scieee Science in your language
[en] (orig)

The trophic ecology of Myotis emarginatus unveiled by DNA metabarcoding

Author: Vallejo López, Nerea
Year: 2025
Source: https://addi.ehu.eus/bitstream/10810/77802/1/TESIS_NEREA_VALLEJO_L%c3%93PEZ.pdf
PhD Thesis by
Ne ea Vallejo López
Leioa, Basque Coun y, 2025
The ophic ecology o
Myo is
ema gina us
un eiled by DNA
me aba coding
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is
ema gina us un eiled by DNA
me aba coding
A hesis submi ed by Ne ea Vallejo López o
he Uni e si y o he Basque Coun y o he
deg ee o Doc o o Philosophy, unde he
supe ision o D Inazio Ga in A o asagas i.
Leioa, Basque Coun y, 2025
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
(cc) 2025 Ne ea Vallejo López (cc by-nc-sa 4.0)
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Co e pho o by Ne ea Vallejo López
Back co e pho o by Joxe a Aiha za
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Familia i, e a Xabi i
We mus y o see he wo ld h ough he eyes o o he animals
-Ma k Beko
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
ii
Table o con en s
Table o con en s ............................................................................................................ ii
Eske onak - Acknowledgemen s ............................................................................... xi
Labu pena ........................................................................................................................... 1
Resumen .............................................................................................................................. 3
Summa y ............................................................................................................................. 6
CHAPTER 1: Gene al in oduc ion ............................................................................. 9
Fo aging ecology o insec i o ous ba s ................................................................... 11
Fo aging ecology ......................................................................................................... 11
Fo aging ecology o insec i o ous ba s: e olu ion and cons ain s. ...... 11
Die composi ion and a iabili y ................................................................................ 13
Spa io- empo al a ia ions in p ey a ailabili y .............................................. 13
P ey choice and p ey pa i ioning ........................................................................ 14
Insec i o ous ba s o aging in he An opocene ................................................. 16
S udying he die o insec i o ous ba s ................................................................... 17
S udy species: Myo is ema gina us ............................................................................ 20
Gene al desc ip ion .................................................................................................... 20
B eeding .......................................................................................................................... 21
Hibe na ion.................................................................................................................... 22
Fo aging ecology ......................................................................................................... 22
Spide consump ion by insec i o ous ba s ........................................................... 24
Thesis backgound ............................................................................................................. 25
Aims and s uc u e o he hesis ................................................................................ 27
Re e ences ........................................................................................................................... 28
CHAPTER 2: The die o he no ch-ea ed ba (Myo is ema gina us) ac oss
he Ibe ian Peninsula analysed by amplicon-me aba coding ...................... 37
Au ho ’s no e ...................................................................................................................... 39
Abs ac ................................................................................................................................ 39
Keywo ds ............................................................................................................................. 39
In oduc ion ........................................................................................................................ 40
Ma e ials and Me hods ................................................................................................... 42
S udy a ea ...................................................................................................................... 42
Sample collec ion ........................................................................................................ 43
E hics s a emen .......................................................................................................... 43
DNA ex ac ion, PCR ampli ica ion and sequencing ..................................... 44
Sequence analysis and lib a y building ............................................................. 44
Die desc ip ion and analysis ................................................................................. 45
Resul s ................................................................................................................................... 46
Geog aphical and seasonal a iabili y o he die .......................................... 46
Consump ion o spide s ........................................................................................... 49
Discussion ............................................................................................................................ 52
Conclusions ......................................................................................................................... 56
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
2
da, ba ez e e nekaza i zako e a abel zain zako ja dunbideei dagokiola. Laginak
bi aldi an jaso zi en (2020ko maia zean e a uz ailean). A mia mak zi en
ha apakin nagusiak, e a a ze ik abe e-izu iak. Azken hauen p esen zia
handiagoa zen kolonia ik hu bil abel zain za-ja due ak zi uz en e emue an; hala
e e, bes e paisaia-aldagai ba zuek, hala nola basoek e a e emu u baniza uek,
e agin handiagoa zu en die a en osae a o oko ean.
O o ha , emai zek M. ema gina usen p o il die e iko kohe en e ba e akus en
du e e emu geog a iko zabal ba ean zeha , e a hegan egi en ez du en
ha apakinak “gleaning” bidez a zema eko be e ebe asuna azpima a zen
du e. Ama aun o bikula ak e aiki zen di uz en a mia mak egi u a be ikal
konplexua du en habi a e an uga iagoak di a, be az, ingu une ho ien
kon se bazioa un sezkoa da M. ema gina us espeziea en bazkaleku egokiak
man en zeko. Ho ez gain, behien izu i-eulien kon sumo lokal baina uga iak
azpima a zen du nola lu a en e abile ak e a abel zain za-kudeake ak okian-
okiko a opodo-komuni a eak alda zen di uz ela, e a, hedadu az, saguza a en
ni xo o ikoa molda di zake ela bai a e e.
S omoxys calci ans ike ke a-e emuko abe e-izu i e nagusi e a
kal ega ienen a ean dago, animalien ongiza ean duen e agin nega iboa du e a
hainba gaixo asunen bek o e gisa ja dun dezake. Espezie honen kon ola
o aindik e e zaila bada e e, Izu i een Kudeake a In eg a uko (IKI) es a egiek
haien e agin nega iboak kon ola zen lagun dezake e. IKI es a egiek izu ien
kon ole ako eknika kul u al, biologikoak e a kimikoak konbina zen di uz e,
in sek iziden e abile a xiki zeko asmoz. Tesi hone an au kez u ako emai zek
auke a ema en du e M. ema gina us ha apa ia IKI es a egie an xe a zeko.
Ho e a ako, M. ema gina us e a bes e ha apa i ba zuen go o ze an S.
calci ansen DNA de ek a zeko qPCR p oba espezi iko ba ga a u nuen. P obak
%92ko zehaz asuna lo u du, e a S. calci ansen espezie, populazio e a kolonia
kon sumi zaileak opa zeko balia dai eke, bai e a ha apakinen kon sumo-maila
e la iboak balioes eko e e.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

3
Resumen
La die a de los mu ciélagos insec í o os se ca ac e iza a menudo po una al a
di e sidad. Sin emba go, lo que ealmen e consumen es á de e minado po
limi aciones elacionadas con su mo ología y el ipo de ecolocalización, la
disponibilidad de p esas, las in e acciones in e especí icas y la oma de
decisiones o ien ada a op imiza el balance ene gé ico. Con la llegada del DNA
me aba coding, es udios de allados sob e la composición y a iabilidad de la
die a han p opo cionado nue os conocimien os sob e las p e e encias ó icas
de a ias especies. Es a esis aplica he amien as molecula es de úl ima
gene ación pa a in es iga la ecología ó ica del mu ciélago a one o pa do,
Myo is ema gina us, en el ex emo su occiden al de su dis ibución eu opea.
El capí ulo 2 p esen a el p ime es udio que u iliza écnicas de DNA
me aba coding pa a analiza la die a de M. ema gina us. Se mues ea on 106
indi iduos en cinco colonias de la Península Ibé ica. Los esul ados e ela on un
consumo ecuen e de a añas ejedo as de elas o bicula es, p incipalmen e de
las amilias A aneidae y Te agna hidae. Asimismo, se obse ó una ele ada
p opo ción de moscas asociadas al ganado, como S omoxys calci ans y Musca sp.,
especialmen e en el no e de la Peninsula. Es as p esas, p obablemen e
cap u adas en eposo, e lejan la capacidad de M. ema gina us pa a caza
median e la écnica de "gleaning", en hábi a s densamen e ege ados o sob e
supe icies e icales.
El capí ulo 3 analiza los cambios es acionales en la composición die é ica en
cinco colonias de c ía si uadas en el País Vasco. Las mues as ecales se
ecogie on de o ma pasi a a lo la go de oda la empo ada ep oduc i a de
2020, minimizando el impac o sob e los animales. La die a gene al ue simila a
la desc i a en el capí ulo an e io , con abundancia de a añas o bicula es y
moscas diu nas como Musca sp. y S. calci ans. No obs an e, la die a a ió a lo
la go de la empo ada: al inicio, p edominaban los Díp e os den o de una die a
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
4
más di e sa, mien as que, hacia el inal, aumen ó el consumo de A ácnidos y
disminuyó la di e sidad die é ica.
El capí ulo 4 examina la elación en e la die a de M. ema gina us y las
ca ac e ís icas del paisaje, con especial a ención a las p ác icas ag ícolas y
ganade as al ededo de dieciséis colonias de c ía en la Península Ibé ica y el su
de F ancia. Se oma on mues as en dos pe iodos (mayo y julio de 2020). Una
ez más, las a añas ue on las p esas más abundan es, seguidas po moscas de
in e és e e ina io. El consumo de es as úl imas ue más común en zonas con
p esencia de ganado, aunque o as a iables del paisaje, como la cobe u a
o es al o las á eas u banas, u ie on mayo in luencia en la composición gene al
de la die a.
En conjun o, los esul ados mues an una die a consis en e pa a M.
ema gina us a lo la go de un amplio ango geog á ico y empo al, con una
ma cada dependencia del "gleaning" pa a cap u a p esas inmó iles. Las a añas
o bicula es equie en hábi a s de g an complejidad e ical, po lo que su
conse ación esul a cla e pa a man ene zonas de caza adecuadas pa a M.
ema gina us. Además, la asociación con moscas diu nas, especialmen e S.
calci ans, sugie e que la ges ión del paisaje y del ganado in luye en las
comunidades locales de a ópodos, con igu ando así el nicho ó ico de es a
especie.
S omoxys calci ans es una de las plagas ganade as más comunes y
pe judiciales del á ea de es udio, capaz de a ec a al bienes a del ganado y
ac ua como ec o de en e medades. Su con ol es ac ualmen e complejo, pe o
la in e acción dep edado a con M. ema gina us ab e la pue a a su inclusión
como enemigo na u al en p og amas de Manejo In eg ada de Plagas (MIP), que
p e ende combina mé odos cul u ales, biológicos y químicos pa a el con ol de
plagas, con el obje i o de minimza el uso de pes icidas. Pa a ello, se desa olló
un ensayo qPCR especí ico pa a la de ección de ADN de S. calci ans en heces de
M. ema gina us y o os dep edado es. El ensayo mos ó una p ecisión supe io
al 92 % y se p esen a como una he amien a e icaz y económica pa a iden i ica
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
5
especies, poblaciones o colonias consumido as, así como pa a es ima el
consumo ela i o de es a mosca, e in eg a a e eb ados dep edado es en
es a egias de MIP.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
6
Summa y
The die o insec i o ous ba s is o en cha ac e ized by a high di e si y o
p ey. Howe e , wha a ba ac ually ea s is ul ima ely shaped by cons ain s posed
by he wing mo phology and echoloca ion, p ey a ailabili y, in e speci ic
in e ac ions, and decision-making p ocesses aimed a op imizing ene gy
balance. Wi h he ad en o DNA me aba coding, de ailed in es iga ions in o
die a y composi ion and a iabili y ha e p o ided new insigh s in o p ey
p e e ences in many insec i o ous ba species. This hesis applies cu ing-edge
molecula ools o explo e he ophic ecology o he no ch-ea ed ba , Myo is
ema gina us, a he sou hwes e n edge o i s Eu opean dis ibu ion.
Chap e 2 p esen s he i s s udy o use DNA me aba coding o in es iga e
he die o M. ema gina us. A o al o 106 indi iduals we e sampled om i e
colonies ac oss he Ibe ian Peninsula. The esul s e ealed equen
consump ion o o b-wea ing spide s, p ima ily om he amilies A aneidae and
Te agna hidae. No ably, li es ock pes s such as S omoxys calci ans and Musca
sp. we e consumed in high p opo ions in wo no he n colonies. These p ey
i ems, likely cap u ed while mo ionless, highligh he species’ gleaning
beha iou .
Chap e 3 p o ides a de ailed analysis o seasonal die a y shi s in i e
ma e ni y colonies loca ed in he Basque Coun y. Faecal samples we e passi ely
collec ed h oughou he en i e 2020 ma e ni y season, wi h minimal
dis u bance o he ba s. The o e all die mi o ed indings om Chap e 2,
domina ed by o b-web building spide s and diu nal pes lies (Musca sp. and S.
calci ans). Howe e , die a y composi ion a ied o e ime: ea ly-season die s
included a b oade ange o p ey o de s (wi h Dip e a being mos abundan ),
whe eas la e in he season, spide consump ion inc eased, and die a y di e si y
declined.
Chap e 4 examines he ela ionship be ween die and landscape ea u es,
pa icula ly ag icul u al p ac ices and li es ock a ming, a ound six een
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
7
ma e ni y colonies in he Ibe ian Peninsula and sou he n F ance. Samples we e
collec ed du ing wo pe iods (May and July 2020). Again, spide s we e he
dominan p ey, ollowed by muscid lies. The p esence o li es ock pes s in he
die was highe in a eas wi h nea by li es ock ope a ions; howe e , o he
landscape a iables, such as o es co e and u baniza ion, had a s onge
in luence on p ey composi ion o e all.
Collec i ely, he esul s demons a e a consis en die a y p o ile o M.
ema gina us ac oss a wide geog aphic ange, emphasizing i s eliance on
gleaning mo ionless p ey. Because o b-web-building spide s h i e in e ically
complex habi a s, he conse a ion o such en i onmen s is c i ical o
main aining sui able o aging g ounds. Addi ionally, he s ong die a y link o
diu nal lies, especially S. calci ans, unde sco es how land use and li es ock
managemen p ac ices can shape local a h opod communi ies and, by
ex ension, he ba ’s ophic niche.
The s able ly S. calci ans is among he mos p e alen and ha m ul li es ock
pes s in he s udy egion, known o i s nega i e impac on animal wel a e and
i s ole as a disease ec o . Al hough con ol o his species emains challenging,
he speci ic p eda ion by M. ema gina us o e s po en ial o inco po a ing
na u al p eda o s in o In eg a ed Pes Managemen (IPM) s a egies. IPM
combines cul u al, biological and chemical pes con ol measu es wi h he aim o
educing pes icide use. To suppo his, I de eloped a species-speci ic qPCR assay
o de ec ing S. calci ans DNA in he aeces o M. ema gina us and o he
p eda o s. The assay achie ed o e 92% accu acy, p o ides a cos -e ec i e ool
o su ey po en ial consume species, popula ions o colonies, and i is able o
es ima e he ela i e le els o p ey consump ion. This molecula ool enables he
iden i ica ion o p eda o popula ions ha signi ican ly ely on S. calci ans and
hus a e good candida es as biocon ol agen s in u u e IPM p og ams.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
CHAPTER 1: Gene al in oduc ion
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Fo aging ecology o insec i o ous ba s
Fo aging ecology
All animals need o ob ain ene gy om he en i onmen , which usually means
loca ing, ob aining and consuming ood i ems ha sui hei abili ies o handle
ood and sa is y me abolic equi emen s. Fo aging encompasses all he
a o emen ioned aspec s o beha iou and is undamen al o all animals,
in luencing hei abili y o su i e and ep oduce (S ephens and K ebs, 1986).
Fo many species, o aging can ake up signi ican amoun s o hei li e ime, and
he e o e be esponsible o a signi ican po ion o hei daily ene gy
expendi u e. Thus, while o aging, animals need o balance he ene gy ob ained
om ood wi h he ene gy spen ob aining i (McGui e and Boyles, 2024).
Decisions made du ing o aging, such as wha , whe e and when o o age, o
when o s op o aging, can in luence ene gy balance and he e o e he
indi iduals’ i ness (S ephens, 2008).
Fo aging ecology o insec i o ous ba s: e olu ion and cons ain s.
Main aining ene gy balance is especially impo an o ba s because, as he
only mammals capable o powe ed ligh , locomo ion incu s g ea ene ge ic cos s
(McGui e and Boyles, 2024). Howe e , ligh has also enabled ba s o a el
longe dis ances while o aging and has opened a wide a ay o o aging niches.
On op o ha , all ex an ba amilies excep o one (P e opodidae) use
echoloca ion o na iga e and o age in a a ie y o en i onmen s du ing he nigh
(Simmons, 2005). Fligh and echoloca ion we e p esen in ances al ba s which,
being able o exploi noc u nal lying insec s, unde wen apid di e si ica ion
du ing he Eocene (Teeling e al., 2005), esul ing in o e 1400 ex an species,
70% o which a e classi ied as insec i o ous (Kunz e al., 2011).
Ex an insec i o ous ba s p esen di e se wing mo phologies and
echoloca ion cha ac e is ics, which de ine he o aging niche o he species in
ques ion. On he one hand, wing mo phology deeply in luences ligh s yle and
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
18
species ha ha e ha de chi inous appendages o wing scales, like lepidop e ans
o coleop e ans, while small and so bodied p ey canno be de ec ed a all
(Symondson, 2002). The kind o ba s ha can be s udied by his app oach is also
limi ed.
The lack o axonomic inesse o isual iden i ica ion was hinde ing ou
capaci y o desc ibe p eda o -p ey in e ac ions in dep h. Howe e , wi h he u n
o he new millennium echnological ad ancemen s ela ed o molecula s udies
ha e e olu ionized die a y s udies o wild animals, he mos u ilized app oach
being Me aba coding (deSousa e al., 2019). This app oach consis s on
ampli ying a single o ew genes p esen in an en i onmen al sample (e.g.: soil,
wa e , aeces), wi h he aim o de ec as many species p esen in i . T adi ionally,
when he aim o he s udy is o iden i y a h opods, a egion o he cy och ome c
oxydase I (COI) gene is a ge ed, whose sequence is can be used o iden i y mos
a hopod species (Hebe e al., 2003). This egion is ecognized as he uni e sal
ma ke o he iden i ica ion o animals by he Conso ium o he Ba code o Li e
and is o en he only DNA sequence publicly a ailable om a species (Pen insaa i
e al., 2016), making i bo h obus and con enien o use o die a y
iden i ica ion pu poses.
Gi en he olume o sequences o be analysed, high- h oughpu sequencing
(HTS) echniques o Nex Gene a ion Sequencing (NGS) a e employed o p ocess
he biological da a and p oduce he desi ed DNA sequences. As hese
echnologies ha e de eloped, he sequencing dep h o each un has inc eased
400- old in en yea s. Now, i is possible o ob ain o e 20 billion high quali y
sequences pe sequencing un o a ela i ely cheap p ice (Han e al., 2024). This
means ha de ec abili y o a e species is inc eased, e en in samples ha ha e
lowe DNA yield because o hei deg ada ion (Capo aso e al., 2012).
The applica ion o molecula echniques has become widesp ead o he
s udies o ba s (deSousa e al., 2019), and has b ough g ea ad ancemen s in he
s udy o ba die s and o aging ecology. Being able o iden i y die a y
composi ion o he speci ic le el eliably and cos e ec i ely means be e
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
19
unde s anding o ood-web s uc u es and p eda o -p ey in e ac ions, which a e
undamen al in unde s anding ecosys em unc ionali y (Symondson, 2002).
Also, i has allowed o be e unde s and spa io- empo al a ia ions in die a y
composi ion, and ine mechanisms o p ey selec ion and esou ce pa i ioning
(Cla e e al., 2011; Ma a e al., 2016; No ella-Fe nandez e al., 2020).
This has also popula ized ai -based die a y analysis, which ocuses on he
cha ac e is ics o he p ey consumed ins ead o hei axonomy. P ey
mo phology, size and ha dness ha e been used o unde s and p ey pa i ioning
and on ogenic shi s in he die o ho seshoe ba s (Aldaso o e al., 2024). Also,
sou ce habi a s o consumed p ey ha e been used o in e o aging habi a
p e e ences (Albe di e al., 2012; And iollo e al., 2021), and also o highligh he
dependencies o p eda o s on he sou ce habi a s o p ey which may no
necessa ily ma ch o aging g ounds (A izabalaga-Escude o e al., 2015;
Aiha za e al., 2023).
DNA me aba coding is he e o e a g ea solu ion o s udy he die a y
composi ion o gene alis species and p o ides he esea che wi h he numbe
o DNA eads belonging o each p ey species. Howe e , due o di e en ial
diges ion a es o p ey, axonomic biases ela ed o p ime annealing, and
echnical cha ac e is ics o he sequencing p ocess (King e al., 2008; Piñol e al.,
2018; Shel on e al., 2022), he e is deba e on he eliabili y o whe he DNA ead
coun s eco e ed by me aba coding accu a ely quan i y he p ey species
consumed by he p eda o (Elb ech and Leese, 2015; Lamb e al., 2018). While
his is usually no a big p oblem o gene al die desc ip ions, i can hinde he
powe o s udies aiming o e alua e he impac ba s can on pes species
popula ions by consuming hem. In hese cases, a ge ed molecula assays ha e
shown po en ial o de ec and quan i y he amoun o DNA in each sample, while
also signi ican ly educing cos s and p ocessing ime compa ed o NGS (Ba oja
e al., 2021).
Du ing i s hal o he 2010s, molecula echniques expanded he knowledge
abou he die a y composi ion and o aging ecology o many ba species. Thei
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
20
ophic posi ion as gene alis op p eda o s and hei ole as bioindica o s made
hem excellen species models o applied s udies on an h opogenic e ec s
(Russo e al., 2021), and o me hodological s udies ocusing on he applica ion
o molecula echniques o ecological s udies (Albe di e al., 2018). Howe e ,
wi hin he g oup he e a e s ill b oad biases in esea ch, as some species and
some a eas o he wo ld emain unde s udied (Tawesuub e al., 2022).
S udy species: Myo is ema gina us
Gene al desc ip ion
Figu e 1. Images o M. ema gina us. A: Close-up o he ace (Pho o: J. Aiha za). B: M.
ema gina us in ligh (Pho o: J. Aiha za). C: Pic u e o a mixed colony o M. ema gina us,
abo e, and R e umequinum, below. (Pho o: N. Vallejo).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
21
The no ch ea ed ba (Myo is ema gina us; Fig. 1) belongs o he amily
Vespe ilionidae. I is a medium sized ba (6-15 g), wi h low o a e age wing
loading and ouned wingips (Fig. 1B). The hai is b igh b own o o ange in he
do sal a ea, and dulle beige in he en al a ea (Fig. 1C). In adul indi iduals, he
snou , ea s and wings a e da k. The ea s a e small, wi h a dis inc no ch on he
ou e edge, a cha ac e is ic echoed in he species’ scien i ic and common names
(Die z and Pi , 2021; Fig. 1A).
Dis ibu ion
M. ema gina us is he only Eu opean ep esen a i e o he A ican clade o he
genus Myo is (Ruedi e al., 2013). I is a medium sized ba whose dis ibu ion is
cen ed in a ound he Medi e anean (F an z e al., 2022); wi h isola ed
popula ions in he wes e n coas o he Medi e anean, C imea, Caucasus, Cen al
Asia and Saudi A abia (Pi accini, 2021). The wes e n Eu opean popula ions a e
all classi ied unde he nominal sub-species M. ema gina us ema gina us (U izl
and Benda, 2022), which ex ends om he no h o A ica up o 51°N, so ha i s
no he nmos dis ibu ional limi goes h ough coun ies such as he
Ne he lands, Ge many, Luxembu g o Belgium (F an z e al., 2022). While i can
be a e wi hin i s dis ibu ion, i seems o li e in a a ie y o habi a s (Die z and
Pi , 2021; Augus o, 2023), and i s dis ibu ion is especially pa chy in i s
no he nmos limi (F an z e al., 2022).
B eeding
The no ch-ea ed ba o ms b eeding colonies o a iable size (20-7000
indi iduals, Die z and Pi , 2021) du ing he summe . They oos in ca es and
mines in he sou he n pa o i s dis ibu ion, bu o en choose a i icial
s uc u es such as a ics, chu ches, cas les, e c., specially in he no h (Die z and
Pi , 2021). B eeding colonies a e almos exclusi ely o med by emales, and only
hal o he animals b eed in any gi en yea (Spi zenbe ge and Weiss, 2020).
While in he b eeding colonies, animals o m igh clus e s, o en wi h indi iduals
o o he species, especially o he genus Rhinolophus (Die z and Pi , 2021; Fig.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
22
1C), and appea o depend g ea ly on social he mo egula ion o he success ul
ea ing o hei pups (Spi zenbe ge and Weiss, 2021). Males a e mos ly soli a y,
bu bigge cong ega ions ha e been eco ded a swa ming si es.
Hibe na ion
The no ch-ea ed ba has he sho es ep oduc i e season (Spi zenbe ge and
Weiss, 2020), and he longes hibe na ion amongs Eu opean ba s, ollowing a
s ong ci cannual hy hm (Spi zenbe ge e al., 2024). Howe e , li le is known
abou his pa o hei biology. In no he n Eu ope hey ha e mos ly been ound
hibe na ing alone o in small g oups in mines, unnels and ock c e ices (Die z
and Pi , 2021). Compa ed o knowledge abou he b eeding colonies, hibe na ion
si es and dynamics a e less known in wes e n Medi e anean coun ies, and only
a ew hibe na ing indi iduals ha e been ound (Alcalde and Escala, 2000), so he
species “seems o anish” o nine mon hs un il b eeding colonies a e es ablished
again (Que glas, 2007).
Fo aging ecology
A he ime o concep ion o his hesis, many aspec s o i s biology, including
i s o aging ecology had been mos ly s udied in i s no he nmos limi , whe e
nu se y and hibe na ion colonies we e well known and moni o ed (Die z and
Pi , 2021). Radio aking s udies had ound ha he ba s commu ed usually unde
5km o hei o aging a eas (Die z e al., 2013), whe eas maximum epo ed
dis ance is o e 10km (Die z e a., 2013). The same s udy epo ed he ba ’s
mean home ange o be be ween 438.6 and 694.7 ha (Die z e al., 2013).
The ba s we e epo ed o ha e lexible o aging beha iou , wi h some s udies
epo ing a p e e ence o na i e o es s (K ull e al., 1991; Zahn e al., 2010;
Dekke e al., 2013), while o he s ound p e e ence o ag icul u al a eas and
ipa ian a eas (Die z e al., 2013). Females om nume ous colonies would also
o age equen ly inside o ca le sheds (K ull e al., 1991; S eck and B inkmann,
2006; Dekke e al., 2013; Die z e al., 2013).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
23
This beha iou seems o in luence he ba ’s die a y composi ion g ea ly a
no he n loca ions, as he isual inspec ion o die a y emains has iden i ied a
la ge numbe o b achyce an lies in he die , cons i u ing be ween 50% and 73%
o he o al olume o he die (K ull e al., 1991; S eck and B inkmann, 2006).
