon o p omo e he Po a o eac ion218. A wide ange o LA ha e been desc ibed
as con enien ca alys in he Po a o cycloaddi ion, e.g. BF3.E 2O, lan hanide i la es,
lan hanide sal s such as ce ium ammonium ni a e (CAN)219 o indium sal s220. In 1988, G ieco
and co-wo ke s ound ha B øns ed-acids, which a e able o p o ona e he iminic ni ogen,
could be con enien ly used o ca alyze he Po a o eac ion. Acco dingly, du ing DA
cycloaddi ion be ween cyclopen adiene and aldimines in he p esence o i luo oace ic acid
(TFA), G ieco and collabo a o s expec ed a o mal [4+2] Diels-Alde eac ion (pa hway A,
Scheme 30), bu hey ound ha N-a yl imines we e ac ing as he dienophile in an in e se
elec on-demand [4+2]-cycloaddi ion a e elec ophilic ac i a ion by TFA, ob aining adduc s
118 de i ed om he Po a o eac ion (pa hway B, Scheme 30) ins ead o he expec ed DA
p oduc s221.
Scheme 30. In e se elec on-demand [4+2]-cycloaddi ion ob ained by G ieco and cowo ke s be ween cyclopen adiene
and aldimines ac i a ed by TFA.
218 Kouzne so VV. Recen syn he ic de elopmen s in a powe ul imino Diels Alde eac ion (Po a o
eac ion): Applica ion o he syn hesis o N-polyhe e ocycles and ela ed alkaloids. Te ahed on.
2009;65(14):2721-2750. doi:10.1016/j. e .2008.12.059
219 S idha an V, Menéndez JC. Ce ium(IV) ammonium ni a e as a ca alys in o ganic syn hesis. Chem Re .
2010;110(6):3805-3849. doi: 10.1021/c 100004p
220 Manian, Ra hna Du ga R. S., Jayashanka an J, Ramesh R, Raghuna han R. Rapid syn hesis o
e ahyd oquinolines by indium ichlo ide ca alyzed mono- and bis-in amolecula imino Diels Alde
eac ions. ChemIn o m. 2007;38(6). doi:10.1002/chin.200706139
221 G ieco PA, Bahsas A. Role e e sal in he cyclocondensa ion o cyclopen adiene wi h he e odienophiles
de i ed om a yl amines and aldehydes: Syn hesis o no el e ahyd oquinolines. Te ahed on Le .
1988;29(46):5855-5858. doi:10.1016/S0040-4039(00)82208-X

89
Key ad ances in he disco e y o e icien ca alys s o he Po a o eac ion
In 1995 Kobayashi e al. epo ed he Po a o eac ion o ole ins wi h aldimines elec onicallly
ac i a ed by 10 mol% o lan hanide i la es, ob aining e ahyd oquinoline adduc s in high
yields222. Kobayashi´s disco e y opened he doo o he de elopmen o highly e icien Lewis-
acid (e.g. lan hanide i la es and chlo ides) and me al- ee B øns ed-acid ca alys s223, which
allowed o mo e om s oichiome ic o ca aly ic amoun s o ca alys . Nowadays, a wide a ie y
o powe ul ca alys s a e used o p omo e he Po a o eac ion, including Lewis-acids (BF3.E 2O,
(Yb(OT )3, Sc(OT )3, CAN, SnCl4, FeCl3, ZnCl2, CuB 2, BiCl3, InCl3, phospho ic acids), B øns ed-acids
(p-TSOH, TFA, HCl, T OH, T 2NH), o molecula iodine (I2), among o he s. One yea La e ,
Kobayashi and co-wo ke s disclosed he i s asymme ic Po a o eac ion be ween hyd oxy-
aldimines 119 (Scheme 31) and non-chi al inyl e he /2,3-dihy o u ane/ciclopen adiene 120
using a chi al lan hanide i la e complex as LA ca alys in he p esence o a base, o ob ain cis-
e ahyd oquinoline adduc s 121 wi h high enan iome ic excesses224. The disco e ies o MCR
and enan ioselec i e e sions and specially he de elopmen o highly e icien ca alys s
ini ia ed by Kobayashi e-a ac ed he a en ion o syn he ic o ganic chemis s owa ds he
Po a o eac ion.
Scheme 31. Asyme ic Po a o eac ion ca alyzed by a lan hanide i la e-complex as a Lewis-acid ca alys .
I-2.3. Dienophiles in he Po a o eac ion
The Po a o eac ion ole a es a wide ange on dienophiles, acceding o many di e en
e ahyd oquinoline-de i ed sca olds.
222 Kobayashi S, Ishi ani H, Nagayama S. Lan hanide T i la e Ca alyzed Imino Diels-Alde Reac ions;
Con enien Syn heses o Py idine and Quinoline De i a i es. Syn hesis. 1995;1995(9):1195-1202
223 Akiyama T, Mo i a H, Fuchibe K. Chi al b øns ed acid-ca alyzed in e se elec on-demand aza
J Am Chem Soc. 2006;128(40):13070-13071. doi: 10.1021/ja064676
224 Ishi ani H, Kobayashi S. Ca aly ic asymme ic aza diels-alde eac ions using a chi al lan hanide lewis
acid. enan ioselec i e syn hesis o e ahyd oquinoline de i a i es using a ca aly ic amoun o a chi al
sou ce. Te ahed on Le . 1996;37(41):7357-7360. doi: h ps://doi.o g/10.1016/0040-4039(96)01655-3
90
Alkenes and alkynes as dienophiles
Ou esea ch g oup p esen ed s y enes 124a (Scheme 32)93 and he cyclic de i a i e indene
124b94 as dienophiles in a BF3.E 2O p omo ed Po a o MCR (wi h imines de i ed om 3-
aminopy idine 122 and aldehydes 123) o he syn hesis o highly unc ionalized
e ahyd oquinoline/quinoline de i a i es 125a/126a o
indeno e ahyd oquinoline/indenoiquinolines 125b/126b. Likewise, ou g oup also p esen ed
ace ylenes 124c as sui able dienophile in he Po a o eac ion o yield di ec ly quinoline
de i a i es 126a225, a s a egy o ien ed o a oid he inal oxida ion s ep.
Scheme 32. S y enes, indene and ace ylenes as dienophiles in he Po a o eac ion.
Vynil/enol e he s/enamin(d)es and cyclic de i a i es as dienophiles
Po a o pe o med he i s imino-DA [4+2]-cycloaddi ion employing inyl e he s and inyl
hioe he s as dienophiles. In he same way enol e he s and cyclic de i a i es ha e been b oadly
explo ed, including hei analogues inyl enamides/enamines (and cyclic de i a i es he eo ). As
an example, in 2012 Jacobsen, Ma cu elle and collabo a o s disclosed an asymme ic Po a o
225 Alonso C, González M, Palacios F, Rubiales G. S udy o he he e o-[4+2]-cycloaddi ion eac ion o
aldimines and alkynes. syn hesis o 1,5-naph hy idine and isoindolone de i a i es. J O g Chem.
2017;82(12):6379-6387. doi: 10.1021/acs.joc.7b00977
91
eac ion o imine glyoxala e 127 (Scheme 33) and 2,3-dihyd o-1H-py ole 128 as dienophiles, in
he p esence o a chi al u ea B øns ed-acid ca alys , ob aining e ahyd oquinoline adduc s 129
which we e he p ecu so s o de i a i es 130 (a whole lib a y o >2000 de i a i es)226.
Scheme 33. Asyme ic Po a o eac ion desc ibed by Jacobsen and collabo a o s
In amolecula Po a o eac ion
Besides he s anda d Po a o eac ion, i he diene and he dienophile a e p esen in he same
molecule, he Po a o eac ion can occu in amolecula ly o achie e used N-con aining
polycyclic s uc u es o high complexi y. Fo ins ance, in ou g oup, Ma ín-Encinas disclosed a
sma in amolecula Po a o eac ion (desc ibed in he Scheme 34) o yield used
quinolino[4,3-b][1,5]naph hy idine sca olds 131, acceding o N-polyhe e ocycles wi h ele a ed
biological in e es as TOP1 inhibi o s97.
Scheme 34. In amolecula Po a o eac ion desc ibed by Ma ín-Encinas.
I-2.4. Dehyd ogena ion o e ahyd oquinoline adduc s ob ained by he Po a o eac ion
o achie e ully a oma ic quinolines
The o ma ion o e ahyd oquinoline adduc s p o ided by he Po a o eac ion may be
subjec ed o selec i e dehyd ogena ion wi h oxidizing agen s o ob ain he co esponding
226 e al. Applica ion o a ca aly ic asymme ic Po a o eac ion using
chi al u eas o he syn hesis o a e ahyd oquinoline lib a y. ACS Comb Sci. 2012;14(11):621-630.
doi:10.1021/co300098
92
a oma ic quinolines. The p ocess comp ises he o mal emo al o 4 hyd ogen a oms and u he
implies he loss o he s e eoselec i i y ob ained du ing he Po a o eac ion. Se e al oxidan s
ha e been success ully explo ed o he dehyd ogena ion o e ahyd oquinoline adduc s, such
as DDQ, CAN, manganese ace a e, molecula sulphu and ni obenzene227. I mus be men ioned
ha du ing he oxida ion s ep undesi ed side-elimina ion eac ions can occu (specially wi h
non-a oma ic N-C and O-C bonds), educing he yield o he p ocess. Acco dingly, La illa and
cowo ke s p esen ed a me hod o he selec i e oxida ion o lac am- used e ahyd oquinoline
de i a i es wi h manganese oxide in he p esence o s oichiome ic amoun s o py idine, which
yields o he co esponding quinoline 132 de i a i es a oiding side elimina ion eac ions d i ing
o undesi ed opened de i a i es 133 ( he p ocess is desc ibed in he Scheme 35).
Scheme 35. Selec i e oxida ion o e ahyd oquinoline adduc s disclosed by La illa and collabo a o s.
227 Vicen e-Ga cía E, Ramón R, P eciado S, La illa R. Mul icomponen eac ion access o complex
quinolines ia oxida ion o he Po a o adduc s. Beils ein J O g Chem. 2011;7:980-987.
doi:10.3762/bjoc.7.110
93
I-2.5. Summa y, a his o ical app oach o he Po a o eac ion
We ha e desc ibed he mechanism and syn he ic applicabili y o he Po a o eac ion, along
wi h he key ad ances achie ed since i s disco e y by Po a o and Mikhailo in 1963 un il he
la e 1990s, when he in e es o he Po a o eac ion g ew conside ably and nowadays is s ill a
b oadly used syn he ic me hod. These key indings a e collec ed in he imeline depic ed in he
Figu e 39, in whe e he main ad ances a e placed in o a his o ical ame.
Figu e 39. Schema ic imeline co e ing he disco e y and main ad ances o he Po a o eac ion.

94
I-3. Syn hesis o quinolinylphosphine oxide de i a i es
*No e: om his poin on, compounds, schemes, igu es and ables will be enume a ed s a ing
om he numbe 1. This nume ical o de will be main ained o e e ence he compounds he ein
syn hesized in he ollowing chap e s dedica ed o hei biological e alua ion.
Con inuing wi h ou esea ch g oup´s p e ious wo k ocused in he de elopmen o small N-
con aining he e ocycles as TOP1 inhibi o s93,94, we designed a se o 2,4-dia ylsubs i u ed
1,2,3,4- e ahyd oquinolines and quinolines bea ing a pen a alen diphenylphosphine oxide
moie y which may be con enien ly p epa ed by he Po a o eac ion which in ol es a Lewis acid
p omo ed [4+2] cycloaddi ion eac ion. Fo he p epa a ion o 8-quinolinylphosphine oxide
de i a i es III, his eac ion could be pe o med be ween N-a yl imines II (ob ained by
condensa ion be ween anilines I and aldehydes) and elec on ich dienophiles, acceding o a
b oad a ie y o e ahyd oquinolines III (Scheme 1).
Scheme 1. Lewis-acid ca alyzed Po a o eac ion
I-3.1. Syn hesis o (2-aminophenyl)diphenylphosphine oxide 1a
In o de o accomplish he syn hesis o quinoline de i a i es h ough he Po a o eac ion, i s ly
we had o p epa e he co esponding o-phosphine oxide aniline 1a (Figu e 1) as long as his
ini ial subs a e is no comme cially a ailable.
Figu e 1. S uc u e o (2-aminophenyl)diphenylphosphine oxide 1a.
Based on he exis ing bibliog aphy, appa en ly he mos eliable me hod o he p epa a ion o
o-phosphine oxide aniline 1a (Figu e 2) implies a 2 s ep p ocedu e in ol ing a nucleophilic
95
a oma ic subs i u ion eac ion (SNA ) o 1,2-dini obenzenes wi h i alen o ganophospho us
eagen s (Scheme 2).
Scheme 2. SNA o 1,2-dini obenzenes and nucleophilic i alen phospho us eagen s ou lined by Ca dogan and
collabo a o s.
The p esen SNA me hodology was disclosed by Ca dogan and collabo a o s in 1969228 bu is
s ill being used in ecen publica ions229. Ca dogan´s g oup desc ibed he displacemen o a ni o
g oup by nucleophilic phospho us eagen s h ough a Michaelis-A buzo -like mechanism. The
eac ion in ol es he nucleophilic addi ion o a i alen phosphi e/phosphini e o 1,2-
dini obenzenes and a subsequen nucleophilic displacemen o he ac i a ed ni o g oup o
o m a phosphonium sal in e media e. Finally, a dealkyla ion eac ion media ed by he
displaced ni o anion leads o he co esponding 2-ni odiphenyl pen a alen phosphine oxide
de i a i e (Scheme 2).
The aniline 1a was p epa ed ollowing he syn he ic ou e depic ed in scheme 3, which
comp ises a nucleophilic displacemen o a ni o g oup o 1,2-dini obenzene wi h e hyl
diphenylphosphini e and a subsequen selec i e hyd ogena ion o he ni o unc ionali y.
228 Cadogan JIG, Sea s DJ, Smi h DM. The eac i i y o o ganophospho us compounds. pa XXV.
displacemen o ac i a ed a oma ic ni o-g oups by e alen phospho us eagen s. J Chem Soc C.
1969(10):1314-1318. doi:10.1039/J39690001314
229 a) Rad'ko a NY, Tolpygin AO, Rad'ko VY, e al. Bis(alkyl) a e-ea h complexes coo dina ed by bulky
iden a e amidina e ligands bea ing pendan Ph2P=O and Ph2P=NR g oups. Syn hesis, s uc u es and
ca aly ic ac i i y in s e eospeci ic isop ene polyme iza ion. Dal on T ans. 2016;45(46):18572-18584. doi:
10.1039/C6DT03074B b) Na a o Y, Ga cía López J, Iglesias MJ, López O iz F. Chela ion-assis ed
in e up ed coppe (I)-ca alyzed Azide Alkyne Azide domino eac ions: Syn hesis o ully subs i u ed 5-
iazenyl-1,2,3- iazoles. O g Le . 2021;23(2):334-339. doi: 10.1021/acs.o gle .0c03838.
96
Scheme 3. Syn hesis o he s a ing subs a e 1a.
Reac ion moni o ing by 31P-NMR spec oscopy e ealed ha he e hyl diphenylphosphini e was
no o ally con e ed in o (2-ni ophenyl)diphenylphosphine oxide, e en hough a e
pu i ica ion o he c ude eac ion, (2-ni ophenyl)diphenylphosphine oxide was ob ained in a
good yield (69%). Mo eo e , he p esen SNA p odecu e allows an easy eco e y o he s a ing
1,2-dini obenzene, which can be e-used in u u e eac ions. A e he inse ion o he
pen a alen phospho ous unc ionali ies in he benzene ing, he ni o g oup was easily educed
in o amino unc ionali y in a quan i a i e yield (shown as 99 %) by selec i e ca aly ic
hyd ogena ion in he p esence o Raney nickel, ob aining he desi ed (2-
aminophenyl)diphenylphosphine oxide 1a (Scheme 3).
I-3.2. Syn hesis o hyb id diphenylphosphine oxide subs i u ed 1,2,3,4-
e ahyd oquinolines by he Po a o eac ion
I-3.2.1. One-po s ep-by-s ep eac ion wi h ole ins ( ou e A)
Once he s a ing subs a e 1a was p epa ed, we p oceeded o use i in he subsequen s eps.
Phosphine oxide de i ed aldimines 4 can be easily p epa ed by he condensa ion o
phospho a ed aniline 1a and a oma ic aldehydes 2 in e luxing chlo o o m (Scheme 4). In o de
o p o ec he imines om hyd olysis, eac ions we e conduc ed unde ine ni ogen
a mosphe e (N2 gas) and molecula sie es we e added o he eac ion media.
97
Scheme 4. Syn he ic ou e A (s epwise Po a o ) o he p epa a ion o 1,2,3,4- e ahyd oquinolin-8-yl phosphine
oxides 6.
The o ma ion o aldimines 4was moni o ed by 1H and 31P-NMR spec oscopy. Despi e hei
chemical ins abili y, con e sion o aniline 1a in o he co esponding aldimine 4can be obse ed
o a ce ain ex en by NMR i he eac ion is pe o med in deu e a ed chlo o o m and aliquo s
a e aken unde ine N2a mosphe e (in he case o 31P-NMR, he eac ion can be made in CHCl3
and hen dilu e he sample in CDCl3). The eac ion condi ions o he o ma ion o aldimines 4
a e collec ed in he Table 1.
Table 1. P epa a ion o 2-(diphenylphosphine oxide) aldimines 4.
En y Compound Reac ion ime
Nº R1
14a 2-MeO-C6H412h
24b 4-(E O)2P(O)O- C6H424h
3
4c
1
-
naph hyl
24h
44i 3,4-F2-C6H324h
Un o una ely, aldimines 4 esul sensi i e o hyd olysis, and he e o e hey we e p epa ed in
si u o he subsequen cycloaddi ion eac ions, wi hou p e ious isola ion. A e comple ion o
imine o ma ion in e luxing chlo o o m, he eac ion was cooled down and phospho a ed N-
a yl imines 4 we e used in he subsequen con en ional Po a o app oach comp ised a Lewis
acid (LA) ca alyzed aza-Diels Alde eac ion wi h elec on ich ole ins 3, in he p esence o bo on
i luo ide die hyl e he a e (BF3.E 2O) as a Lewis acid ca alys (Scheme 4, ou e A). In o de o
p o ec imines om hyd olysis, Po a o eac ions we e conduc ed unde an ine ni ogen
a mosphe e (N2gas) and molecula sie es (4 Å) we e added o he eac ion media. The eac ion
104
I-3.3. Syn hesis o diphenylphosphine oxide subs i u ed quinolines
I-3.3.1. Oxida ion o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6
A e he p epa a ion o e ahyd oquinoline p ima y adduc s 6 by he Po a o eac ion, we
conside ed he syn hesis o he co esponding quinolines 7by a subsequen dehyd ogena ion
p ocess (Scheme 6). Te ahyd oquinolines 6a e subjec ed o oxida ion o ob ain he
co esponding quinolines 7, which in ol es he emo al o ou hyd ogens by an oxidan agen
and leads o he loss o he s e eoselec i i y. The selec i e dehyd ogena ion o THQ amewo ks
leads o ully a oma ic quinolines, and his ac may ha e a ema kable e ec owa ds inhibi ion
o TOP1 as la o quasi- la polya oma ic sys ems may s ablish a ou able in e ac ions wi h
TOP1-DNA complexes (mainly -s acking in e ac ions wi h DNA base pai s)230.
DDQ is one o he mos used oxidizing agen o dehyd ogena e Po a o adduc s. Ou g oup had
p e ious expe ience wo king wi h DDQ and in he p esen oxida ions, apid con e sions wi h no
e idences o side eac ion p oduc s we e obse ed. In his manne , we op imized a s anda d
p o ocol using e ahyd oquinolines 6and 2 equi alen s o DDQ in e luxing chlo o o m (Scheme
6). The eac ion p og ess was ollowed by TLC and NMR spec oscopy (1H, 31P) and, in all cases,
eac ions we e comple ed a e 2 h. The isola ion o quinolines 7 om he eac ion c udes may
esul challenging, because o he di iness de i ed om he excess o DDQ and educed o m
he eo . Thus, as DDQ and educed o m esul pa ially soluble in wa e , we ealized ha a wo k
up comp ising washing he o ganic solu ion jus wi h wa e se e al imes (5-10) allows o ge id
o he impu i ies ha hinde he pu i ica ion s ep.
Scheme 6. A oma iza ion o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6 o yield quinoline-8-yl phosphine
oxides 7.
Following he cu en DDQ oxida ion p o ocol, we p oceeded o he p epa a ion o he
quinoline-8-yl de i a i e 7a by he selec i e dehyd ogena ion o 1,2,3,4- e ahyd oquinolin-8-yl
de i a i e 6a as a model eac ion. The o ma ion o (2-(2-me hoxyphenyl)-4-phenylquinolin-8-
yl)diphenylphosphine oxide 7a was con i med by 1H-NMR spec oscopy. In he 1H-NMR
230 Pommie Y, Ma chand C. In e acial inhibi o s: a ge ing mac omolecula complexes [published
co ec ion appea s in Na Re D ug Disco . 2012 Ma ;11(3):250]. Na Re D ug Disco . 2011;11(1):25-36.
Published 2011 Dec 16. doi:10.1038/n d3404

105
spec um o he ully a oma ic quinoline de i a i e 7a, he cha ac e is ic signals co esponding
o he alipha ic p o ons p esen in he e ahyd oquinoline ing o 6a disappea ed, while a new
-9 ppm) as shown in Figu e 6.
Figu e 6. Compa ison be ween 1H-NMR spec a o e ahyd oquinolin-8-yl phospine oxide 6a and he co esponding
quinolin-8-yl phospine oxide 7a.
106
Once es ablished he eac ion condi ions, we nex s udied he scope o he selec i e
dehyd ogena ion p ocess. Thus, he op imized DDQ p o ocol was applied o he es o 1,2,3,4-
e ahyd oquinolin-8-yl phosphine oxides 6. The a o ded quinolin-8-yl phosphine oxides 7 we e
isola ed by column ch oma og aphy and ec ys allyzed in hexane:e hyl ace a e. Yields o
quinolines 7 p epa ed by he a o emen ioned DDQ oxida ion app oach a e summa ized in Table
3.
Table 3. Yields o quinoline-8-yl phosphine oxides 7 ob ained by DDQ oxida ion o compounds
6.
En y
Compound
Yield (%)
Nº
R
1
R
2
1
7a
2
-
MeO
-
C
6
H
4
H
74
2
7b
4
-
(E O)
2
P(O)O
-
C
6
H
4
H
65
3
7c
1
-
naph hyl
H
72
4
7d
2
-
naph hyl
H
82
5
7
C
6
H
5
4
-
Me
88
6
7g
4
-
F
-
C
6
H
4
4
-
Me
93
7
7h
4
-
F
-
C
6
H
4
4
-
F
96
8
7i
3,4
-
F
2
-
C
6
H
3
4
-
F
99
I we a end o he esul s lis ed in he Table 3, we can obse e ha he DDQ dehyd ogena ion
p ocedu e o e ahyd oquinolines 6 o ob ain he ully a oma ic quinolinyl phosphine oxides 7
was ound o be an e icien me hod wi h o e all high yields (65-99%). The bes yields we e
ob ained wi h quinoline de i a i es 7g (R1 = 4-F-C6H4; R2 = 4-Me; en y 6), 7h (R1 = 4-F-C6H4; R2 =
4-Me; en y 7), and 7i (R1= 3,4-F-C6H3; R2 = 4-F; en y 8), showing excellen yields (be ween 93-
99%).
I-3.3.2. Po a o eac ion wi h ace ylenes ( ou e C)
Once we ob ained quinolines 7a-i by he oxida ion o isola ed Po a o e ahyd oquinoline
adduc s 6 wi h DDQ, we mo ed o in es iga e a s aigh o wa d me hod o ob ain di ec ly
quinolines 7 in ol ing a Po a o eac ion be ween 2-(diphenylphosphine oxide) aldimines 4 and
ace ylenes 8 (Scheme 7, ou e C).
107
Scheme 7. Syn he ic ou e o he di ec p epa a ion o quinoline-8-yl phosphine oxides 7.
To s a he in es iga ion, a Po a o app oach s a ing om in si u gene a ed imines was
explo ed. In his ega d, aldimines 4we e p epa ed om he condensa ion o aniline 1a and
a oma ic aldehydes 2in e luxing chlo o o m wi hin 24 h (we used he same condi ions
desc ibed o he imines p epa ed in ou e A (Scheme 4, ide sup a). Imines 4we e eac ed wi h
ace ylenes 8, 2 equi alen s o BF3.E 2O and DDQ, o ob ain egioselec i ely quinolines 7 (Scheme
7, Table 4). The s uc u e o he ob ained compounds 7by he ou e C (oxida i e Po a o
eac ion) was con i med by compa ison wi h de i a i es 7ob ained by oxida ion o compounds
6.
Table 4. Yields o quinoline-8-yl phosphine oxides 7ob ained by ou e C.
En y Compound Yield (%)
Nº R1R2
17 C6H54-Me 82
27g 4-F-C6H44-Me 71
37h 4-F-C6H44-F 68
47j C6H54-F 56
57k 4-F-C6H4H 50
As i can be obse ed in he able 4, he s aigh o wa d p epa a ion o quinolinyl phosphine
oxides 7 h ough he s ep-by-s ep Po a o -DDQ oxida ion eac ion sequence ( ou e C) epo ed
mode a e o high yields (50-82%) and esul ed specially e ec i e o he di ec p epa a ion o
he compound 7 (R1 = C6H5; R2 = 4-Me; Table 4, en y 1) in a one-po app oach.
A his poin i has o be men ioned ha du ing he Po a o eac ion wi h ace ylenes (Scheme
7), in he absence o DDQ e idences o an unexpec ed side oxida ion eac ion o in e media es
108
6we e obse ed by he in si u gene a ed imines 4, as hese imines 4can ac as H accep o s and
he e o e educe o he co esponding seconda y amine o m (isola ed om he eac ion
c udes), esul ing in an undesi ed loss o e iciency231. This undesi ed educ ion o imines 4 can
be p e en ed by di ec ly adding DDQ o he Po a o eac ion. The o ma ion o quinolines 7
be ween aldimines and ace ylenes in he p esence o DDQ can be explained by a s ep-by-s ep
Po a o eac ion225 ha p oceeds h ough he in e media e adduc s 9, whose subsequen
a u ome iza ion-dehyd ogena ion sequence in he p esence o DDQ leads o he o ma ion o
quinolines 7 (Scheme 7).
Fu he mo e, i should be no ed ha he Po a o MCR wi h ace ylenes is no a ou ed, as he
eac ion is epo ed o unde go a p edominan side- eac ion be ween aldehydes and
ace ylenes. In acidic media, a oma ic aldehydes and ace ylenic compounds lead o he o ma ion
o undesi ed , -unsa u a ed ke ones232. Fo his eason, he de elopmen o a MCR app oach
was disca ded and we uled ou he s udy o he s epwise Po a o -DDQ oxida ion one-po
cascade eac ion, using ace ylenes as dienophiles.
I-3.4. Summa y o he syn he ic ou es employed o he p epa a ion o hyb id quinolin-8-
yl phosphine oxide de i a i es 6 and 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxide
de i a i es 7
Ini ially, quinoline de i a i es 7 (Scheme 8) we e he main objec o esea ch, bu p elimina y
s udies wi h e ahyd oquinolines 6 e ealed ce ain biological ac i i y as an ip oli e a i e/TOP1
inhibi o agen s. Based on hese in e ences, we had o conside he isola ion and u he
e alua ion o e ahyd oquinoline adduc s along wi h ully a oma ic quinolines. Acco dingly,
a ious s a egies based on he Po a o eac ion we e in es iga ed o he syn hesis o 2,4-
disubs i u ed 1,2,3,4- e ahyd oquinolines (6) and quinoline (7) de i a i es bea ing a diphenyl
phosphine oxide unc ionali y in posi ion 8 (namely ou e A, ou e B, oxida ion o compounds 6
and ou e C). All he syn e ic ou es s udied in his sec ion a e collec ed in he Scheme 8.
231 Selas A, Ramí ez G, Palacios F, Alonso C. Design, syn hesis and cy o oxic e alua ion o
diphenyl(quinolin-8-yl)phosphine oxides. Te ahed on Le . 2021;70:153019.
doi:10.1016/j. e le .2021.153019
232 Rueping M, Boo wicha T, Baa s H, Sugiono E. Beils ein J. O g. Chem. 2011;7:1680
1687. doi:10.3762/bjoc.7.198
109
Scheme 8. Syn he ic ou es o he p epa a ion o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6and quinolin-8-
yl phospine oxides 7. A gene al o e iew.