Some s udies e en managed o iden i y species such as S omoxys calci ans o
Musca au umnalis (Ke yn e al., 2012), which a e epipa asi es linked o ca le
(Ge y and Mu illo, 2020). As hese lies a e s ic ly diu nal, he key o his
o aging beha iou was usually a ibu ed o he ba ’s abili y o glean p ey o
su aces, which i s wi h he echomo phological cha ac e is ics o he species
(No be g and Rayne , 1987; Schumm e al., 1991), al hough o he hun ing
s a egies including ae ial hawking ha e been obse ed (Schumm e al., 1991).
Besides diu nal lies, he emainde o he die in mos o hese s udies is
comp ised by A achnida, Lepidop e a, Hemip e a and Coleop e a. These s udies
iden i ied he impo ance o ca le sheds as o aging g ounds o he no ch-ea ed
ba , and e en iden i ied a clea p e e ence o adi ional, wooden sheds housing
bo ine ca le (Dekke e al., 2013). As such, p ese a ion o sui able buildings o
o aging is o en men ioned as an impo an conse a ion measu e o hese
popula ions o M. ema gina us (Die z and Pi , 2021).
Howe e , s udies conduc ed in o he a eas o i s dis ibu ion show a di e en
o aging ecology. In he Ibe ian Peninsula, he no ch-ea ed ba did no isi ca le
sheds o o aging, and ins ead showed p e e ence o a eas wi h dense
ege a ion such as sc ubland, woodlands and coni e plan a ions (Flaque e al.,
2008; Goi i e al., 2011). These s udies epo ed simila commu ing dis ances o
hose ound in Cen al Eu ope, bu Goi i e al. (2001) epo s smalle home
anges, be ween 120 and 371 ha. Using mo phological me hods, Goi i e al.
(2011) iden i ied spide s as he mos consumed p ey i ems bo h in quan i y and
equency o occu ence, ollowed by dip e ans and neu op e ans. Visual
iden i ica ions o emains is limi ed, bu some o he spide s iden i ied belong o
he o b-web building spide guild (S eck and B inkmann, 2006; Goi i e al., 2011;
Ke yn e al., 2012).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
24
Spide consump ion by insec i o ous ba s
Spide s, as p eda o s, a e gene ally expec ed o be less abundan in he
en i onmen han o he a h opods (Pimm, 1988). In addi ion, hey exhibi a
wide di e si y o hun ing s a egies and web s uc u es. Simila o ba s, spide s
can be classi ied in o di e en ecological guilds; howe e , in hei case, guild
classi ica ion co esponds mo e closely wi h axonomy. Acco ding o he guild
classi ica ion by Ue z e al. (1999), spide s can be hun e s o web-builde s. The
hun ing spide s ei he oam eely in he g ound (e.g. Lycosidae) o in he oliage
(e.g. Anyphaenidae), o wai and ambush hei p ey in a a ie y o mic ohabi a s
(e.g. Sal icidae, Thomisidae). Web-building spide s, on he o he hand, a e
classi ied acco ding o he shape o he web hey build o ap hei p ey. This
g oup includes shee and unnel web-builde s (e.g. Agelenidae), angle wea e s
(e.g. Linyphiidae), o b-wea e s (e.g. A aneidae, Te agna hidae) and space- o
cob-web builde s (e.g. The idiidae). Gi en he unc ional di e si y o his o de ,
spide -hun ing ba s a e aced wi h he same unc ional cons ains p esen ed
abo e.
A he ime o he concep ion o his hesis, an a achni o ous die had seldom
been epo ed as he p ima y o aging mode o insec i o ous ba s, bu he e
we e some excep ions. Mos no ably, he Aus alian species Ke i oula papuensis
(Schulz e al., 2000) and he No h Ame ican species Myo is keenii (Bu les e al.,
2008) ha e been desc ibed as spide specialis s. The s a us o he la e as an
independen species, howe e , has been doub ed by a ecen molecula s udy,
which p oposes ha i should be included in he species Myo is e o is (Lausen e
al., 2019).
Die a y s udies on M. e o is ha e iden i ied spide emains in Albe a, Canada
(F eq. o occu ence 22%; Maucie i and Ba klay, 2021), bu i was no as
abundan as in he s udies pe o med on M. keenii, in Haida Gwaii A chipelago,
in wes e n Canada (F eq. o occu ence 80%; Bu les e al., 2008). The Eu opean
Myo is na e e i has shown simila le els o spide consump ion. This o es ba
shows g ea abili y o de ec and glean p ey o su aces (Sieme s and Schni zle ,
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
25
2004), and some s udies ha e epo ed die s ich in diu nal lies and spide s,
s ikingly simila o ha o M. ema gina us (And eas e al., 2012; Sieme s and
Swi , 2006). O he s udies, howe e , ha e epo ed much mo e di e se die s,
whe e o he insec g oups such as nema oce an lies, lepidop e ans o
coleop e ans a e o g ea impo ance (Hope e al., 2014; Roswag e al., 2018).
Spide s ha e also been epo ed in he die o o he gleaning ba species,
albei o a lowe ex en (e.g.: And eas e al., 2012; No ella-Fe nandez e al.,
2020), o linked o condi ions o lowe a ailabili y o lying insec s (Hope e al.,
2014; Kaupas and Ba clay, 2018; Ves e inen e al., 2018).
Thesis backgound
The basic biology o Myo is ema gina us poin s ou a dis inc ene gy
managemen and alloca ion h oughou he yea , compa ed wi h o he membe s
o he same genus in Eu ope (Spi zenbe ge and Weiss, 2020; Spi zenbe ge e
al, 2024). Pas s udies ha e also highligh ed ha , despi e adap abili y in hei
choice o o aging g ounds (K ull e al., 1991; Flaque e al., 2008; Die z e al.,
2013), i has a pa icula die a y composi ion (Goi i e al., 2011; Ke yn e al.,
2012). In ac , bo h o he main p ey ypes desc ibed o his species, ca le pes
lies and spide s, a e no amongs he mos popula die a y i ems o o he
Eu opean ba s (Beck, 1995).
Mos o he knowledge ega ding he o aging ecology o he no ch-ea ed ba
comes om colonies in he no he n a ea o i s dis ibu ion, and he ew s udies
pe o med in Medi e anean coun ies show a di e en o aging beha iou . Also,
a he ime o concep ion o he hesis, he die o he no ch-ea ed ba had only
been s udied using isual iden i ica ion o aecal emains, which limi s he
axonomical in o ma ion ga he ed by he s udies and can lead o biases agains
ha d-bodied p ey (Pompanon e al., 2012). In his hesis we aim o con ibu e o
he knowledge abou he die a y composi ion and a iabili y o he no ch-ea ed
ba by s udying i in i s co e a ea o he wes e n dis ibu ional ange (F an z e
al., 2022), and using up- o-da e molecula echniques.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
26
The s udies p esen ed in his hesis ha e been conduc ed in se e al loca ions
in no he n and wes e n Ibe ian Peninsula and sou he n F ance. As he s udy
a ea encompasses a wide geog aphic egion, local clima e in each colony a ies
om empe a e oceanic o Medi e anean. On op o ha , he whole s udied
egion is highly modi ied by an h opogenic de elopmen , which has de eloped
di e en ly due o geoclima ic, demog aphic and cul u al aspec s. Each colony
s udied is he e o e a ec ed by ag icul u e, o es y, li es ock a ming o
u baniza ion in a di e en way.
Nex gene a ion sequencing echniques a e a g ea ool o expand he
knowledge on he die a y composi ion and die a y a iabili y o he no ch-ea ed
ba o many easons:
i) Species le el iden i ica ion o p ey emains would allow o p ecise
desc ip ion o he die a y composi ion o he no ch-ea ed ba . The
unc ional cha ac e is ics o he mos consumed p ey can be used o in e
impo an aspec s o he o aging ecology o he no ch-ea ed ba in he
Ibe ian Peninsula.
ii) Using up- o-da e molecula echniques, i is possible o analyse hund eds
o samples simul aneously, and o ca y ou ex ensi e spa io- empo al
s udies.
iii) Using gene alis p ime s, i is possible o iden i y he p ey and he
p eda o DNA simul aneously. Thus, i is possible o passi ely collec ba
d oppings e en om mixed species colonies wi hou he isk o
misiden i ying he samples. Compa ed o ob aining aeces a e apping
indi idual animals, passi e sample collec ion allows o colonies o be
epea edly sampled h oughou he b eeding season wi h minimal
impac on he animal’s well-being.
The no ch-ea ed ba is p o ec ed by he EU Habi a s di ec i e (Council
Di eci e 92/43/EEC 1992) and was conside ed o be “Vulne able” by he IUCN
un il 2008 because o declines in popula ion numbe s (Pi accini, 2016). E en
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
27
hough i s global s a us has imp o ed, he species emains classi ied as
“Vulne able” in Spain (Que glas, 2007) and i s s a us has eceded o
“Endange ed” in Po ugal (Augus o, 2023). Iden i ica ion o impo an p ey and
eeding g ounds is pa amoun o he adequa e conse a ion o his ba species
(F ick e al., 2024). Gi en he appa en a iabili y in i s ophic ecology be ween
geog aphical a eas, expanding he basic knowledge abou i s eeding habi s is he
i s s ep o design adequa e managemen plans.
Aims and s uc u e o he hesis
In summa y, he main aim o his hesis is o p esen an in-dep h s udy on he
ophic niche, die a y composi ion and die a y a iabili y o he no ch-ea ed ba
(Myo is ema gina us) in sou h-wes e n Eu ope using molecula echniques o
species le el axonomic iden i ica ion.
The speci ic objec i es o he hesis a e:
1- To p esen he i s e e ully speci ic composi ion o he die M.
ema gina us in he Ibe ian Peninsula using DNA me aba coding, o
desc ibe he unc ional cha ac e is ics o he mos consumed p ey species
and ela e hem o he o aging ecology o Myo is ema gina us. Based on
he ecomo phological cha ac e is ics o he species, I expec non- olan
p ey such as spide s o be consumed in abundance.
2- To analyse he seasonal a iabili y o he die o he no ch-ea ed ba in a
empe a e oceanic a ea h oughou a whole ma e ni y season. I expec he
die a y composi ion o change h oughou he b eeding season, and
espond o changes in esou ce a ailabili y, specially ega ding he
consump ion o diu nal lies.
3- To s udy he ela ionship be ween die a y composi ion and p ey choice
by he no ch-ea ed ba in ela ion o he land co e and a ming p essu e
a ound hei colonies. I expec he p e alence o lies in he die o be
ela ed o li es ock a ming a ound he colony.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
34
Spi zenbe ge F, Weiss E (2020). Time keeping in emale Myo is ema gina us du ing ep oduc ion
(Chi op e a: Vespe ilionidae). Lynx New Se ies, 51(1):131–145.
h ps://doi.o g/10.37520/lynx.2020.010
Spi zenbe ge F, Weiss E (2021). Ene gy sa ing in day- oos ing emale Myo is ema gina us du ing
ep oduc ion (Chi op e a: Vespe ilionidae). Lynx New Se ies, 52(1):105–117.
h ps://doi.o g/10.37520/lynx.2021.008
S a ik N, Gö e T, Zelle U (2021). Spa ial beha io and habi a use o wo sympa ic ba species.
Animals, 11(12): 3460. h ps://doi.o g/10.3390/ani11123460
S eck CE, B inkmann R (2006). The ophic niche o he Geo oy’s ba (Myo is ema gina us) in
sou h-wes e n Ge many. Ac a Chi op e ologica, 8(2):445–450.
h ps://doi.o g/10.3161/1733-5329(2006)8[445: no g]2.0.co;2
S ephens DW (2008). Decision ecology: Fo aging and he ecology o animal decision making.
Cogni i e, A ec i e, & Beha io al Neu oscience, 8(4):475–484.
h ps://doi.o g/10.3758/cabn.8.4.475
S ephens DW, K ebs JR (1986). Fo aging heo y (Vol. 1). P ince on Uni e si y P ess.
h ps://doi.o g/10.2307/j.c s32s6b
S idshol L, Hubanche a A, G ei S, Goe li z HR, Johnson M, Yo el Y, Madsen PT (2023).
Echoloca ing ba s p e e a high isk-high gain o aging s a egy o inc ease p ey p o i abili y.
eLi e, 12:e84190. h ps://doi.o g/10.7554/eli e.84190
Symondson WOC (2002). Molecula iden i ica ion o p ey in p eda o die s. Molecula Ecology,
11(4):627–641. h ps://doi.o g/10.1046/j.1365-294x.2002.01471.x
Taweesub C, Tanalgo KC, S i ongchuay T, Hughes CA (2022). Unde s anding global pa e ns o
insec i o ous ba die a y esea ch. Ba bas ella, 14(1):134–144.
h ps://doi.o g/10.14709/ba bj.14.1.2021.12
Teeling EC, Sp inge MS, Madsen O, Ba es P, O’B ien SJ, Mu phy WJ (2005). A molecula
phylogeny o ba s illumina es biogeog aphy and he ossil eco d. Science, 307(5709):580–
584. h ps://doi.o g/10.1126/science.1105113
Tiede J, Diepenb uck M, Gadau J, Wemheue B, Daniel R, Sche be C (2020). Seasonal a ia ion in
he die o he se o ine ba (Ep esicus se o inus): A high- esolu ion analysis using DNA
me aba coding. Basic and Applied Ecology, 49:1–12.
h ps://doi.o g/10.1016/j.baae.2020.09.004
Tobisch C, Dege S, Panassi i B, T e le J, Moning C (2025). Me aba coding he nigh sky:
Moni o ing landscape-scale insec di e si y h ough ba die . Basic and Applied Ecology,
83:128–135. h ps://doi.o g/10.1016/j.baae.2025.01.012
Ue z GW, Halaj J, Cady AB (1999). Guild s uc u e o spide s in majo c ops. Jou nal o
A achnology, 27:270–280.
Uhle J, Redlich S, Zhang J, Ho ho n T, Tobisch C, Ewald J, Tho n S, Seibold S, Mi esse O,
Mo iniè e J, Bozice ic V, Benjamin CS, Englmeie J, F icke U, Ganuza C, Haensel M, Riebl R,
Rojas-Bo e o S, Rummle T, Uphus L, Schmid S, S e an-Dewen e I, Mülle J (2021).
Rela ionship o insec biomass and ichness wi h land use along a clima e g adien . Na u e
Communica ions, 12(1):5946. h ps://doi.o g/10.1038/s41467-021-26181-3
U izl M, Benda P (2022). In aspeci ic a ia ion o Myo is ema gina us (Chi op e a:
Vespe ilionidae) in e ed om mi ochond ial and nuclea gene ic ma ke s. Ac a
Chi op e ologica, 23(2):285–300. h ps://doi.o g/10.3161/15081109acc2021.23.2.002
Ves e inen EJ, Puis o AIE, Blombe g AS, Lilley TM (2018). Table o i e, please: Die a y
pa i ioning in bo eal ba s. Ecology and E olu ion, 8(22):10914–10937.
h ps://doi.o g/10.1002/ece3.4559
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
35
Zahn A, Baue S, K ine E, Holzhaide J (2010). Fo aging habi a s o Myo is ema gina us in Cen al
Eu ope. Eu opean Jou nal o Wildli e Resea ch, 56(3):395–400.
h ps://doi.o g/10.1007/s10344-009-0331-y
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
CHAPTER 2: The die o he no ch-ea ed ba
(Myo is ema gina us) ac oss he Ibe ian
Peninsula analysed by amplicon-
me aba coding
The con en s o his chap e we e published in he ollowing pape :
Vallejo N, Aiha za J, Goi i U, A izabalaga-
Escude o A, Flaque C, Puig X, Aldaso o M, Ba oja
U, Ga in I (2019). The die o he no ch-ea ed ba
(Myo is ema gina us) ac oss he Ibe ian Peninsula
analysed by amplicon me aba coding. Hys ix
30(1):59–64. h ps://doi.o g/10.4404/hys ix-
00189-2019
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
39
Au ho ’s no e
This chap e ep oduces wo k o iginally pe o med in 2018 and published in
2019. A he ime o he s udy, PERMANOVA was applied wi hou es ing o
homogenei y o dispe sions (e.g., wi h be adispe ). This ep esen s a
me hodological limi a ion, so he esul s o his analysis should be in e p e ed
wi h cau ion. In la e chap e s, his issue is add essed explici ly. The au ho
belie es ha his me hodological sho coming does no impac he o e all
signi icance o he esul s, no he main conclusions eached ega ding he
die a y desc ip ion o M. ema gina us.
Abs ac
Myo is ema gina us is one o he ew ba s known o eed mos ly on spide s. In
o de o s udy he impo ance o his ype o p ey, we analysed he species’ die
in i e colonies ac oss he Ibe ian Peninsula using amplicon me aba coding in
o de o desc ibe i s composi ion a he species le el and analyse i s geog aphic
a iabili y wi hin he peninsula. We iden i ied 138 p ey species, belonging o 11
di e en a h opod o de s. Among hem, 45 species o spide s we e iden i ied,
mos ly o he o b-web building guild, as consumed by 82 ou o 106 s udied ba s,
co esponding o e e y colony and season sampled. Besides, lepidop e ans and
dip e ans we e also consumed in e e y colony. Among he la e , he s able ly
S omoxys calci ans was especially impo an in wo o he colonies, showing ha
M. ema gina us can also oppo unis ically exploi di e en esou ces o o aging
g ounds, such as ca le sheds, which a ec s he composi ion o i s die e en a
he o dinal le el o p ey.
Keywo ds
A aneae, die , DNA me aba coding, Myo is ema gina us, geog aphical
a ia ion.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
40
In oduc ion
Despi e hei p edominan ly insec i o ous beha iou , mos Palea c ic ba s
show a wide a ie y o ophic s a egies. Wing mo phology and echoloca ion
cha ac e is ics o ba s in luence he way hey in e ac wi h he o aging
en i onmen , and he e o e, he p ey hey ind and consume (Em ich e al.,
2014). On op o ha , local o seasonal changes in ood a ailabili y will ine i ably
a ec he inal composi ion o hei die (Kunz e al., 2011). Finally, coexis ence
wi h o he ba species and he mechanisms d i ing he speci ic alloca ion o
esou ces can also be impo an ac o s ha shape he ophic niche o ba s
(Chesson, 2000; Adle e al., 2007; Salsamendi e al., 2012; Viglino e al., 2016;
A izabalaga-Escude o e al., 2018; Schoeman and Monadjem, 2018).
Amongs he p ima ily insec i o ous Eu opean ba s, Myo is ema gina us is
he only one known o eed mos ly on spide s (Goi i e al., 2011; Ke yn e al.,
2012). Wo ldwide, a die based on spide s has only been desc ibed in wo mo e
ba species: Myo is keenii in No h Ame ica (Bu les e al., 2008), and Ke i oula
papuensis in Aus alia (Schulz, 2000). Spide consump ion on hese wo species
is hough o be linked o o aging in clu e ed en i onmen s and gleaning o e
immobile p ey. Myo is ema gina us shows a simila o aging s a egy, a ou ing
clu e ed o es s o a eas o complex ege a ion o hun ing (Zahn e al., 2010;
Goi i e al., 2011; Dekke e al., 2013), bu also gleaning lies o he walls o ca le-
ba ns (K ull e al., 1991). The p ecise mechanism used o ca ch spide s, howe e ,
emains unknown.
Spide consump ion by M. ema gina us eaches almos 80% o he die ’s bulk
in me idional popula ions (Goi i e al., 2011) and in Cen al Eu ope (Baue o á,
1986). Howe e , in some colonies in Cen al and No h-wes e n Eu ope, a die
ich in ca le- lies has also been epo ed, linked o o aging inside ca le-ba ns
(Beck, 1995; Ke yn e al., 2012). E en in hese ci cums ances, spide
consump ion s ill eaches 25% o he o al die (Ke yn e al., 2012). Fu he ,
Ke yn e al. (2012) isually iden i ied se en species o spide s in he aeces o
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
41
M. ema gina us, and Galan e al. (2018) lis ed 16 spide species in he aeces o
en M. ema gina us indi iduals h ough DNA me aba coding.
Apa om M. ema gina us o he Eu opean ba species also consume spide s
al hough hey a e seldom he p ima y ood sou ce. Fo ins ance, Pleco us au i us
and some popula ions o bo eal ba s (Razgou e al., 2011; Ves e inen e al.,
2018) consume spide s occasionally. O he Eu opean ba species, such as Myo is
na e e i o Myo is myo is, p ey upon spide s as an al e na i e ood esou ce in
imes o lowe insec abundance o sca ci y o p e e ed p ey (Ramos-Pe ei a e
al., 2002; Hope e al., 2014).
Ne e heless, spide s do no ep esen a single unc ional p ey o ba s. A
a ie y o unc ional g oups, o guilds, ha e been iden i ied acco ding o hei
own hun ing beha iou and web s uc u e (Ue z e al., 1999). Non-web building
o wande ing spide s, o ins ance, should be de ec ed on and cap u ed di ec ly
om he g ound o ege a ion by gleaning (Hope e al., 2014). Con e sely, web-
building spide s could be cap u ed om hei webs by gleaning (Ke yn e al.,
2012) o hawking (Goi i e al., 2011). Finally, small spide species capable o
“ballooning” migh also be cap u ed by ae ial hawking (Hope e al., 2014). Hence,
he unc ional a ailabili y o a gi en spide species o ba s will depend la gely on
he guild he p ey belongs o.
Di icul ies o accu a ely iden i y a h opod axa by ex e nal mo phological
ai s hampe he lis ing o he ba ’s p ey a he species le el, which, i o e come,
would allow desc ibing he unc ional cha ac e is ics and li es yle o he spide
p ey. The ecen applica ion o molecula me hods o die s udies (Pompanon e
al., 2012) enables a mo e comple e ep esen a ion o he axonomical and
unc ional di e si y o spide s a he species le el (Galan e al., 2018). O b-web
building o ae ial-web building spide s ha e been p oposed as p ey o spide
specialis ba s (Schulz, 2000; Bu les e al., 2008; Goi i e al., 2011), which i s wi h
he species iden i ied in he aeces o M. ema gina us so a (Ke yn e al., 2012;
Galan e al., 2018).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
42
Ou main goals we e o assess he impo ance o spide s in he die o M.
ema gina us, as well as hei axonomical and unc ional di e si y, in a la ge
geog aphical ange. In o de o do so, we analysed he a iabili y o he die a y
composi ion ac oss i e colonies in he Ibe ian Peninsula. In addi ion, we
analysed seasonal a iabili y in wo o he colonies. P e ious s udies ha e shown
a iabili y in he die a y composi ion and ype o o aging g ounds o M.
ema gina us ac oss loca ions (Baue o á, 1986; Goi i e al., 2011; Ke yn e al.,
2012), which is common in ba s, especially a a b oad geog aphical scale (Cla e
e al., 2014a; Aizpu ua e al., 2018). The e o e, co e ing a la ge geog aphical
ange is impo an o e lec he mos comple e niche b ead h (Aizpu ua e al.,
2018).
Ma e ials and Me hods
S udy a ea
Ba s we e cap u ed in i e di e en loca ions along he No he n (Colonies
N1, N2 and N3) and Eas e n coas s (Colonies E1 and E2) o he Ibe ian Peninsula
(Fig. 1), in o de o co e a b oad geog aphical ange. All he chosen loca ions a e
s able b eeding colonies o M. ema gina us alone o wi h o he ba species, and
we e p e iously known by he esea ch eam, o ensu e ha all sampling could
be made in a single nigh ieldwo k, he e o e a oiding excessi e s ess on
indi iduals o any species occupying he same oos .
The clima e in colonies N2 and N3 is empe a e oceanic, due o he p oximi y
o he A lan ic Ocean (AEMET and IMP, 2011, p. 17). N2 is in an a ea whe e open
pas u es o ca le a e abundan ; while colony N3 is mainly su ounded by
coni e plan a ions. Colony N1, on he o he hand, is u he om he coas and
he e o e has a wa me and d ie clima e, ansi ional be ween empe a e
oceanic and Medi e anean (AEMET and IMP, 2011, p. 17); he a ea is co e ed
by coni e o es s and sc ublands. The eas e n colonies, E1 and E2, ha e
Medi e anean clima e: wa m a e age empe a u es wi h summe d ough s
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
43
(AEMET and IMP, 2011, p. 17), whe e land use consis s mos ly o open
ag icul u al a eas. Coni e o es s a e also common nea E1.
Figu e 1. Sampling si es.
Sample collec ion
Each loca ion was sampled on a single nigh in summe o 2012, and colonies
N2 and N3 in sp ing as well. Ba s we e cap u ed en e ing he oos a e he
o aging bou using a ha p ap (Tu le, 1974) and kep in indi idual clo h bags
un il hey de eca ed (maximum 40 min). A e wa ds, he ba s’ sex and age we e
de e mined, and he animals we e immedia ely eleased in o he oos . Faeces
we e ozen wi hin 6 hou s. A o al o 92 ba s we e cap u ed du ing he b eeding
season o 2012: 12 ba s in colony N1, 29 ba s in colony N2, 28 ba s in colony N3,
17 ba s in colony E1 and 6 ba s in colony E2. Se en addi ional indi iduals om
bo h N2 and N3 we e sampled in May o 2012.
E hics s a emen
Cap u e and manipula ion o ba s we e pe o med acco ding o he guidelines
o ea men o animals in esea ch and eaching (She win, 2012), and we e
app o ed by he E hics Commi ee a he Uni e si y o he Basque Coun y (Re .
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
50
species) and g ound unne s (one species) (Ue z e al., 1999; Robe s, 1995).
Al oge he , he species iden i ied belonged o 12 amilies (Table 1).
Table 1. Guild classi ica ion o iden i ied spide species acco ding o Ue z e al.,
1999 and Robe s, 1995.
Family
Species
Guild classi ica ion
Agelenidae
Agelena ea edii
Funnel-web builde
E a igena a ica
Funnel-web builde
Tegena ia domes ica
Funnel-web builde
Tegena ia pa ie ina
Funnel-web builde
Anyphaenidae
Anyphaena accen ua a
Foliage unne
A aneidae
A aneus angula us
Ve ical O b-web builde
A aneus diadema us
Ve ical O b-web builde
A aneus s u mi
Ve ical O b-web builde
A anues igu a us
Ve ical O b-web builde
A aniella cucu bi ina
Ve ical O b-web builde
A giope b uennichi
Ve ical O b-web builde
A giope loba a
Ve ical O b-web builde
Cy opho a ci icola
Ho izon al web builde
Gibba anea gibbosa
Ve ical O b-web builde
La inioides co nu us
Ve ical O b-web builde
La inioides sclope a ius
Ve ical O b-web builde
Mango a acalypha
Ve ical O b-web builde
Neoscona sub usca
Ve ical O b-web builde
Nuc enea umb a ica
Ve ical O b-web builde
Singa ni idula
Ve ical O b-web builde
Zilla diodia
Ve ical O b-web builde
Zygiella sp.
Ve ical O b-web builde
Clubionidae
Clubiona b e ipes
Foliage unne
Clubiona com a
Foliage unne
Eu ichu idae
Cei acan hium elegans
Foliage unne
Gnaphosidae
Sco ophaeus blackwallii
G ound unne
Philod omidae
Philod omus collinus
S alke /Ambushe
Philod omus p aeda us
S alke /Ambushe
Te agna hidae
Te agna ha ex ensa
Ve ical O b-web builde
Te agna ha mon ana
Ve ical O b-web builde
Te agna ha nig i a
Ve ical O b-web builde
Te agna ha ob usa
Ve ical O b-web builde
The idiidae
Enoplogna ha sp.
Space-web builde
Episinus maculipes
Space-web builde
Pa as ea oda epida io um
Space-web builde
Pla nickina inc a
Space-web builde
Rhomphaea c . os a a
Space-web builde
Rhompaea nasica
Space-web builde
S ea oda g ossa
Space-web builde
The idion melanu um
Space-web builde
The idion a ians
Space-web builde
Thomsidae
Xys icus lanio
Ambushe
Ulobo idae
Hyp io es la idus
Ve ical O b-web builde
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
51
The hun ing s a egy o he spide s occu ing in he die o M. ema gina us
a ied be ween colonies du ing he summe (F = 3.982, d = 4, p = 0.034): pos -
hoc compa isons g ouped he composi ion o spide ai s in colonies E1 and N1
om colonies N2 and N3 ( o all signi ican pai wise es s: F > 4.065, d = 1, p <
0.035); any pai wise compa ison in ol ing E2 was no signi ican . O b-web
building spide s o he amily A aneidae we e he mos common spide p ey in
all colonies (Fig. 4): hei consump ion was highes in colony E2, whe e all
iden i ied spide s belong o his g oup; ollowed by N1 and E1, in which o b-web
building spide s eached 90.9% and 80% o occu ences espec i ely. In summe
colonies N2 and N3, he incidence o o b-web building spide s was less
p ominen han elsewhe e (POO < 54%), as o he spide guilds such as space-
web builde s we e consumed in g ea e numbe s (POO > 15%); and in N2 unnel-
web builde s a e 23% o he spide s consumed. Finally, non-web building
spide s we e also consumed, albei occasionally, in e e y colony excep E1 and
E2 (Fig. 4).
We also ound signi ican di e ences in he ai s o spide s consumed in
di e en seasons (F = 3.072, d = 1, p = 0.004), bu none o he pai wise pos -hoc
es s we e signi ican . None heless, he consump ion o o b-web building spide s
did inc ease a he sp ing colonies, as all ba s s udied consumed hem, as
opposed o 48.3% o ba s in colony N2, and 57.1% in colony N3 du ing he
summe .
Figu e 4. Pe cen o occu ence (POO) o spide guilds iden i ied in he die om each
colony. (H O b-webs: Ho izon al o b-webs; V O b-webs: Ve ical o b-webs).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
52
Discussion
Spide s we e he mos commonly consumed p ey o de , being iden i ied in a
o al o 82 ou o 106 ba s’ aeces. The equency o occu ence o spide s in ou
locali ies was in he 62.1-100% ange. Wo ldwide, spide emains ha e been
ound in 99% o he aeces o K. papuensis analysed in Aus alia (Schulz, 2000);
while in he case o M. keenii in No h Ame ica, spide consump ion was eco ded
in 80% o he cases (Bu les e al., 2008). The e o e, o ou knowledge M.
ema gina us is he hi d ba species o i s kind desc ibed o da e. Spide s ha e
also been iden i ied in he aeces o o he ba species in No h Ame ica (Whi ake
e al., 1977; Whi ake , 2004; Kellne and Ha es ad, 2005), and Eu ope (Ramos-
Pe ei a e al., 2002; Razgou e al., 2011; Hope e al., 2014); hough hei FOO
does no exceed 25%.
O e all, he die o M. ema gina us a ied be ween loca ions. The di e ences
o a h opod communi ies migh p omo e he obse ed a ia ions in he die
be ween colonies, mainly a he species le el, a likely ou come gi en he
gene alis p eda o y cha ac e o ba s and he in e colonial di e ences in
landscape and clima e (Cla e e al., 2014a; Viglino e al., 2016: Aizpu ua e al.,
2018). Besides, while a ew axa —e.g.: A. diadema us, A. angula us o S.
calci ans— we e commonly consumed by many indi iduals ac oss colonies, less
equen p ey comp ised mos o he die a y lis , wi h 55% o he species being
consumed by a single ba indi idual (Table S2). Thus, di e ences in he die a y
composi ion we e ampli ied when he p ey species le el was conside ed.
Colonies N1, E1 and E2 show simila die a he o dinal le el, as spide s and
lepidop e ans we e he main p ey. Goi i e al. (2011) desc ibed a compa able die
in Cen al Ibe ian Peninsula and p oposed i as he o aging a che ype closes o
he ba ’s o iginal si ua ion. In bo h s udies, he colonies s udied we e in a eas o
wa me , d ye clima e o Medi e anean cha ac e is ics. E en hough M.
ema gina us is a ba mos ly ound along he Medi e anean (Pi accini, 2016), he
majo i y o s udies on i s o aging ecology ha e been conduc ed in i s
No he nmos dis ibu ion ange, whe e i o en adop s an oppo unis ic
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
53
o aging beha iou (Beck, 1995; Zahn e al., 2010; Ke yn e al, 2012; Dekke e
al., 2013). This calls a en ion o he ac ha ou cu en iew o M. ema gina us’s
ophic niche could be highly biased, and u he s udies ac oss i s en i e
dis ibu ion ange would help o desc ibe i s ypical o aging beha iou and
p e e ed p ey ypes.
Despi e obse ed specializa ion on spide s in he h ee Medi e anean
colonies, summe esul s in colonies N2 and N3 sugges ha M. ema gina us
shows a ce ain deg ee o lexibili y and adap abili y, which allows i o
oppo unis ically hun ocassionally a ailable p ey and/o exploi di e en
o aging g ounds. Thanks o his oppo unis ace , M. ema gina us would no be
as suscep ible o shi s in p ey abundance as o he s ic ly specialis p eda o s
would be (Maine and Boyles, 2015), which would allow i o success ully adap
o modi ied en i onmen s and an h opogenic landscapes.
We ound ha he die composi ion, and ichness in he case o colony N2,
changed signi ican ly be ween seasons in colonies N2 and N3. O e all, om
sp ing o summe , consump ion o spide s dec eased, while ha o dip e ans
inc eased. On op o ha , in colony N3, hal he ba s s udied consumed A. us icus
du ing summe , bu no du ing he sp ing. I s ela i ely high local equency was
p obably linked o a seasonal inc ease in i s densi y in coni e plan a ions
su ounding he colony. Flaque e al. (2008) also epo ed ha M. ema gina us
o aged in pinewood plan a ions in Medi e anean Ibe ian Peninsula, e en
hough i seems o a oid such o aging g ounds in Cen al Eu ope in a ou o
na i e, deciduous woodlands (Zahn e al., 2010; Dekke e al., 2013).
Summe die o colony N2, and pa ly in N3, esemble hose desc ibed by Beck
(1995) and Ke yn e al. (2012): he p ima y ood sou ce a e dip e ans, ollowed
by spide s. The abundance o lies such as Musca sp. and S. calci ans in he die
o M. ema gina us has been linked o he use o ca le sheds as o aging g ounds,
as epo ed in colonies o Cen al Eu ope (Ke yn e al., 2012; Dekke e al.,
2013). Ca le a e abundan in colony N2 (108 cows/km2, www.bizkaia.eus), and
open g asslands and pas u es mos ly co e he su ounding a ea. This
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
54
hypo hesis is suppo ed by he ac ha aces o bo ine DNA we e iden i ied in
he aeces o 30 ou o he 47 ba s ha consumed S. calci ans in colonies N2 and
N3. In his case, he de ec ion o cow DNA would be a esul o seconda y
p eda ion o lies on cow blood (Sheppa d e al., 2005; Pa a e al., 2018).
The p esence o S. calci ans a ound li es ock can cause se e al nega i e
e ec s on he ca le, causing educ ion o weigh and/o milk p oduc ion, and
ac ing as a ec o o disease ( e iewed in Pa a e al., 2018). In ou s udy, S.
calci ans was he mos equen ly consumed p ey species, as i was iden i ied in
58% o ba s in o al, and in 82% o ba s speci ically in he summe colonies N2
and N3. Due o he huge numbe o insec s consumed by an indi idual pe nigh
and hei gene alis na u e, ba s ha e o en been men ioned as po en ial op-
down supp esso o ag icul u al insec pes s (Kunz e al., 2011). The high FOO
alues o S. calci ans sugges ha M. ema gina us could ac as a po en ial
supp esso o ca le lies, as well as o he insec s which, in high densi ies, cause
ha m o ca le.
Cow sheds can be a con enien sou ce o p ey o many ba species
h oughou he yea (Dekke e al., 2013); hey p o ide a mo e cons an sou ce
o insec s o ba s (Zahn e al., 2010), as hey a e less a ec ed by local wea he
and empe a u e d ops. Ne e heless, he highe occu ence o s able lies
eco ded du ing he summe does no seem o suppo his hypo hesis; ins ead,
an inc ease in he densi ies o lying insec s, including ca le ela ed lies like S.
calci ans, Musca au umnalis o Muscina s abulans, linked o wa me summe
empe a u es (LaB eque e al., 1972) is a mo e likely explana ion.
Rega ding spide s, mos species consumed belong o he e ical o b-web
building guild, which we e especially p ominen in colonies N1, E1 and E2. These
ha e also been p oposed as he main guild consumed by o he spide specialis
ba s (Schulz, 2000; Bu les e al., 2008). M. ema gina us mos likely hun s hem
di ec ly om hei webs and could also eed on insec s apped on hem.
Howe e , he exac mechanism used o de ec and ca ch spide s while in hei
webs is no clea , as bo h gleaning (Schulz, 2000; Ke yn e al., 2012) and
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
55
hawking (Goi i e al., 2011) ha e been p oposed as possible s a egies. The
consump ion o o he ypes o p ey sugges s ha M. ema gina us does ha e he
abili y o glean. Diu nal lies such as Musca sp. o S. calci ans could be hun ed
om ca le-shed walls by gleaning (K ull e al., 1991), and/o s olen om o b-
webs whe e hey go apped; and non-web building spide s such as Anyphaena
accen ua a, Clubiona com a o Xys icus lanio we e likely caugh om he su ace
o he ege a ion.
The o e all abundance o o b- and space-web building spide s in all colonies
indica es ha en i onmen s o clu e ed ege a ion, e.g. inside o es s, a e he
mos likely o aging g ounds o M. ema gina us (Dekke e al., 2013; Flaque e
al., 2008; Zahn e al., 2010). Abundance and di e si y o ae ial-web building
spide s is highe in such a eas, as hey p o ide plen y o ancho ing poin s o
build hei webs (Bal ou and Ryps a, 1998). Funnel-web builde s, on he o he
hand, build hei webs close o he g ound, and a e commonly ound inside
buildings (Robe s, 1995); he e o e, hei consump ion may be linked o he use
o such o aging g ounds, especially in colony N2.
Gleaning and o aging in clu e ed en i onmen s a e sha ed cha ac e is ics
be ween he o he spide specialis ba s, and a e hough o be impo an in he
de elopmen o such die a y specializa ion (Schulz, 2000; Bu les e al., 2008).
Howe e , hey a e no mu ually exclusi e, as hey a e also ound amongs o he
ba species. Fo example, P. au i us, Myo is bechs einii, M. myo is o M. na e e i,
o es species which a e known o glean o e p ey (No be g and Rayne , 1987;
Ande son and Racey, 1991; A le az, 1996; Napal e al., 2013; Swi and Racey,
2002), al hough hey do no depend on spide s as ex ensi ely as M. ema gina us
(Beck, 1995; Ramos-Pe ei a e al., 2002; Razgou e al., 2011; Hope e al., 2014).
Spide s, being p eda o s, a e less abundan han o he a h opod axa (Pimm,
1988), which may explain why e y ew ba species consume hem in g ea
quan i ies. While such die a y specializa ion may allow spide ea ing ba s o
educe compe i ion, i is also ad an ageous when he abundance o o he
esou ces, mainly lying insec s, is lowe due o ad e se wea he condi ions
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
56
(Bu les e al., 2009), o du ing seasons o lowe insec abundance. This
emphasizes he uniqueness o M. ema gina us and o he spide specialis ba s
ega ding die a y choices, and hin s a speci ic adap a ions ega ding senso ial
ecology and beha iou .
Conclusions
Using molecula echniques, we s udied he die o i e colonies o M.
ema gina us a wo di e en seasons, and we we e able o iden i y a o al o 138
p ey species, 45 o which we e spide s. These esul s assu e ha hese p eys play
an impo an ole in he die o M. ema gina us and s ess i s uniqueness amongs
Eu opean ba s. In ac , M. ema gina us seems o ocus a g ea pa o i s die on
spide s, p incipally hose belonging o he e ical o b-web building guild, which
a e p esumably caugh di ec ly om hei webs in clu e ed en i onmen s. The
exac mechanisms in ol ed in he de ec ion and ob aining o such p ey a e no
ye unde s ood. This knowledge could po en ially p o ide insigh s in o why hey
a e so a ailable o M. ema gina us, while a ely eco ded in he die o o he
Eu opean o es species. On he o he hand, colonies N2 and N3 also showed ha
M. ema gina us has a ce ain deg ee o geog aphical and seasonal a iabili y, and
can oppo unis ically exploi di e en esou ces, which emphasizes he ac ha
bo h landscape use and o e all esou ce a ailabili y ul ima ely shape he
o aging niche o a ba popula ion.
Re e ences
Adle PB, HilleRisLambe J, Le ine JM (2007). A niche o neu ali y. Ecology Le e s, 10(2):95–
104. h ps://doi.o g/10.1111/j.1461-0248.2006.00996.x
Agencia Es a al de Me eo ología de España (AEMET), Ins i u o de Me eo ologia de Po ugal (IMP)
(2011). A las climá ico Ibé ico. Tempe a u a del ai e y p ecipi ación (1971-2000). Mad id,
Minis e io de Medio Ambien e, Ru al y Ma ino. h ps://doi.o g/10.31978/784-11-002-5
Aizpu ua O, Budinski I, Geo giakakis P, Gopalak ishnan S, Ibañez C, Ma a V, Rebelo H, Russo D,
Szodo ay-Pá adi F, Zhalyazko a V, Z nicic V, Gilbe MTP, Albe di A (2018). Ag icul u e
shapes he ophic niche o a ba p eying on mul iple pes a h opods ac oss Eu ope:
E idence om DNA me aba coding. Molecula Ecology, 27(3):815–825.
h ps://doi.o g/10.1111/mec.14474
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
57
Albe di A, Aizpu ua O, Gilbe MTP, Bohmann K (2017). Sc u inizing key s eps o eliable
me aba coding o en i onmen al samples. Me hods in Ecology and E olu ion, 9(1):134–147.
h ps://doi.o g/10.1111/2041-210X.12849
Ande son ME, Racey PA (1991). Feeding beha iou o cap i e b own long-ea ed ba s, Pleco us
au i us. Animal Beha iou , 42(3):489–493. h ps://doi.o g/10.1016/S0003-3472(05)80048-
X
A le az R (1996). Fo aging beha iou o he gleaning ba Myo is na e e i (Chi op e a,
Vespe ilionidae) in he Swiss Alps. Mammalia, 60(2):181–186.
h ps://doi.o g/10.1515/mamm.1996.60.2.181
A izabalaga-Escude o A, Cla e E, Salsamendi E, Albe di A, Ga in I, Aiha za J, Goi i U (2018).
Assessing niche pa i ioning o co-occu ing sibling ba species by DNA me aba coding.
Molecula Ecology, 27(5):1273–1238. h ps://doi.o g/10.1111/mec.14508
Bal ou RA, Ryps a AL (1998). The in luence o habi a s uc u e on spide densi y in a non- ill
soybean ag oecosys em. The Jou nal o A achnology, 26(2):221–226.
Baue o á Z (1986). Con ibu ion o he ophic bionomics o Myo is ema gina us. Folia Zoologica,
35(4):305–310.
Beck A (1995). Fecal analyses o Eu opean ba species. Myo is, 32-33:109–119.
Bizkaiko Fo u Aldundia – Dipu ación Fo al de Bizkaia. Censos Ganade os. 30/08/2018. Re ie ed
om h p://www.bizkaia.eus/nekaza i za/ganade ia/censos/
Benjamini Y, Hochbe g Y (1995). Con olling he alse disco e y a e: a p ac ical and powe ul
app oach o mul iple es ing. Jou nal o he Royal S a is ical Socie y. Se ies B, 57(1):289–300.
Bu les DW, B igham RM, Ring RA, Reimchen TE (2008). Die o wo insec i o ous ba s, Myo is
luci ugus and Myo is keenii, in ela ion o a h opod abundance in a empe a e Paci ic
No hwes ain o es en i onmen . Canadian Jou nal o Zoology, 86(12):1367–1375.
h ps://doi.o g/10.1139/Z08-125
Bu les DW, B igham RM, Ring RA, Reimchen TE (2009). In luence o wea he on wo
insec i o ous ba s in a empe a e Paci ic No hwes ain o es . Canadian Jou nal o Zoology,
87(2):132–138. h ps://doi.o g/10.1139/Z08-146
Chao A, Jos J (2012). Co e age-based a e ac ion and ex apola ion: s anda dizing samples by
comple eness a he han size. Ecology, 93(12):2533–2347. h ps://doi.o g/10.1890/11-
1952.1
Chesson P (2000). Mechanism o main enance o species di e si y. Annual Re iew o Ecology,
E olu ion and Sys ema ics, 31:343–366. h ps://doi.o g/10.1146/annu e .ecolsys.31.1.343
Cla e EL, Symondson WOC, B ode s H, Fabianek F, F ase EE, MacKenzie A, Boughen A, Hamil on
R, Willis CKR, Ma inez-Nuñez F, Menzies AK, No quay KJO, B igham M, Poissan J, Rin oul J,
Ba clay RMR, Reime JP (2014a). The die o Myo is luci ugus ac oss Canada: assessing
o aging quali y and die a iabili y. Molecula Ecology, 23(15):3618–3632.
h ps://doi.o g/10.1111/mec.12542
Cla e EL, Symondson WOC, Fen on MB (2014b). An ino dina e ondness o bee les? Va ia ion in
seasonal die a y p e e ences o nigh - oos ing big b own ba s (Ep esicus uscus). Molecula
Ecology, 23(15):3633–3647. h ps://doi.o g/10.1111/mec.12519
Deagle BE, Thomas AC, McInnes JC, Cla ke LJ, Ves e inen EJ, Cla e EL, Ka zinel TR, E eson JP
(2018). Coun ing wi h DNA in me aba coding s udies: How should we con e sequence
eads o die a y da a? Molecula Ecology, 28(2):391–406.
h ps://doi.o g/10.1111/mec.14734
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
58
Dekke JJA, Regelink JR, Jansen EA, B inkmann B, Limpens HJGA (2013). Habi a use by emale
Geo oy’s ba (Myo is ema gina us) a i s wo no he nmos ma e ni y oos s and he
implica ions o hei conse a ion. Lu a, 56(2):111–120.
Edga RC (2010). Sea ch and clus e ing o de s o magni ude as e han BLAST. Bioin o ma ics,
16(19):2460–2461. h ps://doi.o g/10.1093/bioin o ma ics/b q461
Edga RC, Fly bje g H (2014). E o il e ing, pai assembly and e o co ec ion o nex -
gene a ion sequencing eads. Bioin o ma ics. 31(21): 3476–3482.
h ps://doi.o g/10.1093/bioin o ma ics/b 401
Em ich MA, Cla e EL, Symondson WOC, Keonig SE, Fen on MB (2014). Resou ce pa i ioning by
insec i o ous ba s in Jamaica. Molecula Ecology, 23(15):3648–3656.
h ps://doi.o g/10.1111/mec.12504
Flaque C, Puig-Mon se a X, Bu gas A, Russo D (2008). Habi a selec ion by Geo oy’s ba s
(Myo is ema gina us) in a u al Medi e anean landscape: implica ions o conse a ion. Ac a
Chi op e ologica, 10(1):61–67. h ps://doi.o g/10.3161/150811008X331090
Galan M, Pons JB, Tou nay e O, Pie e E, Leuch mann M, Pon ie D, Cha bonell N (2018).
Me aba coding o he pa allel iden i ica ion o se e al hund ed p eda o s and hei p ey:
Applica ion o ba species die analysis. Molecula Ecology Resou ces, 18(3):474–489.
h ps://doi.o g/10.1111/1755-0998.12749
Gille F, Tiouchichine ML, Galan M, Blanc F, Némoz M, Aulagnie S, Michaux JR (2015). A new
me hod o iden i y he endange ed Py enean desman (Galemys py enaicus) and o s udy i s
die , using nex gene a ion sequencing om aeces. Mammalian Biology, 80(6):505–509.
h ps://doi.o g/10.1016/mambio.2015.08.002
Goi i U, Aiha za J, Guiu M, Salsamendi E, Almena D, Napal M, Ga in I (2011). Geo oy’s ba ,
Myo is ema gina us, p eys p e e en ially on spide s in mul is a i ied dense habi a s: a s udy
o o aging ba s in he Medi e anean. Folia Zoologica, 60(1):17–24.
h ps://doi.o g/10.25225/ ozo. 60.i1.a3.2011
Hill MO (1973). Di e si y and e enness: a uni ying no a ion and i s consequences. Ecology,
54:427–473. h ps://doi.o g/10.2307/1934352
Hope RP, Bohmann K, Gilbe MTP, Zepeda-Mendoza ML, Razgou O, Jones G (2014). Second
gene a ion sequencing and mo phological aecal analysis e eal unexpec ed o aging
beha iou by Myo is na e e i (Chi op e a, Vespe ilionidae) in win e . F on ie s in Zoology,
11(1):39. h ps://doi.o g/10.1186/1742-9994-11-39
Hsieh TC, Ma KH, Chao A (2016). iNEXT: iN e pola ion and EXT apola ion o species di e si y. R
package e sion 2.0.12 URL: h p://chao.s a .n hu.edu. w/wo dp ess/so wa e-download/
Kellne AM, Ha es ad AS (2005). Die s o ba s in coas al ain o es on Vancou e Island, B i ish
Columbia. Socie y o No hwes e n Ve eb a e Biology, 86(2):45–48.
Ke yn T, Godin MC, Jocqué R, G oo ae P, Libois R (2012). Web-building spide s and blood-
eeding lies as p ey o he no ch ea ed ba (Myo is ema gina us). Belgian Jou nal o Zoology,
142(1):59–67. h ps://doi.o g/10.26496/bjz.2012.137
K ull D, Schumm A, Me zne W, Neuweile G (1991). Fo aging a eas and o aging beha io in he
no ch-ea ed ba , Myo is ema gina us (Vespe ilionidae). Beha io al Ecology and Sociobiology,
28:247–253. h ps://doi.o g/10.1007/BF00175097
Kunz TH, B aun de To ez E, Baue D, Lobo a T, Fleming TH (2011). Ecosys em se ices p o ided
by ba s. Annals o he New Yo k Academy o Sciences, 1223(1):1–38.
h ps://doi.o g/10.1111/j.1749-6632.2011.06004.x
LaB ecque GC, Mei e DW, Weidhass DE (1972). Dynamics o House Fly and S able Fly
popula ions. The Flo ida En omologis , 55(2):101–106. h ps://doi.o g/10.2307/3493346
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 2: No ch-Ea ed ba ’s die ac oss he Ibe ian Peninsula.
59
Legend e P, Legend e L (2012). Nume ical Ecology. 3 d edi ion. Else ie , Ams e dam.
Maine JJ, Boyles JG (2015). Land co e in luences die a y specializa ion o insec i o ous ba s
globally. Mammal Resea ch, 60(4):343–351. h ps://doi.o g/10.1007/s13364-015-0243-z
Manly BFJ (1997). Randomiza ion, Boo s ap and Mon e Ca lo Me hods in Biology. 3 d Edi ion.
Chapman and Hall, London.
Ma in M (2011). Cu adap emo es adap e sequences om high- h oughpu sequencing eads.
EMBne Jou nal, 17(1):10–12. h ps://doi.o g/10.14806/ej.17.1.200
Ma inez-A bizu P (2019). pai wiseAdonis: Pai wise mul ile el compa ison using adonis. R
package e sion 0.3
Ma a VA, Amo im F, Co ley MFV, McC acken GF, Rebelo H, Beja P (2016). Female die a y bias
owa ds la ge mig a o y mo hs in he Eu opean ee- ailed ba (Tada ida enio is). Biology
Le e s, 12(3):20150988. h ps://doi.o g/10.1098/ sbl.2015.0988
Napal M, Ga in I, Goi i U, Salsamendi E, Aiha za J (2013). Pas de o es a ion o Medi e anean
Eu ope explains he p esen dis ibu ion o he s ic o es dwelle Myo is bechs einii. Fo es
Ecology and Managemen , 293:161–170. h ps://doi.o g/10.1016/j. o eco.2012.12.038
No be g UM, Rayne JMV (1987). Ecological mo phology and ligh in ba s (Mammalia;
Chi op e a): wing adap a ions, ligh pe o mance, o aging s a egy and echoloca ion.
Philosophical T ansac ions o he Royal Socie y o London. B, Biological Sciences,
316(1179):335–427. h ps://doi.o g/10.1098/ s b.1987.0030
Oksanen J, Guillaume Blanche F, F iendly M, Kind R, Legend e P, McGlinn D, Minchin PR, O'Ha a
RB, Simpson GL, Solymos P, Hen y M, S e ens H, Szoecs E, Wagne H (2018). egan:
Communi y Ecology Package. R package e sion 2.5-2. h ps://CRAN.R-
p ojec .o g/package= egan
Pa a G, Behe a P, Das SK, Saikia B, Ghosh S, Biswas P, Kuma A, Alam SS, Kawlni L, Lalnunpuia C,
Lalchhandama C, Bacham M, Debba ma A (2018). S omoxys calci ans and i s impo ance in
li es ock: a e iew. In e na ional Jou nal o Ad ance Ag icul u al Resea ch, 6:30–37.