110
I-4. Syn hesis o hyb id dialkyl 1,2,3,4- e ahyd oquinolinylphosphona es and
dialkyl quinolinylphosphona es
Con inuing ou p e ious wo k ini ia ed wi h he p epa a ion o phosphine oxide subs i u ed
quinoline de i a i es as candida es o TOP1 inhibi o s233, we decided o expand ou esea ch
and ocus on he p epa a ion o no el phosphona e- unc ionalized quinolines o a u he
biological s udy. Acco dingly, we amed he s udy o no el hyb id 2,4-quinoline de i a i es wi h
dialkyl phosphona e unc ionali ies. In ligh o he expe ience ob ained om he p e ious wo k,
we es ima e o he Po a o eac ion a highly con enien p ocedu e o access o he
a o emen ioned hyb id quinolinyl phosphona es.
I-4.1. Syn hesis o anilines subs i u ed wi h dialkyl phosphona e 1b, 1c and 1d
Fi s o all, we s a ed wi h he p epa a ion o dialkyl phosphona e-subs i u ed anilines 1b, 1c
and 1d (Figu e 7) as s a ing ma e ial o he Po a o eac ion as hese compounds a e no
comme cially a ailable.
Figu e 7. S uc u e o dialkyl phosphona e-subs i u ed anilines 1b, 1c and 1d.
In o de o ob ain he dialkyl phosphona e-subs i u ed anilines 1b, 1c and 1d (Figu e 7), we i s ly
ied he a o emen ioned SNA o dini obenzenes wi h i alen o ganophospho us eagen s
desc ibed by Ca dogan (shown in he sec ion 3.1. ide sup a). Ca dogan desc ibed he
displacemen o a ni o g oup by nucleophilic ialkyl phosphi es ha leads o he co esponding
dialkylphosphona e de i a i e (Scheme 9, ou e A). The ou e A has been success ully employed
in he p epa a ion o dialkyl phosphona e-subs i u ed anilines 1b and 1c. Ne e heless, he
eac ion did no occu wi h p-dini obenzene unde he same eac ion condi ions, a leas in a
measu able ange a e 120 hou s ( his ac was also obse ed by Ca dogan and collabo a o s).
Consequen ly, when we decided o ex end he scope o he Po a o eac ion using an aniline
bea ing a dialkyl phosphona e g oup in pa a- posi ion (aniline 1d), al e na i e me hods had o
be explo ed.
233 Alonso C, Fue es M, Ma ín-Encinas E, e al. No el opoisome ase I inhibi o s. Syn heses and
biological e alua ion o phospho us subs i u ed quinoline de i a es wi h an ip oli e a i e ac i i y. Eu J
Med Chem. 2018;149:225-237. doi:10.1016/j.ejmech.2018.02.058
111
Scheme 9. Syn he ic ou es s udied o he p epa a ion o dialkyl phosphona e-subs i u ed anilines 1b-d.
The SNA app oach ( ou e A, Scheme 9) esul s o be in insically limi ed o he p epa a ion o
o ho phospho a ed ni obenzenes, and he e o e we ound he Pd-ca alyzed c oss coupling
app oach ( ou e B and ou e C, Scheme 9) a con enien me hod o he p epa a ion o
phospho yla ed anilines 1b, 1c and 1d. In his ega d, he Pd-ca alyzed eac ion be ween a yl
halides and dialkyl-H-phosphi es desc ibed by Hi ao and co-wo ke s esul ed a sui able
me hod234. Te akis( iphenylphosphine)palladium(0) [Pd(PPh3)4]-media ed ca alysis allows a
di ec C-P bound o ma ion by inse ing dialkyl phosphona e moie ies in o a oma ic sys ems
wi h a ni o subs i uen . Mo e ecen ly, Guila d e al. disclosed a no el en y o ex end he
p esen c oss-coupling eac ion o a yl halides bea ing p ima y amines235. Guila d and
collabo a o s desc ibed he in si u o ma ion o Pd(PPh3)4 om Pd(OAc)2 2 mol% and PPh3 6
mol%. Based on hese wo ks, we elabo a ed a p ocedu e in ol ing a Pd c oss coupling eac ion
be ween a yl halides and dialkyl-H-phosphi es in wo ways: 1) a p o ocol employing ni o-
subs i u ed a yl halides, which equi es an addi ional s ep o ans o m he ni o g oup in o a
234 Hi ao T, Masunaga T, Yamada N, Ohshi o Y, Agawa T. Palladium-ca alyzed new ca bon-phospho us
bond o ma ion. Bull Chem Soc Jpn. 1982;55(3):909-913. doi:10.1246/bcsj.55.909.
235 Bessme nykh A, Douaihy CM, Guila d R. Di ec syn hesis o amino-subs i u ed a oma ic phosphona es
ia palladium-ca alyzed coupling o a oma ic mono- and dib omides wi h die hyl phosphi e. Chem Le .
2009;38(7):738-739. doi:10.1246/cl.2009.738.
112
p ima y amine ( ou e B1) o 2) a s aigh o wa d p o ocol using NH2-con aining a yl halides
( ou e B2).
In con as o he o-halogena ed anilines, p-halogena ed aniline p oceeded h ough he c oss-
coupling eac ion wi h a ce ainly low yield ( ou e B2), so we decided o in es iga e o he
me hodologies o a o d p-die hylphosphona e aniline 1d. We ollowed he p o ocol disclosed
by I anpoo e al., which consis s o a ligand- ee-Pd ca alyzed eac ion be ween a yl halides and
ialkylphosphi es o yield dialkyl a ylphosphona es236. By ollowing his p ocedu e ( ou e C), we
ob ained he desi ed p-dialkylphospho yl aniline 1d in a ela i ely high yield.
The syn he ic ou es ollowed o each dialkyl phosphona e-subs i u ed anilines (1b, 1c, 1d) a e
shown below:
Syn hesis o die hyl (2-aminophenyl)phosphona e 1b
We p oceeded he ou es A, B1 and B2 as depic ed in he Scheme 10, and based on he ob ained
esul s we conside ed he ou e B2 he mos app op ia e p o ocol o p epa e die hyl (2-
aminophenyl)phosphona e 1b in ela i ely high yields by a single s ep me hodology.
Scheme 10. Syn he ic ou es s udied o he p epa a ion o he aniline 1b.
236 I anpoo N, Fi ouzabadi H, Moghadam KR, Mo a alli S. Fi s eusable ligand- ee palladium ca alyzed
C P bond o ma ion o a yl halides wi h ialkylphosphi es in nea wa e . RSC Ad . 2014;4(99):55732-
55737. doi:10.1039/C4RA07680J
113
Syn hesis o diisop opyl (2-aminophenyl)phosphona e 1c
The ou es A, B1 and B2 we e in es iga ed o he p epa a ion o diisop opyl (2-
aminophenyl)phosphona e 1c (Scheme 11). A ending o he esul s, i can be no ed ha he
ou e B2 leads o phospho yla ed aniline 1c in a mode a e yield bu in a single ope a ion.
Ne e heless, he ou e A was conside ed he mos app op ia e p o ocol o p epa e he
compound 1c in highe yields, esul ing also an easily scalable syn he ic me hodology.
Scheme 11. Syn he ic ou es s udied o he p epa a ion o he aniline 1c.
Syn hesis o die hyl (4-aminophenyl)phosphona e 1d
Bo h ou es B1 and C ha e demons a ed o be con enien app oaches o p epa e he aniline
1d in simila yields (syn he ic ou es a e shown in he Scheme 12), bu we lean owa ds he ou e
C as i implies a single ope a ion p ocess.
120
Figu e 12. 13C-NMR spec um o die hyl (2,4-diphenylquinolin-8-yl)phosphona e 13a,wi h a egion compa ed o he
13C DEPT 135 NMR spec um he eo .
To u he expand he subs a e scope o his one-po me hodology, we ex ended he cu en
s epwise Po a o -DDQ dehyd ogena ion eac ion sequence (Scheme 14, ou e A) o a wide
ange o a oma ic aldehydes and s y enes wi h di e en elec on-wi hd awing and elec on-
dona ing subs i uen s. In he able 5 a e collec ed he yields o die hyl quinolin-8-yl
phosphona es (en ies 1-14) ob ained upon column ch oma og aphy and c ys alliza ion (see
en ies wi h ou e A).

121
Table 5. Yields o dialkyl quinolin-8-ylphosphona es 13 ob ained by s ep-by-s ep Po a o
eac ion ( ou e A) and a subsequen DDQ oxida ion o Po a o MCR and a subsequen DDQ
oxida ion ( ou e B) and subsequen DDQ oxida ion.
En y
Compound
Rou e
Yield (%)
Nº
R
R
1
R
2
1
13a
E
C
6
H
5
H
A
74
2
13b
E
2
-
MeO
-
C
6
H
4
H
A
48
3
13c
E
3
-
MeO
-
C
6
H
4
H
B
89
4
13d
E
4
-
MeO
-
C
6
H
4
H
A
41
5
13e
E
4
-
(E O)
2
P(O)O
-
C
6
H
4
H
A
64
6
13
E
1
-
naph hyl
H
B
60
7
13g
E
2
-
naph hyl
H
B
83
8
13h
E
3,4
-
F
2
-
C
6
H
3
H
B
76
9
13i
E
C
6
H
5
4
-
Me
A
54
10
1
3j
E
4
-
F
-
C
6
H
4
4
-
Me
A
52
11
13k
E
3,4
-
F
2
-
C
6
H
3
4
-
Me
A
47
12
13l
E
C
6
H
5
4
-
F
A
60
13
13m
E
4
-
F
-
C
6
H
4
4
-
F
A
68
14
13n
E
3,4
-
F
2
-
C
6
H
3
4
-
F
A
43
15
13o
i
P
4
-
F
-
C
6
H
4
H
B
34
16
13p
i
P
3,4
-
F
2
-
C
6
H
4
H
B
38
17
13q
i
P
4
-
F
-
C
6
H
4
4
-
Me
B
58
18
13
i
P
3,4
-
F
2
-
C
6
H
3
4
-
Me
B
39
19 13s iP 4-F-C6H4 4-F B 68
20 13 iP 3,4-F2-C6H3 4-F B 88
I-4.2.2. MCR eac ion wi h ole ins ( ou e B)
A e wa ds, we planned o s udy he oxida i e Po a o MCR a ian o he p epa a ion o
quinoline de i a i es 13 ( he syn he ic me hodology is depic ed in he Scheme 15, i.e. he ou e
B ollowed by he in si u oxida ion o compounds 12 wi h DDQ).
We s a ed ou s udy wi h he p epa a ion o compound 13 (R = E ; R1 = 1-naph hyl; R2 = H;
Table 5, en y 6) ollowing a h ee-componen Po a o eac ion be ween aniline 1b (R = E ),
naph haldehyde 2 (R1 = 1-naph hyl) and phenyls y ene 3 (R2 = H), in he p esence o 2 equi alen s
o BF3.E 2O. A e 12 hou s, 1H- and 31P-NMR indica ed ha he eac ion was comple ed. The
p ocedu e was ollowed by he in si u addi ion o 2 equi alen s o DDQ and he mix u e was
hea ed o e lux o 2 h (Scheme 15). Die hyl (2-(naph halen-1-yl)-4-phenylquinolin-8-
yl)phosphona e 12 was ob ained upon isola ion by column ch oma og aphy in a mode a e yield
(60%).
122
Scheme 15. Syn he ic ou e B (MCR Po a o eac ion) ollowed by he in si u oxida ion o compounds 12 o he
p epa a ion o dialkyl quinolin-8-ylphosphona es 13.
The 1H-NMR spec um o he compound 13 is shown in he Figu e 13, whe e we can obse e
he a oma ic H a oms in a ange be ween 7.51-8.60 ppm and wo signals co esponding o he
p o ons o he 2 CH3-1.20 ppm)
along wi h he p o ons o he 2 CH2(obse -4.30 ppm).
Figu e 13. 1H-NMR spec um o die hyl (2-(naph halen-1-yl)-4-phenylquinolin-8-yl)phosphona e 13 .
123
In he Figu e 14 (13C-NMR spec um o he compound 13 ), we can obse e he signals
co esponding o he a oma ic
assigned o he CH3 and CH2 ca bons o he die hyl phosphona e moie y espec i ely.
Figu e 14. 13C-NMR spec um o die hyl (2-(naph halen-1-yl)-4-phenylquinolin-8-yl)phosphona e 13 .
Once we a o d he quinolin-8-yl de i a i e 13 ollowing he MCR Po a o -DDQ
dehyd ogena ion cascade, we ex ended he scope o he cu en me hodology comp ising he
MCR Po a o eac ion ( ou e B) ollowed by a DDQ oxida ion o he in si u gene a ed Po a o
adduc s. In his manne , he eac i i y o 2-dialkylphosphona e-subs i u ed anilines (1b R =E ; 1c
R = iP ) and a a ie y o s y enes and a oma ic aldehydes (Scheme 15) was explo ed. In he able
5 a e lis ed he co esponding yields o quinolines 13 ob ained by he cu en syn he ic ou e B
upon pu i ica ion by column ch oma og aphy and ec ys alliza ion (see en ies wi h ou e B).
Summa y o he syn he ic ou es employed o he p epa a ion o quinolin-8-yl dialkyl
phosphona e de i a i es 13
Conside ing he esul s collec ed in he Table 5, he p esen ed one-po Po a o -DDQ
dehyd ogena ion eac ion sequence was ound o be an app op ia e me hodology o he
p epa a ion o die hyl quinolin-8-yl phosphona es 13a-n (Table 5, en ies 1-13) and diisop opyl
quinolin-8-yl phosphona es 13o- (en ies 14-19) wi h a wide ange o a oma ic, elec on-
124
dona ing and elec on-wi hd awing subs i uen s. Despi e he ac ha he e ayd oquinoline
adduc s 12 we e no s able and we had o ou line a syn he ic app oach o di ec ly yield he ully
a oma ic de i a i es, he disclosed one-po me hodologies (Scheme 16, ou e A s ep-by-s ep;
ou e B MCR) lead o he ob en ion o quinolines 13 in a egioselec i e way and wi h o e all
mode a e o high yields. The MCR app oach allowed a mo e di ec app oach wi h s ep-economy
and esul ed specially e icien o he p epa a ion o dialkyl quinolin-8-ylphosphona es 13c (R =
E ; R1 = 3-MeO- C6H4; R2 = H; Table 5, en y 3), 13g (R = E ; R1 = 2-naph hyl; R2 = H; en y 7) and
13 (R = iP ; R1 = 3,4-F2- C6H3; R2 = 4-F; en y 20).
Scheme 16. Syn he ic ou es o he p epa a ion o dialkyl quinolin-8-ylphosphona es 13.
125
I-4.3. Syn hesis o hyb id die hyl 1,2,3,4- e ahyd oquinolin-6-ylphosphona es and die hyl
quinolin-6-ylphosphona es
In o de o expand he scope o he eac ion and inc ease he s uc u al di e si y in he syn hesis
o dialkyl phosphona e-subs i u ed quinoline de i a i es, we p oposed he p epa a ion o 2,4-
quinoline de i a i es wi h he die hyl phosphona e unc ionali y in posi ion 6. Fo his pu pose,
we s a ed he s udy o he Po a o MCR eac ion wi h he phospho yla ed aniline 1d.
I-4.3.1. P epa a ion o die hyl 1,2,3,4- e ahyd oquinolin-6-ylphosphona es by he
Po a o MCR app oach
We in es iga ed a h ee-componen Po a o eac ion be ween aniline 1d, aldehydes 2and
s y enes 3, in he p esence o molecula sie es and 2 equi alen s o BF3.E 2O (Po a o MCR,
Scheme 17). We s a ed explo ing he model eac ion be ween die hyl (4-
aminophenyl)phosphona e 1d, 4- luo obenzaldehyde 2 (R1= 4-F2-C6H5)and 4-
luo ophenyls y ene 3 (R2= 4-F). The eac ion was s i ed o e lux in chlo o o m un il 31P/1H-
NMR expe imen s indica ed he consump ion o s a ing ma e ial (1.5 h) and
e ahyd oquinoline 15e was a o ded. Su p isingly, he die hyl (2,4-bis(4- luo ophenyl)-1,2,3,4-
e ahyd oquinolin-6-yl)phosphona e 15e (R1 = 4-F-C6H4; R2 = 4-F) esul ed o be s able unde
pu i ica ion condi ions and we we e able o success ully isola e by column ch oma og aphy (86%
yield) and u he pu i ica ion by ec ys alliza ion in die hyl e he .
Scheme 17. Po a o MCR syn he ic ou e o he p epa a ion o die hyl 1,2,3,4- e ahyd oquinolin-6-ylphosphona es
15.
The s uc u e o he ob ained 1,2,3,4- e ahyd oquinolines 15 was de e mined by one-
dimensional and wo-dimensional NMR spec oscopy (i.e. 1D-NMR and 2D-NMR) and HRMS
expe imen s. Hence, he 1H-NMR spec um o e ahyd oquinoline de i a i e 15e is shown in
he Figu e 15, whe e we can obse e he cha ac e is ic alipha ic p o ons co esponding o he
non-a oma ic pipe idine ing o he e ahyd oquinoline moie y. On he one hand, a high ield
we can obse e he signals co esponding o wo dias e eo opic p o ons (namely 3a-H and 3b-

126
H) o he me hylene (posi ion 3 o he e ahyd oquinoline co e) de ec ed as a double o
2JHH = 12.3 Hz, 3JHH = 11.3 Hz) and a mul iple a 2.23-2.28 ppm
espec i ely. Mo eo e , i can be app ecia ed he p esence o wo double o double s assigned
o he 2-H and 4- 3JHH = 12.3 Hz, 3JHH = 5.2 Hz) and 4.64 ppm (3JHH =
11.3 Hz and 3JHH = 2.9 Hz) espec i ely. Finally, he p o on o he NH g oup is isible as a wide
upon ea men o he sample wi h D2O.
Figu e 15. 1H-NMR spec um o die hyl (2,4-bis(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e 15e.
The egiochemis y o he p ocess was de e mined by a HMBC (He e onuclea Mul iple Bond
Co ela ion) 2D-NMR expe imen o he compound 15e ( he spec a o HMBC is shown in Figu e
16), whe e a c oss-linking connec i i y is obse ed be ween he p o on o he NH g oup and he
C-3 me hylenic ca bon. This co ela ion con i ms ha he 4- luo ophenyl subs i uen has been
egioselec i ely in oduced in he posi ion 4 o he quinoline moie y and no in he posi ion 3.
The o he possible egioisome bea ing he 4- luo ophenyl subs i uen in posi ion 3 was
ce ainly disca ded, which would imply a c oss-linking connec i i y be ween he p o on o he
amino g oup and he ca bon a ached o he 4- luo ophenyl g oup ins ead, and we did no
obse e his c oss-peak pa e n.
127
Figu e 16. HMBC spec a o o die hyl (2,4-bis(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e 15e.
Likewise, he s e eoselec i i y o he p ocess was de e mined by 1D-NOESY-NMR spec oscopy
as depic ed in he Figu e 17. The selec i e sa u a ion o he 2-H p o on p esen ed a posi i e
NOESY e ec on he 4-H p o on (3.50%) and he me hylenic p o ons (2.81% and 0.62%
espec i ely). In addi ion, he selec i e sa u a ion o he 4-H p o on p esen ed posi i e NOESY
e ec on he 2-H p o on (3.28%) and he me hylenic p o ons (3.74% and 0.75%). The collec ed
esul s indica e a ela i e cis-con igu a ion be ween he p o ons in posi ion 2 and 4 o he
quinoline co e and he e o e sugges s ha he [4+2] Po a o -like cycloaddi ion eac ion occu s
h ough an endo ansi ion s a e.
128
Figu e 17. Rela i e con igu a ion o die hyl (2,4-bis(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e 15e
assigned by 1D-NOESY expe imen s.
Once a o ded he e ahyd oquinoline 15e and elucida ed i s chemical s uc u e, we applied
he cu en op imized Po a o MCR me hodology o a a ie y o di e se a oma ic aldehydes and
s y enes in o de o b oaden he scope o he eac ion. Acco dingly, we ob ained a se o 1,2,3,4-
e ahyd oquinolin-6ylphosphona es 15 in good o excellen yields as shown in he Table 6.
Table 6. Syn hesis o die hyl 1,2,3,4- e ahyd oquinolin-6.ylphosphona es 15 by he Po a o
MCR app oach.
En y Compound
Reac ion
ime (h)
Yield (%)
Nº R1 R2
1 15a 4-F-C6H4 H 1,5 81
2 15b 3,4-F2-C6H3 H 1,5 97
3 15c 4-F-C6H4 4-Me 2 65
4 15d 3,4-F2-C6H3 4-Me 1 79
5 15e 4-F-C6H4 4-F 1,5 86
6 15 3,4-F2-C6H3 4-F 1,5 65
In con as o he p e iously unsuccess ully a emp ed p epa a ion o die hyl 1,2,3,4-
e ahyd oquinolin-8-ylphosphona es 12 (Scheme 16), he Po a o MCR eac ion was ound o
be an excep ionally con enien me hod o he p epa a ion o die hyl e ahyd oquinolin-6-
ylphosphona es 15 in high yields (65-97%). In pa icula , i is no ewo hy o highligh he 97% o
yield achie ed o he de i a i e 15b (R1 = 3,4-F2-C6H3; R2 = H; Table 6, en y 2).
129
I-4.3.2. P epa a ion o die hyl quinolin-6-ylphosphona es by DDQ oxida ion o 1,2,3,4-
e ahyd oquinolin-6-yl de i a i es 15
Once we achie ed he e ahyd oquinolines 15 by he MCR Po a o eac ion, we p oceeded o
hei dehyd ogena ion o yield he co esponding quinolines 16 by oxida ion wi h DDQ (Scheme
18). We s a ed s udying he dehyd ogena ion o 1,2,3,4- e ahyd oquinolin-6yl phosphona e
15a (R1 = 4-F-C6H4; R2 = H;) as he model eac ion.
Scheme 18. A oma iza ion o die hyl 1,2,3,4- e ahyd oquinolin-6-ylphosphona es 15 o yield die hyl quinoline-6-
ylphosphona es 16.
Acco dingly, he e ahyd oquinolin-6-yl de i a i e 15a was eac ed wi h 2 equi alen s o DDQ
in chlo o o m a 60 oC and he e olu ion o he dehyd ogena ion o he co esponding a oma ic
quinoline de i a i e 16a was moni o ed by 31P/1H-NMR spec oscopy. In he Figu e 18 we can
obse e he con e sion o e ahyd oquinoline 15a in o dehyd ogena ed quinoline 16a in 1H-
NMR expe imen s. A e 1 h o dehyd ogena ion wi h DDQ, an aliquo was aken and he 1H-
NMR spec um e ealed ha he eac ion was s ill in p og ess bu no inished ye . In he Figu e
18 i can be clea ly obse ed how as he dehyd ogena ion was p oceeding, he signals
co esponding o he ou alipha ic p o ons o he e ahyd oquinoline moie y (plus he NH
g oup) disappea ed, and new a oma ic p o ons co esponding o he newly o med py idine ing
o 16a appea ed.
136
Du ing he pu i ica ion p ocess, e ahyd o-5H-indenoquinolines 19a and 19b we e
spon aneously dehyd ogena ed and a ac ion o he co esponding indenoquinoline 20 was
ob ained (Table 8, en ies 1 and 2). Mo eo e , in he case o compounds 19e and 19g, we
ob ained di ec ly he ully a oma ic indenoquinolines 20e and 20g. Fo ins ance, when ollowing
he cu en Po a o MCR p o ocol o he p epa a ion o he compound 19g, upon he
pu i ica ion s ep we only ob ained he co esponding ully a oma ic 7H-indenoquinoline 20g (R
= 4-P(O)(OiP )2; R1 = 4-CF3-C6H4; En y 7, Table 8).
In he Figu e 22 we can app ecia e he 1H-NMR spec um o he 7H-indenoquinolinyl de i a i e
20g, and i can be no ed ha he cha ac e is ic signals co esponding o he alipha ic p o ons o
he e ahyd o-5H-indenoquinoline ing disappea ed, while he signals o he ully a oma ic 7H-
indenoquinoline co e appea ed in he a oma ic egion. Mo eo e , in he alipha ic a ea we can
only obse e he wo dias e eo opic p o ons o he me hylene (posi ion C-7) as a single a 4.25
ppm and he p o ons assigned o he diisop opyl phosphona e unc ionali y: he ou CH3 g oups
isualized as wo double s a 1.17 ppm (2JHH = 6.2 Hz) o wo me hyl g oups and 1.38 ppm (2JHH
= 6.2 Hz) o he o he wo me hyl g oups; and he CH g oups obse ed as a mul iple a 2.03
ppm ha in eg a es o wo p o ons.
Figu e 22. 1H-NMR spec um o diisop opyl (6-(4-( i luo ome hyl)phenyl)-7H-indeno[2,1-c]quinolin-4-yl)phosphona e
20g.