Pimm S (1988). Ene gy Flow and T ophic S uc u e. Concep s in ecosys em ecology. Sp inge -
Ve lag, New Yo k, New Yo k, USA.
Pi accini R (2016). Myo is ema gina us. The IUCN Red Lis o Th ea ened Species.
e.T14129A22051191. h ps://doi.o g/10.2305/iucn.uk.2016-2. l s. 14129a22051191.en.
Accessed on 13 May 2018.
Pompanon F, Deagle BE, Symondson WOC, B own DS, Ja man SN, Tabe le P (2012). Who is
ea ing wha : Die assessmen using nex gene a ion sequencing. Molecula Ecology,
21(8):1921–1950. h ps://doi.o g/10.1111/j.1365-294X.2011.05403.x
R Co e Team (2018). R: A language and en i onmen o s a is ical compu ing. R Founda ion o
S a is ical Compu ing, Vienna, Aus ia. h ps://www.R-p ojec .o g/
Ramos-Pe ei a MJ, Rebelo H, Rainho A, Palmei im JM (2002). P ey selec ion by Myo is myo is
(Vespe ilionidae) in a Medi e anean egion. Ac a Chi op e ologica, 4(2):189–193.
h ps://doi.o g/10.3161/001.004.0207
Razgou O, Cla e EL, Zeale MRK, Hanme J, Schnell IB, Rasmussen M, Gilbe TP, Jones G (2011).
High- h oughpu sequencing o e s insigh in o mechanisms o esou ce pa i ioning in
c yp ic ba species. Ecology and E olu ion, 1(4):556–570. h ps://doi.o g/10.1002/ece3.49
Robe s MJ (1995). Spide s o B i ain and No he n Eu ope. London, Ha pe Collins.
Salsamendi E, Ga in I, A os egui I, Goi i U, Aiha za J (2012). Wha mechanism o niche
seg ega ion allows he coexis ence o sympa ic sibling hinolophid ba s? F on ie s in Zoology,
9(1):30. h ps://doi.o g/10.1186/1742-9994-9-30
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
66
no ch-ea ed ba has p e iously been s udied in he egion by Vallejo e al. (2019)
and Goi i (unpublished da a) and ound ha bo h spide s and s able lies we e
abundan , he la e , especially du ing he summe mon hs. Based on hese
esul s, we expec ed he die composi ion and di e si y o a y seasonally and
p ecisely p edic ha 1) he die would be mo e di e se in sp ing han in
summe , 2) he p opo ion o spide s consumed will be high o e all, and 3) he
consump ion o diu nal lies would be highes du ing he summe mon hs. A
dec ease in he die a y di e si y du ing he summe mon hs, and an inc ease in
he p opo ion o ca le lies consumed would indica e ha ca le lies a e an
essen ial ood sou ce o M. ema gina us in his a ea, as i ocuses on hem in
imes o highe o e all esou ce abundance, while i main ains a mo e di e se
die in imes o lowe esou ce abundance (Emlen, 1966).
Ma e ials and Me hods
Sample collec ion
The i e ma e ni y colonies s udied a e wi hin a 27 km adius ( he Basque
Coun y, Sou hwes e n Eu ope) and all a e oos ing in a i icial cons uc ions.
The clima e in he egion is empe a e oceanic, wi h mild empe a u es
h oughou he yea (mean: 14ºC) and abundan p ecipi a ion (1200-2000mm).
The landscape a ound all colonies is highly modi ied by human ac i i y, as pine
and eucalyp us plan a ions a e common in he egion.
Ba anbio (BA) – A a m house, whe e a ound 100 M. ema gina us sha e he
oos wi h 40 Rhinolophus e umequinum. The colony is su ounded by
coni e ous and eucalyp us plan a ions on a 5 km adius, bu u he away (up o
10 km) b oad-lea ed o es s, pas u es, he baceous c ops and sc ubland a e
a ailable.
E eño (ER) – An emp y building in an abandoned qua y gi es oos o up o
50 M. ema gina us. A ound 15 R. e umequinum and occasionally some R.
eu yale a e also p esen . I is su ounded by a di e se landscape composed o
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 3: Seasonal shi in he die o M. ema gina us
67
b oad-lea ed o es s (including e e g een oak o es s), pine and eucalyp us
plan a ions, and we land.
Lau o (LA) – A ound 20 M. ema gina us oos in an abandoned un inished
wo-s o ey cons uc ion. The a ea is su ounded by ag icul u al land o a ious
ypes and a ew pa ches o b oadlea ed o es s, eucalyp us plan a ions, pas u es
and sc ublands.
Maña ia (MA) – A chu ch aul whe e up o 200 M. ema gina us sha e he
space wi h R. e umequinum. Mos ly b oad-lea ed o es s and pine plan a ions
su ound he a ea.
Zes oa (ZE) – The bigges colony o M. ema gina us in he egion, wi h mo e
han 500 indi iduals, sha ing he oos wi h a ound 100 R. e umequinum and
30 Miniop e us sch eibe sii in an emp y building, igh nex o a i e bed.
Pas u es, meadows, b oad-lea ed o es s and a ew pine plan a ions su ound
he a ea.
We sampled hese i e colonies in he yea 2020. Ba s a ZE a i ed he
ea lies (May 4 h, week 19), and le he la es (Sep embe 3 d, week 36). On he
o he hand, ba s om LA spen he sho es ime in he oos , a i ing he la es
(May 29 h, week 22) and lea ing he ea lies (Augus 5 h, week 32).
We ook special ca e o educe dis u bance o he colonies. E e y o nigh , a
collec o was placed unde he ba s and aeces we e collec ed a e no mo e han
wo days o minimize DNA deg ada ion. We collec ed up o 20 samples o 4-6
pelle s each. In he cases whe e he isk o con amina ion om he aeces o non-
a ge ba species was high, we collec ed up o 40 samples con aining one o wo
pelle s each. Sampling was always conduc ed in e en weeks. Excep ionally, ou
collec ions we e aken in he nex week, al hough hey we e analysed as i hey
we e collec ed in he week be o e: ZE in week 18, ER in week 20, LA in week 28
and BA in week 30.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
68
The numbe o samples included o each colony and da e a ied be ween 8
and 20. In all cases, we aimed o de ec app oxima ely 75% o p ey i ems pe
colony and day (Chao e al., 2014). Sample comple eness was es ima ed using
package iNEXT (Hsieh e al., 2020). Only in se en cases did no he es ima es
each he in ended 75% co e age (Appendix S3.1). Due o budge a y easons we
we e no able o ise he sample size. In o al, 595 samples we e sequenced. One
ex ac ion blank was added e e y 23 samples, and one lib a y blank was
included in e e y MiSeq Run pe o med.
DNA ex ac ion, PCR ampli ica ion and sequencing
The aeces we e weigh ed, and he DNA was ex ac ed using DNeasy
Powe Soil Ki and DNeasy Powe Soil P o Ki (Qiagen) ollowing manu ac u e ’s
ins uc ions wi h some modi ica ions. Fo he ampli ica ion p ocess we used
p ime se FWH1 (Vamos e al., 2017), which a ge s a 180 bp egion o he COI
gene. This p ime se was chosen because: i s , i ampli ies a b oad ange o p ey
axa, and also ampli ies ba DNA (Tou nay e e al., 2020b) which is help ul o
de ec con amina ion om non- a ge ba species in ou samples; and second, i
is longe han o he popula p ime se s used in ba die a y s udies (e.g. Zeale e
al., 2011; Gille e al., 2015), which educes he chance o ampli y DNA om
unwan ed sou ces. Sho e ma ke s can cap u e g ea e di e si y (Elb ech e al.,
2019; Tou nay e e al., 2020b) bu a e also p one o ampli y e y deg aded and
unwan ed DNA coming, o example, om seconda y p eda ion (Galan e al.,
2018). Usually his is no conce ning, bu gi en he ac ha spide s a e expec ed
o be abundan in he die o M. ema gina us, he p obabili y o de ec ing DNA
om seconda y p eda ion inc eases, and i would hampe i s disc imina ion
om posi i e da a.
PCR ampli ica ion was pe o med ollowing Tou nay e e al. (2020b), wi h
modi ica ions. Lib a ies we e buil using Illumina’s Nex e a XT ki , and samples
we e sequenced in Illumina MiSeq. PCR ampli ica ion, DNA lib a y cons uc ion
and sequencing p ocesses we e done a he Genomics and P o eomics Gene al
Se ice (SGIke ) o he Uni e si y o he Basque Coun y (UPV/EHU).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
69
De ails on all labo a o y p ocedu es can be ound in Appendix S3.2.
Sequence analysis and axonomic assignmen
Bioin o ma ic analyses we e done using sea ch (Rognes e al., 2016) and
Cu adap (Ma in, 2011), ollowing he s eps desc ibed in Esnaola e al. (2018)
wi h he necessa y modi ica ions. De ails a e explained in Appendix S3.2.
The 595 samples (Appendix S3.3) analysed yielded 7851 OTUs (Appendix
S3.4) which we e assigned o hei app op ia e axonomy using he blas n
unc ion in BLAST+ (Camacho e al., 2009) o access he GenBank da ase , and
Boldigge -cline (Buchne and Leese, 2020) o access he BOLD da ase . Only
ma ches o e 98% simila i y we e conside ed. The ou pu o bo h da ase s was
cu a ed manually and using a cus om sc ip so ha each OTU was only assigned
o a single axon. Each assigned axon was classi ied in o one o he ollowing
ca ego ies: p eda o , p ey, no -in-s udy-a ea, en i onmen al-con amina ion and
unassigned.
Selec ion o samples and OTUs
Samples we e checked o con amina ion om po en ial p ey species by
s udying he sample blanks. We ound no clea con amina ion e en om species
ha could be mis aken o p ey. None heless, an abundance h eshold was
applied o emo e axa wi h low ead abundances, so ha OTUs wi h less han
0.5% o eads we e emo ed in each sample. While a om pe ec , his me hod
has p o en o be qui e e ec i e in limi ing con amina ion isk o mul iple sou ces
wi hou elimina ing oo many a e p ey axa (D ake e al., 2022); he e o e, he
da a was in e p e ed ha ing his decision in mind.
We also checked o con amina ion om co-occu ing ba species. Samples
we e disca ded om he analysis i mo e han 10% o all he eads iden i ied as
ba species belonged o o he s han M. ema gina us. We ob ained a leas eigh
o 12 samples eligible o analysis in mos si ua ions. Ne e heless, we emo ed
samples om MA in weeks 20, 32 and 34, and o ZE in week 36 g oups en i ely
om he analysis because we did no manage o ob ain mo e han one iable
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
70
sample o he analyses. Mo e in o ma ion on he selec ion o samples is gi en in
Appendix S3.2.
Desc ip ion o die a y me ics
All da a analysis was pe o med in R e sion 4.0.4 (R Co e Team, 2021). Only
hose OTUs classi ied as po en ial p ey we e used o he die analysis. Due o he
lack o p o en co ela ion be ween ela i e ead abundances (RRA) and biomass
o p ey consumed (Paula e al., 2022), we con e ed ou da a o weigh ed
pe cen ages o occu ences (wPOO), a me ic based on p esence/absence da a
ha p o ides a good p oxy o consump ion (Deagle e al., 2018; Cu e al., 2021).
We calcula ed wPOO alues a he p ey species, genus, amily and o de le els.
Mul i a ia e analysis o die a iabili y and homogenei y
We explo ed die composi ion and a iabili y a he species, genus, amily and
o de le el o p ey i ems. We calcula ed B ay-Cu is dissimila i ies be ween all
samples using unc ion egdis in package egan (Oksanen, 2020). We explo ed
ela ionships be ween die composi ion and Week, Colony as ixed e ec s, and
hei in e ac ion h ough a Pe mu a ional Mul i a ia e Analysis o Va iance
(PERMANOVA; Ande son, 2001), using unc ion adonis2 in package egan wi h
9999 pe mu a ions.
E en hough PERMANOVA is semi-pa ame ic, i does assume ha he
homogenei y o e e y g oup is homogeneously dispe sed (Ande son & Walsh,
2013). To es his, we calcula ed dis ances o samples o he cen oid o hei
espec i e g oup in non-Euclidean space using unc ion be adispe in package
egan, wi h 9999 pe mu a ions. We pe o med he analysis by de ining g oups
o samples by he combina ion o Week and Colony. In addi ion, we used he
esul s o hese analyses o explo e changes in die a iabili y, ha is, be a
di e si y (Ande son e al., 2006). To a oid he c ea ion o nega i e eigen alues
in he p ocess, we calcula ed squa e oo ans o med dis ances, ins ead o
s anda d ones.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
71
The dis ances calcula ed by be adispe we e ex ac ed and modeled agains
ac o s Week, Colony and hei in e ac ion in a con en ional linea eg ession, o
explo e di e ences in die a iabili y. We isualised he ma ginal e ec s o each
ac o in he model and hei in e ac ion using package ma gins (Leepe , 2021).
In addi ion, we ep esen ed each g oup's cen oid posi ion calcula ed by
be adispe in a PCoA o analyse unde lying pa e ns in he o e all composi ion o
he sample g oups and hei ela ionship wi h each o he .
Analysis o seasonal die composi ion
Finally, he e ec o sampling da e on he die composi ion was analysed a
he o dinal le el using a Mul inomial Logi model, which is used o model
disc e e choices be ween mu ually exclusi e al e na i es (C oissan , 2017). They
ha e been ecen ly used o model changes in die composi ion in ba s (Tiede e
al., 2020) and hey can heo e ically de ine he p obabili y ha an al e na i e —
a p ey i em in ou case— is chosen (see C oissan , 2017). To un he model, we
collapsed all o de s ound in less han 15 samples in a new ca ego y called
“O he s”, esul ing in six di e en p ey o de s.
We chose o use R package b ms (Bü kne , 2017), which uses Ma ko chain
Mon e Ca lo (MCMC) algo i hms o i a ious mul ile el models, including
mul inomial logi models, unde a Bayesian amewo k. We i he model using
o de le el wPOO as he esponse, agains a iable Week as a con inuous ixed
e ec , and Colony as a andom e ec o accoun o a ia ion be ween di e en
colonies. We chose he ca ego y “O he s” as a baseline o he model. We
calcula ed he es ima ed p obabili ies o consump ion o each o de e e y week
and he ma ginal e ec o he week on he consump ion o each o de , wi hou
he e ec o he baseline ca ego y.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
72
Resul s
Selec ion o samples and OTUs.
A e emo ing non-eligible samples, 359 samples we e le o he die
analysis (Appendix S3.3), which yielded a o al o 6314 OTUs, o which only 664
had an abundance highe han 0.5% in any o he samples (Appendix S3.4). Se en
OTUs (accoun ing o 50% o o al eads) belonged o he p eda o , M.
ema gina us; 73 (4% o eads) we e classi ied as en i onmen al con amina ion;
251 (24% o eads) we e iden i ied as po en ial p ey i ems; ou belonged o
po en ial p ey species ha a e no ound in he s udy a ea (0.5% o eads); and
he emaining 329 (21% o eads) did no ma ch wi h any sequence in he
da abases a leas a he 98% iden i y le el. In o al, 155 unique p ey species and
21 unique gene a we e iden i ied (Appendix S3.5). In addi ion, se en gene a also
had OTUs iden i ied bo h a he genus and he species le el. In hese cases, a
genus le el occu ence was added o he die a y da a. All in all, we analysed 183
p ey axa, iden i ied a he genus o species le els, belonging o 92 amilies and
14 o de s.
The mos equen p ey species was he o b-wea ing spide A aneus
diadema us. I was iden i ied in 249 samples (F equency o occu ence (FOO)
69%) and accoun ed o 42% RRA and 33.9% wPOO. The nex wo mos equen
p ey i ems we e S omoxys calci ans and Musca domes ica, iden i ied in 81 and
68 samples, wi h 9.8% and 6.6% RRA and 7.8% and 6.7% wPOO, espec i ely.
Mos p ey i ems appea ed occasionally in aeces: 108 p ey species we e only
iden i ied in a single sample each, 22 we e iden i ied in wo samples, and 37 in
be ween h ee and en samples. The e o e, only 16 species occu ed in mo e
han en samples ou o 359 (Table 1). Hal o hem we e o b-web wea ing
spide s.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
73
Table 1. P ey species ha we e iden i ied in mo e han 10 samples, and hei global
equency o occu ence (FOO) and weigh ed pe cen age o occu ence (wPOO).
O de
Family
Species
FOO
wPOO
A aneae
A aneidae
A aneus diadema us
249
33.87
Dip e a
Muscidae
S omoxys calci ans
81
7.85
Dip e a
Muscidae
Musca domes ica
68
6.78
A aneae
A aneidae
Nuc enea umb a ical
67
5.20
A aneae
Te agna hidae
Me ellina me ianae
58
4.66
A aneae
Te agna hidae
Me ellina sp.
46
3.42
Dip e a
Limoniidae
Limonia nubeculosa
28
1.82
A aneae
A aneidae
Zygiella sp.
25
1.91
Epheme op e a
Caenidae
Caenis luc uosa
22
2.91
A aneae
A aneidae
Cyclosa conica
21
1.32
A aneae
A aneidae
A aneus angula us
20
1.67
Lepidop e a
Hepialidae
Pha macis usconebulosa
18
1.87
Dip e a
Tipulidae
Tipula ul ipennis
16
0.98
A aneae
Te agna hidae
Te agna ha sp.
16
1.49
A aneae
Ulobo idae
Hyp io es pa adoxus
15
0.95
A aneae
A aneidae
A aneus igu a us
14
0.78
0.78
A aneae and Dip e a we e he wo mos consumed p ey o de s, accoun ing
o 67% (Weeks 18-20) o 88% (Weeks 34-36) o he o al wPOO. Du ing May,
he consump ion o o he o de s is no ewo hy: Caenis luc uosa
(Epheme op e a) had he highes wPOO (37%) in ZE Week 18; Pha macis
usconebulosa (Lepidop e a) was also he highes consumed p ey i em (wPOO:
27%) in BA Week 20; Melolon ha melolon ha (Coleop e a) was he hi d mos
consumed p ey i em (wPOO 13%) in ER Week 20.
Mul i a ia e analysis o die composi ion and a iabili y
PERMANOVA showed signi ican di e ence in die composi ion ac oss Week,
Colony and he in e ac ion o bo h ac o s a all axonomical le els (p < 0.05;
Appendix S3.6). Howe e , dispe sion analysis be adispe also showed signi ican
di e ences in he die a iabili y o Colonies, Week, and a combina ion o bo h
ac o s a all axonomical le els (p < 0.05; Appendix S3.7). This means ha he
esul s o he PERMANOVA could a ise om ei he communi y composi ion o
dispe sion, and should be in e p e ed wi h cau ion.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
74
Figu e 1 shows a PCoA ep esen ing he cen oid posi ion o e e y g oup o
samples in a non-Euclidean space, as calcula ed by be adispe . The i s wo PCoA
axes ep esen 53% o he o al a iabili y a he o de le el, bu a lowe
pe cen age a o he axonomic le els. The i s axis sepa a es g oups o samples
simila ly ega dless o he axonomic le el: i sepa a es samples om ea ly
season (Weeks 18-24) and he la e season (Weeks 30-36). Mid-season samples
appea all along he i s PCoA axis, close o ea ly o la e season samples
depending on Colony (Fig. 1). The second PCoA axis sepa a es ce ain colonies
mo e and shows di e en pa e ns depending on he axonomical ank used.
Figu e 1. PCoA o dina ion o he posi ion o he cen oids o g oups o samples
collec ed in he same day and Colony, wi h p ey i ems classi ied o he a) O de le el, b)
Family le el, c) Genus le el and d) Species le el. The pe cen a iabili y explained by
each o he axes is indica ed in he axis labels.
The dis ances o cen oid calcula ed by be adispe we e nega i ely co ela ed
o Week a all axonomical le els (O de : F = 62.161, d = 1, p < 0.001; d = 1,
Family: F = 86.5237, d = 1, p < 0.001; Genus: F = 90.024, d = 1, p < 0.001; Species:
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
75
F = 71.262, p < 0.001, Fig. 2a), meaning ha die a iabili y dec eased as he
season p og essed. Dis ances o cen oid we e also signi ican ly di e en
be ween colonies a all axonomical le els (O de : F = 14.864, d = 4, p < 0.001;
Family: F = 25.277, d = 4, p < 0.001; Genus: F = 31.367, d = 4, p < 0.001; Species:
F = 31.000, d = 4, p < 0.001). Colonies LA and ER had signi ican ly lowe a e age
dis ances o he cen oid (Fig. 2b). An in e ac ion be ween Week and Colony
showed ha he empo al pa e n migh a y in di e en ways ac oss Colonies
(O de : F = 5.647, d = 4, p < 0.001; Family: F = 7.429, d = 4, p < 0.001; Genus: F
= 11.335, d = 4, p < 0.001; Species: F = 6.967, d = 4, p < 0.001). ER and BA
p esen ed a sha pe dec ease in die a iabili y as he season p og essed (Fig. 2c
& 2d), compa ed o he es o he colonies (Fig 2e – 2g).
Figu e 2. Ma ginal e ec s o P edic ed A e age Dis ance o Cen oid (PADG) and 95 %
con idence in e als calcula ed by he linea model o dis ances o g oup cen oids (a
p ey species le el) agains Week, Colony and hei in e ac ion. Plo a) shows he
ma ginal e ec o Week PADG wi hou he e ec o Colony, plo b) shows PADG pe
colony, wi hou he e ec o seasonali y, and plo s c) o g) show he colony PADG: c) BA,
d) ER, e) LA, ) MA, g) ZE. The e ec s o he models a di e en axonomical le els a e
simila
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
82
a ound bo ine a ms and ca le a ms (González, 2022). S omoxys calci ans is
conside ed a signi ican pes o li es ock and domes ic animals. Bo h sexes a e
hema ophagous, and hei bi e causes physical dis ess and inju ies o animals,
pa icula ly when hei abundance inc eases, and can ac as a ec o o se e e
diseases and pa hogens (S eck and B inkmann, 2006; González, 2022; González
e al., 2022). Nowadays, no speci ic con ol measu es a e aken agains S.
calci ans by a me s, as he basic knowledge abou his species is s ill sca ce
(González e al., 2022).
Besides, bo h a e diu nal lies and emain ac i e only in he wa mes hou s o
he day (González, 2022), so M. ema gina us should glean hem di ec ly om
su aces. In Cen al Eu ope, adio acking da a has con i med ha M.
ema gina us equen ly isi s ca le sheds a nigh o o age (K ull e al., 1991;
Zahn e al., 2010; Dekke e al., 2013). These s uc u es a e key o aging habi a s
o M. ema gina us, as hey p o ide a eliable ood sou ce, especially on colde
nigh s (Dekke e al., 2013). K ull e al. (1991) did no epo such a co ela ion
be ween wea he and he use o ca le sheds as o aging g ounds, howe e .
Besides M. ema gina us, o he ba species ha use o es s as hei o aging a eas
ha e occasionally been epo ed hun ing lies inside ca le sheds (Sieme s e al.,
2012; Ancillo o e al., 2021). Addi ionally, he ac i i y o open o age s inc eases
a ound ee- anging ca le (Ancillo o e al., 2021).
DNA me aba coding has allowed us o con i m ha he consump ion o S.
calci ans by M. ema gina us is equen in he Basque Coun y, especially a he
beginning o he summe . The e o e, i is e y likely ha i also o ages in ca le
a ms in he Basque Coun y. None heless, speci ic s udies a e needed o con i m
his ac in he a ea. Mo e esea ch is needed o explo e unde wha condi ions
ba s exploi diu nal lies in ca le a ms, especially in he sou he n a ea o he
dis ibu ion o M. ema gina us, u he away om he limi o hei dis ibu ion,
whe e mo e examples o a spide -domina ed die ha e been epo ed (Goi i e
al., 2011; Vallejo e al., 2019). On he o he hand, DNA me aba coding does no
o e accu a e quan i a i e da a (Deagle e al., 2018), so es ima ing he po en ial
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 3: Seasonal shi in he die o M. ema gina us
83
o M. ema gina us colonies o biological con ol is challenging. Me hods a ge ed
o iden i y a single p ey species (e.g. Ba oja e al., 2021) a e an in e es ing op ion
o o e come some o he pi alls o DNA me aba coding in his ega d.
Re e ences
Aizpu ua O, Budinski I, Geo giakakis P, Gopalak ishnan S, Ibañez C, Ma a V, Rebelo H, Russo D,
Szodo ay-Pa ádi F, Zhelyazko a V, Z ncic V, Gilbe MTP, Albe di A (2018). Ag icul u e
shapes he ophic niche o a ba p eying on mul iple pes a h opods ac oss Eu ope:
E idence o m DNA me aba coding. Molecula Ecology, 27(3):815-825.
h ps://doi.o g/10.1111/mec.14474
Albe di A, Ga in I, Aizpu ua O, Aiha za J (2012). The o aging ecology o he Moun ain Long-
ea ed ba Pleco us mac obulla is e ealed wi h DNA mini-ba codes. PLoS ONE, 7(4):e35692.
h ps://doi.o g/10.1371/jou nal.pone.0035692
Albe di A, Aizpu ua O, Gilbe MTP, Bohmann K (2017). Sc u inizing key s eps o eliable
me aba coding o en i onmen al samples. Me hods in Ecology and E olu ion, 9(1):134–147.
h ps://doi.o g/10.1111/2041-210X.12849
Aldaso o M, Ga in I, Vallejo N, Ba oja U, A izabalaga-Escude o A, Goi i U, Aiha za J (2019).
Gaining ecological insigh on die a y alloca ion among ho seshoe ba s h ough molecula
p ime combina ion. PLoS ONE, 14(7):e0220081.
h ps://doi.o g/10.1371/jou nal.pone.0220081
Ancillo o L, Fes a F, De Benede a F, Cosen ino F, Pejic B, Russo D (2021). F ee- anging li es ock
and a di e se landscape s uc u e inc ease ba o aging in moun ainous landscapes.
Ag o o es y Sys ems, 95:407–418. h ps://doi.o g/10.1007/s10457-021-00591-0
Ande son MJ (2001). A new me hod o non-pa ame ic mul i a ia e analysis o a iance. Aus al
Ecology, 26:32–46. h ps://doi.o g/10.1111/j.1442-9993.2001.01070.pp.x
Ande son MJ, Ellingsen KE, McA dle BH (2006). Mul i a ia e dispe sion as a measu e o be a
di e si y. Ecology Le e s, 9:683–693. h ps://doi.o g/10.1111/j.1461-0248.2006.00926.x
Ande son MJ, Walsh DCI (2013). PERMANOVA, ANOSIM, and he Man el es in he ace o
he e ogeneous dispe sion: Wha null hypo hesis a e you es ing? Ecological Monog aphs,
83(4):557–574. h ps://doi.o g/10.1890/12-2010.1
And eas M, Rei e A, Benda P (2012a). Die a y composi ion, esou ce pa i ioning and ophic
niche o e lap in h ee o es oliage-gleaning ba s in Cen al Eu ope. Ac a Chi op e ologica,
14(2):335–345. h ps://doi.o g/10.3163/150811012X661657
And eas M, Rei e A, Benda P (2012b). P ey selec ion and seasonal die changes in he wes e n
ba bas elle ba (Ba bas ella ba bas ellus). Ac a Chi op e ologica, 14(1):81–92.
h ps://doi.o g/10.3161/150811012X654295
And iollo T, Michaux JR, Ruedi M (2021). Food o e e yone: Di e en ial eeding habi s o c yp ic
ba species in e ed om DNA me aba coding. Molecula Ecology, 30(18):4584–4600.
h ps://doi.o g/10.1111/mec.16073
A izabalaga-Escude o A, Ga in I, Ga cía-Muda a JL, Albe di A, Aiha za J, Goi i U (2015). T ophic
equi emen s beyond o aging habi a s: The impo ance o p ey sou ce habi a s in ba
conse a ion. Biological Conse a ion, 191:512–519.
h ps://doi.o g/10.1016/j.biocon.2015.07.043
A izabalaga-Escude o A, Me ckx T, Ga cía-Baque o G, Wahlbe g N, Aizpu ua O, Ga in I, Goi i U,
Aiha za J (2019). T ai -based unc ional die a y analysis p o ides a be e insigh in o he
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
84
o aging ecology o ba s. Jou nal o Animal Ecology, 88(10):1587–1600.
h ps://doi.o g/10.1111/1365-2656.13055
Ba oja U, Ga in I, Aiha za J, A izabalaga-Escude o A, Vallejo N, Aldaso o M, Goi i U (2019). Pes
consump ion in a ineya d sys em by he lesse ho seshoe ba (Rhinolophus hipposide os).
PLoS ONE, 14(7):e0219265. h ps://doi.o g/10.1371/jou nal.pone.0219265
Ba oja U, Ga in I, Vallejo N, Aiha za J, Rebelo H, Goi i U (2021). Ba s ac i ely ack and p ey on
g ape pes popula ions. Ecological Indica o s, 126:107718.
h ps://doi.o g/10.1016/j.ecolind.2021.107718
Baue o á Z (1986). Con ibu ion o he ophic bionomics o Myo is ema gina us. Folia Zoologica,
35(4):305–310.
Beck A (1995). Fecal analyses o Eu opean ba species. Myo is, 32-33:109–119.
Buchne D, Leese F (2020). BOLDigge – a Py hon package o iden i y and o ganise sequences
wi h he Ba code o Li e Da a sys ems. Me aba coding and Me agenomics, 4:e53535.
h ps://doi.o g/10.3897/mbmg.4.53535
Bü kne PC (2017). b ms: an R package o bayesian mul ile el models using S an. Jou nal o
S a is ical So wa e, 80(1):1–28. h ps://doi.o g/10.18637/jss. 080.i01
Bu les DW, B igham RM, Ring RA, Reimchen TE (2008). Die o wo insec i o ous ba s, Myo is
luci ugus and Myo is keenii, in ela ion o a h opod abundance in a empe a e Paci ic
No hwes ain o es en i onmen . Canadian Jou nal o Zoology, 86(12):1367–1375.
h ps://doi.o g/10.1139/Z08-125
Camacho C, Coulou is G, A agyan V, Ma N, Papadopoulos J, Beale K, Madden TL (2009). BLAST+:
a chi ec u e and applica ions. BMC Bioin o ma ics, 10:421. h ps://doi.o g/10.1186/1471-
2105-10-421
Chao A, Go elli NJ, Hsieh TC, Sande EL, Ma KH, Colwell RK, Ellison AM (2014). Ra e ac ion and
ex apola ion wi h Hill numbe s: a amewo k o sampling and es ima ion in species
di e si y s udies. Ecological Monog aphs, 84(1):45–67. h ps://doi.o g/10.1890/13-0133.1
C oissan Y (2017). Es ima ion o Random U ili y Models in R: The mlogi Package. Jou nal o
S a is ical So wa e, 95(11):1–41. h ps://doi.o g/10.18637/jss. 095.i11
Cu JP, Windso FM, Te cel MPTG, Ki son JJN, E ans DM (2022). O e coming he pi alls o
me ging die a y me aba coding in o ecological ne wo ks. Me hods in Ecology and E olu ion,
13:545–559. h ps://doi.o g/10.1111/2041-210X.13796
Deagle BE, Thomas AC, McInnes JC, Cla ke LJ, Ves e inen EJ, Cla e EL, Ka zinel TR, E eson JP
(2018). Coun ing wi h DNA in me aba coding s udies: How should we con e sequence
eads o die a y da a? Molecula Ecology, 28(2):391–406.
h ps://doi.o g/10.1111/mec.14734
Dekke JJ, Regelink JR, Jansen EA, B inkmann R, Limpens HJGA (2013). Habi a use by Myo is
ema gina us a i s wo no he nmos ma e ni y oos s and he implica ions o hei
conse a ion. Lu a, 56(2):111–120
Dennis P, Ska ei J, Kuna e A, McC acken DI (2015). The esponse o spide (A aneae)
assemblages o s uc u al he e ogenei y and p ey abundance in sub-mon ane ege a ion
modi ied by conse a ion g azing. Global Ecology and Conse a ion, 3:715–728.
h p://doi.o g/10.1016/j.gecco.2015.03.007
Die z M, Pi JB, Hillen J (2013). Does he su i al o g ea e ho seshoe ba s and Geo oy’s ba s in
Wes e n Eu ope depend on adi ional cul u al landscapes? Biodi e si y and Conse a ion,
22:3007–3025. h ps://doi.o g/10.1007/s10531-013-0567-4
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
85
Die z M, Pi JB (2021). Geo oy’s Ba Myo is ema gina us (Geo oy, 1806). In: Russo D (Ed.)
Handbook o he Mammals o Eu ope. Sp inge Na u e, Cham., Swi ze land.
h ps://doi.o g/10.1007/978-3-319-65038-8_56-1
Di oll TJ, B own VA, McC acken GF, O’Kee e JM (2022). P ey size is mo e ep esen a i e han
p ey axa when measu ing die a y o e lap in sympa ic o es ba s. En i onmen al DNA,
4(6):1407–1419. h ps://doi.o g/10.1002/edn3.354
D ake LE, Cu JP, Young RE, Ma chbank A, Chadwick EA, Symondson WOC (2022). An assessmen
o minimum sequence copy h esholds o iden i ying and educing he p e alence o
a e ac s in die a y me aba coding da a. Me hods in Ecology and E olu ion, 13(3):694–710.
h ps://doi.o g/10.1111/2041-210X.13780
Elb ech V, B aukmann TWA, I ano a NV, P osse SWJ, Hajibabaei M, W igh M, E geny VZ,
Hebe PDN, S einke D (2019). Valida ion o COI me aba coding p ime s o e es ial
a h opods. Pee J 7:e7745. h ps://doi.o g/10.7717/pee j.7745
Emlen JM (1966). The ole o ime and ene gy in ood p e e ence. The Ame ican Na u alis ,
100(916):611–617.
Em ich MA, Cla e EL, Symondson WOC, Koenig SE, Fen on MB (2014). Resou ce pa i ioning by
insec i o ous ba s in Jamaica. Molecula Ecology, 23(15):3648–3656.
h ps://doi.o g/10.1111/mec.12504
Esnaola A, A izabalaga-Escude o A, González-Es eban J, Elosegi A, Aiha za J (2018).
De e mining die om aeces: Selec ion o me aba coding p ime s o he insec i o e
Py enean desman (Galemys py enaicus). PLoS ONE, 13(12):e0208986.
h ps://doi.o g/10.1371/jou nal.pone.0208986
Fau e PA, Ba clay RMR (1994). Subs a e-gleaning e sus ae ial-hawking: plas ici y in he
o aging and echoloca ion beha iou o he long-ea ed ba , Myo is e o is. Jou nal o
Compa a i e Physiology A, 174(5):651–660. h ps://doi.o g/10.1007/BF00217386
Flaque C, Puig-Mon se a X, Bu gas A, Russo D (2008). Habi a selec ion by Geo oy’s ba s
(Myo is ema gina us) in a u al Medi e anean landscape: implica ions o conse a ion. Ac a
Chi op e ologica, 10(1):61–67. h ps://doi.o g/10.3161/150811008X331090
Galan M, Pons JB, Tou nay e O, Pie e E, Leuch mann M, Pon ie D, Cha bonell N (2018).
Me aba coding o he pa allel iden i ica ion o se e al hund ed p eda o s and hei p ey:
Applica ion o ba species die analysis. Molecula Ecology Resou ces, 18(3):474–489.
h ps://doi.o g/10.1111/1755-0998.12749
Ga in I, Aiha za J, Goi i U, A izabalaga-Escude o A, Nogue as J, Ibáñez C (2019). Ba s om
di e en o aging guilds p ey upon he pine p ocessiona y mo h. Pee J, 7:e7169.
h ps://doi.o g/10.7717/pee j.7169
Gille F, Tiouchichine ML, Galan M, Blanc F, Némoz M, Aulagnie S, Michaux JR (2015). A new
me hod o iden i y he endange ed Py enean desman (Galemys py enaicus) and o s udy i s
die , using nex gene a ion sequencing om aeces. Mammalian Biology, 80(6):505–509.
h ps://doi.o g/10.1016/j.mambio.2015.08.002
Goi i U, Ga in I, Almena D, Salsamendi E, Aiha za J (2008). Fo aging by Medi e anean
ho seshoe ba s (Rhinolophus eu yale) in ela ion o p ey dis ibu ion and edge habi a . Jou nal
o Mammalogy, 89(2):493–502. h ps://doi.o g/10.1644/07-MAMM-A-054R2.1
Goi i U, Aiha za J, Guiu M, Salsamendi E, Almena D, Napal M, Ga in I (2011). Geo oy’s ba ,
Myo is ema gina us, p eys p e e en ially on spide s in mul is a i ied dense habi a s: A s udy
o o aging ba s in he Medi e anean. Folia Zoologica, 60(1):17–24.
h ps://doi.o g/10.25225/ ozo. 60.i1.a3.2011
González MA (2022). Insec os de impo ancia Médico-Ve e ina ia en el No e de España, pp. 240.
Publicación Independien e.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
86
González MA, B a o-Ba iga D, Ba io-Fe nández E, F on e a E, Ruiz-A ondo I (2022). Se e e
Skin Lesions Caused by Pe sis en Bi es o he S able Fly S omoxys calci ans (Dip e a:
Muscidae) in a Donkey Sanc ua y o Wes e n Spain. Jou nal o Equine Ve e ina y Science,
116:104056. h ps://doi.o g/10.1016/j.je s.2022.104056
Hails CJ (1982). A compa ison o opical and empe a e ae ial insec abundance. Bio opica,
14(4):310–313. h ps://doi.o g/10.2307/2388092
Hope PR, Bohmann K, Gilbe MTP, Zepeda-Mendoza ML, Razgou O, Jones G (2014). Second
gene a ion sequencing and mo phological aecal analysis e eal unexpec ed o aging
beha iou by Myo is na e e i (Chi op e a, Vespe ilionidae) in win e . F on ie s in Zoology,
11(1):39. h ps://doi.o g/10.1186/1742-9994-11-39
Hsieh TC, Ma KH, Chao A (2020). iNEXT: iN e pola ion and EXT apola ion o species di e si y. R
package e sion 2.0.20 URL: h p://chao.s a .n hu.edu. w/wo dp ess/so wa e-download/
Hsieh YL, Linsenmai KE (2012). Seasonal dynamics o a bo eal spide di e si y in a empe a e
o es . Ecology and E olu ion, 2(4):768–777. h ps://doi.o g/10.1002/ece3.221
Ke yn T, Godin MC, Jocqué R, G oo ae P, Libois R (2012). Web-building spide s and blood-
eeding lies as p ey o he no ch-ea ed ba (Myo is ema gina us). Belgian Jou nal o Zoology,
142(1):59–67. h ps://doi.o g/10.26496/bjz.2012.137
K ull D, Schumm A, Me zne W, Neuweile G (1991). Fo aging a eas and o aging beha io in he
no ch- ea ed ba , Myo is ema gina us (Vespe ilionidae). Beha io al Ecology and Sociobiology,
28(3):247–253. h ps://doi.o g/10.1007/BF00175097
Leepe TJ (2021). ma gins: Ma ginal E ec s o Model Objec s. R package e sion 0.3.26.
Li le o d-Colquhoun BL, F eeman PT, Sacke VI, Tulloss CV, McGa ey LM, Ge emia C, Ka zinel
TR (2022). The p ecau iona y p inciple and die a y DNA me aba coding: Commonly used
abundance h esholds change ecological in e p e a ion. Molecula Ecology, 31(6): 1615–
1626. h ps://doi.o g/10.1111/mec.16352
Ma in M (2011). Cu adap emo es adap e sequences om high- h oughpu sequencing eads.
EMBne Jou nal, 17(1):10–12. h ps://doi.o g/10.14806/ej.17.1.200
Ma a VA, Amo im F, Co ley MFV, McC acken GF, Rebelo H, Beja P (2016). Female die a y bias
owa ds la ge mig a o y mo hs in he Eu opean ee- ailed ba (Tada ida enio is). Biology
Le e s, 12(3):20150988. h ps://doi.o g/10.1098/ sbl.2015.0988
Maucie i DG, Ba clay RMR (2021). Consump ion o spide s by he li le b own ba (Myo is
luci ugus) and he long-ea ed myo is (Myo is e o is) in he Rocky Moun ains o Albe a,
Canadian Jou nal o Zoology, 99(3):221–226. h ps://doi.o g/10.1139/cjz-2020-0160
Napal M, Ga in I, Goi i U, Salsamendi E, Aiha za J (2013). Pas de o es a ion o Medi e anean
Eu ope explains he p esen dis ibu ion o he s ic o es dwelle Myo is bechs einii. Fo es
Ecology and Managemen , 293:161–170. h ps://doi.o g/10.1016/j. o eco.2012.12.038
No ella-Fe nandez R, Ibañez C, Jus e J, Cla e EL, Doncas e CP, Razgou O (2020). T ophic
esou ce pa i ioning d i es ine-scale coexis ence in c yp ic ba species. Ecology and
E olu ion, 10(24):14122–14136. h ps://doi.o g/10.1002/ece3.7004
O’Rou ke DR, Mangan MT, Mangan KE, Bokulich NA, MacManes MD, Fos e JT (2021). Lo d o he
Dip e a (and mo hs and a spide ): Molecula die analyses and o aging ecology o Indiana
ba s in Illinois. F on ie s in Ecology and E olu ion, 9:623655.
h ps://doi.o g/10.3389/ e o.2021.623655
Oksanen J, Guillaume B, F iendly M, Kind R, Legend e P, McGlinn D, Minchin PR, O´Ha a RB,
Simpson GL, Solymos P, S e ens MHH, Szoecs E, Wagne H (2020). egan: Communi y Ecology
Package. R package e sion 2.5-7. h ps://CRAN.R-p ojec .o g/package= egan
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
87
Oli e CW (1981). Op imal phenology and body-size o o b-wea ing spide s: Fo aging cons ain s.
Oecologia, 49:83–87. h ps://doi.o g/10.1007/BF00376902
Pa a G, Behe a P, Das SK, Saikia B, Ghosh S, Biswas P, Kuma A, Alam SS, Kawlni L, Lalnunpuia C,
Lalchhandama C, Bacham M, Debba ma A (2018). S omoxys calci ans and i s impo ance in
li es ock: a e iew. In e na ional Jou nal o Ad ance Ag icul u al Resea ch, 6:30–37.
Paula DP, Ba os SKA, Pi a RM, Ba e o MR, Togawa RC, Andow DA (2022). Me aba coding
e sus mapping unassembled sho gun eads o iden i ica ion o p ey consumed by
a h opod epigeal p eda o s. GigaScience, 11(1):1–13.
h ps://doi.o g/10.1093/gigascience/giac020
Pompanon F, Deagle BE, Symondson WOC, B own DS, Ja man SN, Tabe le P (2012). Who is
ea ing wha : Die assessmen using nex gene a ion sequencing. Molecula Ecology,
21(8):1931–1950. h ps://doi.o g/10.1111/j.1365-294X.2011.05403.x
P ese nik P, Aulagnie S (2013). The die o Sch eibe ’s ben -winged ba , Miniop e us sch eibe sii
(Chi op e a: Miniop e idae), in no heas e n Slo enia (Cen al Eu ope). Mammalia,
77(3):297–305. h ps://doi.o g/10.1515/mammalia-2012-0033
R Co e Team (2021). R: A language and en i onmen o s a is ical compu ing. R Founda ion o
S a is ical Compu ing, Vienna, Aus ia. h ps://www.R-p ojec .o g/
Ramos-Pe ei a MJ, Rebelo H, Rainho A, Palme eim JM (2002). P ey selec ion by Myo is myo is
(Vespe ilionidae) in a Medi e anean egion. Ac a Chi op e ologica, 4(2):183–193.
h ps://doi.o g/10.3161/001.004.0207
Razgou O, Cla e EL, Zeale MRK, Hanme J, Schnell IB, Rasmussen M, Gilbe TP, Jones G (2011).
High- h oughpu sequencing o e s insigh in o mechanisms o esou ce pa i ioning in
c yp ic ba species. Ecology and E olu ion, 1(4):556–570. h ps://doi.o g/10.1002/ece3.49
Rognes T, Flou i T, Nichols B, Quince C, Mahé F (2016). VSEARCH: a e sa ile open sou ce ool o
me agenomics. Pee J, 4:e2584. h ps://doi.o g/10.7717/pee j.2584
Roswag A, Becke NI, Enca nação JA (2018). Iso opic and die a y niches as indica o s o
esou ce pa i ioning in he gleane ba s Myo is bechs einii, M. na e e i, and Pleco us au i us.
Mammalian Biology, 89:62–70. h ps://doi.o g/10.1016/j.mambio.2017.12.006
Rubio GD, Mo eno CE (2010). O b-wea ing spide di e si y in he Ibe á ma shlands, A gen ina.
Neo opical En omology, 39(4):496–505. h ps://doi.o g/10.1590/S1519-
566X2010000400006
Salinas-Ramos VB, Ancillo o L, Bosso L, Sanchez-Co de o V, Russo D (2019). In e speci ic
compe i ion in ba s: s a e o knowledge and esea ch challenges. Mammal Re iew, 50(1):68–
81. h ps://doi.o g/10.1111/mam.12180
Salsamendi E, Ga in I, A os egui I, Goi i U, Aiha za J (2012). Wha mechanism o niche
seg ega ion allows he coexis ence o sympa ic sibling hinolophid ba s? F on ie s in Zoology,
9(1):30. h ps://doi.o g/10.1186/1742-9994-9-30
Schulz M (2000). Die and o aging beha io o he golden- ipped ba , Ke i oula papuensis: A
spide specialis ? Jou nal o Mammalogy, 81(4):948–957. h ps://doi.o g/10.1644/1545-
1542(2000)081<0948:DAFBOT>2.0.CO;2
Sieme s BM, Swi S (2006). Di e ences in senso y ecology con ibu e o esou ce pa i ioning in
he ba s Myo is bechs einii and Myo is na e e i (Chi op e a: Vespe ilionidae). Beha iou al
Ecology and Sociobiology, 59:373–380. h ps://doi.o g/10.1007/s00265-005-0060-5
Sieme s BM, K ine E, Kaip I, Simon M, G ei S (2012). Ba s ea esd op on he sound o copula ing
lies. Cu en Biology, 22:563–564. h ps://doi.o g/10.1016/j.cub.2012.06.030
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
88
Spi z J, Ridoux V, B ind’Amou A (2014). Le ’s go beyond axonomy in die desc ip ion: es ing a
ai -based app oach o p ey-p eda o ela ionships. Jou nal o Animal Ecology, 83:1137–
1148. h ps://doi.o g/10.1111/1365-2656.12218
S a ik N, Gö e T, Zelle U (2021). Spa ial beha io and habi a use o wo sympa ic ba species.
Animals, 11(12):3460. h ps://doi.o g/10.3390/ani11123460.
S eck CE, B inkmann R (2006). The ophic niche o he Geo oy’s ba (Myo is ema gina us) in
sou h-wes e n Ge many. Ac a Chi op e ologica, 8(2):445–450.
h ps://doi.o g/10.3161/1733-5329(2006)8[445:TTNOTG]2.0.CO;2
Taweesub C, Tanalgo KC, S i ongchuay T, Huges AC (2021). Unde s anding global pa e ns o
insec i o ous ba die a y esea ch. Jou nal o Ba Resea ch & Conse a ion, 14(1):134–144.
h ps://doi.o g/10.14709/Ba bJ.14.1.2021.12
Taylo PJ, G ass I, Albe s AJ, Joube E, Tscha n ke T (2018). Economic alue o ba p eda ion
se ices – A e iew and new es ima es om macadamia o cha ds. Ecosys em se ices,
30:372–381. h ps://doi.o g/10.1016/j.ecose .2017.11.015
Tiede J, Diepenb uck M, Gadau J, Wemheue B, Daniel R, Sche be C (2020). Seasonal a ia ion in
he die o he se o ine ba (Ep esicus se o inus): A high- esolu ion analysis using DNA
me abacoding. Basic and Applied Ecology, 49:1–12.
h ps://doi.o g/10.1016/j.baae.2020.09.004
Tou nay e O, Leuch mann M, Galan M, T illa M, Pi y S, Pinaud D, Filippi-Codaccioni O, Pon ie D,
Cha bonnel N (2020a). eDNA me aba coding e eals a co e and seconda y die s o he g ea e
ho seshoe ba wi h s ong spa io- empo al plas ici y. En i onmen al DNA, 3(1):277–296.
h ps://doi.o g/10.1002/edn3.167
Tou nay e O, Leuch mann M, Filippi-Codaccioni O, T illa M, Pi y S, Pon ie D, Cha bonnel N,
Galan M (2020b). In silico and empi ical e alua ion o wel e me aba coding p ime se s o
insec i o ous die analyses. Ecology and E olu ion, 10(13):6310–6332.
h ps://doi.o g/10.1002/ece3.6362
Vamos EE, Elb ech V, Leese F (2017). Sho COI ma ke s o eshwa e mac oin e eb a e
me aba coding. Me aba coding and Me agenomics, 1:e14625.
h ps://doi.o g/10.3897/mbmg.1.14625
Valbuena-Laca a P, Saloña-Bo das MI (2010). Nue os da os sob e la p esencia de S omoxys
calci ans (Linnaeus, 1758) (Dip e a, Muscidae) en explo aciones ganade as de Vizcaya (País
Vasco, No e de España). Bole ín de la Asociación Española de En omología, 34(1-2):199-205.
Vallejo N, Aiha za J, Goi i U, A izabalaga-Escude o A, Flaque C, Puig X, Aldaso o M, Ba oja U,
Ga in I (2019). The die o he no ch-ea ed ba (Myo is ema gina us) ac oss he Ibe ian
Peninsula analysed by amplicon me aba coding. Hys ix, 30(1):59–64.
h ps://doi.o g/10.4404/hys ix-00189-2019
Wa d D, Lublin Y (1992). Tempo al and spa ial seg ega ion o web-building in a communi y o
o b-wea ing spide s. Jou nal o A achnology, 20(2):73–87
Whi ake JO J (1988). Food habi s analysis o insec i o ous ba s. In: Ecological and beha io al
me hods o he s udy o ba s (T. H. Kunz, ed.). Smi hsonian Ins i u ion P ess, Washing on, D.C,
pp 171-189
W ay AK, Pee y MZ, Jusino MA, Kochanski JM, Banik MT, Palme JM, Lindne DL, G a on C
(2021). P eda o p e e ences shape he die s o a h opodi o ous ba s mo e han
quan i a i e local p ey abundance. Molecula Ecology, 30(3):855–873.
h ps://doi.o g/10.1111/mec.15769
Zahn A, Baue S, K ine E, Holzhaide J (2010). Fo aging habi a s o Myo is ema gina us in Cen al
Eu ope. Eu opean Jou nal o Wildli e Resea ch, 56(3):395–400.
h ps://doi.o g/10.1007/s10344-009-0331-y
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 3: Seasonal shi in he die o M. ema gina us
89
Zeale MR, Bu lin RK, Ba ke GL, Lees DC, Jones G (2011). Taxon-speci ic PCR o DNA ba coding
a h opod p ey in ba aeces. Molecula Ecology Resou ces, 11(2):236–244.
h ps://doi.o g/10.1111/j.1755-0998.2010.02920.x
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
CHAPTER 4: DNA me aba coding e eals
he in luence o land co e and a ming on
he die a y composi ion o a spide -
specialis ba
The con en s o his chap e we e published in he ollowing pape :
Vallejo N, Aldaso o M, Olasagas i L, Aiha za J,
Ga in I (2025). DNA me aba coding e eals he
in luence o land co e and a ming on he die a y
composi ion o a spide -specialis ba .
Me aba coding and Me agenomics, 9:e144371.
h ps://doi.o g/10.3897/mbmg.9.144371
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
98
Landscape cha ac e iza ion
To include he maximum po en ial o aging a ea o M. ema gina us (Flaque
e al., 2008; Goi i e al., 2011; Die z e al., 2013;), he landscape a ound he
colonies was cha ac e ized in a 10 km adius a ound he colonies. We used 10m
as e maps by ESA Wo ldCo e 2020, based on Sen inel-1 and Sen inel-2 da a
(Zanaga e al., 2021). We eclassi ied he land uses as (1) o es , (2) non- o es ed
na u al a eas, (3) pas u es and g assland, (4) c oplands, (5) u ban a eas, (6)
wa e bodies and we lands, and calcula ed hei co e . Addi ionally, we
calcula ed he minimum dis ance om he colony o wa e bodies (6) and u ban
a eas (5). As linea wa e bodies ha could be used as wa e sou ces, like i e s
and small s eams, a e unde es ima ed in as e maps, we co ec ed he alue o
minimum dis ance o land class wa e bodies and we lands (6) using he EU-
Hyd o laye s (Eu opean En i onmen Agency, 20219). Finally, we used o icial
ca le census da a om Spain and F ance (INE, 2020; DRAAF Nou elle Aqui aine,
2020; DRAAF Occi aine, 2020) o es ima e he densi y o o al cows wi hin each
10 km adius a ound oos s, as well as he mean numbe o cows pe li es ock
a m.