137
In like manne , in he 13C-NMR spec um o he 7H-indenoquinolinyl de i a i e 20g (Figu e 23)
we can also obse e he absence o he alipha ic p o ons, excep o he me hylene g oup
loca ed in he posi ion 7 o he indenoquinoline co e, which isualized as a signal in he up ield
wi h a chemical shi o 37.7 ppm (i appea s in he e e se phase in he DEPT-135 13C-NMR
expe imen ). Fu he mo e, a 23.8 ppm appea s a double wi h a coupling cons an o 3JCP = 4.2
Hz assigned o he CH3 o one o he isop opyl g oups and a 24.3 ppm appea s ano he double
(3JCP = 3.1 Hz) assigned o he wo me hyl g oups o he o he isop opyl. Finally, he wo CH o
he isop opyls a e isualized as a double a 70.7 ppm wi h a coupling cons an o 2JCP= 5.5 Hz.
Figu e 23. 13C-NMR spec um o diisop opyl (6-(4-( i luo ome hyl)phenyl)-7H-indeno[2,1-c]quinolin-4-
yl)phosphona e 20g.
Acco ding o he esul s lis ed in he Table 8, i can be no ed ha o e all he h ee-componen
Po a o eac ion allowed he p epa a ion o e ahyd o-5H-indenoquinolines 19 wi h a ious
subs i uen s in a single ope a ion and in good yields (62-73%). In he case o he e ahyd o-5H-
indenoquinolinyl 19b (R = 4-P(O)(OE )2; R1 = 4-MeO-C6H4; Table 8, en y 2), a 73% o yield was
ob ained. Howe e , in some cases, du ing he pu i ica ion by column ch oma og aphy o
e ahyd o-5H-indenoquinolines 19, small ac ions o he co esponding dehyd ogena ed
a oma ic quinolines we e isola ed. Such is he case o compounds 19a (R = 4-P(O)(OE )2; R1 = 3-
MeO-C6H4; en y 1) and 19b (R = 4-P(O)(OE )2; R1 = 4-MeO-C6H4; en y 2), whe e he
co esponding 7H-indenoquinolinyl de i a i e 20a and 20b we e isola ed espec i ely (yields =
138
22% and 11%). Fu he mo e, he e ahyd o-5H-indenoquinolinyl de i a i es 19e (R = 2-
P(O)(OE )2; R1 = 4-MeO-C6H4; en y 5) and 19g(R = 4-P(O)(OiP )2; R1 = 4-CF3-C6H4; en y 7) esul ed
no o be s able unde pu i ica ion condi ions and he co esponding a oma ic 7H-
indenoquinoline de i a i es 20e and 20g we e isola ed.
I-5.2. Syn hesis o dialkyl 7H-indeno[2,1-c]quinolinylphosphona es and dialkyl 7-oxo-7H-
indeno[2,1-c]quinolinylphosphona es
The dehyd ogena ion o e ahyd o-5H-indenoquinolines 19 (Scheme 21) was s udied ollowing
wo p o ocols. On he one hand, we explo ed he p e iously men ioned DDQ oxida ion p o ocol
(2 equi . o DDQ in chlo o o m a 60oC o 2h).
Scheme 21. Oxida ion o compounds 19 o yield he dialkyl 7H-indeno[2,1-c]quinolinylphosphona es 20 and dialkyl 7-
oxo-7H-indeno[2,1-c]quinolinylphosphona es 21.
We s a ed s udying he dehyd ogena ion o die hyl (6-(4-( i luo ome hyl)phenyl)-6,6a,7,11b-
e ahyd o-5H-indeno[2,1-c]quinolin-2-yl)phosphona e 19 wi h 2 equi alen s o DDQ in
e luxing chlo o o m o 2h. NMR-s uc u e elucida ion expe imen s e ealed ha he
co esponding die hyl (7-oxo-6-(4-( i luo ome hyl)phenyl)-7H-indeno[2,1-c]quinolin-2-
yl)phosphona e 21 was ob ained upon pu i ica ion by column ch oma og aphy and
c ys alliza ion (Table 9, en y 6). In he Figu e 24, he 13C-NMR spec a o e ahyd o-5H-
indenoquinoline 19 and he co esponding 7H-indenoquinolinone 21 a e compa ed, whe e i
can be app ecia ed he disappea ance o all he alipha ic ca bons o he e ahyd o-5H-
indenoquinoline co e and he appea ance o he newly o med a oma ic ca bons. Mo eo e , in
he compa a i e o he 13C-NMR spec a we can obse e ha die hyl (7-oxo-6-(4-
( i luo ome hyl)phenyl)-7H-indeno[2,1-c]quinolin-2-yl)phosphona e 21 lacks he me hylenic
ca bon a C-7 posi ion (obse ed as a single a 31.2 ppm in he e ahyd o-5H-indenoquinolinyl
de i a i e 19 , Figu e 24), p esen ing a signal in he u hes down ield a 191.7 ppm ins ead,
which means ha he CH2a posi ion C7 has been oxidized o he co esponding ca bonyl
unc ionali y.
139
Figu e 24. Compa ison be ween he 13C-NMR spec ums o die hyl (6-(4-( i luo ome hyl)phenyl)-6,6a,7,11b-
e ahyd o-5H-indeno[2,1-c]quinolin-2-yl)phosphona e 19 and die hyl (7-oxo-6-(4-( i luo ome hyl)phenyl)-7H-
indeno[2,1-c]quinolin-2-yl)phosphona e 21 .
Fu he mo e, wi h he pu pose o in es iga e he me hylene ca bonyla ion, we p oceeded o
in es iga e he oxida ion condi ions o e ahyd o-5H-indenoquinolinyl de i a i es 19. In his
ega d, manganese (III) ace a e (3 equi alen s) was e alua ed as a mild oxidan agen , employing
ace ic acid as a sol en and s i ing he eac ion mix u es a e lux empe a u e. The eac ions
we e moni o ed by 31P/1H-NMR and TLC. We ied his p ocedu e o a oma ize he e ahyd o-
5H-indenoquinolinyl de i a i es 19a and 19c and we ob ained he co esponding 7H-
indenoquinolinones 21a (R= 4-P(O)(OE )2; R1 = 3-MeO-C6H4; Table 8, en y 1) and 21c (R = 4-
P(O)(OE )2; R 1= 4-MeO-C6H4; en y 2) in low yields (33% and 28%, espec i ely).
A e wa ds, we applied hese wo oxida ion p o ocols (DDQ and Mn III ace a e) as desc ibed in
he Scheme 21, and bo h me hods lead o he o ma ion o compounds 20 and 21 (yields a e
collec ed in he Table 9).
140
Table 9. Syn hesis o dialkyl 7H-indenoquinolinylphosphona es 20 and dialkyl 7-oxo-7H-
indenoquinolin-7one-ylphosphona es 21.
En y
Compound
Oxidan
T (ºC)
Reac ion
ime (h)
Yield
(%)
Nº
R
R
1
1
21a
4
-
P(O)(OE )
2
3
-
MeO
-
C
6
H
4
Mn(OAc)
3
118
36
33
2
21b
4
-
P(O)(OE )
2
4
-
MeO
-
C
6
H
4
DDQ
60
2
14
3
20c
4
-
P(O)(OE )
2
4
-
CF
3
-
C
6
H
4
DDQ
60
2
26
4
21c
4
-
P(O)(OE )
2
4
-
CF
3
-
C
6
H
4
Mn(OAc)
3
118
36
28
5
21d
2
-
P(O)(OE )
2
3
-
MeO
-
C
6
H
4
DDQ
60
2
38
6
21
2
-
P(O)(OE )
2
4
-
CF
3
-
C
6
H
4
DDQ
60
2
32
In iew o he esul s collec ed in Table 9, we can conclude ha he dehyd ogena ion/oxida ion
o e ahyd o-5H-indenoquinoline de i a i es 19 wi h DDQ and Mn(OAc)3 led o he o ma ion
o compounds 7H-indeno[2,1-c]quinolines 20 and/o 7H-indeno[2,1-c]quinolin-7-ones 21.
The DDQ dehyd ogena ion p o ocol led o he ob ainmen o he 7H-indenoquinoline 20c (R =
4-P(O)(OE )2; R1 = 4-CF3-C6H4; En y 3) wi h a low yield (26%). On he con a y, ollowing he
same eac ion condi ions, he DDQ p o ocol led o 7H-indenoquinolinones 21b, 21d and 21 in
low yields (14-38%).
The dehyd ogena ion o e ahyd o-5H-indeno[2,1-c]quinoline de i a i es 19 ollowing he
Mn(OAc)3 in p o ocol, on he whole led o he dehyd ogena ion o he ou alipha ic hyd ogens
bu also o he oxida ion o he me hylenic ca bon (posi ion 7 o he indenoquinoline co e) in o
a ca bonyl g oup, ob aining di ec ly he ully a oma ic 7H-indeno[2,1-c]quinolin-7-ones 21a (R =
4-P(O)(OE )2; R1 = 3-MeO-C6H4; Table 9, en y 1) and 21c (R = 4-P(O)(OE )2; R1 = 4-CF3-C6H4; en y
4) in low yields (33% and 28% espec i ely).
141
Summa y o he syn he ic ou es employed o he p epa a ion o dialkyl indeno[2,1-
c]quinolinylphosphona es 18, 19 and 20
Scheme 22. Syn he ic ou es o he p epa a ion o dialkyl e ahyd o-5H-indeno[2,1-c]quinolinylphosphona es 19,
dialkyl 7H-indeno[2,1-c]quinolinylphosphona es 20 and dialkyl 7-oxo-7H-indeno[2,1-c]quinolinylphosphona es 21.
In conclusion, we ound he Po a o MCR a con enien syn he ic me hod o he p epa a ion o
dialkyl e ahyd o-5H-indeno[2,1-c]quinolinylphosphona es 19 (Scheme 22).
Te ahyd oindenoquinolines 19 may be dehyd ogena ed o ob ain he co esponding 7H-
indeno[2,1-c]quinolines 20, al hough conside ing ha he me hylenic ca bon (posi ion 7 o he
indenoquinoline sca old) could be subjec ed o oxida ion and lead o 7H-indeno[2,1-
c]quinolinones 21. Acco dingly, he oxida ion o he me hylenic ca bon allowed us o
inco po a e a new di e si y poin in he indeno[2,1-c]quinoline co e. Howe e , i has o be
men ioned ha u u e in es iga ions should be made o imp o e he cu en oxida ion
p o ocols.

142
Chap e II. S udy o he in i o TOP1 inhibi o y ac i i y
o he newly syn hesized quinoline de i a i es
143
II-1. In oduc ion: in i o d ug sc eening o TOP1 inhibi o s
Human opoisome ase 1B (hTOP1) is a po en ial and well s ablished a ge o an i-cance
d ugs26. In his sense, in i o d ug sc eening assays o he iden i ica ion o no el hTOP1B
inhibi o s and u he s udies o hei mode o ac ion ep esen he i s s ep o he biological
e alua ion o no el TOP1 inhibi o s. The mos employed s a e-o - he-a assays o he sc eening
o TOP1 a ge ing small compounds a e ea u ed below, as well as a no el, quan i a i e and
highly sensi i e me hodology o he eal- ime assessmen o he TOP1 ac i i y in i o.
II-1.1. DNA Relaxa ion assay
DNA elaxa ion assay is he s anda d and mos common in i o assay o la ge d ug sc eenings
o no el se s o compounds as candida es o TOP1 inhibi o s, and is based on he sepa a ion o
he di e en opological o ms o DNA by aga ose gel elec opho esis. TOP1 is able o elax
supe coiled ci cula plasmid DNA subs a es (double s anded bac e ial ci cula DNA) by
in oducing ansien nicks (clea age s ep) in one o he s ands, allowing a con olled o a ion
o he non-clea ed s and h ough he nick. These nicks a e apidly sealed du ing he eliga ion
s ep, ob aining elaxed o ms o he plasmid. In he DNA elaxa ion assay, nega i ely supe coiled
DNA plasmids a e incuba ed wi h pu i ied TOP1 and he eac ion is s opped wi h 0.5% o SDS
(sodium dodecyl sulpha e), gene a ing a a ia ion in he linking numbe (Lk) o DNA by ac ion o
he enzyme.
Topoisome s a e DNA subs a es wi h iden ical composi ion bu di e en Lk and a e u he
di e en ia ed by elec opho esis in 1% aga ose gel. Supe coiled DNA (Sc) emains compac and
p esen s a as e elec opho e ic mobili y, he eby eaching he lowes pa o he gel (Figu e
25, below). On he con a y, elaxed o ms (Relax) ha e an ex ended shape and consequen ly
exhibi a slowe mig a ion. Acco dingly, elaxed o ms emain abo e, occupying a wide space
as long as TOP1 ac ion esul s in a ious elaxed opoisome s wi h di e en Lk (Figu e 25, abo e).
I he elec opho esis uns a low ol age du ing long imes (e.g. 20-30 V du ing 12-20 h), hese
elaxed opoisome s could be clea ly obse ed as shown in he example depic ed in he Figu e
25.
144
Figu e 25. DNA elaxa ion assay, kine ic expe imen wi h DMSO (ine sol en ) and CPT (TOP1 inhibi o ).
A e elec opho esis comple ion, o he u he isualiza ion o he esul s, he DNA has o be
s ained by soaking he gel in a dissolu ion con aining a nucleic-acid dye (mainly DNA
in e cala o s as E B , SYBR sa e o GelRed). Then, he gels a e eady o be pho og aphed in an
UV- ansillumina o . The TOP1 ac i i y is analysed by measu ing he con e sion a io o
supe coiled plasmid in o he elaxed o m, and his assessmen can be applied in o de o s udy
he inhibi o e ec o d ugs/candida es. I a TOP1 inhibi o agen is in oduced in he eac ion
media, he inhibi o in e e es he ac ion o he enzyme ob aining less elaxed plasmid and a
la ge ac ion o supe coiled o m238, as shown in he Figu e 25 ( he e e sible TOP1 inhibi o
accumula ion o Sc
DNA elaxa ion assays could be pe o med in a ime-cou se s yle (kine ic expe imen s) o in an
end-poin expe imen manne . Kine ic expe imen s pe mi he s udy o he inhibi o y ac i i y
du ing a selec ed ime in e al (applicable o e alua e he e e sibili y o he inhibi ion o e he
ime)94, while end-poin expe imen s a e indica ed o e eal he op imum concen a ion o he
238 Ni iss JL, Kiiani sa K, Sun Y, Ni iss KC, Maizels N. Topoisome ase Assays. Cu P o oc. 2021;1(10):e250.
doi:10.1002/cpz1.250
145
d ug o be used o he inhibi ion o TOP1239. In pa icula , in he Figu e 25 is depic ed an example
o a kine ic expe imen o he DNA elaxa ion assay.
II-1.2. Nicking assay
The nicking assay is mainly he same expe imen as he DNA elaxa ion assay, bu he DNA
samples a e loaded in o an aga ose gel con aining e hidium b omide (E B ). E B is a DNA
in e cala o and unwinding agen , which in oduces posi i e supe coils in o in ac DNA
plasmid238. As explained in he sec ion II-1.1. o his chap e ( ide sup a), when pe o ming he
DNA elaxa ion assay expe imen , du ing incuba ion in he p esence o TOP1 he nega i ely
supe coiled plasmid is elaxed by he enzyme ac ion, ob aining he co esponding elaxed o m
(Relax). In he absence o TOP1, he nega i ely supe coiled o m (Sc) is main ained (e.g. in a
nega i e con ol, Figu e 25, lane 7). Howe e , du ing incuba ion o plasmid DNA wi h TOP1,
some compounds a e able o s abilize TOP1CC and gene a e a nicked plasmid (Nick), as
illus a ed in he Figu e 26. The nicking assay allows he di e en ia ion o hese h ee o ms o
plasmid DNA (Nick, Sc and elax).
Figu e 26. Supe coiled, elaxed and nicked o ms o plasmid DNA a e incuba ion wi h TOP1.
In he so-called nicking assay, a 1% aga ose gel p es ained wi h E B (0.5-1 µg/mL) is used o
dis inguish nicked plasmid om in ac plasmid ( elaxed and supe coiled)97. Du ing he
elec opho esis, he DNA samples a e p og essi ely being in e cala ed by E B , leading o an
un wis ing o he double helix o he DNA. A his poin , i has o be men ioned ha ex ended
239 Teje ía A, Pé ez-Pe ejo Y, Regue a RM, e al. An ileishmanial ac i i y o new hyb id
e ahyd oquinoline and quinoline de i a i es wi h phospho us subs i uen s. Eu J Med Chem.
2019;162:18-31. doi:10.1016/j.ejmech.2018.10.065
248
phospha idylcholine, in e e ing wi h he lipid me abolism and he e o e a ec ing he
memb ane emodelling315. Mo eo e , i is epo ed ha mil e osine also induces he inhibi ion
o he cy och ome C oxidase, al e ing he mi ochond ial esponse317. None heless, i seems ha
he e may be some o he a ge s in ol ed in he an ileishmanial e ec o mil e osine.
A p esen , mil e osine is he mos e ec i e APL bo h in Leishmania amas igo es and in
p omas igo es. Fu he mo e, mil e osine has been he i s o al an ileishmanial agen . I was
in oduced in 2002, and up o now is s ill being he unique o al an ileishmanial d ug accep ed
by he FDA o he ea men o isce al and cu aneous leishmaniasis296 ( he es o
an ileishmanial d ugs a e adminis a ed in a enously by an ini ial load dosage and subsequen
main enance adminis a ions).
Pa omomycin
Pa omomycin (5, Figu e 79) is a wide spec um aminoglycoside an ibio ic ha has e ealed as
an e ec i e an imala ial agen , e en hough i s mode o ac ion is la gely unclea . As an
aminoglycoside an ibio ic, pa omomycin speci ically binds o he 30s ibosomal subuni and
he e o e s abilizes he ibosomal complex, leading o a blockade in he p o ein ansloca ion
s ep. Hence, some au ho s claim ha he an ileishmanial e ec may be ela ed wi h he
inhibi ion o he p o ein syn hesis318. Con e sely, o he au ho s sugges ha he ca ionic
pa omomycin ac s by binding o anionic componen s o he leishmanial cell memb ane (i.e.
glycocalix and lipophosphoglycan), leading o a a al cell memb ane al e a ion319. Pa omomycin
is clinically used by in a enous adminis a ion in bo h isce al and cu aneous leishmaniasis
since 2006 and, in some cases, i is opically adminis e ed o ea cu aneous leishmaniasis296.
Pen amidine
Pen amidine (6, Figu e 79) is an an imic obial agen employed in he ea men o leishmaniasis.
The mode o ac ion o pen amidine elies on a selec i e in acellula accumula ion in Leishmania
317 San a-Ri a RM, Hen iques-Pons A, Ba bosa HS, de Cas o SL. E ec o he lysophospholipid analogues
edel osine, ilmo osine and mil e osine agains Leishmania amazonensis. J An imic ob Chemo he .
2004;54(4):704-710. doi:10.1093/jac/dkh380
318 Da idson RN, den Boe M, Ri meije K. Pa omomycin. T ans R Soc T op Med Hyg. 2009;103(7):653-660.
doi:10.1016/j. s mh.2008.09.008
319 Chawla B, Jhing an A, Panig ahi A, S ua KD, Madhubala R. Pa omomycin a ec s ansla ion and
esicle-media ed a icking as e ealed by p o eomics o pa omomycin -suscep ible - esis an Leishmania
dono ani. PLoS One. 2011;6(10):e26660. doi:10.1371/jou nal.pone.0026660

249
cells and p oceeds by selec i ely binding o he kine oplas DNA, esul ing in he inhibi ion o
he DNA syn hesis320.
Pen amidine is cu en ly used as a second-line d ug in bo h isce al and cu aneous leishmaniasis
due o he epo ed ele a ed oxici y. In his ega d, he pha macological ea men wi h
pen amidine could be accompanied by gas oin es inal oxici y, ca dio oxici y and he induc ion
o i e e sible insulin-dependen diabe es melli us321.
320 Singh K, Ga g G, Ali V. Cu en The apeu ics, Thei P oblems and Thiol Me abolism as Po en ial D ug
Ta ge s in Leishmaniasis. Cu D ug Me ab. 2016;17(9):897-919.
doi:10.2174/1389200217666160819161444
321 Schola E. Pen amidine. In: Enna SJ, Bylund DB, eds. xPha m: The comp ehensi e pha macology
e e ence. New Yo k: Else ie ; 2009:1-7. h ps://doi.o g/10.1016/B978-008055232-3.62388-8
250
Figu e 79. S uc u es o p incipal d ugs cu en ly used in chemo he apy o leishmaniasis.
IV-1.3.2. Immuno he apy o he ea men o leishmaniasis
The immune esponse o he hos o Leishmania in acelula in ec ion esul s qui e complex and
i s e icacy is de e mined by he species and s ains o Leishmania pa asi es, he hos -pa asi e
in e ac ion and bo h inna e and adap i e immuni ies o he hos .
Rega ding o he immune esponse, i has o be conside ed ha Leishmania pa asi es ha e
de eloped sys ema ic esis ance owa d he immune sys em o he hos . Hence, mac ophages,
dend i ic cells and neu ophils a e essen ially he phagocy es implica ed in he cellula up ake
o Leishmania me acyclic p omas igo es in he e y i s s age o he in ec ion, and
consequen ly, Leishmania pa asi es ha e adap ed o su i e and e ade he immune sys em once
251
in ec ed he phagocy es322. Fo ins ance, L. dono ani has been ound o inhibi he apop osis o
mac ophages upon cellula up ake by s imula ing he p oduc ion o GM-CSF (g anulocy e-
mac ophage colony-s imula ing ac o , a cy okine ha slows down he induced apop osis o
mac ophages) and TNF- ( umou nec o ic ac o an in lamma o y cy okine ha can block he
apop osis o mac ophages)323, whe eas TNF- esen s he con a y e ec (s imula ing
apop osis) in polimo phonuclea g anulocy es such as neu ophils324. On he o he hand, i has
o be men ioned ha Leishmania seems o use di e en pa hways o induce apop osis o PAM
and in he case o neu ophils, L. majo p omas igo es ha e been epo ed o inhibi he
apop osis o neu ophils by blocking he caspase 3 pa hway325.
As usually occu s wi h in ec ions, when Leishmania pa asi es en e s in he phagocy es o he
hos , dend i ic cells (DCs) eme ge o ini ia e and egula e he adap i e immune esponse owa d
he Leishmania in ec ion. DCs play a key ole in he modula ion o he adap i e immuni y in
leishmaniasis and in luence he abili y o he hos T cells o p oduce IFN- 326.
IFN- sen ial cy okine ha p omo es he p oduc ion o ni ic oxide (NO) and eac i e
oxygen species (ROS), leading o he ac i a ion o mac ophages, which u n able o kill he
in acellula Leishmania pa asi es327. Fo ins ance, he ea men wi h human ecombinan IFN-
ome o Leishmania
alone328 and (specially) as adju an o chemo he apy d ugs322.
The ou come o Leishmania in ec ion depends o a la ge ex en on he na u e o he cy okines
sec e ed by he an igen p esen ing cells (APCs), mainly DCs bu also mac ophages (Figu e 80).
Fo example, he elease o IL-12 (in e leukin 12) by APCs s imula es he de elopmen o CD4+
Th1 (T helpe cells) lymphocy es ha p ima ily p oduce IFN-
322 Okwo I, Uzonna JE. Immuno he apy as a s a egy o ea men o leishmaniasis: a e iew o he
li e a u e. Immuno he apy. 2009;1(5):765-76. doi: 10.2217/im .09.40
323 Moo e KJ, Ma lashewski G. In acellula in ec ion by Leishmania dono ani inhibi s mac ophage
apop osis. J Immunol. 1994;152(6):2930-7. PMID: 8144893
324 Niwa M, Ha a A, Kanamo i Y, Ha akeyama D, Saio M, Takami T, Ma suno H, Kozawa O, Uema su T.
Nuclea ac o -kappaB ac i a es dual inhibi ion si es in he egula ion o umo nec osis ac o -alpha-
induced neu ophil apop osis. Eu J Pha macol. 2000;407(3):211-9. doi: 10.1016/s0014-2999(00)00735-4
325 Aga E, Ka schinski DM, an Zandbe gen G, Lau s H, Hansen B, Mülle K, Solbach W, Laskay T. Inhibi ion
o he spon aneous apop osis o neu ophil g anulocy es by he in acellula pa asi e Leishmania majo . J
Immunol. 2002;169(2):898-905. doi: 10.4049/jimmunol.169.2.898.
326 Tibú cio R, Nunes S, Nunes I, Rosa Ampue o M, Sil a IB, Lima R, Machado Ta a es N, B odskyn C.
Molecula Aspec s o Dend i ic Cell Ac i a ion in Leishmaniasis: An Immunobiological View. F on
Immunol. 2019;10:227. doi: 10.3389/ immu.2019.00227
327 Liu D, Uzonna JE. The ea ly in e ac ion o Leishmania wi h mac ophages and dend i ic cells and i s
in luence on he hos immune esponse. F on Cell In ec Mic obiol. 2012;2:83. doi:
10.3389/ cimb.2012.00083
328 Sunda S, Mu ay HW. E ec o ea men wi h in e e on-gamma alone in isce al leishmaniasis. J
In ec Dis. 1995;172(6):1627-9. doi: 10.1093/in dis/172.6.1627
252
mac ophage ac i a ion and he e o e, o a highe an ileishmanial adap i e immune esponse329.
On he con a y, he sec e ion o IL-4 by APCs enhances he de elopmen o CD4+ Th2 cells ha
p oduce IL-4 and IL-10 (among o he cy okines), leading p og essi ely o complica ions in he
ou come o leishmaniasis330.
Figu e 80. The e ec o sec e ed cy okines in he ou come o leishmaniasis.
Cy okine and monoclonal an ibody-based immuno he apy
We p e iously expounded he ele ance o he eleased cy okines in he ou come o
leishmaniasis disease. The as majo i y o he in o ma ion ega ding he e ec o cy okines in
leishmaniasis a e collec ed om s udies in mice models, which means ha hei applica ion in
humans is s ill challenging. Fo ins ance, he ea men wi h IL-12 ecombinan cy okine and
an i-IL-4 monoclonal an ibody in he suscep ible BALB/c mice model led o he e e se o ch onic
disease caused by L. majo in ec ion, by he s imula ion o he IFN- 331. On he o he
hand, he use o an i-IL-10 monoclonal an ibody in human pa ien s wi h cu aneous leishmaniasis
329 Mi zaei A, Maleki M, Masoumi E, Maspi N. A his o ical e iew o he ole o cy okines in ol ed in
leishmaniasis. Cy okine. 2021;145:155297. doi: 10.1016/j.cy o.2020.155297
330 Ma ne F, Albe G, Mag am J, Kop M. The ole o IL-12 and IL-4 in Leishmania majo in ec ion. Chem
Immunol. 1997;68:86-109. doi: 10.1159/000058696
331 Uzonna JE, B e sche PA.
majo in ec ion in BALB/c mice. Eu . J. Immunol. 2001;31:3175-3184. doi:
10.1002/1521-4141(200111)31:11<3175::AID-IMMU3175>3.0.CO;2-L
253
caused by L. b aziliensis induced a ema kable dec ease in he le els o IL-4, IL-10 and TNF-
cy okines associa ed wi h complica ions in he ou come o he disease332.
Likewise, he combina ion o chemo he apeu ic d ugs wi h cy okines has been explo ed as an
al e na i e o he use o cy okines alone. Cy okines p esen a sho hal -li e329 and some
di icul ies o adjus he dose, bu exhibi a he apeu ic po en ial and a e u he in es iga ed as
adju an s o d ugs cu en ly used in clinics. Acco dingly, he e ec o human ecombinan GM-
CSF (h -GM-CSF) used in combina ion wi h pen a alen an imonial d ugs was in es iga ed o
he ea men o acu e leishmaniasis caused by L.dono ani and L. majo in human neu openic
pa ien s, epo ing a apid eco e y o he neu openia and a comple e esolu ion o he
in ec ion wi hin 3 mon hs333. In like manne , h -GM-CSF also showed a syne gic e ec when
using in combina ion wi h liposomal ampho e icin B o ea isce al leishmaniasis/HIV
coin ec ion, leading o he es o e o he immune esponse o he pa ien (leukocy openia was
e e ed and a highe mac ophage ac i a ion a e was obse ed)334.
Vaccine-based immuno he apy
Many e o s ha e been ocused in o de o a o d e ec i e, s able and a o dable accines o
induce a long- e m immuniza ion owa ds Leishmania in ec ions, specially o p o ec om VL.
None heless, up o now, an ileishmanial accines ha e no been eached o he app o al o
hei clinical use.
In es iga ions o de elop accines agains Leishmania we e ini ia ed by using killed o
inac i a ed Leishmania pa asi es ( he so-called i s gene a ion accines), alone o wi h
adju an s. In his ega d, accines con aining killed Leismania p omas igo es alone335 o in
combina ion wi h BCG336 (Bacillus Calme e Gué in) as an adju an we e ound o imp o e he
e olu ion o he disease. Mo eo e , he employmen o pas eu ized Leishmania p omas igo es
along wi h BCG also epo ed an imp o emen in he eco e y a e o pa ien s wi h se e e
332 Cas ellano LR, A gi o L, Dessein H, Dessein A, da Sil a MV, Co eia D, Rod igues V. Po en ial Use o
In e leukin-10 Blockade as a The apeu ic S a egy in Human Cu aneous Leishmaniasis. J Immunol Res.
2015;2015:152741. doi: 10.1155/2015/152741
333 Al-Zamel F, Al-Shamma y FJ, El-Shewemi S, Soliman R. Enhancemen o leishmanicidal ac i i y o human
mac ophages agains Leishmania majo and Leishmania dono ani in ec ion using ecombinan human
g anulocy e mac ophage colony s imula ing ac o . Zen albl Bak e iol. 1996;285(1):92-105
334 Mas oianni A. Liposomal ampho e icin B and HuGM-CSF o ea men o isce al leishmaniasis in
AIDS. In ez Med. 2004;12(3):197-204
335 May ink W, Magalhaes PA, Michalick MS, da Cos a CA, Lima Ade O, Melo MN, Toledo VP, Nascimen o
E, Dias M, Gena o O, e al. Immuno he apy as a ea men o Ame ican cu aneous leishmaniasis:
p elimina y s udies in B azil. Pa assi ologia. 1992;34(1-3):159-65
336 Gena o O, de Toledo VP, da Cos a CA, He me o MV, A onso LC, May ink W. Vaccine o p ophylaxis and
immuno he apy, B azil. Clin De ma ol. 1996;14(5):503-12. doi: 10.1016/0738-081x(96)00040-5