Sample collec ion, labo a o y p ocessing and bioin o ma ic p ocess.
Faecal samples we e collec ed on wo di e en days om each colony in
2020; one a he end o May (sp ing) and ano he a he beginning o July
(summe ). The samples we e p ocessed wi h hose p esen ed in Vallejo e al.
(2023), ollowing iden ical me hodologies and c i e ia. Fo each day and colony
sampled, he eon sampling e en , we passi ely collec ed up o 40 samples each
consis ing o 2-6 pelle s (app oxima e weigh 30-60 mg). DNA om each sample
was ex ac ed using DNeasy Powe Soil Ki and DNeasy Powe Soil P o Ki
(Qiagen) ollowing manu ac u e ’s p o ocol wi h some modi ica ions (Appendix
S3.2) Each ex ac ion ound included 23 samples and one nega i e ex ac ion
con ol.
Following DNA ex ac ion, all samples and ex ac ion blanks we e ampli ied
using p ime se FWH1, as desc ibed by Vamos e al. (2017), o ampli y DNA om
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 4: Land co e in luences die o a specialis ba
99
bo h po en ial p ey i ems and ba s. Fo he ampli ica ion p ocess we used 10 µl
o Qiagen mul iplex PCR ki , 1 µl o wa d p ime (10 µM), 1 µl e e se p ime (10
µM), 7 µl H2O and 1 µl o DNA. Cycling condi ions s a ed wi h 15 min a 95 °C o
polyme ase ac i a ion, ollowed by 40 cycles o 94 °C (30 s) – 45 °C (45 s) – 72
°C (2 m), and inished wi h 10 minu es a 72 °C. Ampli ica ion p oduc s we e hen
pu i ied using magne ic beads.
Fou indi idual me agenomic lib a ies we e buil ollowing o icial Illumina
p o ocols (Illumina, 2013), and one con ol was added pe lib a y a his s age.
In he i s lib a y, wo con ols we e added. Du ing his p ocess, index
sequences and Illumina adap e s we e a ached using Nex e a XT 2. A di e en
combina ion o o wa d and e e se ma ke s was used in each sample o allow
hei di e en ia ion. Ampli ica ion success was checked by mig a ing he
p oduc in an aga ose gel be o e pu i ying again and pooling all he samples a
equal mola i ies o sequencing. Sequencing was pe o med in Illumina MiSeq
(500 cycle 2 ki ), in ou sepa a e uns. Fo his s udy, we used 505 samples,
which we e p ocessed oge he wi h mo e M. ema gina us samples included in
Vallejo e al. (2023), and one sample belonging o Miniop e us sch eibe sii, which
did no belong o any s udy. In o al, we sequenced 940 biological samples, 39
ex ac ion blanks and i e lib a y blanks wi h no DNA empla e.
Bioin o ma ic analyses we e done wi h VSEARCH (Rognes e al., 2016) and
Cu adap (Ma in, 2011) o p ocess aw sequences, me ge pai ed-end eads, im
he p ime sequences and clus e hem in o ope a ional axonomic uni s (OTUs)
a he 97% simila i y h eshold. These we e compa ed o online da abases using
he blas n unc ion in BLAST+ (Camacho e al., 2009) o access he GenBank
da ase , and Boldigge -cline (Buchne and Leese, 2020) o access he BOLD
da abase. We accep ed all ma ches abo e a 98% iden i y and an e- alue lowe
han 1e-20, when p o ided. The esul s we e cu a ed using a cus om sc ip in R
e sion 4.4.0 (R Co e Team, 2024), ollowed by a manual cu a ion o ensu e a
single axon ma ched pe OTU. We classi ied all iden i ica ions as belonging o
he p eda o , en i onmen al con amina ion, po en ial p ey species absen om
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
100
he s udy a ea, o po en ial p ey species p esen in he s udy a ea. Bioin o ma ic
p ocedu es, and he pa ame e s used in he p ocess a e de ailed in Appendix
S3.2.
All subsequen analyses we e pe o med in R e sion 4.4.0 (R Co e Team,
2024), and all isualiza ions we e done using ggplo 2 (Wickham, 2016). In o de
o ensu e ha all samples used in he analysis belonged o he a ge species,
samples we e disca ded i mo e han 10% o all he eads iden i ied as a ba
belonged o species o he han M. ema gina us. We aimed o de ec
app oxima ely 75% o he p ey i ems pe colony and day (Chao e al., 2014). We
es ima ed he di e si y o he samples and hei co e age using package iNEXT
(Hsieh e al., 2020). In gene al, calcula ed measu es we e accep able (Appendix
S4.2), bu in some o he colonies hey did no each he in ended 75% co e age
( i e ou o 30) as we could no inc ease he sample size due o budge a y
easons.
On he o he hand, ex ac ion and lib a y blanks we e examined o accoun
o po en ial pe asi e con amina ion e en s ega ding p ey i ems bu no axa
we e emo ed om he analysis a his poin . Howe e , unde he p esump ion
ha OTUs wi h low abundances a e likely sou ces o mis akes and con amina ion
e en s, OTUs wi h less han 0.5% eads we e emo ed in each sample (D ake e
al., 2022).
Die desc ip ion
Only hose OTUs classi ied as po en ial p ey i ems ound in he s udy a ea
we e used o he die analysis. We con e ed all ela i e ead abundance alues
o bina y da a, and buil die ables a he species, amily, and o de le els. To
make a gene al desc ip ion o he die , we calcula ed he equency o occu ence
(FOO) and weigh ed pe cen age o occu ence (wPOO) alues o all die a y i ems
a he species, amily and o de le el as desc ibed by Deagle e al. (2019).
Addi ionally, we used six die a y a iables o explo e hei ela ionship wi h
landscape a iables: i s o de Hill numbe s a he species, amily and o de
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
101
le els, and spide species ichness pe sampling e en , which we e calcula ed
using R package hilldi (Albe di, 2019); and wPOO alues o diu nal lies (as
amily Muscidae) and spide s (as o de A aneae) pe sampling e en .
S a is ical analyses
We i s es ed he no mali y o all ou die a y a iables wi h he Shapi o-Wilk
es . We applied he a csine squa e oo ans o ma ion o die a y p opo ion
a iables o imp o e hei i (Go elli and Ellison, 2004). We explo ed di e ences
in he die a y me ics be ween he wo sampling seasons (sp ing and summe )
using pai ed - es s. Then, we explo ed ela ionships be ween he die a y
me ics and land co e a iables, pe sampling season.
Be o e he analysis, we used he squa e oo a csine ans o ma ion on all
land co e a iables, he log ans o ma ion on he numbe o ca le heads, and
he mean numbe o ca le heads pe ope a ion. To explo e he o dina ion o he
ba colony associa ion wi h land co e we pe o med a PCA. All landscape
a iables we e s anda dized p io o da a analysis o ensu e ha he scales we e
compa able. Then, we ex ac ed he i s h ee p incipal componen s, which
we e hen ela ed o die a y a iables in a mul iple eg ession using unc ion glm
o package s a s in R (R Co e Team, 2024).
Finally, we modelled diu nal ly consump ion using a wo-pa o hu dle
model, which a e commonly employed when he esponse a iable is ze o-
in la ed. This app oach assumes ha wo di e en biological p ocesses a e a
play; in ou case, one would cause he absence o lies in he die , and he o he
would in luence hei equency o occu ence (Zuu e al., 2009). The choice o
his model was guided by he a p io i hypo hesis ha he p esence o cow sheds
and ca le could be a p e equisi e o he a ailabili y and he e o e he
consump ion o lies by M. ema gina us. Acco dingly, we implemen ed a hu dle
model using unc ion hu dle in package pscl (Zeileis e al., 2008), speci ying (i)
he p obabili y o lies being consumed by he colony, modelled as a bina y
esponse o he landscape a iables, and (ii) he ela i e impo ance o lies in
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
102
he die , modelled as he wPOO alues anging om 1 o 100, and ounded o he
nea es in ege . To accoun o o e -dispe sion, we selec ed a ze o unca ed
nega i e binomial dis ibu ion. As explana o y a iables, we included he aw
numbe o ca le su ounding he colony and ans o med and s anda dized
alues o he p opo ion o o es ed and u ban a eas. We also included
collec ion season as a ac o . We buil all possible combina ions o models and
chose he bes one based on AICc alues using he d edge unc ion om package
MuMIn (Ba oń, 2023).
Resul s
Landscape a iabili y in he s udy a ea
The selec ed colonies we e p edominan ly su ounded by o es s, bo h na i e
and plan a ions, as well as g asslands and c oplands a a ying p opo ions. In
some Medi e anean colonies o he ypes o na u al a eas, mainly sh ublands,
we e also no iceably p esen (Fig. 2A). The numbe o cows a a 10 km adius
was also highly a iable be ween he selec ed colonies, and so was he mean
numbe o cows pe a m, e lec ing he a iabili y in li es ock managemen
be ween colonies (Fig. 2A).
The i s h ee axes o he PCA accoun ed o 80% o he o al a ia ion in he
da a (Fig. 2B). The i s axis explained 51% o he o al a iabili y and sepa a ed
he wes e n and no he n colonies, cha ac e ized by highe p opo ions o ee
co e and g assland, om hose colonies wi h g ea e c opland co e , la ge
a eas o o he na u al habi a s and highe numbe s o cows pe a m, mainly
loca ed in he sou h-eas e n pa o he s udy a ea. This axis also co ela ed wi h
he na u al oceanic-Medi e anean clima ic g adien p esen in he s udy a ea.
The second axis explained 19% o he a ia ion and was co ela ed wi h highe
le els o u baniza ion and g ea e numbe s o cows in a 10 km adius. The hi d
axis, which was no po ayed in he PCA plo , explained 9% o he a ia ion and
sepa a ed colonies acco ding o hei p oximi y o u ban and coas al a eas.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
103
Figu e 2. A: Ba cha depic ing he p opo ion o land co e ypes in a 10 km adius
a ound he colony, and an es ima ion o he numbe o bo ine ca le heads and mean
numbe o ca le heads pe ope a ion in he same a ea. B: PCA o he landscape
a iables calcula ed o all he ma e ni y colonies.
Selec ion samples and OTUs.
The ou MiSeq uns gene a ed o e 44 million pai ed-end eads, and a mean
o 44876 eads pe sample. In colony CR an unexpec edly high numbe o
Miniop e us sch eibe sii indi iduals we e ound in he oos ha yea , so
collec ion o samples was impossible in sp ing, and e y challenging in summe .
As a esul , his colony was emo ed om u he analysis. In colony MA ba s
mo ed wi hin he oos du ing he nigh , esul ing in e y ew samples belonging
o M. ema gina us being collec ed. The oos in LA was emp y in he i s week o
July (summe ), so we used samples om mid-July ins ead. In o al, 8941 OTUs
om 505 samples we e compa ed agains GenBank and BOLD Sys ems
da abases, which comp ise he ull da ase (Appendix S4.3). As expec ed, some
samples om mixed colonies con ained DNA o co-occu ing ba species, and as
a esul , we emo ed 154 samples om u he analysis as pe he c i e ia
explained in he p e ious sec ion (Fig. 3). A e excluding non-eligible samples
due o ex e nal con amina ion, imp ope ampli ica ion, o sequencing e o
ela ed o p ey i ems, 320 samples we e le o he die a y analysis (Appendix
S4.4).
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
104
The selec ed samples con ained a o al o 15.3 million aw eads, and a mean
o 43729 eads pe sample. A e p ocessing, 14 million eads we e assigned o
7366 OTUs, o which only 825 had a equency o occu ence exceeding 0.5% in
any sample. Ten o hem (55% o he o al sequence eads) belonged o he
p eda o , M. ema gina us, 103 (5% o eads) we e classi ied as en i onmen al
con amina ion, 318 (24% o eads) we e iden i ied as po en ial p ey i ems, and
eigh belonged o po en ial p ey species ha a e no ound in he s udy a ea
(0.4% o eads). The emaining 386 OTUs (15.6% o eads) did no ma ch wi h
any sequence in he e e ence da abases a he 98% iden i y h eshold.
Figu e 3. F equency o samples p ocesses in each colony and da e. Colou e e s o
sample quali y ega ding amoun o DNA co esponding o Myo is ema gina us: g een >
90%; yellow 75-90%, ed < 75%. Only G een samples we e chosen o he die analysis.
Die desc ip ion
A o al o 253 p ey species belonging o 97 amilies and 16 o de s we e
iden i ied (Appendix S4.5). Mos p ey species we e only iden i ied in a single
sample (147 p ey species) o in wo samples (40 p ey species). Spide s
(A aneae) we e he mos consumed p ey o de (wPOO = 52%, FOO = 83%).
Mo eo e , spide s exhibi ed he highes wPOO alues in 22 sampling e en s ou
o 30 (Fig. 4) and we e consumed mo e in July (Fig. 5). The second-mos
consumed p ey o de was Dip e a (wPOO = 29%, FOO = 62%). The die was
comple ed by Coleop e a, Lepidop e a, Hemip e a, Epheme op e a and Odona a,
in dec easing o de o wPOO.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
105
Figu e 4. Weigh ed pe cen age o occu ence (wPOO) alues o each o he sampling
e en s a he o de le el.
Figu e 5. Weigh ed pe cen age o occu ence (wPOO) o p ey. The eigh species wi h
mo e han 10% equency o occu ence o e all a e displayed in he bo om o he
g aph and wi h solid colou s. Addi ionally, hose species wi h wPOO highe han 10% a
each sampling e en a e displayed in he op o he g aph wi h do ed colou s.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
106
Eigh p ey species had a FOO alue o e 10% (n > 32) (Table 1). These include
i e species and one genus o o b-web building spide s and wo diu nal pes lies
associa ed wi h li es ock a ming. Collec i ely, hese eigh species comp ised
27% o 75% o he die in any sampling e en , as measu ed by wPOO. Among he
spide s, A aneus diadema us was he mos consumed (wPOO = 20%, FOO = 56%),
pa icula ly in July. House lies (Musca domes ica) we e he mos consumed
diu nal ly (wPOO = 11%, FOO = 30%), especially by ba s om he Medi e anean
colonies. Whe eas consump ion o s able lies (S omoxys calci ans) was g ea e
in mo e oceanic colonies. Beyond hese eigh axa, 14 addi ional ones we e
locally no ewo hy, con ibu ing o mo e han 10% wPOO in a leas one
sampling e en (Fig. 5). This ca ego y includes se e al la ge species like, A giope
b uennichi (A aneae), Sympe um sanguineum (Odona a), Anoxia illosa
(Coleop e a) o Cicada o ni (Hemip e a).
Table 1. P ey species ha we e iden i ied in mo e han 32 samples (FOO %10), and
hei global equency o occu ence (FOO) and weigh ed pe cen age o occu ence
(wPOO).
O de
Family
Species
FOO
wPOO
A aneae
A aneidae
A aneus diadema us
179
20.15
Dip e a
Muscidae
Musca domes ica
95
11.23
A aneae
A aneidae
Nuc enea umb a ical
66
4.97
A aneae
Te agna hidae
Me ellina me ianae
54
4.22
A aneae
A aneidae
A aneus angula us
50
4.16
Dip e a
Muscidae
S omoxys calci ans
48
5.03
A aneae
A aneidae
Me ellina sp.
42
2.82
A aneae
A aneidae
Neoscona sub usca
32
0.78
2.31
Seasonal a ia ion
Die a y di e si y was highe in May a all axonomical le els (Fig. 6), albei a
he o de le el he di e ence was only ma ginally signi ican (Species: = 3.073,
d = 14, p = 0.0083; Family: = 2.854, d = 14, p = 0.0127; O de : = 2.113, d =
14, p = 0.0529). Spide species ichness ( = 2.353, d = 14, p = 0.0338) was also
signi ican ly highe in May. Howe e , he p opo ion o spide s in he die
inc eased signi ican ly om May o July ( = -2.745, d = 14, p = 0.0158). The
wPOO o diu nal lies, coun ed as species belonging o he amily Muscidae, did
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
107
no change signi ican ly be ween sampling seasons ( = 1.379, d = 14, p = 0.1895)
and he exclusion o he colonies whe e no diu nal ly consump ion was de ec ed
did no al e he esul s ( = 1.3959, d = 10, p = 0.193).
Figu e 6. Seasonal di e ences be ween die a y me ics. Lines link obse a ions om
he same colony. Signi icance alues o he pai ed - es a e ep esen ed (n.s. = non-
signi ican , * = 0.01 < p- alue < 0.05, ** = p- alue < 0.05).
Rela ionship wi h landscape
Spide ichness in bo h seasons was nega i ely associa ed wi h he i s axis
o he landscape PCA (May: PC1 = -0.8992, = -3.091, d = 14, p = 0.0103; July:
PC1 = -1.2570, = -4.422, d = 14, p = 0.0010). In May, he wPOO o diu nal lies
was signi ican ly ela ed o he second PC (PC2 = -0.12767, = -2.551, d = 14, p
= 0.0269), whe eas in July, he ela ionship was only ma ginally signi ican (PC2
= -0.11894, = -2.060, d = 14, p = 0.0639). No o he die a y me ic showed
signi ican associa ions wi h he PCA axes.
The bes hu dle model included he aw numbe o cows, he pe cen age o
o es ed a ea and he pe cen age o u ban a ea in he nega i e binomial
componen , while only he aw numbe o cows was selec ed in he binomial
sec ion. The p obabili y o consuming diu nal lies inc eased signi ican ly wi h
mo e ca le heads nea he colony (es = 0.0004, z = 3.198, p = 0.0014). Howe e ,
once ly consump ion occu ed, he wPOO alue was no ela ed o he numbe
o ca le a ound he colony (es = 8.647 · 10-5, z = 1.338, p = 0.1808). Ins ead, he
impo ance o diu nal lies in he die was signi ican ly shaped by he pe cen age
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
114
handling in he ield and in he labo a o y, and igo ous da a cu a ion mi iga e
such isks (Fice ola e al., 2016). Addi ionally, die a y da a om DNA
me aba coding may include alse posi i es, especially o p eda o s like M.
ema gina us a high ophic le els (Te cel e al., 2021). In ou s udy,
dis inguishing seconda y p eda ion (DNA o he spide ’s p ey) om ue p ey
was challenging, p omp ing he use o s ic bioin o ma ic il e s and ca e ul
da ase in e p e a ion.
A signi ican limi a ion o DNA me aba coding, pa icula ly amplicon
me aba coding, is i s lack o eliable quan i a i e accu acy, e en when employing
gene alis p ime s (K ehenwinkel e al., 2017). As a esul , many au ho s ad ise
agains using e ie ed sequence coun in o ma ion, o ela i e ead
abundances, o he desc ip ion o die composi ion, in a ou o
p esence/absence da a (Elb ech and Leese, 2015). Me ics de i ed om
occu ence da a, such as wPOO, can p o ide a good summa y o die a y
composi ion, bu i is unlikely ha hey would ep esen he inges ed biomass
accu a ely (Deagle e al., 2019). This hampe s e o s o assess he p eda ion
p essu e ba s like M. ema gina us exe on speci ic pes species. Mo e speci ic
me hods, such as hose desc ibed by Ba oja e al. (2021), a e be e sui ed o
his pu pose, hough none ha e ye been applied o s udy p eda ion by M.
ema gina us on diu nal pes lies.
Conclusions
Ad ancemen s in high- h oughpu sequencing and a non-in asi e sampling
me hodology allowed us o pe o m one o he mos ex ensi e die a y s udies on
a Eu opean ba species on an in e media e geog aphical scale.
The main p ey i ems o he no ch-ea ed ba emain consis en o e a la ge
geog aphically ex ensi e and clima ically di e se ange. O b-web building
spide s a e he p e e ed p ey ype in he sou he n hal o he wes e n
dis ibu ion (Goi i e al., 2011; Vallejo e al., 2019, 2023). Ye , hei consump ion
does no depend on landscape ea u es such as he p esence o o es ed a eas.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 4: Land co e in luences die o a specialis ba
115
Fu he mo e, he known habi a s o some spide species sugges ha na u al
habi a s o he han deciduous o es s a e a good sou ce o p ey o his ba in he
Medi e anean, so conse a ion e o s should go beyond he conse a ion o
o es ed a eas. Ins ead, managemen o he conse a ion o M. ema gina us
should be ocused on b oad scale p ese a ion o a a ie y o na i e habi a
ypes; esul ing in he conse a ion o hei associa ed a h opod communi ies.
This would ensu e a ailabili y o o b-web building spide s, as well as o he
insec s ha migh be hun ed oppo unis ically (F ick e al., 2024).
The impo ance o pes lies o he su i al o M. ema gina us should no be
unde es ima ed ei he , especially in no he n colonies (Pi and Die z, 2018;
Vesce a e al., 2024). Ou esul s show ha , when a ailable, ba s will ake
ad an age o pes lies, he e o e es ic ing he access o ba s o cowsheds will
nega i ely impac pes ly p o i abili y (Die z and Pi , 2021). I sui able sou ces
o pes lies disappea , ou esul s sugges ha M. ema gina us colonies will be
mos ulne able i he su ounding na u al habi a s a e also deg aded.
Despi e he ising numbe o s udies on he die a y p e e ences o he no ch-
ea ed ba , i is seldom no ed as a p eda o o li es ock pes lies beyond he
es ic ed ealm o ba s udies. In-dep h in e disciplina y s udies on he e icacy
o ba s o con ol pes ly popula ions along human-induced geog aphical and
en i onmen al g adien s a e equi ed. This way, in eg a ed pes managemen
s a egies in Eu ope could imp o e he conse a ion s a us o wild ba
popula ions and he wel a e o a m animals alike. This ba species is a good
esea ch subjec candida e o add ess such ques ions.
Re e ences
Aizpu ua O, Budinski I, Geo giakakis P, Gopalak ishnan S, Ibañez C, Ma a V, Rebelo H, Russo D,
Szodo ay-Pa ádi F, Zhelyazko a V, Z ncic V, Gilbe MTP, Albe di A (2018). Ag icul u e
shapes he ophic niche o a ba p eying on mul iple pes a h opods ac oss Eu ope:
E idence om DNA me aba coding. Molecula Ecology, 27(3):815–825.
h ps://doi.o g/10.1111/mec.14474
Albe di A (2019). Hilldi : An R package o he in eg al analysis o di e si y based on Hill
numbe s. h ps://doi.o g/10.1101/545665
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
116
Albe di A, Aizpu ua O, Gilbe MTP, Bohmann K (2017). Sc u inizing key s eps o eliable
me aba coding o en i onmen al samples. Me hods in Ecology and E olu ion, 9(1):134-147.
h ps://doi.o g/10.1111/2041-210X.12849
Albe di A, Razgou O, Aizpu ua O, No ella-Fe nandez R, Aiha za J, Budinski I, Ga in I, Ibáñez C,
Izagi e E, Rebelo H, Russo D, Vlaschenko A, Zhelyazko a V, Z nčić V, Gilbe MTP (2020).
DNA me aba coding and spa ial modelling link die di e si ica ion wi h dis ibu ion
homogenei y in Eu opean ba s. Na u e Communica ions, 11:1154.
h ps://doi.o g/10.1038/s41467-020-14961-2
Ancillo o L, A iano A, Na done V, Budinski I, Rydell J, Russo D (2017). E ec s o ee- anging
ca le and landscape complexi y on ba o aging: Implica ions o ba conse a ion and
li es ock managemen . Ag icul u e, Ecosys ems & En i onmen , 241:54–61.
h ps://doi.o g/10.1016/j.agee.2017.03.001
And eas M, Rei e A, Benda P (2012). P ey selec ion and seasonal die changes in he wes e n
ba bas elle ba (Ba bas ella ba bas ellus). Ac a Chi op e ologica, 14(1):81–92.
h ps://doi.o g/10.3161/150811012X654295
And iollo T, Michaux JR, Ruedi M (2021). Food o e e yone: Di e en ial eeding habi s o c yp ic
ba species in e ed om DNA me aba coding. Molecula Ecology, 30(18):4584–4600.
h ps://doi.o g/10.1111/mec.16073
A izabalaga-Escude o A, Me ckx T, Ga cía-Baque o G, Wahlbe g N, Aizpu ua O, Ga in I, Goi i U,
Aiha za J (2019). T ai -based unc ional die a y analysis p o ides a be e insigh in o he
o aging ecology o ba s. Jou nal o Animal Ecology, 88(10):1587–1600.
h ps://doi.o g/10.1111/1365-2656.13055
Ba oja U, Ga in I, Vallejo N, Aiha za J, Rebelo H, Goi i U (2021). Ba s ac i ely ack and p ey on
g ape pes popula ions. Ecological Indica o s, 126:107718.
h ps://doi.o g/10.1016/j.ecolind.2021.107718
Ba oń K (2023). MuMIn: Mul i-model in e ence. A ailable om: h ps://CRAN.R-
p ojec .o g/package=MuMIn
Benda P, Lučan R, Obuch J, Rei e A, And eas M, Bačko P, Bohnens engel T, Eid E, Še čík M, Vallo
P, Am Z (2010). Ba s (Mammalia: Chi op e a) o he Eas e n Medi e anean and Middle Eas .
Pa 8. Ba s o Jo dan: auna, ecology, echoloca ion, ec opa asi es. Ac a Socie a is Zoologicae
Bohemicae, 74:185–353.
Boyles JG, S o m JJ (2007). The pe ils o picky ea ing: die a y b ead h is ela ed o ex inc ion isk
in insec i o ous ba s. PLoS ONE, 2(7):e672. h ps://doi.o g/10.1371/jou nal.pone.0000672
Buchne D, Leese F (2020). BOLDigge – a Py hon package o iden i y and o ganise sequences
wi h he ba code o li e da a sys ems. Me aba coding and Me agenomics, 4:e53535.
h ps://doi.o g/10.3897/mbmg.4.53535
Bu les DW, B igham RM, Ring RA, Reimchen TE (2009). In luence o wea he on wo
insec i o ous ba s in a empe a e Paci ic No hwes ain o es . Canadian Jou nal o Zoology,
87(2):132–138. h ps://doi.o g/10.1139/Z08-146
Camacho C, Coulou is G, A agyan V, Ma N, Papadopoulos J, Beale K, Madden TL (2009). BLAST+:
A chi ec u e and applica ions. BMC Bioin o ma ics, 10:421. h ps://doi.o g/10.1186/1471-
2105-10-421
Cla e EL, Ba be BR, Sweeney BW, Hebe PDN, Fen on MB (2011). Ea ing local: in luences o
habi a on he die o li le b own ba s (Myo is luci ugus). Molecula Ecology, 20:1772–1780.
h ps://doi.o g/10.1111/j.1365-294X.2011.05040.x
Deagle BE, Thomas AC, McInnes JC, Cla ke LJ, Ves e inen EJ, Cla e EL, Ka zinel TR, E eson JP
(2019). Coun ing wi h DNA in me aba coding s udies: How should we con e sequence
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
117
eads o die a y da a? Molecula Ecology, 28(2):391–406.
h ps://doi.o g/10.1111/mec.14734
Dekke JJA, Regelink JR, Jansen EA, B inkmann R, Limpens HJGA (2013). Habi a use by emale
Geo oy’s ba s (Myo is ema gina us) a i s wo no he nmos ma e ni y oos s and he
implica ions o hei conse a ion. Lu a, 56(2):111–120.
Dennis P, Ska ei J, Kuna e A, McC acken DI (2015). The esponse o spide (A aneae)
assemblages o s uc u al he e ogenei y and p ey abundance in sub-mon ane ege a ion
modi ied by conse a ion g azing. Global Ecology and Conse a ion, 3:715–728.
h ps://doi.o g/10.1016/j.gecco.2015.03.007
Die z M, Pi JB (2021). Geo oy’s ba Myo is ema gina us (Geo oy, 1806). In: Russo D (Ed.)
Chi op e a, handbook o he mammals o Eu ope. Sp inge In e na ional Publishing.
h ps://doi.o g/10.1007/978-3-030-44029-9_56
Die z M, Pi JB, Hillen J (2013). Does he su i al o g ea e ho seshoe ba s and Geo oy’s ba s in
Wes e n Eu ope depend on adi ional cul u al landscapes? Biodi e si y and Conse a ion,
22:3007–3025. h ps://doi.o g/10.1007/s10531-013-0567-4
Di oll TJ, B own VA, McC acken GF, O’Kee e JM (2022). P ey size is mo e ep esen a i e han
p ey axa when measu ing die a y o e lap in sympa ic o es ba s. En i onmen al DNA,
4(6):1407–1419. h ps://doi.o g/10.1002/edn3.354
DRAAF Nou elle Aqui aine (2020). Le ecensemen ag icole 2020. A ailable om:
h ps://d aa .nou elle-aqui aine.ag icul u e.gou . /donnees-a2479.h ml [Accessed on
2023/03/31]
DRAAF Occi aine (2020). Le ecensemen ag icole 2020. A ailable om:
h ps://d aa .occi anie.ag icul u e.gou . /les-donnees-du- a2020-a8512.h ml [Accessed on
2023/03/31]
Downs NC, Sande son LJ (2010). Do ba s o age o e ca le dung o o e ca le? Ac a
Chi op e ologica, 12:349–358. h ps://doi.o g/10.3161/150811010X537936
D ake LE, Cu JP, Young RE, Ma chbank A, Chadwick EA, Symondson WOC (2022). An assessmen
o minimum sequence copy h esholds o iden i ying and educing he p e alence o
a e ac s in die a y me aba coding da a. Me hods in Ecology and E olu ion, 13(3):694–710.
h ps://doi.o g/10.1111/2041-210X.13780
Eu opean En i onmen Agency (2019). EU-hyd o: Ri e Ne wo k. Eu os a . A ailable om:
h ps://doi.o g/10.2909/393359a7-7ebd-4a52-80ac-1a18d5 3db9c [Accessed on
2023/03/31]
Elb ech V, Leese F (2015). Can DNA-based ecosys em assessmen s quan i y species abundance?
Tes ing p ime bias and biomass-sequence ela ionships wi h an inno a i e me aba coding
p o ocol. PLoS ONE, 10(7):e0130324. h ps://doi.o g/10.1371/jou nal.pone.0130324
Elb ech V, Peine B, Leese F (2017). So ing hings ou : Assessing e ec s o unequal specimen
biomass on DNA me aba coding. Ecology and E olu ion, 7:6918–6926.
h ps://doi.o g/10.1002/ece3.3192
Emlen JM (1966). The ole o ime and ene gy in ood p e e ence. The Ame ican Na u alis ,
100(916):611–617. h ps://doi.o g/10.1086/282455
INE (2020). Censo ag a io 2020. A ailable om:
h ps://www.ine.es/censoag a io2020/p esen acion/index.h m [Accessed on 2023/03/29]
Fen on MB (1990). The o aging beha iou and ecology o animal-ea ing ba s. Canadian Jou nal o
Zoology, 68:411–422. h ps://doi.o g/10.1139/z90-061
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
118
Fice ola GF, Tabe le P, Coissac E (2016). How o limi alse posi i es in en i onmen al DNA and
me aba coding? Molecula Ecology Resou ces, 16:604–607. h ps://doi.o g/10.1111/1755-
0998-12508
Fick SE, Hijmans RJ (2017). Wo ldClim 2: new 1-km spa ial esolu ion clima e su aces o global
land a eas. In e na ional Jou nal o Clima ology, 37:4302–4315.
h ps://doi.o g/10.1002/joc.5086
Finn C, G a a ola F, Pinchei a-Donoso D (2023). Mo e lose s han winne s: in es iga ing
An h opocene de auna ion h ough he di e si y o popula ion ends. Biological Re iews,
98:1732–1748. h ps://doi.o g/10.1111/b .12974
Flaque C, Puig-Mon se a X, Bu gas A, Russo D (2008). Habi a selec ion by Geo oy’s ba s
(Myo is ema gina us) in a u al Medi e anean landscape: Implica ions o conse a ion. Ac a
Chi op e ologica, 10(1):61–67. h ps://doi.o g/10.3161/150811008X331090
Foley JA, DeF ies R, Asne GP, Ba o d C, Bonan G, Ca pen e SR, Chapin FS, Coe MT, Daily GC,
Gibbs HK, Helkowski JH, Holloway T, Howa d EA, Kucha ik CJ, Mon eda C, Pa z JA, P en ice
IC, Ramanku y N, Snyde PK (2005). Global consequences o land use. Science, 309:570–574.
h ps://doi.o g/10.1126/science.1111772
Fonde lick J, Azam C, B ochie C, Cosson E, Quékenbo n D (2015). Tes ing he ele ance o using
spa ial modeling o p edic o aging habi a sui abili y a ound ba ma e ni y: A case s udy in
Medi e anean landscape. Biological Conse a ion, 192:120–129.
h ps://doi.o g/10.1016/j.biocon.2015.09.012
Fo is e ML, Pel on EM, Black SH (2019). Declines in insec abundance and di e si y: We know
enough o ac now. Conse a ion Science and P ac ice, 1(8):e80.
h ps://doi.o g/10.1111/csp2.80
F an z AC, Viglino A, Wilwe E, C uz A-P, Wi ische J, Weigand AM, Buijk J, Nyssen P,
Dekeukelei e D, Dekke JJA, Ho sbu gh GJ, Schneide S, Lang M, Caniglia R, Gala e ni M,
Schleime A, Bücs S-L, Pi JB (2022). Conse a ion by ans-bo de coope a ion: Popula ion
gene ic s uc u e and di e si y o Geo oy’s ba (Myo is ema gina us) a i s no h-wes e n
eu opean ange edge. Biodi e si y and Conse a ion, 31(3):925–948.
h ps://doi.o g/10.1007/s10531-022-02371-3
F ick WF, de Wi LA, Iba a A, Lea K, O’Ma a MT (2024). Conse ing ba s and hei o aging
habi a s. In: Russo D, Fen on B (Eds) A Na u al His o y o Ba Fo aging, pp. 305–325.
Academic P ess. h ps://doi.o g/10.1016/b978-0-323-91820-6.00002-4
Ge y AC, Mu illo AC (2019). P omo ing biosecu i y h ough insec managemen a animal
acili ies. In: Dewul J, an Imme seel F (Eds.) Biosecu i y in animal p oduc ion and e e ina y
medicine: om p inciples o p ac ice, pp. 243–281. CABI.
h ps://doi.o g/10.1079/9781789245684.0243
Goi i U, Aiha za J, Guiu M, Salsamendi E, Almena D, Napal M, Ga in I (2011). Geo oy’s ba ,
Myo is ema gina us, p eys p e e en ially on spide s in mul is a i ied dense habi a s: A s udy
o o aging ba s in he Medi e anean. Folia Zoologica, 60(1):17–24.
h ps://doi.o g/10.25225/ ozo. 60.i1.a3.2011
González MA, B a o-Ba iga D, Ba op-Fe nández E, F on e a E, Ruiz-A ondo I (2022). Se e e
Skin Lesions Caused by Pe sis en Bi es o he S able Fly S omoxys calci ans (Dip e a:
Muscidae) in a Donkey Sanc ua y o Wes e n Spain. Jou nal o Equine Ve e ina y Science,
116:104056. h ps://doi.o g/10.1016/j.je s.2022.104056
Go elli NJ, Ellison AM (2004). A p ime o ecological s a is ics. Sinaue Associa es Publishe s.
Hails CJ (1982). A compa ison o opical and empe a e ae ial insec abundance. Bio opica,
14(4):310–313. h ps://doi.o g/10.2307/2388092
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
119
Hope PR, Bohmann K, Gilbe MTP, Zepeda-Mendoza ML, Razgou O, Jones G (2014). Second
gene a ion sequencing and mo phological aecal analysis e eal unexpec ed o aging
beha io by Myo is na e e i (Chi op e a, Vespe ilionidae) in win e . F on ie s in Zoology,
11(1):39. h ps://doi.o g/10.1186/1742-9994-11-39
Hsieh YL, Linsenmai KE (2012). Seasonal dynamics o a bo eal spide di e si y in a empe a e
o es . Ecology and E olu ion, 2(4):768–777. h ps://doi.o g/10.1002/ece3.221
Hykel M, Ha abiš F, Dolný A (2017). Diel changes in habi a use by d agon lies: Noc u nal
oos ing si e selec ion by he h ea ened d agon ly Sympe um dep essiusculum (Odona a:
Libellulidae). En omological Science, 21:154–163. h ps://doi.o g/10.1111/ens.12292
Illumina (2013). 16S Me agenomic Sequencing Lib a y P epa a ion (Illumina Technical No e
15044223).
h p://suppo .illumina.com/documen s/documen a ion/chemis y_documen a ion/16s/16
s-me agenomic-lib a y-p ep-guide-15044223-b.pd [Accessed on 2025/02/15]
Jones G (1990). P ey selec ion by he g ea e ho seshoe ba (Rhinolophus e umequinum):
Op imal o aging by echoloca ion? Jou nal o Animal Ecology, 59:587–602.
h ps://doi.o g/10.2307/4882
Jung K, Kalko EKV (2010). Whe e o es mee s u baniza ion: Fo aging plas ici y o ae ial
insec i o ous ba s in an an h opogenically al e ed en i onmen . Jou nal o Mammalogy,
91:144–153. h ps://doi.o g/10.1644/08-MAMM-A-313R.1.
Ke yn T, Godin M-C, Jocqué R, G oo ae P, Libois R (2012). Web-building spide s and blood-
eeding lies as p ey o he no ch-ea ed ba (Myo is ema gina us). Belgian Jou nal o Zoology,
142(1):59–67. h ps://doi.o g/10.26496/bjz.2012.137
K ehenwinkel H, Wol M, Lim JY, Rominge AJ, Simison WB, Gillespie RG (2017). Es ima ing and
mi iga ing ampli ica ion bias in quali a i e and quan i a i e a h opod me aba coding.
Scien i ic Repo s, 7:17668. h ps://doi.o g/10.1038/s41598-017-17333-x
K ull D, Schumm A, Me zne W, Neuweile G (1991). Fo aging a eas and o aging beha io in he
no ch-ea ed ba , Myo is ema gina us (Vespe ilionidae). Beha io al Ecology and Sociobiology,
28:247–253. h ps://doi.o g/10.1007/BF00175097
Lewanzik D, Voig CC (2016). T ansi ion om con en ional o ligh -emi ing diode s ee ligh ing
changes ac i i y o u ban ba s. Jou nal o Applied Ecology 54:264–271.
h ps://doi.o g/10.1111/1365-2664.12758
Lindecke O, Cu ie SE, Fasel NJ, F i ze M, K a chenko K, K uszynski C, Lehne LS, Röleke M,
Voig -Heucke SL, Voig CC (2021). Common noc ule Nyc alus noc ula (Sch ebe , 1774). In:
Russo D (Ed.), Chi op e a, handbook o he mammals o Eu ope, pp. 463–487. Sp inge
In e na ional Publishing. h ps://doi.o g/10.1007/978-3-030-44029-9_63
Maine JJ, Boyles JG (2015). Land co e in luences die a y specializa ion o insec i o ous ba s
globally. Mammal Resea ch, 60(4):343–351. h ps://doi.o g/10.1007/s13364-015-0243-z
Ma in M (2011). Cu adap emo es adap e sequences om high- h oughpu sequencing eads.
EMBne Jou nal, 17(1):10-12. h ps://doi.o g/10.14806/ej.17.1.200
Ma a VA, da Sil a LP, Ve íssimo J, Ho a P, Raposei a H, McC acken GF, Rebelo H, Beja P (2021).
Combining DNA me aba coding and ecological ne wo ks o in o m conse a ion biocon ol by
small e eb a e p eda o s. Ecological Applica ions, 31(8):e02457.
h ps://doi.o g/10.1002/eap.2457
McGui e LP, Boyles JG (2024). Ene ge ics o o aging ba s. In: Russo D, Fen on B (Eds) A Na u al
His o y o Ba Fo aging, pp. 173–198. Academic P ess. h ps://doi.o g/10.1016/B978-0-323-
91820-6.00012-7
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
120
Nae T, Besna d AL, Lehnen L, Pe i EJ, an Schaik J, Puechmaille SJ (2023). How o quan i y
ac o s deg ading DNA in he en i onmen and p edic deg ada ion o e ec i e sampling
design. En i onmen al DNA, 5(3):403–416. h ps://doi.o g/10.1002/edn3.414
No ella-Fe nandez R, Ibañez C, Jus e J, Cla e EL, Doncas e CP, Razgou O (2020). T ophic
esou ce pa i ioning d i es ine-scale coexis ence in c yp ic ba species. Ecology and
E olu ion, 10(24):14122–14136. h ps://doi.o g/10.1002/ece3.7004
No ella-Fe nandez R, Jus e J, Ibáñez C, Rebelo H, Russo D, Albe di A, Kie e A, G aham L, Paul H,
Doncas e CP, Razgou O (2021). B oad-scale pa e ns o geog aphic a oidance be ween
species eme ge in he absence o ine-scale mechanisms o coexis ence. Di e si y and
Dis ibu ions, 27:1606–1618. h ps://doi.o g/10.1111/ddi.13375
Ny ele M, Bon e D (2020). Whe e ha e all he spide s gone? Obse a ions o a d ama ic
popula ion densi y decline in he once e y abundan ga den spide , A aneus diadema us
(A aneae: A aneidae), in he Swiss Midland. Insec s, 11(4):248.
h ps://doi.o g/10.3390/insec s11040248
Pa k KJ (2015). Mi iga ing he impac s o ag icul u e on biodi e si y: Ba s and hei po en ial ole
as bioindica o s. Mammalian Biology, 80:191–204.
h ps://doi.o g/10.1016/j.mambio.2014.10.004
Peel MC, Finlayson BL, McMahon TA (2007). Upda ed wo ld map o he Köppen-Geige clima e
classi ica ion. Hyd ology and Ea h Sys em Sciences, 11:1633–1644.
h ps://doi.o g/10.5194/hess-11-1633-2007
Pi JB, Die z M (2018). Popula ionshdich e und Lebens aumnu zung de lede mause maus
(Myo is ema gina us Geo oy, 1806) an ih e nö dlichen Ve b ei ungsg enze in Luxembu g.
Bulle in de la Socié e des na u alis s luxembou geois, 12:107-121.
Pi accini R (2016). Myo is ema gina us. The IUCN Red Lis o Th ea ened Species.
e.T14129A22051191. h ps://doi.o g/10.2305/IUCN.UK.2016-2.RLTS.T14129A22051191.en
Puig-Mon se a X, Mas M, Flaque C, Tuneu-Co al C, López-Baucells A (2021). Bene i s o
o ganic oli e a ming o he conse a ion o gleaning ba s. Ag icul u e, Ecosys ems &
En i onmen , 313:107361. h ps://doi.o g/10.1016/j.agee.2021.107361
R Co e Team (2024). R: A Language and En i onmen o S a is ical Compu ing. R Founda ion o
S a is ical Compu ing, Vienna, Aus ia. h ps://www.R-p ojec .o g/
Raupp MJ, Sh ewsbu y PM, He ms DA (2010). Ecology o he bi o ous a h opods in u ban
landscapes. Annual Re iew o En omology, 55:19–38. h ps://doi.o g/10.1146/annu e -en o-
112408-085351
Razgou O, Ibáñez C, Puechmaille SJ, Jus e J (2021). Myo is na e e i Species Complex (M.
na e e i, M. c yp icus, and M. escale ai). In: Russo D (Ed.), Chi op e a, handbook o he
mammals o Eu ope, pp. 257–285. Sp inge In e na ional Publishing.
h ps://doi.o g/10.1007/978-3-030-44029-9_57
Rigal S, Dakos V, Alonso H, Auniņš A, Benkő Z, B o ons L, Chodkiewicz T, Chyla ecki P, de Ca li E,
del Mo al JC, Domşa C, Escandell V, Fon aine B, Foppen R, G ego y R, Ha is S, He ando S,
Husby M, Ie onymidou C, Jigue F, Kennedy J, Kl aňo á A, Kmecl P, Kuczyński L, Ku la ičius P,
Kålås JA, Lehikoinen A, Linds öm Å, Lo illiè e R, Moshøj C, Nellis R, Noble D, Eskildsen DP,
Paque J-Y, Pélissié M, Plade all C, Po olou D, Rei J, Schmid H, Seaman B, Szabo ZD, Szép T,
Flo enzano GT, Teu elbaue N, T au mann S, an Tu nhou C, Ve mouzek Z, Viks øm T,
Voříšek P, Weise bs A, De ic o V (2023). Fa mland p ac ices a e d i ing bi d popula ion
decline ac oss Eu ope. P oceedings o he Na ional Academy o Sciences,
120(21):e2216573120. h ps://doi.o g/10.1073/pnas.2216573120
Robe s MJ (1995). Spide s o B i ain and No he n Eu ope. London, Ha pe Collins.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 4: Land co e in luences die o a specialis ba
121
Rognes T, Flou i T, Nichols B, Quince C, Mahé F (2016). VSEARCH: A e sa ile open sou ce ool o
me agenomics. Pee J, 4:e2584. h ps://doi.o g/10.7717/pee j.2584
Rydell J, Racey PA (1995). S ee lamps and he eeding ecology o insec i o ous ba s. In: Racey
and Swi (Eds.) Ecology, E olu ion and Beha iou o Ba s: The P oceedings o a Symposium
held by he Zoological Socie y o London and he Mammal Socie y: London, pp. 291–308.
Ox o d Uni e si y P ess. h ps://doi.o g/10.1093/oso/9780198549451.003.0019
Sala OE, Chapin SF III, A mes o JJ, Be low E, Bloom ield J, Di zo R, Hube -Sanwald E, Huenneke
LF, Jackson RB, Kinzig A, Leemans R, Lodge DM, Mooney HA, Oes e held M, Po NL, Sykes MT,
Walke BH, Walke M, Wall DH (2000). Global biodi e si y scena ios o he yea 2100.
Science, 287(5459):1770–1774. h ps://doi.o g/10.1126/science.287.5459.1770
Sanbo n AF, Simões PC, Phillips PK, Qua au JA (2011). The mo egula ion and he in luence o
body empe a u e on calling song pa ame e s in Cicada o ni (Hemip e a: Cicadidae).
Eu opean Jou nal o En omology, 108:365–369. h ps://doi.o g/10.14411/eje.2011.045
Sánchez-Bayo F, Wyckhuys KAG (2019). Wo ldwide decline o he en omo auna: A e iew o i s
d i e s. Biological Conse a ion, 232:8–27. h ps://doi.o g/10.1016/j.biocon.2019.01.020
Sieme s BM, K ine E, Kaip I, Simon M, G ei S (2012). Ba s ea esd op on he sound o copula ing
lies. Cu en Biology, 22:563–564. h ps://doi.o g/10.1016/j.cub.2012.06.030
Spi zenbe ge F, Weiss E (2020). Time keeping in emale Myo is ema gina us du ing ep oduc ion
(Chi op e a: Vespe ilionidae). Lynx new se ies, 51:131–145.
h ps://doi.o g/10.37520/lynx.2020.010
S eck CE, B inkmann R (2006). The ophic niche o he Geo oy’s ba (Myo is ema gina us) in
sou h-wes e n Ge many. Ac a Chi op e ologica, 8:445–450. h ps://doi.o g/10.3161/1733-
5329(2006)8[445:TTNOTG]2.0.CO;2
S idshol L, Scholz C, He manns U, Teige T, Pos M, S apel eld B, Reusch C, Voig CC (2023). Low
o aging a es d i e la ge insec i o ous ba s away om u ban a eas. Global Change Biology,
30:e17063. h ps://doi.o g/10.1111/gcb.17063
Te cel MPTG, Symondson WOC, Cu JP (2021). The p oblem o omni o y: A syn hesis on
omni o y and DNA me aba coding. Molecula Ecology, 30:2199-2206.
h ps://doi.o g/10.1111/mec.15903
Tiede J, Diepenb uck M, Gadau J, Wemheue B, Daniel R, Sche be C (2020). Seasonal a ia ion in
he die o he se o ine ba (Ep esicus se o inus): A high- esolu ion analysis using DNA
me aba coding. Basic and Applied Ecology, 49:1–12.
h ps://doi.o g/10.1016/j.baae.2020.09.004
Tou nay e O, Leuch mann M, Galan M, T illa M, Pi y S, Pinaud D, Filippi-Codaccioni O, Pon ie D,
Cha bonnel N (2020). eDNA me aba coding e eals a co e and seconda y die s o he g ea e
ho seshoe ba wi h s ong spa io- empo al plas ici y. En i onmen al DNA, 3(1):277–296.
h ps://doi.o g/10.1002/edn3.167
Valbuena-Laca a P, Saloña-Bo das MI (2010). Nue os da os sob e la p esencia de S omoxys
calci ans (Linnaeus, 1758) (Dip e a, Muscidae) en explo aciones ganade as de Vizcaya (País
Vasco, No e de España). Bole ín de la Asociación Española de En omología, 34(1-2):199–205.
Vallejo N, Aiha za J, Goi i U, A izabalaga-Escude o A, Flaque C, Puig X, Aldaso o M, Ba oja U,
Ga in I (2019). The Die o he No ch-Ea ed Ba (Myo is ema gina us) ac oss he Ibe ian
Peninsula analysed by Amplicon Me aba coding. Hys ix, 30(1):59–64.
h ps://doi.o g/10.4404/hys ix-00189-2019
Vallejo N, Aiha za J, Olasagas i L, Aldaso o M, Goi i U, Ga in I (2023). Seasonal shi in he die o
he no ched-ea ed ba (Myo is ema gina us) in he Basque Coun y: om lies o spide s.
Mammalian Biology, 103:419–431. h ps://doi.o g/10.1007/s42991-023-00353-8
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
122
Vamos EE, Elb ech V, Leese F (2017). Sho COI ma ke s o eshwa e mac oin e eb a e
me aba coding. Me aba coding and Me agenomics 1:e14625.
h ps://doi.o g/10.3897/mbmg.1.14625
Vesce a C, Van Vy e C, Smi s Q, Michaux JR (2024). All-you-can-ea bu e : A spide -specialized
ba species (Myo is ema gina us) u ns in o a pes ly ea e a ound ca le. PLoS ONE,
19:e0302028. h ps://doi.o g/10.1371/jou nal.pone.0302028
Wickham H (2016). ggplo 2: Elegan g aphics o da a analysis. A ailable om:
h ps://ggplo 2. idy e se.o g.
Wick amasinghe LP, Ha is S, Jones G, Vaughan Jennings N (2004). Abundance and species
ichness o noc u nal insec s on o ganic and con en ional a ms: E ec s o ag icul u al
in ensi ica ion on ba o aging. Conse a ion Biology, 18:1283–1292.
h ps://doi.o g/10.1111/j.1523-1739.2004.00152.x
W ay AK, Pee y MZ, Jusino MA, Kochanski JM, Banik MT, Palme JM, Lindne DL, G a on C
(2020). P eda o p e e ences shape he die s o a h opodi o ous ba s mo e han
quan i a i e local p ey abundance. Molecula Ecology, 30(3):855–873.
h ps://doi.o g/10.1111/mec.15769
Wong BBM, Candolin U (2015). Beha io al esponses o changing en i onmen s. Beha io al
Ecology, 26:665–673. h ps://doi.o g/10.1093/beheco/a u183
Zahn A, Baue S, K ine E, Holzhaide J (2010). Fo aging habi a s o Myo is ema gina us in Cen al
Eu ope. Eu opean Jou nal o Wildli e Resea ch, 56(3):395–400.
h ps://doi.o g/10.1007/s10344-009-0331-y
Zahn A, Rainho A, Kie e A (2021). G ea e mouse-ea ed ba Myo is myo is (Bo khausen, 1797).
In: Russo D (Ed.), Chi op e a, handbook o he mammals o Eu ope. Sp inge In e na ional
Publishing, pp. 287–320. h ps://doi.o g/10.1007/978-3-030-44029-9_59
Zanaga D, Van De Ke cho e R, De Kee smaecke W, Sou e ijns N, B ockmann C, Quas R, We e s
J, G osu A, Paccini A, Ve gnaud S, Ca us O, San o o M, F i z S, Geo gie a I, Lesi M, Ca e S,
He old M, Li L, Tsendbaza N-E, Ramoino F, A ino O (2021). ESA Wo ldCo e 10 m 2020
100. h ps://doi.o g/10.5281/ZENODO.5571936
Zeleis A, Kleibe C, Jackman S (2008). Reg ession models o coun da a in R. Jou nal o S a is ical
So wa e, 27(8):1–25. h ps://doi.o g/10.18637/jss. 027.i08
Zuu AF, Ieno EN, Walke N, Sa elie AA, Smi h GM (2009). Mixed e ec s models and ex ensions in
ecology wi h R. Sp inge , New Yo k. h ps://doi.o g/10.1007/978-0-387-87458-6
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
CHAPTER 5: Analysis o a li es ock pes
ly p eda ion h ough eal- ime qPCR:
Applica ions o In eg a ed Pes
Managemen
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
130
The ampli ied DNA was mig a ed in a 1.5% aga ose gel o con i m ampli ica ion.