254
leishmaniasis337. In like manne , he combina ion o chemo he apy (sodium s iboglucona e) wi h
a i s gene a ion accine (au ocla ed L. majo + BCG) elucida ed an imp o ed cu e- a e in VL
pa ien s in compa ison wi h he chemo he apeu ic ea men alone338, which sugges s a
bene icial e ec o he accine in pa ien s sensi i e o chemo he apeu ic d ugs.
In o de o sol e he s anda diza ion di icul ies o he i s gene a ion accines, a second
gene a ion was de eloped based on pu i ied (o ecombinan ) Leishmania ac ions/p o ein
subuni s and DCs. Among in es iga ed Leishmania subuni s, A2 amas igo e an igen, FML
( ucose-mannose ligand), L-Ag (L. dono ani memb ane an igen) and HSP-70/HSP-83 (hea shock
p o eins) ha e been epo ed o induce Th1 cell-based immuni y ha a ou s he ou come o
leishmaniasis in animal models339. Fu he mo e, he polyp o ein-based accine LEISH-F1 (a L.
majo de i ed h ee ecombinan an igen mix u e named as 111- ) o mula ed wi h MPL-SE
(monophospho yl lipid Ain s able emulsion) is epo ed as he i s de ined accine o
leishmaniasis and eached o phase I and phase II clinical ials. LEISH-F1/MPL-SE accine
p esen ed a sa e p o ile bu u he s udies ha e o be made in o de o p o e i s e icacy o
p e en VL340.
Mo e ecen ly, he disclosu e o a hi d gene a ion accines based on DNA (namely DNA
accines), allowed he de elopmen o mo e s able and highly immunogenic accines. DNA
accines a e based on plasmids con aining speci ic Leishmania an igens ha a e ans ec ed o
he cells o he hos . The eby, he hos cell ansc ibes he ans ec ed genes and ansla es he
co esponding mRNA o exp ess he encoded p o ein (i.e. he speci ic Leishmania an igens),
which induces a T-cell based immune esponse341. Fo ins ance, a accine based on bi unc ional
HbR-encoding DNA (HbR: haemoglobin ecep o , an essen ial ecep o o he iabili y o
Leishmania cells by ac ing on he haemoglobin me abolism o he pa asi es) ha induced a
337 Con i J, Ul ich M, Poleg e MA, A ila A, Rod íguez N, Mazzedo MI, Blanco B. The apy o Venezuelan
pa ien s wi h se e e mucocu aneous o ea ly lesions o di use cu aneous leishmaniasis wi h a accine
con aining pas eu ized Leishmania p omas igo es and bacillus Calme e-Gue in: p elimina y epo . Mem
Ins Oswaldo C uz. 2004;99(1):57-62. doi: 10.1590/s0074-02762004000100010
338 Musa AM, Khalil EA, Mahgoub FA, Elgawi SH, Modabbe F, Elkada u AE, Aboud MH, Noazin S, Ghalib
HW, El-Hassan AM; Leishmaniasis Resea ch G oup/Sudan. Immunochemo he apy o pe sis en pos -kala-
aza de mal leishmaniasis: a no el app oach o ea men . T ans R Soc T op Med Hyg. 2008;102(1):58-63.
doi: 10.1016/j. s mh.2007.08.006
339 Das A, Ali N. Vaccine De elopmen Agains Leishmania dono ani. F on Immunol. 2012;3:99. doi:
10.3389/ immu.2012.00099
340 Chak a a y J, Kuma S, T i edi S, Rai VK, Singh A, Ashman JA, Laughlin EM, Cole RN, Kahn SJ, Beckmann
AM, Cowgill KD, Reed SG, Sunda S, Piazza FM. A clinical ial o e alua e he sa e y and immunogenici y
o he LEISH-F1+MPL-SE accine o use in he p e en ion o isce al leishmaniasis. Vaccine.
2011;29(19):3531-7. doi: 10.1016/j. accine.2011.02.096
341 Kuma A, Saman M. DNA accine agains isce al leishmaniasis: a p omising app oach o p e en ion
and con ol. Pa asi e Immunol. 2016;38(5):273-81. doi: 10.1111/pim.12315
255
comple e p o ec ion on BALB/c mice model agains VL caused by L. dono ani. The immune
esponse was ound o be ela ed wi h he up egula ion o IL-12, TNF- -
accompanied by a dec ease in he sec e ion o IL-4 and IL-10 cy okines342. In like manne , a DNA-
based accine con aining UBQ-ORFF (ubiqui in conjuga ion o open eading ame F) was ound
o de elop a p o ec i e e ec in BALB/c mice model agains L. dono ani induced VL ia
up egula ion o IL-12 and IFN- -4 and IL-10
cy okines343.
Finally, i has o be men ioned ha gene ically modi ied li e a enua ed accines a e also unde
p eclinical de elopmen . Acco dingly, leishmaniza ion wi h LmCen (cen in gene dele ed L.
majo ) s ain in p eclinical animal models has ecen ly been ound o induce an in lamma o y
immune esponse and p o ide p o ec ion agains bo h L. majo and L.dono ani in ec ions344.
IV-1.3.3. Miscellaneous ea men s o leishmaniasis
Besides chemo he apy and immuno he apy, he e a e some o he expe imen al app oaches o
ea leishmaniasis as auxilia y he apies o unde p eclinical de elopmen (Figu e 81). Fo
ins ance, physical modali ies as c yo he apy/ he mo he apy and applica ion o CO2 lase imply
a di ec me hod o apply cold/hea in he a ec ed skin a ea in CL345, in an a emp o kill he
pa asi es in he open wounds. Fu he mo e, su ge y is necessa y in he mos se e e in a-
abdominal inju ies and in some dis igu ing local wounds296.
Likewise, d ug epu posing eme ged as a a ional s a egy o iden i y new an ileishmanial d ug
candida es om exis ing clinical/p eclinical d ugs o o he pu poses, which ha e been widely
s udied and usually o e a sa e pha macokine ic p o ile. In his ega d, he azole an i ungal d ugs
342 Guha R, Gup a D, Ras ogi R, e al. Vaccina ion wi h leishmania hemoglobin ecep o -encoding DNA
p o ec s agains isce al leishmaniasis. Sci T ansl Med. 2013;5(202):202 a121.
doi:10.1126/sci anslmed.3006406
343 Sha ma A, Madhubala R. Ubiqui in conjuga ion o open eading ame F DNA accine leads o enhanced
cell-media ed immune esponse and induces p o ec ion agains bo h an imony-suscep ible and - esis an
s ains o Leishmania dono ani. J Immunol. 2009;183(12):7719-7731. doi:10.4049/jimmunol.0900132
344 Ka maka S, Ismail N, Oli ei a F, O is ian J, Zhang WW, Ka i aj S, Singh KP, Mondal A, Das S, Pandey K,
Bha acha ya P, Volpedo G, Ganna a am S, Sa oska M, Sa oska S, Sas y RM, Oljuskin T, Sepahpou T,
Meneses C, Hamano S, Das P, Ma lashewski G, Singh S, Kamhawi S, Dey R, Valenzuela JG, Sa oska A,
Nakhasi HL. P eclinical alida ion o a li e a enua ed de mo opic Leishmania accine agains ec o
ansmi ed a al isce al leishmaniasis. Commun Biol. 2021;4(1):929. doi: 10.1038/s42003-021-02446-x
345 a) Wol Nassi P, DE Mello TFP, Na asconi TR, e al. Sa e y and e icacy o cu en al e na i es in he
opical ea men o cu aneous leishmaniasis: a sys ema ic e iew. Pa asi ology. 2017;144(8):995-1004.
doi:10.1017/S0031182017000385. b) Valencia BM, Mille D, Wi zig RS, Boggild AK, Llanos-Cuen as A.
No el low-cos he mo he apy o cu aneous leishmaniasis in Pe u. PLoS Negl T op Dis. 2013;7(5):e2196.
doi:10.1371/jou nal.pn d.0002196
256
( luconazole346 and i aconazole347) e idenced a p omising an ileishmanial po en ial in CL
pa ien s and cla i h omycin mac olide an ibio ic p esen ed a leishmanicidal e ec owa d L.
dono ani pa asi es in i o348. Fu he mo e, Tamoxi en, an es ogen ecep o modula o o he
ea men o b eas cance , epo ed an in i o an ileishmanial e ec by a ec ing he
sphingolipid me abolism in Leishmania cells and p esen s p omising esul s in p eclinical assays
wi h animal models and in a pilo clinical ial wi h human pa ien s349.
Figu e 81. Summa y o expe imen al and clinical he apies o he ea men o leishmaniasis.
IV-1.4. LTOP1B as a d uggable a ge in an ileishmanial d ug disco e y
TOP1B is p esen in all ypanosoma ids and esul s essen ial o hei cell iabili y.
T ypanosomal TOP1B di e s om o he euka yo ic analogues on i s oligome ic na u e, which
esul s a cu ious pa icula i y in a highly conse ed enzyme amily. The genes encoding each
monome a e loca ed in di e en ch omosomes and upon gene exp ession, bo h p o ome s
346 Sousa AQ, F u uoso MS, Mo aes EA, Pea son RD, Pompeu MM. High-dose o al luconazole he apy
e ec i e o cu aneous leishmaniasis due o Leishmania (Vianna) b aziliensis. Clin In ec Dis.
2011;53(7):693-695. doi:10.1093/cid/ci 496
347 Cal opina M, Gue a a AG, A mijos RX, Hashiguchi Y, Da idson RN, Coope PJ. I aconazole in he
ea men o New Wo ld mucocu aneous leishmaniasis. In J De ma ol. 2004;43(9):659-663.
doi:10.1111/j.1365-4632.2004.02183.x
348 Roy K, Das S, Mondal S, Roy AK, Be a T. The in Vi o e ec o cla i h omycin on amas igo e o
Leishmania Dono ani. In J D ug De Res. 2013;5(3):425 431
349 Zewdie KA, Hailu HG, Ayza MA, Tes aye BA. An ileishmanial Ac i i y o Tamoxi en by Ta ge ing
Sphingolipid Me abolism: A Re iew. Clin Pha macol. 2022;14:11-17. doi:10.2147/ CPAA.S344268
257
need o be assembled in o de o ge he ac i e o m o he enzyme350. Acco dingly, he la ge
subuni (composed o 636 amino acids wi h a molecula mass o ~73 kDa in L. dono ani) con ains
he co e domain, while he small subuni (composed o 262 amino acids wi h a molecula mass
~28 kDa in L. dono ani) encloses he C e minal domain bea ing he phylogene ically conse ed
SKxxY mo i ha ha bo s he ca aly ic Ty esidue (loca ed in posi ion 222 in he case o
LTOP1B)351. The schema ic ep esen a ion o LTOP1B domain o ganiza ion om L. dono ani is
illus a ed in he Figu e 82, along wi h he human iso o m (hTOP1B).
Figu e 82. Schema ic o e iew o he domain o ganiza ion o human hTOP1B (monome ic) and L.dono ani LTOP1B
(he e odime ic, small and la ge subuni s).
LTOP1B, as a membe o euka yo ic TOP1B sub amily, elaxes bo h posi i e and nega i e DNA
by in oducing ansien single-s anded b eaks in dsDNA ha allows s and o a ion (as
expounded in he in oduc ion, ide sup a). The eby, LTOP1B gene a es ansien TOP1CCs in an
ATP-independen manne by co alen ly binding o
pe mi s and passage and hen, eliga es he scission.
Leishmanial opoisome ase IB (LTOP1B) inhibi o s as d ug candida es o leishmaniasis
LTOP1B sha es he ca aly ic mechanism wi h he o he euka yo ic TOP1B iso o ms as he SKxxY
mo i is main ained, including he ca aly ic Ty esidue. Con e sely, he e coexis clea
350 Balaña-Fouce R, Al a ez-Velilla R, Fe nández-P ada C, Ga cía-Es ada C, Regue a RM. T ypanosoma ids
opoisome ase e- isi ed. New s uc u al indings and ole in d ug disco e y. In J Pa asi ol D ugs D ug
Resis . 2014;4(3):326-37. doi: 10.1016/j.ijpdd .2014.07.006
351 Villa H, O e o Ma cos AR, Regue a RM, Balaña-Fouce R, Ga cía-Es ada C, Pé ez-Pe ejo Y, Tekwani BL,
Myle PJ, S ua KD, Bjo ns i MA, O dóñez D. A no el ac i e DNA opoisome ase I in Leishmania dono ani.
J Biol Chem. 2003;278(6):3521-6. doi: 10.1074/jbc.M203991200
264
Table 23. An ileishmanial ac i i y o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6and
quinolin-8-yl phosphine oxides 7.
En y Compound
EC
50
(
µ
M)
L. in an um
a
GI
50
(
µ
M)
b
SIc
p omas igo es
amas igo es
splenocy es
Nº
R
1
R
2
(
Leishmania
)
(
Leishmania
)
(mu ine)
1
AmB
-
-
0.77 ± 0.15
0.32 ± 0.05
20
62.50
2
6a
2
-
MeO
-
C
6
H
4
H
9.29 ± 2.25
0.98 ± 0.73
34.23 ± 1.78
34.93
3
6g
4
-
F
-
C
6
H
4
4
-
Me
7.10
± 0.81
1.85 ± 1.09
13.82 ± 0.39
7.47
4
6i
3,4
-
F
2
-
C
6
H
3
4
-
F
6.15 ± 1.24
1.46 ± 0.16
63.70 ± 1.88
43.63
5
7d
2
-
naph hyl
H
4.91 ± 0.38
4.14 ± 1.64
57.11 ± 6.60
13.79
6
7i
3,4
-
F
2
-
C
6
H
3
4
-
F
2.23 ± 0.25
2.15 ± 1.23
23.95 ± 1.36
11.14
7
7j
C
6
H
5
4
-
F
6.01 ± 0.80
1.39 ± 1.08
71.03 ± 2.11
51.10
a,b The cy o oxici y EC50/GI50 alues collec ed in he p esen able we e calcula ed by cell iabili y assays and a e de ined
as he concen a ions co esponding o a 50% cell g ow h inhibi ion. The EC50/ GI50 esul s a e shown as he mean ±
he s anda d de ia ion om independen cell iabili y assay expe imen s pe o med in quad uplica e. c The SI was
calcula ed as he a io be ween GI50 splenocy es/ EC50 p omas igo es.
O e all, all o he s udied ( e ahyd o)quinolin-8-yl phosphine oxide de i a i es 6 and 7 epo ed
a no able an ileishmanial e ec owa d L.in an um p omas igo es and amas igo es in he single
digi mic omola ange, wi h EC50 alues anging be ween 2.23-9.29 µM in ee li ing
p omas igo es in i o and be ween 0.98-4.14 µM owa d in amac ophage amas igo es ex i o.
The an ileishmanial ac i i y o he s udied compounds 6/7 was sligh ly mino bu compa able o
he e e ence d ug ampho e icin B (Table 23, en y 1), which epo ed EC50 alues o 0.77 ± 0.15
µM in ee li ing p omas igo es and 0.32 ± 0.05 µM owa d in acellula amas igo es. Howe e ,
AmB p esen ed an ele a ed SI o 62.50 and only he compounds 6i (R1 = 3,4-F2-C6H3; R2 = 4-F;
en y 4) and 7j (R1 = C6H5; R2 = 4-F; en y 7) we e close in e ms o selec i e cy o oxici y owa d
L. in an um pa asi es. In ac , he ( e ahyd o)quinolin-8-yl phosphine oxide de i a i es 6i and
7j epo ed he bes an ileishmanial ac i i y o he cu en s udy due o he selec i e
an ileishmanial e ec .
Inhibi ion o L. in an um LTOP1B
Once concluded he e alua ion o an ileishmanial ac i i y wi h compounds 6/7, he L. in an um
LTOP1B inhibi o y ac i i y o (2-(3,4-di luo ophenyl)-4-(4- luo ophenyl)quinolin-8-
yl)diphenylphosphine oxide 7i was hen e alua ed. The quinolin-8-yl de i a i e 7i was p e iously
ound as a supp esso -like hTOP1B (human iso o m) inhibi o wi h a qui e s ong po ency a

265
sho eac ion imes (up o 1 min) in DNA elaxa ion assays (see Figu e 38 and Table 11, en y 8;
in Chap e II, ide sup a). In iew o he o me esul s, he compound 7i was es ed in he
p e iously expounded DNA elaxa ion assay wi h LTOP1B o L. in an um and human hTOP1B in
o de o in es iga e whe he he inhibi o y ac i i y is main ained in he leishmanial
he e odime ic iso o m o no , and hence, o u he compa e he po en ial inhibi o y ac i i ies
in bo h euka yo ic TOP1B enzymes.
Acco dingly, in i o DNA elaxa ion assays we e pe o med as p e iously explained wi h he
nega i ely supe coiled pBluesc ip -SK DNA (pSK DNA) plasmid. The enzyma ic eac ions we e
incuba ed a 26oC (LTOP1B)/ 37oC (hTOP1B) in he p esence o 100 µM o compound 7i and
aliquo s we e s opped a 2 min, 4 min, 8 min and 16 min eac ion imes wi h 1% sa kosyl ( inal
concen a ion). Mo eo e , endpoin DNA elaxa ion assays we e made o a ixed ime pe iod
o 5 min wi h inc easing compound concen a ions (in iplica e) in o de o calcula e IC50 alues
o he inhibi ion o TOP1B239. IC50 was e e ed as he 50% o he e ec i e concen a ion o
e ec i ely inhibi he TOP1B elaxa ion ac i i y. The esul s ob ained in he p esen DNA
elaxa ion assays a e collec ed in he Table 24.
Table 24. LTOP1B and hTOP1B inhibi o y ac i i y o quinolin-8-yl phosphine oxide de i a i e 7i.
En y Compoun
d
% Inhibi ion LTOP1B a IC50 LTOP1B
(µM)
IC50 hTOP1B
(µM)
Nº 2
min
4
min
8
min
16 min
1 7i +++ +++ +++ - 48.11 ± 0.33 69.65 ± 1.29
aThe ac i i y o he compound inhibi ing LTOP1B elaxa ion a 1O0 µM was exp essed semiquan i a i ely by
compa ison wi h he maximum inhibi o y ac i i y obse ed o CPT a 100 µM as ollows: -, no ac i i y; +, weake
ac i i y han CPT; ++ simila ac i i y o CPT; +++ s onge ac i i y han CPT
A ending o he Table 24, he compound 7i was ound o inhibi LTOP1B in a highe a e han
CPT and he inhibi o y ac i i y was main ained up o 8 min o incuba ion. Mo eo e , he
quinolyn-8-yl phosphine oxide 7i p esen ed IC50 alue o 48.11 ± 0.33 µM on LTOP1B and a IC50
alue o 69.65 ± 1.29 µM on hTOP1B. In iew o he collec ed esul s, we may conclude ha he
266
compound 7i main ained he TOP1B inhibi o y ac i i y p e iously p esen ed owa d he human
iso o m in he L. in an um LTOP1B. Finally, i has o me men ioned ha he IC50 alues ob ained
in bo h euka yo ic enzymes esul ed o be qui e simila , e en hough i was a bi highe in he
case o hTOP1B enzyme.
IV-2.2. An ileishmanial e ec o dialkyl quinolinyl phosphona es
In he p esen sec ion is shown he sc eening o dialkyl quinolin-8-yl phosphona es 13 and
die hyl quinolin-6-yl phosphona es 16 (Figu e 89) as an ileishmanial d ug candida es.
Figu e 89. Gene al s uc u es o dialkyl quinolin-8-yl phosphona es 12 and die hyl quinolin-6-yl phospjona es 15.
In i o an ileismanial ac i i y in L. in an um pa asi es (amas igo es and p omas igo es)
In i s place, he an ileishmanial e ec o dialkyl quinolin-8-ylphosphona es 13 and die hyl
quinolin-6-ylphosphona es 16 was e alua ed agains L. in an um p omas igo es and
amas igo es.
The op imized expe imen condi ions used in he sec ion IV-2.1. o his addenda we e ollowed
( ide sup a). Acco dingly, he an ileishmanial e ec o dialkyl quinolinylphosphona e de i a i es
13 and 16 was assessed in L. in an um-iRFP p omas igo es in i o, L. in an um-iRFP
in amac ophage amas igo es ( om an ex i o mu ine splenic explan cul u e) and mu ine
splenocy es (an ex i o splenic explan cul u e).
The cell iabili y o iable L. in an um p omas igo es and amas igo es was measu ed by he
de ec ion o nea -in a ed adia ion (
compounds ( h ee independen expe imen s pe compound) in di e en concen a ions. The
ob ained Leishmania-cell iabili y was plo ed in dose- esponse cu es and he e o e EC50 alues
we e calcula ed wi h Sigma-Plo 10.0 so wa e.
On he o he hand, he cell iabili y o ex i o mu ine splenocy es was measu ed by using he
Alama Blue iabili y assay upon 96 h o incuba ion wi h he es ed compounds a di e en
267
concen a ions (expe imen s we e pe o med in iplica e). The esul ing cell iabili y was
plo ed in dose- esponse cu es and GI50 alues we e u he calcula ed by using Sigma-Plo 10.0
s a is ical package.
Finally, he SI was calcula ed as he ela ionship be ween EC50 o ex i o in amac ophage
amas igo es and GI50 o ex i o splenocy es. The esul s in ol ing EC50 in amas igo es, EC50 in
p omas igo es, GI50 in splenocy es and SI a e collec ed in he Table 25.
268
Table 25. An ileishmanial ac i i y o dialkyl quinolin-8-ylphosphona es 13 and die hyl quinolin-
6-ylphosphona es 16.
En y Compound
EC
50
(
µ
M)
L. in an um
GI
50
(
µ
M)
SI
p omas igo
es
amas igo es
splenocy es
Nº
R
R
1
R
2
(
Leishmania
)
(
Leishmania
)
(mu ine)
1
AmB
-
-
-
0.77 ± 0.15
0.32 ± 0.05
20
62.50
2
13a
E
C
6
H
5
H
0.91 ± 0.04
4.03 ± 0.30
3.61 ± 0.45
0.90
3
13b
E
2
-
MeO
-
C
6
H
4
H
11.37 ± 0.62
19.46 ± 2.38
30.09 ± 6.05
1.55
4
13d
E
4
-
MeO
-
C
6
H
4
H
9.46 ± 1.67
8.23 ± 1.70
15.90 ± 1.65
1.93
5
13
E
1
-
naph hyl
H
20.
55 ± 2.19
19.66 ± 2.39
12.22 ± 1.49
0.62
6
13g
E
2
-
naph hyl
H
20.38 ± 1.57
20.44 ± 5.62
51.62 ± 1.52
2.53
7
13j
E
4
-
F
-
C
6
H
4
4
-
Me
7.29 ± 0.94
9.80 ± 0.48
14.54 ± 1.56
1.48
8
13k
E
3,4
-
F
2
-
C
6
H
3
4
-
Me
2.59 ± 0.48
26.23 ± 3.65
24.07 ± 7.79
0.92
9
13l
E
C
6
H
5
4
-
F
16.05 ± 1.94
11.89 ± 5.17
33.86 ± 7.98
2.85
10
13
m
E
4
-
F
-
C
6
H
4
4
-
F
8.43 ± 0.92
24.17 ± 2.37
20.26 ± 7.49
0.84
11 13n E 3,4-F2-C6H3 4-F 6.35 ± 0.16 13.43 ± 5.53 20.64 ± 3.11 1.54
12 13o iP 4-F-C6H4 H 9.57 ± 0.40 19.47 ± 2.23 22.10 ± 4.70 1.13
13 13p iP 3,4-F2-C6H3 H 11.18 ± 0.74 10.20 ± 1.34 19.79 ± 3.76 1.94
14 13q iP 4-F-C6H4 4-Me 5.01 ± 0.35 24.32 ± 2.53 21.23 ± 3.50 0.87
15 13 iP 3,4-F2-C6H3 4-Me 7.46 ± 0.76 13.91 ± 3.65 28.33 ± 9.16 2.04
16 13s iP 4-F-C6H4 4-F 4.86 ± 0.50 5.52 ± 1.11 15.29 ± 1.72 2.77
17 13 iP 3,4-F2-C6H3 4-F 19.26 ± 1.79 19.65 ± 1.73 18.60 ± 1.10 0.94
18 16a E 4-F-C6H4 H 15.22 ± 1.14 29.23 ± 14.00 28.07 ± 1.23 0.96
19
16b
E
3,4
-
F
2
-
C
6
H
3
H
14.72 ± 1.78
14.20 ± 2.83
26.23 ± 0.51
1.85
20 16c E 4-F-C6H4 4-Me 7.02 ± 0.94 17.56 ± 7.81 11.18 ± 4.42 0.64
21 16d E 3,4-F2-C6H3 4-Me 21.29 ± 2.34 32.95 ± 6.55 32.33 ± 3.36 0.98
22 16e E 4-F-C6H4 4-F 16.73 ± 0.72 31.46 ± 2.71 44.97 ± 10.24 1.43
23 16 E 3,4-F2-C6H3 4-F 7.07 ± 0.61 26.36 ± 2.33 100 3.79
a,b The cy o oxici y EC50/GI50 alues collec ed in he p esen able we e calcula ed by cell iabili y assays and a e
de ined as he concen a ions co esponding o a 50% cell g ow h inhibi ion. The EC50/ GI50 esul s a e shown as he
mean ± he s anda d de ia ion om independen cell iabili y assay expe imen s pe o med in quad uplica e. c The
SI was calcula ed as he a io be ween GI50 splenocy es/ EC50 p omas igo es.
As i can be obse ed in he Table 25, all he es ed compounds 13/16 we e ound o be ac i e
in bo h p omas igo e and amas igo e o ms o L. in an um-iRFP s ain, p esen ing EC50 alues
anging om 0.91 ± 0.04 µM (compound 13a, R = E ; R1 = C6H5; R2 = H; Table 25, en y 2) o 21.29
± 2.34 µM (compound 16d, R= E ; R1 = 4-F-C6H4; R2 = 4-Me; en y 21) in ee li ing p omas igo es
in i o and om 4.03 ± 0.30 µM (compound 13a, R = E ; R1 = C6H5; R2 = H; en y 2) o 26.36 ±
2.33 µM (compound 16a, R = E ; R1 = 4-F-C6H4; R2 = H; en y 18) owa d ex i o in amac ophage
269
amas igo es. Howe e , he SI was gene ally low (below 2.85 in all he quan i iable cases) o all
he s udied dialkyl quinolinyl phosphona es 13/16, which indica es a high oxici y owa d he
hos cells excep o he compound 16 (R = E ; R1 = 3,4-F2-C6H3; R2 = 4-F; en y 23) ha epo ed
a GI50 alue highe han 100 µM in mu ine splenocy es and he e o e p esen s a much be e
selec i i y owa d he in ec i e agen .
Inhibi ion o L. in an um LTOP1B
The LTOP1B inhibi o y ac i i y o dialkyl quinolinyl phosphona e de i a i es 13 and 16 was
e alua ed by DNA elaxa ion assays pe o med wi h pSK DNA plasmid and L. in an um LTOP1B.
Endpoin DNA elaxa ion assays we e ca ied ou by incuba ing he enzyma ic eac ions a 26oC
in he p esence o he es ed compounds (100 µM) and s opping hem a e a eac ion ime o
5 min wi h 1% o sa kosyl ( inal concen a ion). The inhibi o y ac i i y o he es ed compounds
was exp essed as he pe cen age o LTOP1B inhibi ion (0-100%), which was de e mined by
measu ing he band co esponding o he supe coiled pSK plasmid363. The ob ained esul s a e
lis ed in he Table 26.
363 Selas A, Fue es M, Melcón-Fe nández E, e al. Hyb id Quinolinyl Phosphona es as He e ocyclic
Ca boxyla e Isos e es: Syn hesis and Biological E alua ion agains Topoisome ase 1B (TOP1B).
Pha maceu icals (Basel). 2021;14(8):784. doi:10.3390/ph14080784