Ampli ica ion p oduc s we e cleaned wi h ExoSAP-IT (Applied Biosys ems, USA)
and sequenced by an ABI3730XL sequence (The moFishe , USA). I p ocessed
he esul ing sequences wi h Geneious ( e sion 2022.2). Fo wa d and e e se
pai s we e checked o e o s and assembled, and he sequences we e iden i ied
by compa ing hem agains he GenBank Nucleo ide da abase using he BLASTn
ool. I only ega ded iden i ica ions as alid i he iden i y alue was o e 98%.
P ime design o qPCR o en i onmen al samples
I e ie ed a pa ial sequence o he ull mi ochond ial genome o S omoxys
calci ans om GenBank (accession numbe DQ533708.1) and used i as a
empla e o ou qPCR assay. I designed he speci ic p ime s and p obes using
he P ime -Ques Design Tool (In eg a ed DNA Technologies,
h ps://eu.id dna.com/). I se an op imum mel ing empe a u e (Tm) o 62 °C
and 68 °C o he p ime s (ScaF and ScaR) and p obe (ScaP) espec i ely, a leng h
o 22 and 24 base pai s o he p ime s and he p obe, and a 50% GC con en . I
looked o amplicons o a ound 100 base pai s o ensu e hei in eg i y a e
diges ion by p eda o s. I gene a ed 50 p ime pai and p obe combina ions and
e i ied hei speci ici y and ha o he p edic ed amplicon in silico, by
compa ing hem agains all sequences a ailable in GenBank. I selec ed he bes
assay by ensu ing ha he esul ing amplicon and a leas wo o he assay
elemen s only ma ched wi h S omoxys calci ans on GenBank, and ha he
mel ing empe a u e o he p obe was a leas 6 °C highe han he p ime s’
(Table 1).
qPCR quan i ica ion
I es ed he designed p ime s using qPCR. I selec ed one S. calci ans C+
sample wi h good ex ac ion quali y me ics (DNA concen a ion = 24 ng/µl;
A260/A280 = 2.06; A260/A230 = 2.24) o build a s anda d cu e and c ea ed
se en aliquo s acco ding o a i e- old dilu ion se ies om a s a ing DNA
concen a ion o 5 ng/µl. These se en aliquo s we e ampli ied oge he wi h
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

Chap e 5: Li es ock pes p eda ion h ough RT-qPCR
131
samples C- (n = 7), Sc+ (n = 88), Sc- (n = 17), Bl+ (n = 8) and a no empla e con ol
NTC (n = 1). All samples besides he s anda d cu e and he NTC we e dilu ed o
a maximum DNA concen a ion o 5ng/µl.
Table 1: P ime s and p obes designed and used o he qPCR assay.
Name
Sequence
Len.
(bp)
GC%
Tm
(°C)
Ta ge
gene
P oduc
leng h
ScaF
5’ – ATTATAGCCCATGACCTTTAACTG – 3’
24
37.5
60.8
CO3
147 bp
ScaR
5’ – CATCTCGTCATCATTGATAAACTGT – 3’
25
36.0
61.4
ScaP
5’–/56-FAM/TGGTGCAAT/ZEN/
AACTACAGTTGCAGGA/3IABkFQ/ – 3’
25
44.4
66.3
Th ee eplica es o each sample we e included in a qPCR eac ion using 5 µl
o Mas e Mix (NZYSup eme qPCR P obe Mas e Mix (2x), ROX Plus; NZY ech),
0.4 µl o each p ime (10 nM), 0.1 µl o p obe (10 nM), 3.1 µl o nuclease- ee H2O
and 1 µl o empla e DNA o a o al olume o 10 µl pe eac ion. NTC eac ions
con ained 1 µl o nuclease ee H2O ins ead o DNA. The qPCR eac ions we e
pe o med in a 7900HT Fas Real-Time PCR Sys em uni (The mo ishe , USA),
and condi ions we e 95 °C o 5 min, ollowed by 39 cycles o 95 °C o 5 s and 60
°C o 40 s.
I p e-p ocessed aw un ou pu s using Bio-Rad CFX Maes o o indexing he
samples, and isually es ablished he h eshold o ob ain C ( h eshold cycle)
alues. These alues indica e he cycle numbe a which he luo escence signal
o he qPCR eaches a h eshold alue ha ep esen s he exponen ial
ampli ica ion phase o he eac ion, and i is ela ed o he s a ing DNA quan i y
(Bus in e al., 2009).
S a is ical analyses
I ex ac ed C alues o all eplica es and pe o med he es o he analyses
in R 4.4.0 (R Co e Team, 2024). Fo he s anda d cu e, I buil a linea
eg ession be ween C alues and he loga i hm o he DNA concen a ion o he
dilu ion o C+ samples. I eco ded he slope o he ela ionship, and he R2 alue
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
132
o he eg ession. Then, I calcula ed he e iciency (e ) o he ampli ica ion
applying equa ion 1:
𝑒𝑓𝑓 = −1 + 10(− 1
𝑠𝑙𝑜𝑝𝑒) (1)
The es o he samples we e i s e alua ed quali a i ely acco ding o
whe he o no he eplica es p oduced a no iceable change in abso bance
(he ea e labelled qPCR+ and qPCR-, espec i ely), and he e o e a measu ed C
alue. I only ega ded a sample as posi i e i all h ee o he eplica es we e
posi i e. Then I calcula ed he coe icien o a ia ion o C alues among
eplica es using equa ion 2, and i i was highe han 10% I emo ed he mos
in luen ial ou lie alue among he h ee eplica es (Xue e al., 2025). Finally, I
calcula ed he mean C alues pe sample and I alida ed hem based on he
s anda d cu e. Samples wi h mean C alue ou side he ange es ablished by he
s anda d cu e (21.1 < C < 32.9) we e dis ega ded.
a ia ion = mean(𝐶𝑡)
𝑠𝑡.𝑑𝑒𝑣 (𝐶𝑡)×100 . (2)
Using mean C alues, and he s anda d cu e me hod, I p edic ed he ini ial
DNA concen a ion o all emaining samples. I e alua ed quali a i e qPCR
esul s in ela ion o DNA me aba coding esul s o samples Sc+, Sc- and Bl+. I
also e alua ed whe he qPCR esul s we e ela ed o sample quali y and sample
cha ac e is ics. Fo ha , I sepa a ed he samples acco ding o he quali a i e
esul combina ion in DNA me aba coding (g oups Sc+, Sc- and Bl+) and qPCR
(g oups qPCR+, qPCR-), and compa ed he cha ac e is ics o hese sample g oups
in ela ion o di e en sample me ics, namely: o al ead coun s in DNA
me aba coding, S. calci ans eads eco e ed by DNA me aba coding, and
A280/A260 and A230/A260 a io o he ex ac ion. P o ein o phenol con amina ion,
ep esen ed by low alues o bo h a ios measu ed, can lead o inhibi ion and
nega i ely a ec downs eam analyses (Olson and Mo ow, 2012). This would
impac bo h he qPCR assay p esen ed in his s udy and he DNA me aba coding
esul s. Simila ly, low me aba coding o al ead coun s can also be ela ed o
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 5: Li es ock pes p eda ion h ough RT-qPCR
133
excessi e deg ada ion o he DNA (Nae e al., 2023). The di e ences be ween
g oups we e e alua ed using K uskall Wallis es om package s a s (R Co e
Team, 2024), ollowed by a pos -hoc Dunn’s es wi h Holm’s co ec ion om
package s a ix (Kassamba a, 2023).
Finally, I compa ed he p edic ed DNA concen a ion o Sc+/qPCR+ samples
wi h ead coun s epo ed by DNA me aba coding using Spea man’s co ela ion
es (R Co e Team, 2024).
Resul s
The axonomic iden i y o all he C+ samples collec ed, included he one used
o build he s anda d cu e, was con i med o be S. calci ans h ough sequencing
o he COI gene. In he qPCR assay, all he eplica es om S. calci ans (C+) we e
success ully ampli ied, and he s anda d cu e had an e iciency o 91.92% and
R2 = 0.982 (Appendix S5.2).
Figu e 1. P edic ed DNA concen a ion (ng/µl) achie ed in he qPCR assays, excep in
C+ samples, which indica e measu ed concen a ions. Boxplo s indica e he 1s and 3 d
qua iles, wi h he median ep esen ed by a hick line. Whiske s ex end up o 1.5 imes
he IQR (in e qua ile ange). Each do ep esen s a single sample. Da a poin s on op o
he dashed line ep esen ailed ampli ica ions. No e ha he y axis is ep esen ed
exponen ially.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
134
The qPCR eac ion was nega i e o he NTC, non- a ge insec DNA (C-), and
all he Sc- aecal sample eplica es. All eigh Bl+ samples and eigh o he Sc+
samples also ailed o ampli y, because hey ei he did no p oduce a no iceable
abso p ion signal, o hei mean C alue ell below he accep ed h eshold
(Appendix S5.1). The qPCR eac ion was posi i e in 80 samples (in all hei h ee
eplica es), all o hem being Sc+. These had C alues be ween 22.3 and 32.8,
which co esponds o a p edic ed concen a ion o S. calci ans DNA be ween
2.15 ng/µl and 0.0016 ng/µl (Fig. 1).
The ou ex ac ion-quali y me ics e alua ed ( he o al me aba coding ead
coun s, S. calci ans ead coun s, A260/A280 a io o he ex ac ion and A260/A230
a io o he ex ac ion) we e signi ican ly di e en be ween all classes
(Sc+/qPCR+, Sc+/qPCR-, Sc- and Bl+; Appendix S5.3). Bl+ samples had
signi ican ly lowe alues han Sc+/qPCR+ o all he me ics. On he o he hand,
Sc- and Sc+/qPCR- samples we e simila o Bl+ samples when compa ing he
numbe o S. calci ans eads and he A260/A230 ex ac ion a io, and hese alues
we e signi ican ly lowe han hose epo ed o Sc+/qPCR+ samples. Finally, Sc-
and Sc+/qPCR+ samples con ained he highes median o me aba coding eads,
which we e also signi ican ly di e en om Bl+ samples (Fig. 2).
Figu e 2. Me aba coding ead coun esul s and ex ac ion quali y me ics. Signi icance
alues o Dunn’s es wi h Holm’s co ec ion a e ep esen ed (* = 0.05 < p- alue, ** = p-
alue < 0.01, *** = p- alue < 0.001, **** = p- alue < 0.0001). Boxplo s indica e he 1s
and 3 d qua iles, wi h he median ep esen ed by a hick line. Whiske s ex end up o
1.5 imes he IQR (in e qua ile ange). See Ma e ials and Me hods sec ion o
abb e ia ions.
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 5: Li es ock pes p eda ion h ough RT-qPCR
135
I ound signi ican posi i e ank co ela ion be ween he ini ial DNA
concen a ion es ima ed by qPCR and he ead coun s o S omoxys calci ans
epo ed by DNA me aba coding ( ho = 0.65, p = 2.2e-16).
Discussion
This s udy p esen s an e ec i e qPCR me hodology o de ec aces o
S omoxys calci ans DNA in he aeces o he espe ilionid ba Myo is
ema gina us. The qPCR assay was adequa ely e icien a ampli ying S. calci ans
DNA, based on he s anda d cu e esul s. O e all, he assay was 100% accu a e
ega ding insec DNA ex ac ions, and 92% o aecal samples belonging o M.
ema gina us. The assay p esen ed he e easily iden i ies consump ion o S.
calci ans by i s na u al e eb a e p eda o s like he no ch-ea ed ba , and likely,
o he s as he ba n swallow. Li es ock pes s a e usually ound in abundance
a ound ca le and inside o ca le sheds, making hem an a ac i e ood sou ce
o insec i o ous p eda o s. While he dis ibu ion o hese wo p eda o s has
been explici ly linked o he a ailabili y o li es ock pes s (Die z e al., 2013;
Musi elli e al., 2016), he p esence o li es ock seems o encou age o aging by
o he species, whose link wi h ca le a ming a e no as clea ly se (Ancillo o e
al., 2021; Sieme s e al., 2012). This assay can help iden i y popula ions ha ha e
a high dependency o li es ock pes s and help design adequa e managemen
measu es o each pa icula case.
Unexpec edly, some o ou samples we e nega i e in qPCR while posi i e by
DNA me aba coding. Some s udies ha e epo ed a highe sensi i i y o qPCR
han DNA me aba coding (Ha pe e al., 2018; Ba oja e al., 2022; Johnson e al.,
2024), which con adic s ou esul s. The Sc+/qPCR+ samples had signi ican ly
highe S. calci ans eads eco e ed by me aba coding han any o he sample
class (Sc+/qPCR-, Bl+ and Sc-), which could explain why qPCR esul s we e
nega i e o he me aba coding-posi i e samples Bl+ and Sc+/qPCR–. Howe e ,
ex ac ion quali y me ics could also in luence qPCR esul s, due o high p o ein
o DNA a ios (measu ed by he A260/A280 a io) and con amina ion om o he
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258

The ophic ecology o Myo is ema gina us
136
compounds such as sal s o phenols (A260/A230 a io) han can lowe PCR
e iciency o inhibi i all oge he (Olson and Mo ow, 2012. Faecal samples had
o e all lowe a io alues han insec samples, Sc+/qPCR- samples had e en
lowe A260/A230 alues han Sc+/qPCR+ samples (Fig. 2; Appendix S5.1).
None heless, i e ou o he eigh Sc+/qPCR- samples had a e age C alues
be ween 33 and 34, we e posi i e in all h ee eplica es and had a ia ion
coe icien s lowe han 10%. They we e dis ega ded as hey ailed o mee one
o he c i e ia o be conside ed as qPCR+ (i.e., mean C ≤ 32.9). Howe e , hese
samples could be ue posi i es wi h e y low amoun s o S. calci ans DNA, so
he qPCR assay could be able o de ec i s a ge beyond he h eshold p esen ed
he e.
All Bl+ samples we e ex ac ion con ols, and e en hough hey we e posi i e
in he DNA me aba coding es , we e no expec ed o con ain any empla e DNA.
Ou o he 24 indi idual eplica es o Bl+ samples (eigh iplica e samples), only
h ee p oduced a measu able change in abso p ion ha co ela ed wi h C alues
o e 37, well below he accep ed h eshold o his s udy. The obse ed
disc epancy be ween qPCR and DNA me aba coding could mean ha he la e
is mo e eliable when he quali y o he inpu sample is comp omised.
Con e sely, i could also mean ha me aba coding is mo e e o -p one and I
canno ule ou ha S. calci ans eads in Bl+ samples a e alse posi i es,
esul ing om sequencing e o s, con amina ion du ing lib a y p epa a ion, o
ag-jump e en s (Esling e al., 2015). S ochas ic e o s such as hese can cause
alse posi i es in ex ac ion blanks and biological samples alike (e.g. Dick e al.,
2023). The design o his s udy does no allow o assess hese al e na i e
explana ions.
The p edic ed ini ial concen a ions o Sc+ samples showed a posi i e
co ela ion wi h DNA me aba coding eads o S. calci ans, consis en wi h
indings om o he s udies (Dick e al., 2023; Johnson e al., 2024). This
co ela ion would suppo he use o ei he me hod o compa ing he ela i e
abundance o single-locus DNA ac oss mul iple samples. In ac , DNA
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 5: Li es ock pes p eda ion h ough RT-qPCR
137
me aba coding emains a powe ul ool o communi y-le el analysis o
en i onmen al samples. Using gene alis p ime s, i can be applied e en wi h
limi ed p io knowledge o he biological sys em unde in es iga ion
(Wanges een e al., 2018). Howe e , due o he inhe en ly mul i-locus na u e o
DNA me aba coding, and PCR ampli ica ion biases wi hin a single PCR eac ion
(K ehenwinkel e al., 2017), he esul ing ead coun s do no always co ela e
wi h inpu DNA concen a ions (Jusino e al., 2019). On op o ha , a iable
diges ion a es o di e en p ey i ems o issue ypes ( e iewed in King e al.,
2008) adds an addi ional laye o a iabili y ha makes he es ima ion o he
biomass consumed by he p eda o e en mo e challenging. Ca e ully e alua ing
p ime selec ion o each speci ic applica ion can help mi iga e echnical biases
(Piñol e al., 2018; Jusino e al., 2019), bu s ill, some au ho s ad ise agains using
DNA me aba coding da a o quan i a i e pu poses (Elb ech and Leese, 2015).
The e o e, when he ocus is on a single axon, he eliabili y and obus ness
o qPCR makes i a s ong op ion o bo h quali a i e and quan i a i e s udies.
This is pa icula ly ele an o e alua ing pes consump ion by na u al enemies
(Ba oja e al., 2022; Mangan e al., 2018; his s udy) o o moni o ing in asi e
(Johnson e al., 2024) o elusi e species (Ripa e al., 2024). Addi ionally, qPCR
o e s logis ical ad an ages o e DNA me aba coding, as i is mo e cos -e ec i e
(Ba oja e al., 2022) and equi es ewe analy ical s eps, making i less p one o
echnical e o s o con amina ion e en s. Thus, qPCR is a e y well-sui ed
echnique o la ge-scale o long- e m moni o ing p og ams hanks o i s
e iciency, ep oducibili y and educed cos s.
The qPCR assay p esen ed in his s udy is in ended o acili a e he e alua ion
o S. calci ans consump ion by e eb a e na u al enemies. I enables o su ey
species, popula ions, o colonies consuming S. calci ans, as well as ela i ely
quan i iying consump ion. While a iable diges ion a es may al e he
ela ionship be ween inges ed biomass and qPCR ampli ica ion esul s, when
combined wi h o he echniques, he in o ma ion ob ained om qPCR could
p o ide aluable insigh s in o he di ec e ec o na u al p eda o s on he
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
The ophic ecology o Myo is ema gina us
138
supp ession o S. calci ans. Such da a a e essen ial o assessing hei
e ec i eness agains li es ock pes s and p o ec ing na i e popula ions o
e eb a e p eda o s ha may signi ican ly depend on his ood sou ce. All in all,
he in o ma ion p o ided by his qPCR assay could p o e o be use ul o he
implemen a ion o e eb a e na u al enemies in o IPM p og ams o li es ock
pes s.
Re e ences
Amb osini R, Rubolini D, T o ò P, Libe ini G, Bandini M, Romano A, Sicu ella B, Scandola a C,
Romano M, Saino N (2012). Main enance o li es ock a ming may bu e popula ion decline
o he Ba n Swallow Hi undo us ica. Bi d Conse a ion In e na ional, 22:411–248.
h ps://doi.o g/10.1017/S0959270912000056
Ancillo o L, Fes a F, De Benede a F, Cosen ino F, Pejic B, Russo D (2021). F ee- anging li es ock
and a di e se landscape s uc u e inc ease ba o aging in moun ainous landscapes.
Ag o o es y Sys ems, 95:407–418. h ps://doi.o g/10.1007/s10457-021-00591-0
Ba oja U, Ga in I, Vallejo N, Ca o A, Ibáñez C, Basso A, Goi i U (2022). Molecula assays o eliably
de ec and quan i y p eda ion on a o es pes in ba aeces. Scien i ic Repo s, 12:2243.
h ps://doi.o g/10.1038/s41598-022-06195-7
Ba zman M, Bà be i P, Bi ch ANE, Boonekamp P, Dachb od -Saaydeh S, G a B, Hommel B, Jensen
JE, Kiss J, Kudsk P, Lamichhane JR, Messéan A, Moonen AC, Ra nadass A, Ricci P, Sa ah JL,
Sa in M (2015). Eigh p inciples o in eg a ed pes managemen . Ag onomy o Sus ainable
De elopmen , 35:1199–1215. h ps://doi.o g/10.1007/s13593-015-0327-9
Bus in SA, Benes V, Ga son JA, Hellemans J, Hugge J, Kubis a M, Muelle R, Nolan T, P a l MW,
Shipley GL, Vandesompele J, Wi we CT (2009). The MIQE Guidelines: Minimum In o ma ion
o publica ion o Quan i a i e eal- ime PCR Expe imen s. Clinical Chemis y, 55(4):611–622.
h ps://doi.o g/10.1373/clinchem.2008.112797
Cla e E (2014). Molecula de ec ion o ophic in e ac ions: eme ging ends, dis inc ad an ages,
signi ican conside a ions and conse a ion applica ions. E olu iona y Applica ions,
7(9):1144–1157. h ps://doi.o g/10.1111/e a.12225
da Sil a LP, Ma a VA, Lopes PB, Pinho CJ, Cha es C, Co eia E, Pin o J, Heleno RH, Timo eo S, Beja
P (2024). Die a y me aba coding e eals he simpli ica ion o bi d-pes in e ac ion ne wo ks
ac oss a g adien o ag icul u al co e . Molecula Ecology, 33:e17324.
h ps://doi.o g/10.1111/mec.17324
Deguine JP, Aube o JN, Flo RJ, Lescou e F, Wyckhuys, KAG, Ra adass A (2021). In eg a ed
pes managemen : good in en ions, ha d eali ies. A e iew. Ag onomy o Sus ainable
De elopmen , 41:38. h ps://doi.o g/10.1007/s13593-021-00689-w
Dick C, La son WA, Ka pan K, Bae sche DS, Shi Y, Se hi S, Fangue NA, Hende son MJ (2023). P ey
a ion, empe a u e and p eda o species in luence diges ion a es o p ey DNA in e ed om
qPCR and me aba coding. Molecula Ecology Resou ces, 25(5):e13849.
h ps://doi.o g/10.1111/1755-0998.13849
Die z M, Pi JB (2021). Geo oy’s ba Myo is ema gina us (Geo oy, 1806). In: Russo D (Ed.)
Chi op e a, Handbook o he Mammals o Eu ope. Sp inge In e na ional Publishing.
h ps://doi.o g/10.1007/978-3-030-44029-9_56
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258
Chap e 5: Li es ock pes p eda ion h ough RT-qPCR
139
Die z M, Pi JB, Hillen J (2013). Does he su i al o g ea e ho seshoe ba s and Geo oy’s ba s in
Wes e n Eu ope depend on adi ional cul u al landscapes? Biodi e si y and Conse a ion,
22:3007–3025. h ps://doi.o g/10.1007/s10531-013-0567-4
Dimi o ić BA, Gajski D, Kos T, Jelić M, Jelaska LŠ (2023). Insigh in o ophic in e ac ions o
spide s in oli e g o es wi h In eg a ed and Ecological Pes Managemen using DNA
me aba coding. Di e si y, 15(9):976. h ps://doi.o g/10.3390/d15090976
Di ec i e 2009/128/EC o he Eu opean Pa liamen and o he Council o 21 Oc obe 2009
es ablishing a amewo k o Communi y ac ion o achie e he sus ainable use o pes icides.
h p://da a.eu opa.eu/eli/di /2009/128/oj
Du el L, Es ada-Peña A, F anc M, Mehlho n H, Bouye J (2015). In eg a ed ly managemen in
Eu opean uminan ope a ions om he pe spec i e o di ec i e 2009/128/EC on sus ainable
use o pes icides. Pa asi ology Resea ch, 114:379–389. h ps://doi.o g/10.1007/s00436-014-
4273-2
Elb ech V, Leese F (2015). Can DNA-based ecosys em assessmen s quan i y species abundance?
Tes ing p ime bias and biomass-sequence ela ionships wi h an inno a i e me aba coding
p o ocol. PLoS ONE, 10(7):e0130324. h ps://doi.o g/10.1371/jou nal.pone.0130324
Esling P, Lejze owicz F, Pawlowski J (2015). Accu a e mul iplexing and il e ing o high-
h oughpu amplicon-sequencing. Nucleic Acids Resea ch, 43(5):2513–2524.
h ps://doi .o g/10.1093/na /gk 107
Ga cia K, Olimpi EM, Ka p DS, Gon hie DJ (2020). The good, he bad, and he isky: Can bi ds be
inco po a ed as biological con ol agen s in o In eg a ed Pes Managemen p og ams? Jou nal
o In eg a ed Pes Managemen , 11(1):11. h ps://doi.o g/10.1093/jipm/pmaa009
Ge y AC, Mu illo AC (2019). P omo ing biosecu i y h ough insec managemen a animal
acili ies. In: Dewul J, an Imme seel F (Eds.) Biosecu i y in animal p oduc ion and e e ina y
medicine: om p inciples o p ac ice, pp. 243–281. CABI.
h ps://doi.o g/10.1079/9781789245684.0243
González MA (2022). Insec os de impo ancia Médico-Ve e ina ia en el No e de España, pp. 240
Publicación Independien e.
González MA, Du alle G, Mo el D, de Blas, I, Ba io E, Ruiz-A ondo I (2024). An In eg a ed Pes
Managemen S a egy App oach o he Managemen o he S able Fly S omoxys calci ans
(Dip e a: Muscidae). Insec s, 15:222. h ps://doi.o g/10.3390/insec s15040222
Gup a N (2019). DNA ex ac ion and Polyme ase Chain Reac ion. Jou nal o Cy ology, 36(2):116–
117. h ps://doi.o g/10.4103/JOC.JOC_110_18
Ha pe LR, Handley LL, Hahn C, Boonham N, Rees HC, Gough K, Lewis E, Adams IP, B e he on P,
Phillips S, Hän ling B (2018). Needle in a hays ack? A compa ison o eDNA me aba coding and
a ge ed qPCR o de ec ion o he g ea c es ed new (T i u us c is a us). Ecology and
E olu ion, 8:6330–6341. h ps://doi.o g/10.1002/ece3.4012
Hebe PDN, Cywinska A, Ball SL, de Waa d JR (2003). Biological iden i ica ions h ough DNA
ba codes. P oceedings o he Royal Socie y o London. Se ies B: Biological Sciences,
270(1512):313–321. h ps://doi.o g/10.1098/ spb.2002.2218
Johnson M, Te zla S, Ka z A, Jinelle S (2024). Compa ison o qPCR and me aba coding o
en i onmen al DNA su eillance o a eshwa e pa asi e. Ecology and E olu ion,
14(5):e11382. h ps://doi.o g/10.1002/ece3.11382
Jusino MA, Banik MT, Palme JM, W ay AK, Xiao L, Pel on E, Ba be JR, Kawaha a AY, G a on C,
Pee y MZ, Lindne DL (2019). An imp o ed me hod o u ilizing high- h oughpu amplicon
sequencing o de e mine he die s o insec i o ous animals. Molecula Ecology Resou ces,
19:176–190. h ps://doi.o g/10.1111/1755-0998.12951
REGISTRO TELEMÁTICO
Sa e en E egis o
O oko a / Regis o Gene al
de En adas
03/10/2025 14:30
EHU2025E047258