270
Table 26. LTOP1B inhibi o y ac i i y o dialkyl quinolin-8-ylphosphona es 13 and die hyl
quinolin-6-ylphosphona es 16.
En y
Compound LTOP1B
inhibi iona
Nº
R
R
1
R
2
1
13a
E
C
6
H
5
H
58.87
2
13b
E
2
-MeO
-
C
6
H
4
H
46.41
3
13d
E
4
-MeO
-
C
6
H
4
H
45.45
4
13
E
1
-
naph hyl
H
7.50
5
13g
E
2
-
naph hyl
H
18.36
6
13j
E
4
-
F
-
C
6
H
4
4
-
Me
41.21
7
13k
E
3,4
-
F
2
-
C
6
H
3
4
-
Me
77.02
8
13l
E
C
6
H
5
4
-
F
16.49
9
13
m
E
4
-
F
-
C
6
H
4
4
-
F
22.44
10
13n
E
3,4
-
F
2
-
C
6
H
3
4
-
F
54.01
11
13o
i
P
4
-
F
-
C
6
H
4
H
3.55
12 13p
i
P 3,4-F2-C6H3 H 5.41
13 13q iP 4-F-C6H4 4-Me 41.62
14 13 iP 3,4-F2-C6H3 4-Me 52.65
15 13s iP 4-F-C6H4 4-F 43.31
16 13 iP 3,4-F2-C6H3 4-F 73.27
17 16a E 4-F-C6H4 H 1.94
18 16b E 3,4-F2-C6H3 H 14.56
19 16c E 4-F-C6H4 4-Me 43.25
20 16d E 3,4-F2-C6H3 4-Me 43.84
21
16e
E
4
-
F
-
C
6
H
4
4
-
F
37.86
22 16 E 3,4-F2-C6H3 4-F 50.24
a The LTOP1B inhibi o y ac i i y is shown as he pe cen age o TOP1 inhibi ion (0-100%)
As i can be obse ed in Table 26, a 100 µM and a eac ion ime o 5 min he majo i y o he
compounds we e ound o inhibi LTOP1B om L. in an um in i o in o e all mode a e o good
inhibi ion a es. In pa icula , he dialkyl quinolin-8-ylphosphona e de i a i es 13k (R = E ; R1 =
3,4-F2-C6H3; R2 = 4-Me; Table 26, en y 7) and 13 (R = iP ; R1 = 3,4-F2-C6H3; R2 = 4-F, en y 16)
epo ed he bes LTOP1B inhibi o y a es (77.02% and 73.27% espec i ely) upon 5 min o
enzyma ic eac ion. The compound 13k p e iously p esen ed a s ong TOP1 inhibi o y ac i i y
agains he human hTOP1B iso o m (see he Table 12 o he Chap e II, en y 11; ide sup a) a
e y sho enzyma ic eac ion imes (15 sec) and a mode a e inhibi ion a 1-3 min ime ame,
so i seems sligh ly mo e ac i e owa d he L. in an um LTOP1B iso o m. On he o he hand, he
271
quinolin-8-yl de i a i e 13 had p e iously epo ed a mode a e hTOP1B ac i i y up o 3 min a
160 µM (see he Table 12, Chap e II, en y 20; ide sup a), whe eas demons a ed a s onge
inhibi o y e ec owa d he LTOP1B o L. in an um a 100 µM.
On balance, in ligh o he ob ained esul s we may conclude ha he es ed dialkyl
quinolinylphosphona es 13/16 epo ed o e all mode a e o high LTOP1B inhibi ion in i o a
100 µM. Likewise, compounds 13/16 demons a ed a p omising an ileishmanial e ec in L.
in an um p omas igo es (in i o) and amas igo es (ex i o) in he mic omola ange, e en
hough he selec i i y owa d he in ec i e agen in he BALB/c mice model was on he whole
low, esul ing in ele a ed oxici ies agains he hos cells. Finally, he absence o a clea
ela ionship be ween he LTOP1 inhibi o y ac i i y and he EC50 alues in L. in an um
p omas igo es/amas igo es sugges s ha o he a ge s may be in ol ed in he an ileishmanial
esponse o he compounds subjec o s udy.
272
V. Conclusions
273
Conclusions:
I-1. The e sa ili y o he Po a o eac ion allowed us he p epa a ion o di e se lib a ies o
compounds based on hyb ids o 2,4-disubs i u ed quinoline de i a i es and phosphine oxide o
dialkyl phosphona e moie ies in posi ions 6 and 8 o he quinoline co e. In his ega d, he
adap abili y o he Po a o eac ion by using s y enes/ace ylenes as dienophiles acili a ed he
op imiza ion o s ep-by-s ep/MCR one-po me hodologies o s aigh o wa dly ob ain
1,2,3,4. e ahyd oquinolines and ully a oma ic and quinolines.
I-2. Fu he mo e, he ange-expansion o he ole inic componen , om s y enes o hei cyclic
analogue indene, allowed us o jump om a combina o ial chemis y s a egy (i.e. explo ing
hyb ids o phospho a ed 1,2,3,4- e ahyd oquinolines/quinolines) o a di e si y o ien ed
chemis y, ob aining sca olds o quinolines used wi h indene wi h a highe s uc u al
complexi y and a simila subs i u ion pa e n.
I-3. In summa y, he applicabili y o he Po a o eac ion o a wide ange o dienophiles opened
he doo o a highe s uc u al di e si y in quinoline/indenoquinoline-based sca olds, pe mi ed
he molecula hyb idiza ion be ween he pen a alen phospho us-con aining moie ies (diphenyl
phosphine oxide and dialkyl phosphona es) in he quinoline co e and enabled he
unc ionaliza ion o he quinoline-de i ed amewo ks wi h a b oad a ie y o subs i uen s.
II-1. The biological sc eening o he no el hyb id phospho a ed quinoline de i a i es as TOP1
inhibi o s allowed o iden i y hose ones wi h he abili y o inhibi he enzyme a 160 µM (as
e e sible TOP1 inhibi o s). Fu he mechanis ic s udies (nicking assays and clea age/ eliga ion
equilib ium expe imen ) e ealed ha he s udied phospho a ed quinolines ac as supp esso -
like TOP1 inhibi o s, as hey do no induce he accumula ion o TOP1-dependan nicked plasmid
in he nicking assay and no accumula ion o TOP1CC p oduc s was obse ed in he
clea age/ eliga ion equilib ium expe imen .
II-2. Fu he mo e, we pa icipa ed in he de elopmen o he REEAD assay applied o he in i o
d ug sc eening o no el TOP1 inhibi o s in ea ly s ages o he d ug disco e y p ocess, wi h he
aim o disc imina e among all he d ug candida es hose small compounds wi h he abili y o
inhibi he hTOP1B a pha macologically ele an concen a ions. We achie ed o success ully
s udy some o he no el hyb id phospho a ed quinoline de i a i e by he REEAD assay, p o ing
ha his no el sc ening me hodology p o ides he TOP1 ac i i y a e in quan i a i e e ms wi h
a high sensi i i y, which p ima ily implies o ob ain eliable and p ecise inhibi o y alues du ing
he biological e alua ion o he es ed d ug candida es.
280
VI-1.2. Syn hesis o quinolinylphosphine oxide de i a i es
P epa a ion o (2-aminophenyl)diphenylphosphine oxide 1a
(2-ni ophenyl)diphenylphosphine oxide.
A solu ion o e hyl diphenylphosphini e (19.44 mL, 90 mmol, 1.2 equi .) in 30
mL o d y dime hyl o mamide (DMF) was added d op by d op du ing 2.5 h o a
s i ed -10oC solu ion o 1,2-dini obenzene (12.61 g, 75 mmol, 1 equi .) in 40 mL o d y
ace oni ile (MeCN). Upon addi ion, he eac ion mix u e was main ained s i ing a oom
empe a u e o 12h. The esul an p ecipi a e was il e ed o , washed wi h DMF, d ied in acuo
and ec ys alized in e hyl ace a e (E OAc) a 4oC, ob aining 20.08 g (62.10 mmol) o (2-
ni ophenyl)diphenylphosphine oxide as a yellow solid (69%); mp 226-227oC (E OAc).
(2-Aminophenyl)diphenylphosphine oxide (1a):
(2-Ni ophenyl)diphenylphosphine oxide (19.40 g, 60 mmol) was hyd ogena ed
wi h a spoon o RANEY® Nickel (app ox. 5 g) in 60 mL
o MeOH a 80 psi a oom empe a u e o 12 h. The eac ion mix u e was hen
il e ed o h ough a pad o celli e and e apo a ed o d yness o ob ain (2-
aminophenyl)diphenylphosphine oxide 1a (17.59 g, 59.97 mmol) as a whi e solid (99%); mp 167-
168oC (me hanol).
Gene al p ocedu e o he p epa a ion o aldimines 4
To a solu ion o (2-aminophenyl)diphenylphosphine oxide 1 (2.93 g, 10 mmol, 1 equi .) in CHCl3
(25 mL) was added he co esponding aldehyde (10 mmol). The mix u e was s i ed a CHCl3
e lux un il consump ion o s a ing ma e ials was con i med by 1H NMR, 31P NMR and/o 19F
NMR spec oscopy. The yielded aldimines 4 we e p o ed uns able du ing dis illa ion and/o
ch oma og aphy condi ions, so hey we e used in si u wi hou u he pu i ica ion o he
upcoming eac ions.
Gene al p ocedu e o he p epa a ion o 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6
A) S ep-by s ep Po a o p ocedu e ( ou e A).
S y enes 3 (12 mmol, 1.2 equi .) and 2 equi alen o BF3·E 2O (1.23 mL, 10 mmol) we e added
o a solu ion o he co esponding in si u p epa ed aldimine 4 (10 mmol) in CHCl3 (25 mL). The
mix u e was s i ed and hea ed o CHCl3 e lux un il TLC, 31P NMR and 1H NMR spec oscopy
analysis indica ed he disappea ance o he aldimine. The molecula sie es we e emo ed by

281
il a ion and he esul ing solu ion was dilu ed wi h me hylene chlo ide (20 ml), washed wi h a
solu ion o NaOH 2M (50 ml), ex ac ed wi h me hylene chlo ide (2 x 10 mL) and d ied o e
MgSO4. Upon in acuo sol en e apo a ion, he esul an eac ion c ude was u he pu i ied by
silica gel lash column ch oma og aphy on silica gel using a g adien o elu ion o 5-70% e hyl
ace a e in hexane o a o d 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6.
B) MCR Po a o p ocedu e ( ou e B):
A mix u e o (2-aminophenyl)diphenylphosphanoxide 1a (10 mmol, 1 equi .), eshly dis illed
aldehydes 2 (10 mmol, 1 equi .), s y enes 3 (12 mmol, 1.2 equi .) and 2 equi alen s o BF3·E 2O
(2.47 mL, 20 mmol) dissol ed in CHCl3 (25 mL) was s i ed and hea ed o e lux in he p esence
o molecula sie es (4 Å), un il TLC, 31P NMR and 1H NMR spec oscopy analysis indica ed he
consump ion o he s a ing ma e ials. The molecula sie es we e emo ed by il a ion and he
esul ing solu ion was dilu ed wi h me hylene chlo ide (15 ml), washed wi h a solu ion o NaOH
2M (50 ml), ex ac ed wi h me hylene chlo ide (2 x 10 mL) and d ied o e MgSO4. Upon in acuo
sol en e apo a ion, he esul an eac ion c ude was u he pu i ied by silica gel lash column
ch oma og aphy on silica gel using a g adien o elu ion o 5-70% e hyl ace a e in hexane o
a o d 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxides 6.
(2-(2-Me hoxyphenyl)-4-phenyl-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6a).
The gene al p ocedu e A was ollowed using o-anisaldehyde (1.21 mL, 10 mmol) and s y ene
(1.37 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 36 h, a o ding he compound
6a (4.69 g, 91%) as a whi e solid.
Mel ing poin : 233-235oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.80 (ddd, 3JHH = 12.3 Hz, 3JHH = 11.1 Hz, 2JHH = 12.5 Hz, 1 H, CH2),
1.82 (s, NH), 2.36-2.41 (m, 1 H, CH2), 3.68 (s, 3 H, OCH3), 4.23 (dd, 4JHH = 4.3 Hz, 3JHH = 12.3 Hz, 1
H, CH), 5.11 (dd, 4JHH = 4.3 Hz, 3JHH = 12.3.1 Hz, 1 H, CH), 6.25 (ddd 3JHH = 7.6 Hz, 3JHH = 7.4 Hz, 4JHP
= 2.9 Hz, 1 H), 6.51-6.75 (m, 5 H), 7.03-7.73 (m, 16 H) ppm.
282
13C RMN (100 MHz, CDCl3): 2), 44.8 (HC), 50.0 (OCH3), 55.4 (HC), 110.2 (HC), 110.9
(d, 1JCP = 105.6 Hz, C), 114.4 (d, 3JCP = 13.8 Hz, HC), 121.0 (HC), 125.8-133.8 (m, 19 HC and 4 C),
144.5 (C), 150.5 (d, 2JCP = 4.6 Hz, C), 156.5 (C) ppm.
31P NMR (120 MHz, CDCl3).3 ppm.
HRMS (EI): calcula ed o C34H30NO2P [M]+ 515.2014; ound 515.2022.
4-(8-(diphenylphospho yl)-4-phenyl-1,2,3,4- e ahyd oquinolin-2-yl)phenyl die hyl phospha e
(6b).
The gene al p ocedu e A was ollowed using die hyl (4- o mylphenyl) phospha e (2.58 g, 10
mmol) and s y ene (1.37 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 24 h,
a o ding he compound 6b (2.81 g, 44%) as a whi e solid.
Mel ing poin : 66-68oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.31-1.36 (m, 6 H, 2 CH3), 1.92-1.99 (m, 1H, CH2), 2.16-2.26 (m,
1H, CH2), 4.17-4.22 (m, 5 H, 1 CH and 2 CH2), 4.70 (dd, 3JHH = 11.2 Hz, 3JHH =2.9 Hz, 1H, HC), 6.33-
7.78 (m, NH and 22 H) ppm.
13C RMN (75 MHz, CDCl3): 16.2 (2 CH3), 41.0 (CH2), 44.7 (HC), 56.2 (HC), 64.7 (2 CH2),
111.0 (d, 1JCP = 106.0 Hz, C), 115.0 (d, 3JCP = 13.8 Hz, HC), 120.0-133.2 (m, 21 HC and 4 C), 140.6
(C), 144.1 (C), 149.8 (d, 2JCP = 5.9 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)-5.3, 36.3 ppm.
HRMS (EI): calcula ed o C37H37NO5P2 [M]+ 637.2147; ound 637.2158.
283
(2-(Naph halen-1-yl)-4-phenyl-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6c).
The gene al p ocedu e A was ollowed using 1-naph haldehyde (1.36 mL, 10 mmol) and s y ene
(1.37 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 24 h, a o ding he compound
6c (3.48 g, 65%) as a whi e solid.
Mel ing poin : 267-269oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 2.11 (ddd, 3JHH = 12.7 Hz, 3JHH = 11.3 Hz, 2JHH = 12.5 Hz, 1 H, CH2),
2.48-2.55 (m, 1 H, CH2), 4.39 (dd, 3JHH = 4.3 Hz, 3JHH = 12.7 Hz, 1 H, CH), 5.56 (dd, 3JHH = 2.7 Hz, 3JHH
= 11.3 Hz, 1 H, CH), 6.40 (ddd 3JHH = 7.6 Hz, 3JHH = 7.5 Hz, 4JHP = 3.0 Hz, 1 H), 6.66-6.75 (m, 2 H),
7.16-7.99 (m, NH, 22 H) ppm.
13C RMN (75 MHz, CDCl3): 2), 45.1 (HC), 52.9 (HC), 114.4 (d, 1JCP = 105.5 Hz, C), 114.8
(d, 3JCP = 13.8 Hz, HC), 120.5 (C), 125.5 (HC), 122.8 (HC), 125.4 (HC), 125.9 (HC), 126.1 (HC), 126.3
(d, 3JCP = 7.8 Hz, C), 126.9 (HC), 127.8 (HC), 128.5-129.0 (m, 6 HC), 130.7 (C), 131.8-133.9 (m, 11
HC and 2C), 139.3 (C), 144.3 (C), 150.3 (d, 2JCP = 4.6 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C37H30NOP [M]+ 535.2065; ound 535.2076.
(2-(Naph halen-2-yl)-4-phenyl-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6d).
The gene al p ocedu e B was ollowed using 2-naph haldehyde (1.36 g, 10 mmol) and s y ene
(1.37 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 36 h, a o ding he compound
6d (3.85 g, 72%) as a whi e solid.
Mel ing poin : 245-247oC (e hyl ace a e/hexane).
284
1H RMN (400 MHz, CDCl3): = 2.12 (ddd, 3JHH = 12.6 Hz, 3JHH = 11.9 Hz, 2JHH = 12.7 Hz, 1 H, CH2),
2.33-2.39 (m, 1 H, CH2), 4.33 (dd, 3JHH = 4.1 Hz, 3JHH = 12.2 Hz, 1 H, CH), 4.93 (dd, 3JHH = 3.1 Hz, 3JHH
= 11.5 Hz, 1 H, CH), 6.42 (ddd 3JHH = 7.6 Hz, 3JHH = 7.6 Hz, 4JHP = 2.9 Hz, 1 H), 6.67-6.75 (m, 2 H),
7.16-7.86 (m, NH, 22 H) ppm.
13C RMN (100 MHz, CDCl3): 2), 44.9 (HC), 56.9 (HC), 111.2 (d, 1JCP = 105.5 Hz, C), 114.8
(d, 3JCP = 13.8 Hz, HC), 124.6 (HC), 124.6 (HC), 125.7 (HC), 125.9 (HC), 126.2 (d, 3JCP = 7.8 Hz, C),
126.8 (HC), 127.6 (HC), 128.0-133.5 (m, 19 HC and 3 C), 141.4 (C), 144.3 (C), 150.2 (d, 2JCP = 4.6
Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C37H30NOP [M]+ 535.2065; ound 535.2086.
(4-Phenyl-2-(py idin-2-yl)-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6e).
The gene al p ocedu e B was ollowed using 2-Py idineca boxaldehyde (0.95 mL, 10 mmol) and
s y ene (1.37 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 12 h, a o ding he
compound 6e (3.36 g, 69%) as a yellow solid.
Mel ing poin : 110-112oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.97 (ddd, 3JHH = 12.5 Hz, 3JHH = 11.4 Hz, 2JHH = 12.5 Hz, 1 H, CH2),
2.45-2.52 (m, 1 H, CH2), 4.27 (dd, 3JHH = 4.6 Hz, 3JHH = 12.5 Hz, 1 H, CH), 4.85 (dd, 3JHH = 3.3 Hz, 3JHH
= 11.3 Hz, 1 H, CH), 6.38 (ddd 3JHH = 7.6 Hz, 3JHH = 7.6 Hz, 4JHP = 3.0 Hz, 1 H), 6.63-6.74 (m, 2 H),
6.96 (d, 3JHH = 7.9 Hz, 1 H), 7.17-7.81 (m, NH, 18 H) ppm.
13C RMN (75 MHz, CDCl3): 2), 45.6 (HC), 57.9 (HC), 111.0 (d, 1JCP = 105.6 Hz, C), 115.1
(d, 3JCP = 13.9 Hz, HC), 119.6 (C), 122.2 (HC), 126.2 (d, 3JCP = 7.9 Hz, C), 126.8 (HC), 128.2-132.1
(m, 15 HC and C), 133.3 (d, 1JCP = 104.8 Hz, C), 133.4 (2 HC), 137.2 (HC), 144.3 (C), 148.9 (HC),
149.9 (d, 2JCP = 4.5 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C32H27N2OP [M]+ 486.1861; ound 486.1869.
285
(2-Phenyl-4-(p- olyl)-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6 ).
The gene al p ocedu e B was ollowed using benzaldehyde (1.02 mL, 10 mmol) and 1-me hyl-4-
inylbenzene (1.58 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 48 h, a o ding
he compound 6 (3.05 g, 61%) as a whi e solid.
Mel ing poin : 223-225oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.97-2.25 (m, 2 H, CH2), 2.33 (s, 3 H, CH3), 4.19 (dd, 3JHH = 4.0 Hz,
3JHH = 12.4 Hz, 1 H, CH), 4.71 (dd, 3JHH = 3.4 Hz, 3JHH = 11.4 Hz, 1 H, CH), 6.35 (ddd 3JHH = 7.8 Hz,
3JHH = 7.4 Hz, 4JHP = 2.8 Hz, 1 H), 6.57-6.68 (m, 2 H), 6.99-7.78 (m, NH, 19 H) ppm.
13C RMN (75 MHz, CDCl3): 3), 41.0 (CH2), 44.4 (HC), 57.0 (HC), 111.0 (d, 1JCP = 108.0
Hz, C), 114.8 (d, 3JCP = 11.7 Hz, HC), 126.1-133.6 (m, 21 HC and 3 C), 136.4 (C), 141.2 (C), 143.9
(C), 150.0 (d, 2JCP = 3.6 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C34H30NOP [M]+ 499.2065; ound 499.2077.
2-(4- luo ophenyl)-4-(p- olyl)-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6g).
The gene al p ocedu e B was ollowed using 4- luo obenzaldehyde (1.08 mL, 10 mmol) and 1-
me hyl-4- inylbenzene (1.58 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 36 h,
a o ding he compound 6g (3.67 g, 71%) as a whi e solid.
Mel ing poin : 207-209oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.93 (ddd, 3JHH = 12.7 Hz, 3JHH = 11.5 Hz, 2JHH = 12.7 Hz, 1 H, CH2),
2.18 (ddd, 3JHH = 4.7 Hz, 3JHH = 3.4 Hz, 2JHH = 12.7 Hz, 1 H, CH2), 2.34 (s, 3 H, CH3), 4.18 (dd, 3JHH =

286
4.7 Hz, 3JHH = 12.7 Hz, 1 H, CH), 4.69 (dd, 3JHH = 3.4 Hz, 3JHH = 11.5 Hz, 1 H, CH), 6.36 (ddd 3JHH =
10.4 Hz, 3JHH = 7.6 Hz, 4JHP = 3.0 Hz, 1 H), 6.81-7.15 (m, NH and 11 H), 7.44-7.78 (m, 10 H) ppm.
13C RMN (75 MHz, CDCl3): 3), 41.2 (CH2), 44.3 (HC), 56.3 (HC), 111.0 (d, 1JCP = 105.0
Hz, C), 114.9 (d, 3JCP = 13.1 Hz, HC), 115.3 (d, 3JCF = 21.3 Hz, 2 HC), 126.3 (d, 3JCP = 7.5 Hz, C), 127.6-
129.5 (m, 12 HC), 131.8-133.5 (m, 6 HC and 2 C), 136.5 (C), 139.8 (C), 141.1 (C), 149.0 (C), 162.0
(d, 1JCF = 243.8 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-116.3 o -116.1 ppm.
HRMS (EI): calcula ed o C34H29FNOP [M]+ 517.1971; ound 517.1982.
2,4-Bis(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine oxide (6h).
The gene al p ocedu e B was ollowed using 4- luo obenzaldehyde (1.08 mL, 10 mmol) and 4-
luo os y ene (1.44 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 24 h, a o ding
he compound 6h (2.30 g, 44%) as a whi e solid.
Mel ing poin : 183-185oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.90 (ddd, 3JHH = 12.4 Hz, 3JHH = 11.3 Hz, 2JHH = 12.7 Hz, 1 H, CH2),
2.14-2.20 (m, 1 H, CH2), 4.22 (dd, 3JHH = 4.3 Hz, 3JHH = 12.4 Hz, 1 H, CH), 4.70 (dd, 3JHH = 3.2 Hz, 3JHH
= 11.3 Hz, 1 H, CH), 6.37 (ddd 3JHH = 7.6 Hz, 3JHH = 7.4 Hz, 4JHP = 3.0 Hz, 1 H), 6.62-7.19 (m, NH and
11 H), 7.44-7.78 (m, 9 H) ppm.
13C RMN (75 MHz, CDCl3): 2), 44.0 (HC), 56.2 (HC), 111.3 (d, 1JCP = 105.5 Hz, C), 114.9
(d, 3JCP = 13.8 Hz, HC), 115.4 (d, 3JCF = 21.3 Hz, 2 HC), 115.6 (d, 3JCF = 21.3 Hz, 2 HC), 125.8 (d, 3JCP
= 8.0 Hz, C), 127.6-133.6 (m, 16 HC and 2 C), 139.6 (d, 4JCF = 3.1 Hz, C), 139.8 (d, 4JCF = 3.2 Hz, C),
149.9 (d, 2JCP = 4.6 Hz, C), 161.8 (d, 1JCF = 245.0 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-116.5 o -116.4 and -116.0 o -115.8 (m)
ppm.
HRMS (EI): calcula ed o C33H26F2NOP [M]+ 521.1720; ound 521.1727.
287
2-(3,4-di luo ophenyl)-4-(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-8-yl)diphenylphosphine
oxide (6i).
The gene al p ocedu e A was ollowed using 3,4-di luo obenzaldehyde (1.10 mL, 10 mmol) and
4- luo os y ene (1.44 mL, 12 mmol). The eac ion was hea ed o CHCl3 e lux o 36 h, a o ding
he compound 6i (2.64 g, 49%) as a whi e solid.
Mel ing poin : 167-169oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.72 (s, 1 H, NH), 1.88 (ddd, 3JHH = 11.7 Hz, 3JHH = 11.4 Hz, 2JHH =
11.4 Hz, 1 H, CH2), 2.15-2.20 (m, 1 H, CH2), 4.21 (dd, 3JHH = 4.6 Hz, 3JHH = 11.7 Hz, 1 H, CH), 4.67
(dd, 3JHH = 3.4 Hz, 3JHH = 11.7 Hz, 1 H, CH), 6.40 (ddd 3JHH = 10.4 Hz, 3JHH = 7.5 Hz, 4JHP = 3.0 Hz, 1
H), 6.64-7.14 (m, 9 H), 7.46-7.77 (m, 10 H) ppm.
13C RMN (75 MHz, CDCl3): 2), 43.9 (HC), 55.9 (HC), 111.8 (d, 1JCP = 103.7 Hz, C), 114.9
(d, 2JCF = 17.7 Hz, HC), 115.4 (d, 3JCP = 13.6 Hz, HC), 115.7 (d, 3JCF = 20.2 Hz, 2 HC), 117.3 (d, 2JCF =
17.7 Hz, HC), 121.1 (HC), 125.7 (C), 128.6-133.3 (m, 14 HC and 2 C), 139.6 (C), 141.0 (C), 149.4
(Dd, 1JCF = 246.5 Hz, 2JCF = 12.8 Hz, C-F), 161.8 (d, 1JCF = 243.4 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-116.2 o -116.1, -137.8 o -137.6 and -
115.9 o -115.8 (m) ppm.
HRMS (EI): calcula ed o C33H25F3NOP [M]+ 539.1626; ound 539.1636.
288
Gene al p ocedu e o he p epa a ion o quinolin-8-yl phospine oxides 7
A) Oxida ion o compounds 6 wi h DDQ
DDQ (0.45 g, 2 mmol, 2 equi .) was added o a solu ion o he co esponding 1,2,3,4-
e ahyd oquinolin-8-yl phosphine oxide 6 (1 mmol, 1 equi .) in chlo o o m (5 mL) and he
eac ion mix u e was s i ed and hea ed o e lux un il TLC, 31P NMR and 1H NMR spec oscopy
analysis indica ed he consump ion o he 1,2,3,4- e ahyd oquinolin-8-yl phosphine oxide 6 and
he subsequen o ma ion o he quinolin-8-yl phospine oxide 7 (2 h). The o med eac ion b u e
was il e ed o , d ied in acuo and pu i ied by silica gel lash column ch oma og aphy (40% o
e hyl ace a e in hexane) and a u he ec ys alliza ion in E OAc/hexane o yield quinolin-8-yl
phosphine oxides 7.
B) One-po Po a o eac ion wi h ace ylenes (Rou e C).
The co esponding ace ylene 8 (2 mmol, 1 equi .) and 2 equi alen s o BF3·E 2O (0.5 mL, 4 mmol)
we e added o a solu ion o he in si u p epa ed aldimine 4 (2 mmol) in d y CHCl3 and he mix u e
was s i ed a e lux du ing 2 h. Then, he eac ion was allow o each oom empe a u e and
DDQ (0.91 g, 4 mmol, 2 equi .) was added, o subsequen ly hea again o e lux o 30 minu es.
The eac ion mix u e was hen washed wi h an aqueous solu ion o
NaOH 2M (25 mL) and wa e (25 mL), ex ac ed wi h dichlo ome hane (2 × 25 mL), and d ied
o e anhyd ous MgSO4. Upon he emo al o he sol en unde acuum, he esul an c ude oil
was pu i ied by silica gel lash column ch oma og aphy using
ace a e in hexane o a o d quinolin-8-yl phospine oxides 7.
(2-(2-Me hoxyphenyl)-4-phenylquinolin-8-yl)diphenylphosphine oxide (7a).
The gene al p ocedu e A (oxida ion o compounds 6 wi h DDQ) was employed wi h 6a (0.52 g, 1
mmol) o a o d 7a (0.38 g, 74%) as a whi e solid.
Mel ing poin : 267-269oC (e hyl ace a e/hexane).
289
1H RMN (300 MHz, CDCl3): = 3.80 (s, 3 H, OCH3), 6.52 (dd J = 1.6 Hz, J = 7.6 Hz, 1 H), 6.69-6.75
(m, 1 H), 6.94 (d, 3JHH = 8.7 Hz, 1 H), 7.20-7.66 (m, 13 H), 7.89 (dd, 3JHP = 12.5 Hz, 3JHH = 7.0 Hz, 4
H), 7.96 (s, 1 H), 8.12 (d, 3JHH = 9.0 Hz, 1 H), 8.67 (ddd, 3JHP = 13.9 Hz, 3JHH = 7.1 Hz, 4JHH = 1.6 Hz,
1 H) ppm.
13C RMN (75 MHz, CDCl3): 3), 111.3 (HC), 120.9 (HC), 121.0-138.5 (m, 21 HC and 6
C), 147.7 (d, 2JCP = 5.6 Hz, C), 155.5 (C), 157.5 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C34H26NO2P [M]+ 511.1701; ound 511.1719.
4-(8-(diphenylphospho yl)-4-phenylquinolin-2-yl)phenyl die hyl phospha e (7b).
The gene al p ocedu e A (oxida ion o compounds 6 wi h DDQ) was employed wi h 6b (0.64 g, 1
mmol) o a o d 7b (0.41 g, 65%) as a whi e solid.
Mel ing poin : 128-130oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.36-1.41 (m, 6 H, 2 CH3), 4.20-4.30 (m, 4 H, 2 CH2), 7.11-7.15 (m,
2 H), 7.36-7.65 (m, 14 H), 7.75 (s, 1 H), 7.88-7.95 (m, 4 H), 8.15 (d, 3JHH = 8.4 Hz, 1 H), 8.64 (ddd,
3JHP = 13.9 Hz, 3JHH = 7.1 Hz, 4JHH = 1.5 Hz, 1 H) ppm.
13C RMN (75 MHz, CDCl3): 16.3 (2 CH3), 64.9 (2 CH2), 119.1 (HC), 120. (HC), 120.1 (HC),
120.4 (C), 126.0-132.3 (m, 19 HC and 2 C), 134.2 (d, 1JCP = 108.2 Hz, 2 C), 135.5 (C), 138.0 (d, 3JCP
= 5.8 Hz, HC), 148.2 (d, 2JCP = 5.7 Hz, C), 149.8 (C), 152.3 (d, 2JCP = 6.7 Hz, C), 154.8 (C) ppm.
31P NMR (120 MHz, CDCl3)-5.4, 28.9 ppm.
HRMS (EI): calcula ed o C37H33NO5P2 [M]+ 633.1834; ound 633.1849.
296
VI-1.3. Syn hesis o hyb id 1,2,3,4- e ahyd oquinolinyl and quinolinyl dialkyl phosphona es
P epa a ion o anilines subs i u ed wi h dialkyl phosphona e 1b, 1c and 1d
Die hyl (2-aminophenyl)phosphona e 1b.
To a suspension o 2-b omoaniline (4.30 g, 25 mmol, 1 equi .), die hyl
phosphi e (3.86 mL, 30 mmol, 1.2 equi .) and eshly dis illed ie hlamine
(5.23 mL, 37.5 mmol, 1.5 equi .) in 30 mL o d y deoxydena ed E OH we e
added 5% mol o Pd(OAc)2 (0.28 g) and 15% mol o iphenylphosphine (1.01 g). The eac ion
mix u e was s i ed and hea ed o E OH e lux o 12h and he esul ed eac ion c ude was
pu i ied by silica gel column ch oma og aphy (30% o e hyl ace a e in hexane) and subsequen ly
acuum-e apo a ed o d yness o a o d 15.28 g (59 mmol) o die hyl (2-
aminophenyl)phosphona e 1b as a yellow solid (73%); mp 58 ).
Diisop opyl (2-ni ophenyl)phosphona e.
1,2-Dini obenzene (12.61 g, 75 mmol, 1 equi .) and iisop opyl phosphi e
(22.21 mL, 90 mmol, 1.2 equi .) we e dissol ed in 70 mL o d y
dime hyl o mamide (DMF) and he eac ion mix u e was main ained s i ing a MeCN e lux o
12 h. The esul an eac ion c ude was il e ed o , d ied in acuo, and pu i ied by silica gel
column ch oma og aphy (10% o e hyl ace a e in hexane) o yield 17.88 g (62.25 mmol) o
diisop opyl (2-ni ophenyl)phosphona e as a b own oil (83%); R = 0.39 (50:50 E OAc/hexane).
Diisop opyl (2-aminophenyl)phosphona e 1c.
(Diisop opyl (2-ni ophenyl)phosphona e (19.40 g, 60 mmol) was
hyd ogena ed wi h a spoon o RANEY® Nickel (app ox. 5 g) in 60 mL
o MeOH a 80 psi a oom empe a u e o 12 h. The eac ion mix u e was
hen il e ed o h ough a pad o celli e and e apo a ed o d yness o ob ain (2-
aminophenyl)diphenylphosphine oxide 1a (17.59 g, 59.97 mmol) as a whi e solid (99%).

297
Die hyl (4-aminophenyl)phosphona e 1d.
To a suspension o 4-b omoaniline (4.30 g, 25 mmol, 1 equi .), ie hylphosphi e
(17.15 ml, 100 mmol, 4 equi .), TBAB ( e abu ylammonium b omide, 8.06 g, 25
mmol, 1 equi .) and eshly dis illed ie hylamine (6.97 mL, 50 mmol, 2 equi .) in
30 mL o deoxygena ed dis illed wa e , 4.4% mol o palladium(II) chlo ide (0.20g)
we e added and he eac ion mix u e was s i ed a 100oC o 8h. The ob ained eac ion c ude
was pu i ied by silica gel column ch oma og aphy (30% o e hyl ace a e in hexane) and acuum-
e apo a ed o d yness, a o ding 4.15 g (18.11 mmol) o die hyl (4-aminophenyl)phosphona e
1d as a whi e solid (72%); mp 125 127oC (e hyl ace a e/hexane).
Gene al p ocedu e o he p epa a ion o dialkyl quinolin-8-ylphosphona es 13
A) S ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e
S y enes 3 (1.2 mmol, 1.2 equi .) and 2 equi alen o BF3·E 2O (0.25 mL, 2 mmol) we e added o
a solu ion o he co esponding in si u p epa ed aldimine 4 (1 mmol) in CHCl3 (3 mL). The mix u e
was s i ed and hea ed o CHCl3 e lux un il TLC, 31P NMR and 1H NMR spec oscopy analysis
indica ed he disappea ance o he aldimine. Then, he eac ion was allow o each oom
empe a u e and DDQ (0.45 g, 2 mmol, 2 equi .) was added, o subsequen ly hea he eac ion
again o e lux o 2 h. The eac ion mix u e was hen dilu ed in 10 mL o dichlo ome hane,
washed wi h a 2M aqueous solu ion o NaOH (25 mL) and wa e (25 mL), ex ac ed wi h
dichlo ome hane (2 × 10 mL), and d ied o e anhyd ous MgSO4. The sol en was emo ed unde
acuum a o ding an oil ha was pu i ied by silica gel lash column ch oma og aphy using an
elu ion o 20 80% e hyl ace a e-hexane o a o d dialkyl quinolin-8-yl phosphona es 13.
B) MCR Po a o -DDQ oxida ion sequen ial p ocedu e
A mix u e o dialkyl (4-aminophenyl)phosphona e 1b/1c (1 mmol, 1 equi .), eshly dis illed
aldehydes 2 (1 mmol, 1 equi .), s y enes 3 (1.2 mmol, 1.2 equi .) and 2 equi alen s o BF3·E 2O
(0.25 mL, 2 mmol) dissol ed in CHCl3 (3 mL) was s i ed and hea ed o e lux in he p esence o
molecula sie es (4 Å), un il TLC, 31P NMR and 1H NMR spec oscopy analysis indica ed he
consump ion o he s a ing ma e ials (16 h). Then, he eac ion was allow o each oom
empe a u e and DDQ (0.45 g, 2 mmol, 2 equi .) was added, o subsequen ly hea he eac ion
again o e lux o 2 h. The eac ion mix u e was hen dilu ed in 10 mL o dichlo ome hane,
washed wi h a 2M aqueous solu ion o NaOH (25 mL) and wa e (25 mL), ex ac ed wi h
dichlo ome hane (2 × 10 mL), and d ied o e anhyd ous MgSO4. The sol en was emo ed unde
acuum a o ding an oil ha was pu i ied by silica gel lash column ch oma og aphy using an
elu ion o 20 80% e hyl ace a e-hexane o a o d dialkyl quinolin-8-yl phosphona es 13.
298
Die hyl (2,4-diphenylquinolin-8-yl)phosphona e (13a).
The gene al p ocedu e A (s ep-by s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), benzaldehyde (0.10 mL, 1 mmol),
s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.31 g, 74%) o a whi e solid iden i ied as
13a.
Mel ing poin : 118-120oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.32-1.36 (m, 6 H, 2 CH3), 4.26-4.44 (m, 4 H, 2 CH2), 7.45-7.57 (m,
9 H), 7.92 (s, 1 H), 8.06-8.08 (d, 3JHH = 8.4 Hz, 1 H) 8.37-8.43 (m, 3 H) ppm.
13C RMN (75 MHz, CDCl3): 16.7 (d, 3JCP = 6.6 Hz, 2 CH3), 62.5 (d, 2JCP = 5.7 Hz, 2 CH2), 119.3
(HC), 125.5 (d, 3JCP = 16.2 Hz, HC), 126.0 (d, 3JCP = 10.7 Hz, C), 128.0 (2 HC), 128.6 (d, 1JCP = 193.7
Hz, C), 128.7 (HC), 128.8 (2 HC), 128.9 (2 HC), 129.7 (2 HC), 129.9 (HC), 130.7 (HC), 136.9 (d, 2JCP
= 7.4 Hz, HC), 138.2 (C), 139.0 (C), 148.8 (d, 2JCP = 6.7 Hz, C), 149.6 (C), 156.6 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C25H24NO3P [M]+ 417.1494; ound 417.1494.
Die hyl (2-(2-me hoxyphenyl)-4-phenylquinolin-8-yl)phosphona e (13b).
The gene al p ocedu e A (s ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), o-anisaldehyde (0.12 mL, 1
mmol), s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.21 g, 48%) o a whi e solid
iden i ied as 13b.
Mel ing poin : 121-123oC (e hyl ace a e/hexane).
299
1H RMN (400 MHz, CDCl3): = 1.25-1.28 (m, 6 H, 2 CH3), 3.81 (s, 3 H, OCH3), 4.17-4.35 (m, 4 H, 2
OCH2), 6.95-6.97 (m, 2 H), 7.36-7.49 (m, 6 H), 7.77 (s, 1 H), 7.95-7.97 (d, 3JHH = 8.4 Hz, 1 H), 8.26-
8.31 (m, 3 H) ppm.
13C RMN (100 MHz, CDCl3): 16.5 (d, 3JCP = 6.6 Hz, 2 CH3), 55.4 (OCH3), 62.3 (d, 2JCP = 5.5 Hz, 2
OCH2), 114.1 (3 HC), 118.6 (HC), 124.9 (d, 3JCP = 16.2 Hz, HC), 125.6 (d, 3JCP = 10.7 Hz, C), 128.1
(d, 1JCP = 187.9 Hz, C), 128.5 (HC), 128.6 (3 HC), 129.3 (HC), 129.5 (HC), 130.6 (HC), 131.5 (C),
136.7 (d, 2JCP = 7.5 Hz, HC), 138.2 (C), 148.7 (d, 2JCP = 6.7 Hz, C), 149.2 (C), 156.1 (C), 161.1 (C)
ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C26H26NO4P [M]+ 447.1599; ound 447.1597.
Die hyl (2-(3-me hoxyphenyl)-4-phenylquinolin-8-yl)phosphona e (13c).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1b (0.23 g, 1 mmol), m-anisaldehyde (0.12 mL, 1 mmol), s y ene
(0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.42 g, 89%) o a whi e solid iden i ied as 13c.
Mel ing poin : 127-129oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.25-1.28 (m, 6 H, 2 CH3), 3.81 (s, 3 H, OCH3), 4.17-4.35 (m, 4 H, 2
OCH2), 6.95-6.97 (m, 2 H), 7.36-7.49 (m, 6 H), 7.77 (s, 1 H), 7.95-7.97 (d, 3JHH = 8.4 Hz, 1 H), 8.26-
8.31 (m, 3 H) ppm.
13C RMN (75 MHz, CDCl3): 16.5 (d, 3JCP = 6.6 Hz, 2 CH3), 55.4 (OCH3), 62.3 (d, 2JCP = 5.5 Hz, 2
OCH2), 114.1 (3 HC), 118.6 (HC), 124.9 (d, 3JCP = 16.2 Hz, HC), 125.6 (d, 3JCP = 10.7 Hz, C), 128.1
(d, 1JCP = 187.9 Hz, C), 128.5 (HC), 128.6 (3 HC), 129.3 (HC), 129.5 (HC), 130.6 (HC), 131.5 (C),
136.7 (d, 2JCP = 7.5 Hz, HC), 138.2 (C), 148.7 (d, 2JCP = 6.7 Hz, C), 149.2 (C), 156.1 (C), 161.1 (C)
ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C26H26F3NO4P [M]+ 447.1599; ound 447.1597.
300
Die hyl (2-(4-me hoxyphenyl)-4-phenylquinolin-8-yl)phosphona e (13d).
The gene al p ocedu e A (s ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), p-anisaldehyde (0.12 mL, 1
mmol), s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.18 g, 41%) o a whi e solid
iden i ied as 13d.
Mel ing poin : 120-122oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.23-1.27 (m, 6 H, 2 CH3), 3.86 (s, 3 H, OCH3), 4.16-4.35 (m, 4 H, 2
OCH2), 6.93-6.95 (m, 1 H), 7.31-7.48 (m, 7 H), 7.79-7.82 (m, 2 H), 7.98-8.00 (m, 2 H), 8.28-8.34
(m, H) ppm.
13C RMN (100 MHz, CDCl3): 16.5 (d, 3JCP = 6.7 Hz, 2 CH3), 55.4 (OCH3), 62.3 (d, 2JCP = 5.7 Hz,
2 OCH2), 112.6 (HC), 116.3 (HC), 119.2 (HC), 120.0 (HC), 125.4 (d, 3JCP = 16.3 Hz, HC), 125.9 (d,
2JCP = 10.7 Hz, C), 128.5 (d, 1JCP = 188.5 Hz, C), 128.6 (HC), 128.7 (2 HC), 129.5 (2 HC), 129.6 (HC),
130.6 (HC), 136.9 (d, 2JCP = 7.5 Hz, HC), 138.0 (C), 140.3 (C), 148.5 (d, 2JCP = 6.8 Hz, C), 149.4 (C),
156.1 (C), 160.1 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C26H26NO4P [M]+ 447.1599; ound 447.1597.
301
Die hyl (2-(4-me hoxyphenyl)-4-phenylquinolin-8-yl)phosphona e (13e).
The gene al p ocedu e A (s ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), die hyl (4- o mylphenyl)
phospha e (0.26 mL, 1 mmol), s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.36 g, 64%)
o a b own oil iden i ied as 13e.
R : 0.22 (20:80 e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.31-1.39 (m, 12 H, 4 CH3), 4.20-4.40 (m, 8 H, 4 CH2), 7.26-7.53
(m, 8 H), 7.86 (s, 1 H), 8.04-8.07 (m, 1 H), 8.33-8.40 (m, 3 H) ppm
13C RMN (75 MHz, CDCl3): 16.2 (d, 3JCP = 6.5 Hz, 2 CH3), 16.6 (d, 3JCP = 6.4 Hz, 2 CH3), 62.5 (d,
2JCP = 5.6 Hz, 2 CH2), 64.9 (d, 2JCP = 5.9 Hz, 2 CH2), 118.9 (HC), 125.4-138.0 (m, 4 C and 12 HC),
148.7 ppm (d, 2JCP = 6.7 Hz, C), 149.7 (m, C), 152.3 (m, C), 155.5 (C) ppm.
31P NMR (120 MHz, CDCl3)-5.4 ppm.
HRMS (EI): calcula ed o C29H33NO7P2 [M]+ 569,1732; ound 569,1732.
Die hyl (2-(naph halen-1-yl)-4-phenylquinolin-8-yl)phosphona e (13 ).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1b (0.23 g, 1 mmol), 1-nap haldehyde (0.13 mL, 1 mmol),
s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.28 g, 60%) o a yellow solid iden i ied as
13 .
Mel ing poin : 140-142oC (e hyl ace a e/hexane).

302
1H RMN (400 MHz, CDCl3): = 1.16-1.20 (m, 6 H, 2 CH3), 4.19-4.30 (m, 4 H, 2 CH2), 7.51-7.62 (m,
9 H), 7.77 (s, 1 H), 7.86-7.97 (m, 3 H), 8.15-8.17 (d, 3JHH = 8.4 Hz, 1 H), 8.39-8.44 (m, 1 H), 8.58-
8.60 (d, 3JHH = 8.3 Hz, 1 H) ppm.
13C RMN (100 MHz, CDCl3): 16.5 (d, 3JCP = 6.1 Hz, 2 CH3), 62.9 (d, 2JCP = 5.3 Hz, 2 CH2), 124.0
(HC), 125.4 (HC), 125.7 (C), 125.8 (HC), 125.9 (HC), 126.2 (HC), 126.5 (HC), 126.9 (HC), 128.4 (HC),
128.8 (HC), 128.9 (2 HC), 129.5 (d, 1JCP = 191.1 Hz, C), 129.6 (HC), 129.8 (2 HC), 130.6 (HC), 131.1
(C), 134.0 (C), 136.5 ppm (d, 2JCP = 6.6 Hz, HC), 137.9 (C), 138.1 (C), 148.7 ppm (d, 2JCP = 5.8 Hz,
C), 149.2 (C), 159.0 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C29H26NO3P [M]+ 467.1650; ound 467.1651.
Die hyl (2-(naph halen-2-yl)-4-phenylquinolin-8-yl)phosphona e (13g).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1b (0.23 g, 1 mmol), 2-nap haldehyde (0.16 g, 1 mmol), s y ene
(0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.39 g, 83%) o a yellow solid iden i ied as 13g.
Mel ing poin : 135-137oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): 1.34-1.39 (m, 6 H, 2 CH3), 4.30-4.48 (m, 4 H, 2 CH2), 7.53-7.58 (m,
8 H), 7.90-8.11 (m, 5 H), 8.38-8.46 (m, 1 H), 8.65-8.75 (m, 2 H) ppm.
13C RMN (75 MHz, CDCl3): = 16.7 (d, 3JCP = 6.5 Hz, 2 CH3), 62.6 (d, 2JCP = 5.3 Hz, 2 CH2), 119.5
(HC), 125.5 (HC), 125.6 (HC), 125.7 (HC), 126.1 (d, 3JCP = 10.6 Hz, C), 126.5 (HC), 127.1 (HC), 127.4
(HC), 127.6 (HC), 128.6 (HC), 128.7 (d, 1JCP = 187.5 Hz, C), 128.8 (HC), 128.9 (2 HC), 129.0 (HC),
129.7 (2 HC), 130.7 (HC), 133.5 (C), 134.3 (C), 136.5 (C), 137.0 (d, 2JCP = 7.3 Hz, HC), 138.2 (C),
148.9 (d, 2JCP = 6.3 Hz C), 149.7 (C), 156.5 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C29H26NO3P [M]+ 467.1650; ound 467.1649.
303
Die hyl (2-(3,4-di luo ophenyl)-4-phenylquinolin-8-yl)phosphona e (13h).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1b (0.23 g, 1 mmol), 3,4-di luo obenzaldehyde (0.11 g, 1 mmol),
s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.34 g, 76%) o a whi e solid iden i ied as
13h.
Mel ing poin : 153-155oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): 1.25-1.29 (m, 6 H, 2 CH3), 4.19-4.30 (m, 4 H, 2 CH2), 7.18-7.20 (m,
1 H), 7.42-7.44 (m, 6 H), 7.74 (s, 1 H), 7.97-8.01 (m, 2 H), 8.18-8.33 (m, 2 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 62.4 (d, 2JCP = 5.8 Hz, 2 CH2), 116.9
(d, 2JCF = 18.6 Hz, HC), 117.5 (d, 2JCF = 17.5 Hz, HC),118.5 (HC), 123.8 (dd, 3JCF = 6.6 Hz, 4JC-F = 3.3
Hz, HC), 125.8 (d, 3JCP = 16.2 Hz, HC), 126.0 (d, 3JCP = 10.6 Hz, C), 128.5 (d, 1JCP = 188.6 Hz, C), 129.5
(2 HC), 136.1.3 (dd, 3JCF = 5.7 Hz, 4JCF = 3.6 Hz, C), 137.2 (d, 2JCP = 7.6 Hz, HC), 137.8 (C), 148.5 (d,
2JCP = 6.6 Hz, C), 150.2 (C), 150.9 (dd, 1JCF = 248.6 Hz, 2JCF = 12.2 Hz, C), 151.7 (dd, 1JCF = 250.5 Hz,
2JCF = 12.3 Hz, C), 154.1 (C) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-136.6 o -136.5 (m) and -137.5 o -137.4
(m) ppm.
HRMS (EI): calcula ed o C25H22F2NO3P [M]+ 453.1305; ound 453.1321.
304
Die hyl (2-(4-me hoxyphenyl)-4-phenylquinolin-8-yl)phosphona e (13i).
The gene al p ocedu e A (s ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), benzaldehyde (0.10 mL, 1 mmol),
4-me hyls y ene (0.16 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.24 g, 54%) o a whi e solid
iden i ied as 13i.
Mel ing poin : 125-127oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.31-1.36 (m, 6 H, 2 CH3), 2.48 (s, 3 H, CH3), 4.27-4.43 (m, 4 H, 2
CH2), 7.26-7.35 (m, 10 H), 7.91 (s, 1 H), 8.09-8.02 (m, 1 H), 8.35-8.42 (m, 3 H) ppm.
13C RMN (75 MHz, CDCl3): 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 21.4 (CH3), 62.5 (d, 2JCP = 5.8 Hz, 2
CH2), 119.2 (HC), 125.4 (d, 3JCP = 16.1 Hz, HC), 126.1 (d, 2JCP = 10.7 Hz, C), 128.0 (2HC), 128.8 (2HC),
127.3-130.8 (m, 1 C and 7 HC), 135.2 (C), 136.9 (d, 3JCP = 10.7 Hz, C), 138.7 (C), 138,9 (C), 148.7
(m, C), 149.8 (C), 156.5 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C26H26NO3P [M]+ 431,1650; ound 431,1651.
Die hyl (2-(4- luo ophenyl)-4-(p- olyl)quinolin-8-yl)phosphona e (13j).
The gene al p ocedu e A (s ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), 4- luo obenzaldehyde (0.11 mL,
1 mmol), 4-me hyls y ene (0.16 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.23 g, 52%) o a whi e
solid iden i ied as 13j.
Mel ing poin : 139-141oC (e hyl ace a e/hexane).
305
1H RMN (300 MHz, CDCl3): = 1.32-1.36 (m, 6 H, 2 CH3), 2.48 (s, 3 H, CH3), 4.22-4.44 (m, 4 H,
2 CH2), 7.17-7.23 (m, 2 H), 7.35-7.43 (m, 4 H), 7.47-7.53 (m, 1 H), 7.86 (s, 1 H), 8.08-8.11 (m, 1
H), 8.32-8.40 (m, 3 H) ppm.
13C RMN (75 MHz, CDCl3): 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 21.5 (CH3), 62.5 (m, 2 CH2), 115.9 (d,
2JCF = 21.7 Hz, 2 HC), 118.9 (HC), 125.5 (d, 3JCP = 18.0 Hz, HC), 126.0 (d, 3JCP = 10.7 Hz, C), 128.2 (d,
1JCP = 166.3 Hz, C), 129.6 (3 HC), 129.8 (HC), 129.9 (HC), 130.9 (2 HC), 135.1 (2 C), 136.9 (HC),
138.9 (C), 148.7 (C), 150.1 (d, 2JCP = 17.2 Hz, C), 155.4 (C), 164.2 (d, 1JCF = 249.8 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-112.1 o -111.9 (m) ppm.
HRMS (EI): calcula ed o C26H25FNO3P [M]+ 449.1556; ound 449.1562.
Die hyl (2-(3,4-di luo ophenyl)-4-(p- olyl)quinolin-8-yl)phosphona e (13k).
The gene al p ocedu e A (s ep-by-s ep Po a o -DDQ oxida ion sequen ial p ocedu e) was
ollowed using aminophenylphosphona e 1b (0.23 g, 1 mmol), 3,4-di luo obenzaldehyde (0.11
g, 1 mmol), 4-me hyls y ene (0.16 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.32 g, 47%) o a whi e
solid iden i ied as 13k.
Mel ing poin : 133-135oC (e hyl ace a e/hexane).
1H RMN (300 MHz, CDCl3): = 1.34-1.39 (m, 6 H, 2 CH3), 2.49 (s, 1 H, CH3), 4.21-4.43 (m, 4 H, 2
CH2), 7.28-7.31 (m, 1 H), 7.36-7.43 (m, 4 H), 7.49-7.56 (m, 1 H), 7.82 (s, 1 H), 8.07-8.12 (m, 2 H),
8.26-8.43 (m, 2 H) ppm.
13C RMN (75 MHz, CDCl3): 16.7 (d, 3JCP = 6.5Hz, 2 CH3), 21.5 (CH3), 62.4 (d, 2JCP = 5.8 Hz, 2
CH2), 117.0 (d, 2JCF = 18.9 Hz, HC), 117.6 (d, 2JCF = 17.4 Hz, HC),118.6 (HC), 123.9 (dd, 3JCF = 6.5 Hz,
4JC-F = 3.3 Hz, HC), 125.8 (d, 3JCP = 16.2 Hz, HC), 126.2 (d, 3JCP = 10.6 Hz, C), 128.5 (d, 1JCP = 188.5
Hz, C), 129.5 (2 HC), 129.6 (2 HC), 130.9 (C), 135.0 (C), 136.3 (C), 137.2 (d, 2JCP = 7.6 Hz, HC), 139.0
(C), 148.7 (d, 2JCP = 6.6 Hz, C), 150.2 (C), 150.8 (dd, 1JCF = 247.4 Hz, 2JCF = 12.1 Hz, C), 151.7 (dd, 1JCF
= 250.7 Hz, 2JCF = 12.3 Hz, C), 153.5 (C) ppm.
312
Diisop opyl (2-(3,4-di luo ophenyl)-4-(p- olyl)quinolin-8-yl)phosphona e (13 ).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1c (0.26 g, 1 mmol), 3,4-di luo obenzaldehyde (0.11 mL, 1
mmol), 4-me hyls y ene (0.16 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.19 g, 39%) o a whi e
solid iden i ied as 13 .
Mel ing poin : 140-142oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.15 (d, 3JHH = 6.2 Hz, 2 CH3), 1.34 (d, 3JHH = 6.2 Hz, 2 CH3), 2.39
(CH3), 4.88-4.96 (m, 2 H, 2 CH), 7.16-7.23 (m, 1 H), 7.26-7.33 (m, 4 H), 7.40-7.44 (m, 1 H), 7.72 (s,
1 H), 7.99-8.02 (m, 2 H), 8.23-8.36 (m, 2 H) ppm.
13C RMN (100 MHz, CDCl3): = 21.2 (CH3), 23.9 (d, 3JCP = 5.0 Hz, 2 CH3), 24.3 (d, 3JCP = 4.8 Hz, 2
CH3), 70.7 (d, 2JCP = 5.9 Hz, 2 CH), 116.8 (d, 2JCF = 18.7 Hz, HC), 117.3 (d, 2JCF = 17.5 Hz, HC), 118.2
(HC), 123.6 (dd, 3JCF = 6.6 Hz, 4JCF = 3.4 Hz, HC), 125.5 (d, 3JCP = 16.2 Hz, HC), 126.0 (d, 3JCP = 10.4
Hz, C), 129.4 (2 HC), 129.4 (2 HC), 129.5 (d, 1JCP = 188.1 Hz, C), 130.5 (HC), 134.9 (HC), 136.2 (dd,
3JCF = 5.8 Hz, 4JCF = 3.6 Hz, C), 137.1 (d, 3JCF = 7.7 Hz, HC), 138.7 (C), 148.4 (d, 2JCP = 6.4 Hz, C), 149.9
(C), 150.8 (dd, 2JCF = 12.6 Hz, 1JCF = 247.6 Hz, C), 151.6 (dd, 2JCF = 12.7 Hz, 1JCF = 251.3 Hz, C), 153.7
(C) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-136.9 o -136.7 (m) and -137.9 o 137.7
(m) ppm.
HRMS (EI): calcula ed o C28H28F2NO3P [M]+ 435.1400; ound 435.1415.

313
Diisop opyl (2,4-bis(4- luo ophenyl)quinolin-8-yl)phosphona e (13s).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1c (0.26 g, 1 mmol), 4- luo obenzaldehyde (0.11 mL, 1 mmol),
4- luo os y ene (0.14 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.30 g, 68%) o a whi e solid
iden i ied as 13s.
Mel ing poin : 113-115oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.15 (d, 3JHH = 6.2 Hz, 2 CH3), 1.35 (d, 3JHH = 6.1 Hz, 2 CH3), 4.90-
4.99 (m, 2 H, 2 CH), 7.11-7.20 (m, 4 H), 7.40-7.46 (m, 3 H), 7.75 (s, 1 H), 7.91-7.93 (m, 1 H), 8.29-
8.35 (m, 3 H) ppm.
13C RMN (100 MHz, CDCl3): 23.9 (d, 3JCP = 5.1 Hz, 2 CH3), 24.3 (d, 3JCP = 3.8 Hz, 2 CH3), 70.7 (d,
2JCP = 6.0 Hz, 2 CH), 115.6 (d, 2JCF = 21.5 Hz, 2 HC), 115.8 (d, 2JCF = 21.6 Hz, 2 HC), 118.6 (HC), 125.5
(d, 3JCP = 16.1 Hz, HC), 125.7 (d, 3JCP = 10.6 Hz, C), 129.6 (d, 1JCP = 189.7 Hz, C), 131.2 (d, 3JCF = 8.1
Hz, 2 HC), 134.0 (C), 134.9 (C), 136.8 (d, 2JCP = 7.4 Hz, HC), 148.4 (C), 148.5 (d, 2JCP = 6.8 Hz, C),
150.1 (C), 163.0 (d, 1JCF = 248.3 Hz, C-F), 164.0 (d, 1JCF = 249.7 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-112.2 o -112.0 (m) and -113.4 o -113.2
(m) ppm.
HRMS (EI): calcula ed o C27H26F2NO3P [M]+ 481.1618; ound 481.1632.
314
Diisop opyl (2-(3,4-di luo ophenyl)-4-(4- luo ophenyl)quinolin-8-yl)phosphona e (13 ).
The gene al p ocedu e B (MCR Po a o -DDQ oxida ion sequen ial p ocedu e) was ollowed
using aminophenylphosphona e 1c (0.26 g, 1 mmol), 3,4-di luo obenzaldehyde (0.11 mL, 1
mmol), 4- luo os y ene (0.44 mL, 1.2 mmol) and BF3·E 2O, a o ding (0.19 g, 88%) o a whi e solid
iden i ied as 13 .
Mel ing poin : 144-146oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.06 (d, 3JHH = 6.2 Hz, 2 CH3), 1.25 (d, 3JHH = 6.2 Hz, 2 CH3), 4.79-
4.87 (m, 2 H, 2 CH), 7.17-7.23 (m, 1 H), 7.40-7.49 (m, 6 H), 7.74 (s, 1 H), 7.95-7.98 (m, 1 H), 8.00-
8.03 (m, H), 8.23-8.28 (m, H), 8.30-8.37 (m, H) ppm.
13C RMN (100 MHz, CDCl3): = 23.8 (d, 3JCP = 5.0 Hz, 2 CH3), 24.1 (d, 3JCP = 3.9 Hz, 2 CH3), 70.7 (d,
2JCP = 6.0 Hz, 2 CH), 115.7 (d, 3JCF = 20.6 Hz, 2 HC), 116.8 (d, 2JCF = 18.7 Hz, HC), 117.2 (d, 2JCF = 17.5
Hz, HC), 118.2 (HC), 123.6 (dd, 3JCF = 6.5 Hz, 4JCF = 3.3 Hz, HC), 125.7 (d, 3JCP = 17.6 Hz, HC), 125.7
(C), 129.4 (d, 1JCP = 189.5 Hz, C), 129.9 (HC), 131.1 (HC), 131.2 (2 HC), 133.6 (C), 135.8 (dd, 3JCF =
5.7 Hz, 4JCF = 3.5 Hz, C), 136.9 (d, 3JCF = 7.6 Hz, HC), 148.3 (d, 2JCP = 6.5 Hz, C), 148.6 (C), 150.6 (dd,
2JCF = 12.6 Hz, 1JCF = 247.8 Hz, C), 151.5 (dd, 2JCF = 12.7 Hz, 1JCF = 251.6 Hz, C), 153.6 (C), 162.9 (d,
1JCF = 248.9 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-113.0 o -112.8 (m), -136.8 o -136.5 (m)
and -137.8 o 137.6 (m) ppm.
HRMS (EI): calcula ed o C27H25F3NO3P [M]+ 499.1524; ound 499.1534.
315
Gene al p ocedu e o he p epa a ion o die hyl 1,2,3,4- e ahyd oquinolin-6-
ylphosphona es 15
MCR Po a o p ocedu e
A mix u e o die hyl (4-aminophenyl)phosphona e 1d (1 mmol, 1 equi .), eshly dis illed
aldehydes 2 (1 mmol, 1 equi .), s y enes 3 (1.2 mmol, 1.2 equi .) and 2 equi alen s o BF3·E 2O
(0.25 mL, 2 mmol) dissol ed in CHCl3 (3 mL) was s i ed and hea ed o e lux in he p esence o
molecula sie es (4 Å), un il TLC, 31P NMR and 1H NMR spec oscopy analysis indica ed he
consump ion o he s a ing ma e ials. The molecula sie es we e emo ed by il a ion and he
esul ing solu ion was dilu ed wi h me hylene chlo ide (15 ml), washed wi h a solu ion o NaOH
2M (25 ml), ex ac ed wi h me hylene chlo ide (2 x 10 mL) and d ied o e MgSO4. Upon in acuo
sol en e apo a ion, he esul an eac ion c ude was u he pu i ied by lash column
ch oma og aphy on silica gel using a g adien o elu ion o 5-70% e hyl ace a e in hexane, o
a o d 1,2,3,4- e ahyd oquinolin-6-yl phosphona es 15.
Die hyl (2-(4- luo ophenyl)-4-phenyl-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e (15a).
The gene al p ocedu e (MCR Po a o ) was ollowed using aminophenylphosphona e 1d (0.26 g,
1 mmol), 4- luo obenzaldehyde (0.11 mL, 1 mmol), s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O,
a o ding (0.36 g, 81%) o a whi e solid iden i ied as 15a.
Mel ing poin : 146-148oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.13-1.24 (m, 6 H, 2 CH3), 1.75 (ddd, 3JHH = 12.3 Hz, 3JHH = 11.3 Hz,
2JHH = 11.4 Hz, 1 H, CH2), 2.25-2.30 (m, 1 H, CH2), 3.83-4.02 (m, 4 H, 2 CH2), 4.26 (dd, 3JHH = 5.0 Hz,
3JHH = 12.8 Hz, 1 H, CH), 4.42 (s, NH), 4.64 (dd, 3JHH = 2.8 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.58-6.61 (m,
7.01-7.07 (m, 3 H), 7.20-7.32 (m, 5 H), 7.38-7.49 (m, 3 H) ppm.
13C RMN (100 MHz, CDCl3): 16.4 (d, 3JCP = 6.7 Hz, 2 CH3), 41.8 (CH2), 44.6 (HC), 56.5 (HC), 61.8
(d, 2JCP = 5.4 Hz, 2 CH2), 113.8(d, 3JCP = 16.1 Hz, HC), 114.8 (d, 1JCP = 196.9 Hz, C), 115.8 (d, 2JCF =
316
21.5 Hz, 2 HC), 124.4 (d, 3JCP = 15.5 Hz, C), 127.0 (HC), 128.2 (HC), 128.3 (2 HC), 128.6 (2 HC),
128.9 (2 HC), 131.8 (d, 2JCP = 11.3 Hz, HC), 133.6 (d, 2JCP = 12.0 Hz, HC), 138.9 (d, 4JCF = 3.1 Hz, C),
144.2 (C), 148.8 (d, 4JCP = 3.0 Hz, C), 162.5 (d, 1JCF = 246.3 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-114.7 o -114.5 (m) ppm.
HRMS (EI): calcula ed o C25H27FNO3P [M]+ 439,1713; ound 439,1725.
Die hyl (2-(3,4-di luo ophenyl)-4-phenyl-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e (15b).
The gene al p ocedu e (MCR Po a o ) was ollowed using aminophenylphosphona e 1d (0.26 g,
1 mmol), 3,4-di luo obenzaldehyde (0.11 mL, 1 mmol), s y ene (0.14 mL, 1.2 mmol) and BF3·E 2O,
a o ding (0.44 g, 97%) o a whi e solid iden i ied as 15b.
Mel ing poin : 164-166oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.19-1.29 (m, 6 H, 2 CH3), 2.17 (ddd, 3JHH = 12.5 Hz, 3JHH = 11.6 Hz,
2JHH = 11.5 Hz, 1 H, CH2), 2.31-2.36 (m, 1 H, CH2), 3.89-4.07 (m, 4 H, 2 CH2), 4.28 (dd, 3JHH = 5.3 Hz,
3JHH = 12.5 Hz, 1 H, CH), 4.52 (s, NH), 4.67 (dd, 3JHH = 2.5 Hz, 3JHH = 11.1 Hz, 1 H, CH), 6.65-6.68 (m,
7.07-7.10 (m, 1 H), 7.18-7.37 (m, 8 H), 7.49-7.54 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): 16.3 (d, 3JCP = 6.8 Hz, 2 CH3), 41.8 (CH2), 44.4 (HC), 56.3 (HC), 61.8
(d, 2JCP = 5.1 Hz, 2 CH2), 114.0 (d, 2JCF = 16.2 Hz, HC), 115.6 (d, 2JCF = 17.6 Hz, HC), 117.6 (d, 2JCF =
17.3 Hz, HC), 122.6 (dd, 3JCF = 6.2 Hz, 4JCF = 3.6 Hz, HC), 124.3 (d, 3JCP = 15.6 Hz, C), 127.1 (HC),
128.6 (2 HC), 128.9 (2 HC), 131.8 (d, 3JCP = 11.2 Hz, HC), 133.6 (d, 2JCP = 11.8 Hz, HC), 140.3 (dd,
3JCF = 5.0 Hz, 4JCF = 3.7 Hz, C), 144.0 (2 C), 148.5 (d, 4JCP = 3.1 Hz, C), 149.9 (dd, 2JCF = 12.6 Hz, 1JCF
= 248.6 Hz, C), 150.7 (dd, 2JCF = 12.7 Hz, 1JCF = 248.9 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-137.5 o -137.2 (m) and -139.1 o 139.3
(m) ppm.
HRMS (EI): calcula ed o C25H26F2NO3P [M]+ 457,1618; ound 457,1630.
317
Diisop opyl (2-(4- luo ophenyl)-4-(p- olyl) -1,2,3,4- e ahyd oquinolin-8-yl)phosphona e (15c).
The gene al p ocedu e (MCR Po a o ) was ollowed using aminophenylphosphona e 1d (0.26 g,
1 mmol), 4- luo obenzaldehyde (0.11 mL, 1 mmol), 4-me hyls y ene (0.16 mL, 1.2 mmol) and
BF3·E 2O, a o ding (0.29 g, 65%) o a whi e solid iden i ied as 15c.
Mel ing poin : 160-162oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.13-1.40 (m, 6 H, 2 CH3), 2.13 (ddd, 3JHH = 12.3 Hz, 3JHH = 11.6 Hz,
2JHH = 11.7 Hz, 1 H, CH2), 2.21-2.27 (m, 1 H, CH2), 2.32 (s, 1 H, CH3), 3.83-4.01 (m, 4 H, 2 CH2), 4.21
(dd, 3JHH = 5.2 Hz, 3JHH = 12.2 Hz, 1 H, CH), 4.49 (s, NH), 4.49 (dd, 3JHH = 2.8 Hz, 3JHH = 11.2 Hz, 1 H,
CH), 6.56-6.601 (m, 7.01-7.12 (m, 6 H), 7.37-7.46 (m 3 H) ppm.
13C RMN (100 MHz, CDCl3): 16.3 (d, 3JCP = 6.8 Hz, 2 CH3), 21.1 (CH3), 41.8 (CH2), 44.2 (HC),
56.5 (HC), 62.2 (d, 2JCP = 4.8 Hz, 2 CH2), 113.7 (d, 2JCF = 16.2 Hz, HC), 114.5 (d, 1JCP = 196.4 Hz, C),
115.7 (d, 2JCF = 21.4 Hz, 2 HC), 124.5 (d, 3JCP = 15.4 Hz, C), 128.2 (HC), 128.3 (HC), 128.4 (2 HC),
129.5 (3 HC), 131.7 (d, 2JCP = 11.2 Hz, HC), 133.6 (d, 2JCP = 12.0 Hz, HC), 136.5 (C), 139.0 (d, 4JCP =
3.2 Hz, C), 141.1 (C), 148.8 (d, 4JCP = 3.0 Hz, C), 162.4 (d, 1JCF = 246.1 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-114.7 o -114.6 (m) ppm.
HRMS (EI): calcula ed o C26H25FNO3P [M]+ 453,1869; ound 453,1879.

318
Die hyl (2-(3,4-di luo ophenyl)-4-(p- olyl)-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e (15d).
The gene al p ocedu e (MCR Po a o ) was ollowed using aminophenylphosphona e 1d (0.26 g,
1 mmol), 3,4-di luo obenzaldehyde (0.11 mL, 1 mmol), 4-me hyls y ene (0.16 mL, 1.2 mmol) and
BF3·E 2O, a o ding (0.37 g, 79%) o a whi e solid iden i ied as 15d.
Mel ing poin : 156-158oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.14-1.24 (m, 6 H, 2 CH3), 2.10 (ddd, 3JHH = 12.8 Hz, 3JHH = 11.4 Hz,
2JHH = 11.5 Hz, 1 H, CH2), 2.22-2.27 (m, 1 H, CH2), 2.32 (s, 3 H, CH3), 3.83-4.02 (m, 4 H, 2 CH2), 4.20
(dd, 3JHH = 5.1 Hz, 3JHH = 12.4 Hz, 1 H, CH), 4.49 (s, NH), 4.61 (dd, 3JHH = 2.7 Hz, 3JHH = 11.2 Hz, 1 H,
CH), 6.59-6.62 (m, 1 H), 7.02-7.15 (m, 7 H), 7.23-7.29 (m, 1 H), 7.41-7.47 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.3 (d, 3JCP = 6.8 Hz, 2 CH3), 21.2 (CH3), 41.8 (CH2), 44.1 (HC),
56.3 (HC), 61.7 (d, 2JCP = 5.1 Hz, 2 CH2), 113.9 (d, 2JCF = 16.1 Hz, HC), 115.1 (d, 1JCP = 220.4 Hz, C),
115.5 (d, 2JCF = 17.7 Hz, HC), 117.6 (d, 3JCP = 17.3 Hz, HC), 122.6 (dd, 3JCF = 6.2 Hz, 4JCF = 3.5 Hz,
HC), 124.5 (d, 3JCP = 15.5 Hz, C), 128.4 (2 HC), 129.6 (2 HC), 131.0 (d, 2JCP = 11.2 Hz, HC), 133.6 (d,
2JCP = 11.9 Hz, HC), 136.6 (C), 140.4 (dd, 4JCF = 3.6 Hz, 3JCF = 5.0 Hz, C), 140.8 (C), 148.5 (d, 4JCP =
3.0 Hz, C), 149.9 (dd, 2JCF = 12.7 Hz, 1JCF = 248.4 Hz, C), 150.7 (dd, 2JCF = 12.8 Hz, 1JCF = 248.8 Hz, C)
ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-137.3 o -137.2 (m) and -139.2 o 139.0
(m) ppm.
HRMS (EI): calcula ed o C26H28F2NO3P [M]+ 471,1775; ound 471,1786.
319
Die hyl (2,4-bis(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e (15e).
The gene al p ocedu e (MCR Po a o ) was ollowed using aminophenylphosphona e 1d (0.26 g,
1 mmol), 4- luo obenzaldehyde (0.11 mL, 1 mmol), 4- luo os y ene (0.14 mL, 1.2 mmol) and
BF3·E 2O, a o ding (0.39 g, 86%) o a whi e solid iden i ied as 15e.
Mel ing poin : 185-187oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.16-1.25 (m, 6 H, 2 CH3), 2.10 (ddd, 3JHH = 12.5 Hz, 3JHH = 11.2 Hz,
2JHH = 11.5 Hz, 1 H, CH2), 2.23-2.28 (m, 1 H, CH2), 3.86-4.04 (m, 4 H, 2 CH2), 4.26 (dd, 3JHH = 5.2 Hz,
3JHH = 12.3 Hz, 1 H, CH), 4.41 (s, NH), 4.64 (dd, 3JHH = 2.9 Hz, 3JHH = 11.2 Hz, 1 H, CH), 6.57-6.60 (m,
6.98-7.07 (m, 5 H), 7.16-7.20 (m, 2 H), 7.37-7.48 (m, 3 H) ppm.
13C RMN (100 MHz, CDCl3): 16.4 (d, 3JCP = 6.7 Hz, 2 CH3), 41.9 (CH2), 43.9 (HC), 56.5 (HC), 61.8
(d, 2JCP = 5.2 Hz, 2 CH2), 113.9 (d, 2JCF = 16.1 Hz, HC), 115.1 (d, 1JCP = 197.2 Hz, C), 115.6-115.9 (m,
4 HC), 124.1 (d, 3JCF = 16.0 Hz, C), 128.2-130.1 (m, 4 HC), 131.8 (d, 2JCP = 11.1 Hz, HC), 133.5 (d,
2JCP = 11.8 Hz, HC), 138.8 (d, 4JCF = 3.1 Hz, C), 139.9 (d, 4JCF = 3.2 Hz, C), 148.7 (d, 4JCP = 3.1 Hz, C),
162.2 (d, 1JCF = 245.0 Hz, C-F), 162.5 (d, 1JCF = 246.4 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-114.5 o -114.4 (m) and -116.5 o -116.4
(m) ppm.
HRMS (EI): calcula ed o C25H26F2NO3P [M]+ 457,1618; ound 457,1626.
320
Die hyl (2-(3,4-di luo ophenyl)-4-(4- luo ophenyl)-1,2,3,4- e ahyd oquinolin-6-yl)phosphona e
(15 ).
The gene al p ocedu e (MCR Po a o ) was ollowed using aminophenylphosphona e 1d (0.26 g,
1 mmol), 3,4-di luo obenzaldehyde (0.11 mL, 1 mmol), 4- luo os y ene (0.44 mL, 1.2 mmol) and
BF3·E 2O, a o ding (0.31 g, 65%) o a whi e solid iden i ied as 15 .
Mel ing poin : 178-180oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.15-1.24 (m, 6 H, 2 CH3), 2.06 (ddd, 3JHH = 12.6 Hz, 3JHH = 11.4 Hz,
2JHH = 11.7 Hz, 1 H, CH2), 2.22-2.27 (m, 1 H, CH2), 3.84-4.00 (m, 4 H, 2 CH2), 4.24 (dd, 3JHH = 5.1 Hz,
3JHH = 12.2 Hz, 1 H, CH), 4.58 (s, NH), 4.61 (dd, 3JHH = 2.7 Hz, 3JHH = 11.3 Hz, 1 H, CH), 6.60-6.63 (m,
1 H), 6.96-7.01 (m, 3 H), 7.11-7.28 (m, 5 H), 7.40-7.46 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.3 (d, 3JCP = 6.7 Hz, 2 CH3), 41.9 (CH2), 43.7 (HC), 56.1 (HC), 61.8
(d, 2JCP = 5.2 Hz, 2 CH2), 114.1 (d, 2JCF = 16.1 Hz, HC), 115.3 (d, 1JCP = 197.1 Hz, C), 115.4-115.6 (m,
5 HC), 117.6 (d, 3JCF = 17.2 Hz, HC), 122.6 (dd, 3JCF = 6.3 Hz, 4JCF = 3.6 Hz, HC), 124.0 (d, 3JCP = 15.7
Hz, C), 130.0-136.5 (m, 4 HC), 139.7 (d, 4JCF = 3.3 Hz, C), 140.1 (dd, 4JCF = 3.7 Hz, 3JCF = 4.9 Hz, C),
148.5 (d, 4JCP = 3.0 Hz, C), 150.0 (dd, 2JCF = 12.8 Hz, 1JCF = 248.6 Hz, C), 150.6 (dd, 2JCF = 12.8 Hz,
1JCF = 248.9 Hz, C) 161.9 (d, 1JCF = 245.1 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-116.4 o -116.2 (m), -137.3 o -137.1 (m)
and -139.0 o 138.9 (m) ppm.
HRMS (EI): calcula ed o C25H25F3NO3P [M]+ 475,1524; ound 475,1534.
Gene al p ocedu e o he p epa a ion o die hyl quinolin-6-yl phosphona es 16
Oxida ion o compounds 16 wi h DDQ
DDQ (0.45 g, 2 mmol, 2 equi .) was added o a solu ion o he co esponding 1,2,3,4-
e ahyd oquinolin-6-yl phosphona e 15 (1 mmol, 1 equi .) in chlo o o m (5 mL) and he
eac ion mix u e was s i ed and hea ed o e lux un il TLC, 31P NMR and 1H NMR spec oscopy
321
analysis indica ed he consump ion o he 1,2,3,4- e ahyd oquinolin-6-yl phosphona e 15 and
he subsequen o ma ion o he die hyl quinolin-6-yl phosphona e 16 (2 h). The o med eac ion
b u e was il e ed o , d ied in acuo and pu i ied by silica gel lash column ch oma og aphy
(40% o e hyl ace a e in hexane) and a u he ec ys alliza ion in E OAc/hexane o yield
quinolin-6-yl phosphona es 16.
Die hyl (2-(4- luo ophenyl)-4-phenylquinolin-6-yl)phosphona e (16a).
The gene al p ocedu e (oxida ion o compounds 15 wi h DDQ) was employed wi h 15a (0.44 g,
1 mmol) o a o d 16a (0.40 g, 91%) as a whi e solid.
Mel ing poin : 137-139oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.29-1.33 (m, 6 H, 2 CH3), 4.06-4.19 (m, 4 H, 2 CH2), 7.19-7.26 (m,
2 H), 7.53-7.60 (m, 5 H), 7.84 (s, 1 H), 8.00-8.05 (m, 1 H), 8.20-8.24 (m, 2 H), 8.26-8.29 (m, 1 H),
8.45-8.49 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): 16.3 (d, 3JCP = 6.5 Hz, 2 CH3), 62.3 (d, 2JCP = 5.5 Hz, 2 CH2), 115.9
(d, 2JCF = 21.7 Hz, 2 HC), 119.8 (HC), 124.9 (d, 3JCP = 17.3 Hz, C), 126.2 (d, 1JCP = 189.7 Hz, C), 128.9
(2 HC), 128.9 (HC), 129.5 (2 HC), 129.6 (d, 3JCF = 8.5 Hz, 2 HC), 130.4 (d, 2JCP = 3.8 Hz, HC), 130.6
(HC), 131.6 (d, 2JCP = 11.9 Hz, HC), 135.2 (C), 137.4 (C), 150.2 (d, 4JCP = 3.0 Hz, C), 150.3 (C), 157.6
(C), 164.1 (d, 1JCF = 250.2 Hz, C-F) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-111.9 o -111.7 (m) ppm.
HRMS (EI): calcula ed o C25H23FNO3P [M]+ 435.1400; ound 435.1415.
328
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C27H30NO4P [M]+ 463.1935; ound 463.1942.
Die hyl (6-(4-me hoxyphenyl)-6,6a,7,11b- e ahyd o-5H-indeno[2,1-c]quinolin-4-
yl)phosphona e (19b).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (2-aminophenyl)phosphona e
1b (1 mmol, 0.23 g), 4-me hoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol)
and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.34 g 73%) o a whi e
solid iden i ied as 19b.
Mel ing poin : 183-185oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.32-1.36 (m, 6 H, 2 CH3), 2.37-2.48 (m, 1 H), 3.20-3.27 (m, 2 H),
3.86 (s, 3 H, OCH3), 4.07-4.24 (m, 5 H), 4.56-4.58 (m, 1 H), 4.83 (s, 1 H) 6.68-6.74 (m, 1 H), 6.88-
6.91 (m, 1 H), 7.07-7.56 (m, 7 H), 7.52-7.56 (m, 2 H) ppm;
13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.4 Hz, 2 CH3), 31.6 (CH2), 46.3 (HC), 47.8 (HC), 55.4
(OCH3), 55.5 (HC), 62.3 (d, 2JCP = 4.9 Hz, 2 OCH2), 109.0 (d, 1JCP = 181.7 Hz, C), 112.4 (HC), 112.7
(HC), 117.0 (d, 3JCP = 15.0 Hz, HC), 118.8 (HC), 124.2 (d, 2JCP = 12.0 Hz, C), 125.2 (HC), 125.3 (HC),
126.6 (HC), 127.4 (HC), 130.0 (HC), 131.8 (d, 3JCP = 6.8 Hz, HC), 135.7 (d, 3JCP = 1.8 Hz, HC), 143.2
(C), 144.1 (C), 146.5 (C), 149.6 (d, 3JCP = 9.3 Hz, C), 160.2 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C27H30NO4P [M]+ 463.1935; ound 463.1910.

329
Die hyl (6-(4- luo ophenyl)-6,6a,7,11b- e ahyd o-5H-indeno[2,1-c]quinolin-4-yl)phosphona e
(19c).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (2-aminophenyl)phosphona e
1b (1 mmol, 0.23 g), 4- i luo ome hylbenzaldehyde (0.16 mL, 1 mmol), indene (0.14 mL, 1.2
mmol) and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.24 g 48%) o a
whi e solid iden i ied as 19b.
Mel ing poin : 157-159oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.29-1.36 (m, 6 H, 2 CH3), 2.28-2.37 (m, 1 H), 3.11-3.21 (m, 2 H),
4.01-4.18 (m, 4 H, 2 OCH2), 4.56-4.58 (m, 1 H), 4.86-4.87 (m, 1 H), 6.66-6.71 (m, 1 H), 7.04-7.34
(m, NH and 4 H), 7.48-7.52 (m, 2 H), 7.60-7.67 (m, 4 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.4 (s, 3JCP = 6.7 Hz, CH3), 31.3 (CH2), 46.1 (HC), 47.0 (HC), 56.2
(CH), 62.3 (s, 2JCP = 5.1 Hz, 2 OCH2), 108.9 (d, 1JCP = 181.7 Hz, C), 123.9 (d, 3JCP = 12.1 Hz, C), 124.3
(d, 1JCF = 272.9 Hz, CF3), 125.1-127.4 (m, 8 HC), 131.6 (d, 2JCP = 6.7 Hz, HC), 134.5 (d, 4JCF = 2.6 Hz,
HC), 142.7 (C), 146.1 (C), 146.3 (d, 3JCP = 1.3 Hz, C), 149.3 (d, 3JCP = 9.5 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-62.8. o -62.7 (m) ppm
HRMS (EI): calcula ed o C27H27F3NO3P [M]+ 501,1681; ound 501,1685.
330
Die hyl (6-(4- luo ophenyl)-6,6a,7,11b- e ahyd o-5H-indeno[2,1-c]quinolin-2-yl)phosphona e
(19d).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (4-aminophenyl)phosphona e
1d (1 mmol, 0.23 g), 3-me hoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol)
and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.30 g 65%) o a whi e
solid iden i ied as 19d.
Mel ing poin : 157-159oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): 1.15-1.22 (m, 6 H, 2 CH3), 2.30-2.34 (m, 1 H), 3.11-3.17 (m, 2 H),
3.77 (s, 3 H, OCH3), 3.83-3.99 (m, 4 H, 2 OCH2), 4.18 (s, 1 H, NH), 4.46-4.48 (m, 1 H), 4.67-4.69
(m, 1 H), 6.52-6.55 (m, 1 H), 6.78-6.80 (m, 1 H), 6.98-7.09 (m, 5 H), 7.23-7.32 (m, 2 H), 7.47-7.50
(m, 1 H), 7.65-7.69 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.4 (d, 3JCP = 6.7 Hz, CH3), 16.5 (d, 3JCP = 6.7 Hz, CH3), 31.4 (CH2),
45.9 (HC), 47.9 (HC), 55.5 (OCH3), 57.2 (HC), 61.8 (s, 2JCP = 5.3 Hz, OCH2), 61.9 (s, 2JCP = 5.1 Hz,
OCH2), 112.5 (HC), 112.8 (HC), 115.3 (d, 3JCP = 16.0 Hz, HC), 116.4 (d, 1JCP = 196.0 Hz, C), 118.9
(HC), 123.6 (d, 3JCP = 15.5 Hz, C), 124.9 (HC), 125.2 (HC), 124.9 (HC), 125.2 (HC), 126.7 (HC), 127.2
(HC), 129.9 (HC), 130.8 (d, 2JCP = 10.8 Hz, HC), 134.1 (d, 2JCP = 11.7 Hz, HC), 142.6 (C), 143.6 (C),
145.8 (C), 149.0 (d, 3JCP = 3.0 Hz, C), 160.0 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C27H30NO4P [M]+ 463.1912; ound 463.1911.
331
Die hyl (6-(4- i luo ome hylphenyl)-6,6a,7,11b- e ahyd o-5H-indeno[2,1-c]quinolin-2-
yl)phosphona e (19 ).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (4-aminophenyl)phosphona e
1d (1 mmol, 0.23 g), 4- i luo ome hylbenzaldehyde (0.16 mL, 1 mmol), indene (0.14 mL, 1.2
mmol) and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.34 g 67%) o a
whi e solid iden i ied as 19d.
Mel ing poin : 225-227oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.15-1.22 (m, 6 H, 2 CH3), 2.22-2.29 (m, 1 H), 3.07-3.16 (m, 2 H),
3.82-4.00 (m, 4 H, 2 OCH2), 4.25 (s, 1 H, NH), 4.47-4.49 (m, 1 H), 4.75-4.78 (m, 1 H), 6.56-6.59 (m,
1 H), 6.94-6.97 (m, 1 H), 7.00-7.10 (m, 2 H), 7.28-7.33 (m, 1 H), 7.48-7.60 (m, 5 H), 7.67-7.70 (m,
1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.4 (s, 3JCP = 6.7 Hz, CH3), 16.5 (s, 3JCP = 7.0 Hz, CH3), 31.2 (CH2),
45.7 (HC), 47.6 (HC), 57.0 (CH), 61.8 (s, 2JCP = 5.3 Hz, 2 OCH2), 115.5 (d, 3JCP = 15.9 Hz, HC), 116.9
(d, 1JCP = 197.6 Hz, C), 123.4 (d, 3JCP = 15.5 Hz, C), 124.2 (d, 1JCF = 272.1 Hz, CF3), 124.9 (HC), 125.1
(HC), 125.5-130.3 (m, 1 C and 6 HC), 130.8 (d, 2JCP = 10.8 Hz, HC), 134.0 (d, 2JCP = 11.6 Hz, HC),
142.1 (C), 145.5 (C), 146.0 (d, 3JCP = 1.3 Hz, C), 148.6 (d, 3JCP = 3.0 Hz, C) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-62.9. o -62.7 (m) ppm.
HRMS (EI): calcula ed o C27H27F3NO3P [M]+ 501.1681; ound 501.1698.
332
Die hyl (6-(2-me hoxyphenyl)-7H-indeno[2,1-c]quinolin-4-yl)phosphona e (20a).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (2-aminophenyl)phosphona e
1b (1 mmol, 0.23 g), 3-me hoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol)
and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.10 g (22%) o a whi e
solid iden i ied as 20a.
Mel ing poin : 143-145oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.27-1.32 (m, 6 H, 2 CH3), 3.97 (s, 3 H, OCH3), 4.28-4.42 (m, 6 H),
7.04-7.08 (m, 1 H), 7.45-7.88 (m, 7 H), 8.37-8.47 (m, 2 H), 8.92-8.95 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 38.1 (CH2), 55.6 (OCH3), 62.6 (d, 2JCP
= 5.9 Hz, 2 OCH2), 114.8 (HC), 115.2 (HC), 121.7 (HC), 123.9 (d, 3JCP = 10.7 Hz, HC), 124.1 (HC),
125.4 (HC), 125.7 (d, 2JCP = 16.2 Hz, HC), 127.4 (HC), 128.1 (d, 4JCP = 3.1 Hz, HC), 128.5 (HC), 129.3
(HC), 129.6 (d, 1JCP = 189.5 Hz, C), 134.4 (C), 135.5 (d, 3JCP = 7.1 Hz, HC), 140.2 (C), 141.2 (C), 144.2
(C), 145.9 (d, 4JCP = 2.0 Hz, C), 148.0 (d, 3JCP = 6.7 Hz, C),155.0 (d, 4JCP = 1.2 Hz,C), 159.7 (C) ppm.
31P NMR (120 MHz, CDCl3):
HRMS (EI): calcula ed o C27H30NO4P [M]+ 459.1599; ound 459.1603.
Die hyl (6-(4-me hoxyphenyl)-5H-indeno[2,1-c]quinolin-4-yl)phosphona e (20b).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (2-aminophenyl)phosphona e
1b (1 mmol, 0.23 g), 4-me hoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol)
333
and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.05 g 11%) o a whi e
solid iden i ied as 20b.
Mel ing poin : 183-185oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.27-1.30 (m, 6 H, 2 CH3), 3.96 (s, 3 H, OCH3), 4.25-4.39 (m, 6 H),
7.04-7.07 (m, 1 H), 7.45-7.87 (m, 6 H), 8.37-8.47 (m, 2 H), 8.92-8.95 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.0 Hz, 2 CH3), 38.2 (CH2), 55.7 (OCH3), 62.7 (d, 2JCP
= 4.9 Hz, 2 OCH2), 114.9 (HC), 115.9 (HC), 121.8 (HC), 124.1 (d, 3JCP = 10.6 Hz, HC), 124.4 (HC),
125.4 (HC), 125.8 (d, 2JCP = 16.1 Hz, HC), 127.6 (HC), 128.2 (HC), 128.6 (HC), 129.4 (HC), 129.8 (d,
1JCP = 189.8 Hz, C), 134.6 (C), 135.6 (d, 3JCP = 6.3 Hz, HC), 140.8 (C), 141.4 (C), 145.2 (C), 146.1 (C),
148.2 (d, 3JCP = 6.0 Hz, C),155.2 (C), 159.8 (C) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C27H26NO4P [M]+ 459.1599; ound 459.1594.
Die hyl (6-(2,4-di luo ophenyl)-5H-indeno[2,1-c]quinolin-2-yl)phosphona e (20e).
The gene al p ocedu e (MCR Po a o ) was ollowed using die hyl (4-aminophenyl)phosphona e
1d (1 mmol, 0.23 g), 4-me hoxybenzaldehyde (0.12 mL, 1 mmol), indene (0.14 mL, 1.2 mmol)
and BF3·E 2O. The eac ion mix u e was hea ed o e lux o 6 h o yield 0.25 g 55%) o a whi e
solid iden i ied as 20e.
Mel ing poin : 138-140oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.28-1.32 (m, 6 H, 2 CH3), 3.82 (s, 3 H, OCH3), 4.06-4.21 (m, 6 H),
7.40-7.51 (m, 2 H), 7.59-7.61 (m, 1 H), 7.86-7.95 (m, 3 H), 8.23-8.27 (m, 1 H), 8.47-8.49 (m, 1 H),
9.23-9.27 (m, 1H) ppm.
13C RMN (100 MHz, CDCl3): = 16.6 (d, 3JCP = 6.5 Hz, 2 CH3), 36.1 (CH2), 55.6 (OCH3), 62.5 (d, 2JCP
= 5.3 Hz, 2 OCH2), 114.2 (2 HC), 123.1 (d, 2JCP = 17.7 Hz, C), 124.9 (HC), 125.2 (HC), 125.9 (d, 1JCP
= 189.1 Hz, C), 129.5 (d, 2JCP = 9.5 Hz, HC), 129.9 (d, 3JCP = 11.5 Hz, HC), 130.5 (2 HC), 131.1 (d, 3JCP
= 14.3 Hz, HC), 132.6 (C), 135.2 (d, 4JCP = 1.1 Hz, C), 140.2 (C), 145.1 (C), 146.6 (C), 149.9 (d, 2JCP
= 3.1 Hz, C), 157.9 (C), 160.7 (C) ppm.

334
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C27H26NO4P [M]+ 459.1599; ound 459.1606.
Diisop opyl (6-(4- i luo ome hylphenyl)-5H-indeno[2,1-c]quinolin-4-yl)phosphona e (20g).
The gene al p ocedu e (MCR Po a o ) was ollowed using diisop opyl (4-
aminophenyl)phosphona e 1c (1 mmol, 0.26 g), 4- i luo ome hylbenzaldehyde (0.16 mL, 1
mmol), indene (0.14 mL, 1.2 mmol) and BF3·E 2O. The eac ion mix u e was hea ed o e lux o
6 h o yield 0.33 g 62%) o a whi e solid iden i ied as 20g.
Mel ing poin : 164-166oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.17 (m, 6 H, 2 CH3), 1.38 (d, 3JHH= 6.2 Hz, 6 H, 2 CH3) 4.25 (s, 2 H,
CH2), 4.98-5.06 (m, 2 H, 2 OCH), 7.48-7.57 (m, 2 H), 7.69-7.74 (m, 2 H), 7.81-7.83 (m, 2 H), 8.35-
8.37 (m, 2 H), 8.39-8.45 (m, 2 H), 8.89-8.91 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 23.8 (d, 3JCP = 4.4 Hz, 2 CH3), 24.3 (d, 3JCP = 2.9 Hz, 2 CH3), 38.1
(CH2), 70.7 (d, 2JCP = 5.5 Hz, 2 CH), 124.0 (d, 3JCP = 11.4 Hz, C), 124.2 (d, 1JCF = 272.5 Hz, CF3), 124.3
(HC), 125.2 (s, 3 HC), 126.1 (d, 2JCP = 16.1 Hz, HC), 127.5 (HC), 127.8 (HC), 128.6 (HC), 129.6 (s, 2
HC), 129.7-131.6 (m, 2 C), 134.0 (C), 135.7 (d, 3JCP = 6.4 Hz, HC), 140.1 (C), 143.3 (C), 144.6 (C),
146.3 (C), 147.9 (d, 3JCP = 6.6 Hz, C), 153.4 (C) ppm.
31P NMR (120 MHz, CDCl3)
19F NMR c ude eac ion mix u e (282 MHz, CDCl3)-62.8. o -62.7 (m) ppm.
HRMS (EI): calcula ed o C29H27F3NO3P [M]+ 525.1681; ound 525.1678.
335
Gene al p ocedu es o he p epa a ion o dialkyl 7H-indeno[2,1-c]quinolinyl phosphona es
20 and dialkyl 7-oxo-7H-indeno[2,1-c]quinolinyl phosphona es 21
A) Oxida ion o compounds 19 wi h DDQ
DDQ (0.45 g, 2 mmol, 2 equi .) was added o a solu ion o he co esponding dialkyl
e ahyd oindenoquinolinyl phosphona e 19 (1 mmol) in chlo o o m (5 mL) and he eac ion
mix u e was s i ed and hea ed o e lux un il TLC, 31P NMR and 1H NMR spec oscopy analysis
indica ed he consump ion o he s a ing ma e ial o un il no u he e olu ion was obse ed (2
h). The o med eac ion b u e was il e ed o , d ied in acuo and pu i ied by silica gel lash
column ch oma og aphy (40% o e hyl ace a e in hexane) and a u he ec ys alliza ion in
E OAc/hexane o yield he co esponding 7H-indeno[2,1-c]quinolinyl phosphona e 20 o dialkyl
7-oxo-7H-indeno[2,1-c]quinolinyl phosphona e 21.
B) Oxida ion o compounds 19 wi h Mn(OAc)3
Mn(OAc)3 (2.15 g, 4 mmol, 4 equi .) was added o a solu ion o he co esponding dialkyl
e ahyd oindenoquinolinyl phosphona e 19 (1 mmol) in ace ic acid (15 mL) and he eac ion
mix u e was s i ed and hea ed o e lux un il TLC, 31P NMR and 1H NMR spec oscopy analysis
indica ed he consump ion o he s a ing ma e ial o un il he eac ion does no p og ess any
longe (36 h). The o med eac ion b u e was ex ac ed wi h 25 mL o dichlo ome hane and 25
mL o wa e and hen quenched wi h a aqueous sa u a ed solu ion o NaHCO3 (2x 20 mL). The
esul an c ude oil was d ied o e MgSO4 and pu i ied by silica gel lash column ch oma og aphy
(25% o e hyl ace a e in hexane) and a u he ec ys alliza ion in E OAc/hexane o yield he
co esponding 7H-indeno[2,1-c]quinolinyl phosphona e 20 o dialkyl 7-oxo-7H-indeno[2,1-
c]quinolinyl phosphona e 21.
336
Die hyl (6-(4- i luo ome hylphenyl)- 5H-indeno[2,1-c]quinolin-4-yl)phosphona e (20c).
The gene al p ocedu e A (oxida ion o compounds 19 wi h DDQ) was ollowed using he die hyl
e ahyd o-5H-indeno[2,1-c]quinolin-4-yl phosphona e 19c (0.48 g, 1 mmol) o a o d 0.05 g
(11%) o a yellow solid iden i ied as 20c.
Mel ing poin : 164-166oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): 1.18-1.20 (m, 6H, 2CH3), 2.22 (dd, 2JHH = 12.5 Hz, 3JHH = 7.8 Hz,
1H, CH2), 3.00-3.07 (m, 2H, CH2 y HC-CH2), 3.91-4.09 (m, 4H, 2OCH2), 4.16 (s, 1H, NH), 4.46 (d,
3JHH = 6.6 Hz, 1H, CH), 4.77 (s, 1H, CH), 6.56- 6.61 (m, 1H), 6.94-7.09 (m, 3H), 7.19-7.27 (m, 1H),
7.39-7.58 (m, 6H) ppm.
13C RMN (100 MHz, CDCl3): = 16.1 (CH3), 16.2 (CH3), 31.1 (CH2), 45.9 (d, 4JCP = 2.4 Hz, HC-C),
47.2 (HC-CH2), 56.0 (HC-N), 62.0 (OCH2), 62.1 (OCH2), 108.8 (d, 1JCP = 182.1 Hz, C), 117.0 (d,
3JCP = 14.9 Hz, HC), 123.8 (d, 3JCP = 12.1 Hz, C), 124.5 (q, 1JCF = 272.1 Hz, CF3), 124.8 (2HC),
125.55 (d, 4JCP = 3.6 Hz, HC), 126.4 (HC), 126.5 (2HC), 127.1 (HC), 129.5 (q, 2JCF = 32.4 Hz, C-
CF3), 129.6 (HC), 131.43 (d, 2JCP = 6.6 Hz, HC), 134.3 (HC), 142.5 (C), 145.8 (C), 146.4 (C), 149.0
(d, 2JCP = 9.5 Hz, C) ppm.
31P NMR (120 MHz, CDCl3):
19F NMR (282 MHz, CDCl3)-62.8 ppm.
HRMS (EI): calcula ed o C27H23F3NO3P [M]+ 497,1368; ound 497,1374.
337
Die hyl 6-(3-me hoxyphenyl)-7-oxo-5H-indeno[2,1-c]quinolin-4-yl)phosphona e (21a).
The gene al p ocedu e B (oxida ion o compounds 19 wi h Mn(OAc)3) was ollowed using he
die hyl e ahyd o-5H-indeno[2,1-c]quinolin-4-yl phosphona e 19a (0.47 g, 1 mmol) o a o d
0.16 g (33%) o a yellow solid iden i ied as 21a.
Mel ing poin : 158-160oC (e hyl ace a e/hexane).
1H RMN (400 MHz, CDCl3): = 1.22-1.26 (m, 6 H, 2 CH3), 3.91 (s, 3 H, OCH3), 4.22-4.39 (m, 4 H, 2
OCH2), 7.04-7.07 (m, 2 H), 7.39-7.47 (m, 2 H), 7.56-7.69 (m, 5 H), 8.08-8.10 (m, 1 H), 8.42-8.48
(m, 1 H), 8.65-8.67 (m, 1 H) ppm.
13C RMN (100 MHz, CDCl3): = 16.5 (d, 3JCP = 6.5 Hz, 2 CH3), 55.5 (OCH3), 62.9 (d, 2JCP = 5.9 Hz, 2
OCH2), 115.5 (HC), 116.2 (HC), 122.7 (C), 123.0 (d, 3JCP = 10.5 Hz, HC), 123.2 (HC), 124.5 (HC),
124.6 (HC), 127.0 (d, 2JCP = 15.7 Hz, HC), 128.6 (HC), 129.0 (d, 4JCP = 2.5 Hz, HC), 130.7 (d, 1JCP =
190.1 Hz, C), 131.4 (HC), 133.6 (C), 134.7 (HC), 138.4 (C), 139.1 (d, 3JCP = 6.8 Hz, HC), 141.4 (C),
151.6 (d, 3JCP = 6.6 Hz, C), 153.6 (d, 4JCP = 1.4 Hz,C), 156.3 (C), 159.1 (C), 191.8 (CO) ppm.
31P NMR (120 MHz, CDCl3)
HRMS (EI): calcula ed o C27H24NO5P [M]+ 473,1392; ound 473,1398.
Die hyl (6-(4-me hoxyphenyl)-7-oxo-5H-indeno[2,1-c]quinolin-4-yl)phosphona e (21b).
The gene al p ocedu e A (oxida ion o compounds 19 wi h DDQ) was ollowed using he die hyl
e ahyd o-5H-indeno[2,1-c]quinolin-4-yl phosphona e 19b (0.47 g, 1 mmol) o a o d 0.07 g
(14%) o a yellow solid iden i ied as 21b.
344

345
346
347
348
349

350
351
352
353
360

361
362
363
364
365

366
VI-2.4. Clea age- eliga ion equilib ium assay
The clea age- eliga ion equilib ium was in es iga ed by incuba ing 200 nM o Cy3-labelled DNA
-Cy3-ATTTGACCTCGAGAATTATACGAAGTTATTAC- -GTAATAACTTCGTATAATTC-
TCGAGGTCAAAT-
con ol), CPT o ei he compounds 16 , 13s o 19a (as indica ed in Chap e II, Figu e 49) in a
eac ion bu e con aining 10 mM T is HCl, 5 mM MgCl2, 5 mM CaCl2
(pH 7.5) o 10 min a 37oC. The eac ions we e s opped by he addi ion o SDS o a inal
concen a ion o 0.2%, E OH p ecipi a ed and ypsinized ollowing s anda d p o ocols as
desc ibed in he li e a u e95. The eac ion p oduc s we e analyzed in a 20% dena u ing
polyac ylamide gel and he p oduc isualized by a Typhoon Scannne FLA 9500.
VI-2.5. REEAD assay
Reagen s: all chemicals we e pu chased om Sigma Ald ich. Phi29 eac ion bu e and dNTP
we e om The mo Fishe Scien i ic. The ecombinan enzymes Phi29 polime ase and T4 DNA
ligase we e kindly p o ided by D B.R. Knudsen (Depa men o Molecula Biology and Gene ics,
Aa hus Uni e si y, Aa hus, Denma k). DNA oligonucleo ides we e pu chased om Mic osyn h
Seqlab (Ge many).
VI-2.5.1. REEAD-on-slide assay
DNA oligonucleo ides o he REEAD-on-a-slide assay:
- - -amine-CCAACCAACCAACCAAATAAG CGATCTTCACAGT-
- -AGAAAAATTTTTAAAAAAACTGTGAAGATCGCTTATTT TT TTAAA
AATTTTTCTAAGTCTTTTAGATCCCTCAATGCTGCTGCTGTACTACGATCTAAAAGACTTAGA- -amine.
- -FAM- CCTCAATGCTGCTGCTGTACTAC-
The REEAD-on-a-slide p ocedu e: The eac ions we e ca ied ou on o p ime -coupled high
densi y (HD) glass slides (#DHD1-0023 Su modics, Eden P ai ie, MN, USA). Then, 25 mm2 squa ed
hyd ophobic a eas we e d awn on he glass su ace using a luo escen mini pap pen (#008877
-amine REEAD p ime was coupled o he squa es o he slides
acco ding o he Su modics manu ac u e desc ip ions. A o al o 1 pmol o he REEAD subs a e
was hyb idized o he p ime -coupled squa es o he slide o 60 min a 37oC. In o al, 200 mol
o TOP1 was incuba ed wi h he REEAD dumbbell subs a e, coupled o he squa es o he slide,
-HCl, 5 mM CaCl2, 5 mM MgCl2, and
367
150 mM (pH 7.5) o highe concen a ions o NaCl as indica ed, o 30 min a 37 oC. The
ci cula iza ion eac ions we e e mina ed by addi ion o 0.3% SDS. The slides we e washed o
one minu e a oom empe a u e in wash bu e 1 (0.1 M T is-HCl, 150 mM NaCl, and 0.3% SDS,
pH 7.5) ollowed by one minu e a oom empe a u e in wash bu e 2 (0.1 M T is-HCl, 150 mM
NaCl, and 0.05% Tween-20, pH 7.5). Finally, he slides we e dehyd a ed in 99.9% e hanol o one
minu e and ai -d ied. The RCA was pe o med o 6
T is-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4
The RCA eac ion was s opped by washing he slide o 10 min in wash bu e 1, ollowed by one
minu e in wash bu e 2 and one minu e in 99.9% e hanol and he slide was hen ai -d ied. The
p obe in a bu e con aining 20% o mamide, 2× SSC (300 mM NaCl, 30 mM sodium ci a e) and
5% glyce ol o 30 min a 37 oC. The slides we e washed o one minu e in wash bu e 1 ollowed
by one minu e in wash bu e 2, dehyd a ed wi h 99.9% e hanol, moun ed wi h Vec ashield (#H-
100 Vec o labo a o ies, Bu lingame, CA, USA), and isualized in a Olympus IX73/Olympus IX71
luo escen mic oscope. Fi een pic u es o e e y squa e o he slide we e aken using a 63x/60x
objec i e and he TOP1 ac i i y was quan i ied coun ing he luo escen do s using he Image J
so wa e
VI-2.5.2. (C/L) REEAD assay
DNA oligonucleo ides o he (C/L) REEAD assay:
- - -amine-CCAACCAACCAACCAAGGAGCCAAACATGTGCATTGAGG-
-Clea age hal - -phospho-AAAAATTTTTTCTAAGTCTTTTACCCTCAATGCACATGTTTG
GCTCCGTAAAAGACTTAGA- -amine.
-Liga o hal - -AGAAAAAATTTTTAGCTCGAACTGTGAAGATCGCTTATTCGAGCT-
- -FAM-ACTGTGAAGATCGCTTAT-
(C/L) REEAD p ocedu e: The eac ions we e ca ied ou on o p ime -coupled HD glass slides as
desc ibed o he REEAD-on-a-slide. -amine REEAD (C/L) p ime was coupled o he
squa es o he slides acco ding o he Su modics manu ac u e desc ip ions. In o al, 1 pmol o
clea age-hal -dumbbell subs a e was hyb idized o he p ime -coupled slides. To measu e he
e ec o he s udied compounds on he binding/clea age s ep o TOP1 ca aly ic cycle, 200 mol
368
o pu i ied TOP1 was added o he clea age hal -dumbbell-
o a s anda d TOP1 eac ion bu e con aining 10 mM T is-HCl, 5 mM CaCl2, 5 mM MgCl2, 100
mM NaCl (pH 7.5) o 30 min a 37o
o he s udied compounds. No e, he subs a e was added in an app oxima e i e- ime su plus
compa ed o enzyme. Since, he enzyme was consumed in his dead-end eac ion his ensu ed
su icien su plus o subs a e in he du a ion o he expe imen o he po en ial inhibi o y
e ec o he added compounds o be measu ed. The slides we e hen washed wice o h ee
minu es wi h a bu e con aining 10 mM T is-HCL (pH 7.5) and 1 mM EDTA o emo e all aces
200 pmol liga o -hal dumbbell and 500 mM NaCl was added o he squa es o he slide and
incuba ed o 60 min a 37oC. The slides we e hen washed o one minu e in wash bu e 1, one
minu e in wash bu e 2 and one minu e in 99.9% e hanol as desc ibed in he REEAD-on slide.
The ci cula iza ion eac ions w -ligase in
a bu e con aining 50 mM T is-HCl, 10 mM MgCl2, 1mM ATP (pH 7.5) o 60 min a 25oC. The
slides we e washed in wash bu e s 1 and 2 and dehyd a ed. RCA was pe o med as desc ibed
in he REEAD-on-a-
REEAD (C/L) p obe in a bu e con aining 20% o mamide, 2× SSC (300 mM NaCl, 30 mM Sodium
ci a e) and 5% glyce ol o 30 min a 37oC. RCPs we e isualized and quan i ied as desc ibed in
he REEAD-on-a-slide he li e a u e247. Fo he measu emen o he inhibi ion o he liga ion s ep
o he TOP1 ca aly ic cycle, clea age was pe o med as desc ibed abo e, bu in he absence o
any added inhibi o . -hal
dumbbell and 500 mM NaCl was added o he squa es o he slide in he p esence o 5% DMSO,
oC. The
ci cula iza ion and olling ci cle ampli ica ion we e comple ed as desc ibed o he measu emen
o he inhibi ion o he REEAD-on-a-slide.
369
VI-3. Cell iabili y assays
VI-3.1. Cell cul u e
A-549 (CCL- -OV-3 (HTB- -5 (CCL- we e pu chased
om he Ame ican Type Cul u e Collec ion (ATCC). HEK-293 human cell line was ob ained om
Cell Lines Se ice (CLS). RPMI-8402 and CPT-K5 human suspension cell lines we e kindly gi ed
by D . B.R. Knudsen (Depa men o Molecula Biology and Gene ics, Aa hus Uni e si y, Aa hus,
Denma k).
Cells we e cul u ed acco ding o manu ac u e ´s guidelines in hei espec i es cell-cul u e
media supplemen ed wi h 10% / hea -
(In i oGen) an imic obial agen (*excep when doing he siRNA ans ec ion wi h HEK-293 cells,
which we e cul u ed wi hou any an imic obial agen ). RPMI-8402 and CPT-K5 cell lines we e
cul u ed wi h 100 uni s/mL penicillin and 100 mg/mL s ep omycin (Sigma Ald ich) ins ead o
No moc -cul u e media:
-A-549 cells e e cul u ed in F12-K medium (Gibco).
-SK-OV-3 cells we e cul u ed in Mc Coy 5 a modi ied medium (Gibco).
-MRC-5 cells we e cul u ed in EMEM medium (Gibco).
-HEK-293 and HEK 293 KD cells we e cul u ed in DMEM medium (Gibco).
-RPMI-8402 and CPT-K5 cells we e cul u ed in RPMI 1640 medium (Gibco).
The cell cul u es we e pla ed in o 25/75/150 cm2 cul u e lasks o g ow h in a humidi ied
incuba o unde s anda d mammalian cell-cul u e condi ions (37oC, 5% CO2, 90% ela i e
humidi y).
Monolaye adhe en cell lines (A-549, SK-OV-3, HEK-293, HEK-293 KD and MRC-5) we e g own
a ached o a solid suppo ( he bo om o he cul u e lask) and he media was eplaced e e y
3 days and/o we e spli o main ain ~70-75% o cell-con luence. The cells we e ha es ed by
ypsin ea men o 1 min a 37oC (0.25% ypsin-EDTA solu ion, Sigma Ald ich) upon wo
consecu i e washes wi h PBS (phospha e bu e ed saline).
Suspension cell lines (RPMI-8402 and CPT-K5) we e g own as single cells. 0.5-0.7·106 cells/mL
we e seeded and a concen a ion o 0.3-1.5·106 cell/mL was main ained spli ing by dilu ion o
by eplacemen o he media (by cen i uga ion a 100 × g o 5 min o esuspend he esul an
pelle in o esh media) when he colou indica o u ned in o yellow (e e y 4-5 days).
376
A-549 GI50: 1.20 ± 0.12 µM
SK-OV-3 GI50: 50 µM
HEK-293 GI50: 28.00 ± 2.26 µM
MRC-5 GI50: 50 µM

377
A-549 GI50: 1.32 ± 0.15 µM
SK-OV-3 GI50: 50 µM
HEK-293 GI50: 38.34 ± 3.54 µM
MRC-5 GI50: 50 µM
378
A-549 GI50: 1.35 ± 0.53 µM
SK-OV-3 GI50: 17.79 ± 5.45 µM
HEK-293 GI50: 23.88 ± 4.05 µM
MRC-5 GI50: 50 µM
379
A-549 GI50: 1.32 ± 0.21 µM
SK-OV-3 GI50: 50 µM
HEK-293 GI50: 18.01 ± 3.37 µM
MRC-5 GI50: 50 µM
380
A-549 GI50: 3.11 ± 0.65 µM
SK-OV-3 GI50: 13.06 ± 1.80 µM
HEK-293 GI50: 24.13 ± 1.76 µM
MRC-5 GI50: 50 µM
381
A-549 GI50: 1.80 ± 0.41 µM
SK-OV-3 GI50: 8.36 ± 0.38 µM
HEK-293 GI50: 7.62 ± 0.38 µM
MRC-5 GI50: 50 µM

382
A-549 GI50: 1.68 ± 0.39 µM
SK-OV-3 GI50: 14.48 ± 1.55 µM
HEK-293 GI50: 10.47 ± 0.47 µM
MRC-5 GI50: 50 µM
383
A-549 GI50: 6.32 ± 1.09 µM
SK-OV-3 GI50: 50 µM
HEK-293 GI50: 50 µM
MRC-5 GI50: 50 µM
384
A-549 GI50: 7.65 ± 0.90 µM
SK-OV-3 GI50: 17.38 ± 1.58 µM
HEK-293 GI50: 8.97 ± 0.54 µM
MRC-5 GI50: 50 µM
385
A-549 GI50: 2.64 ± 0.43 µM
SK-OV-3 GI50: 10.51 ± 2.20 µM
HEK-293 GI50: 10.88 ± 0.78 µM
MRC-5 GI50: 50 µM
392
A-549 GI50: 3.20 ± 0.35 µM
SK-OV-3 GI50: 9.08 ± 0.27 µM
HEK-293 GI50: 50 µM
MRC-5 GI50: 50 µM

393
A-549 GI50: 12.59 ± 1.34 µM
SK-OV-3 GI50: 25.04 ± 3.61 µM
HEK-293 GI50: 38.29 ± 8.89 µM
MRC-5 GI50: 50 µM
394
A-549 GI50: 26.15 ± 4.01 µM
SK-OV-3 GI50: 7.04 ± 0.21 µM
HEK-293 GI50: 10.84 ± 0.98 µM
MRC-5 GI50: 35.11 ± 5.58 µM
395
A-549 GI50: 3.18 ± 0.27 µM
SK-OV-3 GI50: 1.33 ± 0.76 µM
HEK-293 GI50: 48.14 ± 6.39 µM
MRC-5 GI50: 50 µM
396
A-549 GI50: 1.47 ± 0.12 µM
SK-OV-3 GI50: 30.80 ± 2.82 µM
HEK-293 GI50: 7.77 ± 0.22 µM
MRC-5 GI50: 50 µM
397
A-549 GI50: 1.49 ± 0.10 µM
SK-OV-3 GI50: 9.68 ± 0.75 µM
HEK-293 GI50: 27.17 ± 3.45 µM
MRC-5 GI50: 32.03 ± 13.51 µM

398
A-549 GI50: 1.61 ± 0.17 µM
SK-OV-3 GI50: 10.24 ± 0.39 µM
HEK-293 GI50: 50 µM
MRC-5 GI50: 50 µM
399
A-549 GI50: 2.72 ± 0.37 µM
SK-OV-3 GI50: 10.59 ± 1.13 µM
HEK-293 GI50: 22.66 ± 1.36 µM
MRC-5 GI50: 50 µM
400
A-549 GI50: 2.27 ± 0.33 µM
SK-OV-3 GI50: 9.29 ± 1.79 µM
HEK-293 GI50: 24.43 ± 3.46 µM
MRC-5 GI50: 50 µM
401
A-549 GI50: 3.07 ± 0.22 µM
SK-OV-3 GI50: 9.79 ± 0.59 µM
HEK-293 GI50: 15.66 ± 1.74 µM
MRC-5 GI50: 50 µM