1
Exome sequencing and case-con ol analyses iden i y RCC1 as a
candida e b eas cance suscep ibili y gene
Aoua e Riahi (1,2), Hoda Radmanesh (1,3), Pe e Schü mann (1), Na alia Bogdano a (1,4),
Robe Ge e s (5), Rym Meddeb (2,6), Mahe Kha a (2), Thilo Dö k (1)
(1) Gynaecology Resea ch Uni , Hanno e Medical School, Hanno e , Ge many; (2) Labo a oi e
Géné ique Humaine, Facul é de Médecine de Tunis, Uni e si y Tunis El Mana , Tunis, Tunisia; (3)
Medical Gene ic Resea ch Cen e (MGRC), School o Medicine, Mashhad Uni e si y o Medical
Sciences, Mashhad, I an; (4) Radia ion Oncology Resea ch Uni , Hanno e Medical School,
Hanno e , Ge many; (5) Genome Analy ics Uni , Helmhol z Cen e o In ec ion Resea ch,
B aunschweig, Ge many; (6) Depa men o He edi a y and Congeni al Diso de s, Cha les
Nicolle Hospi al, Tunis, Tunisia.
Con lic o in e es s a emen : The au ho s decla e no po en ial con lic s o in e es .
Keywo ds: B eas ca cinoma, eplica ion, mi osis, ounde mu a ion, RCC1
Con ac :
Aoua e Riahi, PhD/ Thilo Dö k, PhD
Hanno e Medical School
Gynaecology Resea ch Uni (OE 6411)
Ca l-Neube g-S . 1
D-30625 Hanno e , Ge many
Phone: +44 511 532 6075
Fax: +44 511 532 6081
E-mail: doe k. hilo@mh-hanno e .de
2
Abs ac :
B eas cance is a gene ic disease bu he known genes explain a mino i y o cases. To elucida e
he molecula basis o b eas cance in he Tunisian popula ion, we pe o med exome
sequencing on six BRCA1/BRCA2 mu a ion-nega i e pa ien s wi h amilial b eas cance and
iden i ied a no el ameshi mu a ion in RCC1, encoding he Regula o o Ch omosome
Condensa ion 1. Subsequen geno yping de ec ed he 19-bp dele ion in addi ional 5 ou o 153
(3%) b eas cance pa ien s bu in none o 400 emale con ols (p=0.0015). The dele ion was
en iched in pa ien s wi h a posi i e amily his o y (5%, p=0.0009) and co-seg ega ed wi h b eas
cance in he ini ial pedig ee. The mu an allele was los in 4/6 b eas umou s om mu a ion
ca ie s which may be consis en wi h he hypo hesis ha RCC1 dys unc ion p o ides a
selec i e disad an age a he s age o umou p og ession. In summa y, we p opose RCC1 as a
likely b eas cance suscep ibili y gene in he Tunisian popula ion.
No el y & Impac S a emen :
A unca ing mu a ion in RCC1 was exclusi ely ound in b eas cance pa ien s om a ounde
popula ion. RCC1 is impo an o eplica ion con ol and p ope mi o ic spindle o ma ion bu
has no p e iously been associa ed wi h he edi a y cance . Ou esul s sugges RCC1 as a no el
b eas cance suscep ibili y gene.
3
In oduc ion
B eas cance is a gene ically he e ogeneous disease wi h se e al suscep ibili y loci con ibu ing
o he disease.[1-4] Genomic bioma ke s o b eas cance a e comp ised o a e highly
pene an mu a ions o genes such as BRCA1 o BRCA2, mode a ely pene an mu a ions o
genes such as ATM o CHEK2, as well as mo e common genomic a ian s, including single
nucleo ide polymo phisms, associa ed wi h modes e ec sizes.[4] Founde popula ions ha e
been e y help ul o map and iden i y amilial b eas cance suscep ibili y genes, including
BRCA1, CHEK2, o PALB2, and whole exome sequencing con inues o p opose new
candida es.[5,6] The p oduc s o hese genes equen ly coope a e in moni o ing he ideli y o
DNA eplica ion, DNA damage epai and cell di ision. Because hese pa hways a e complex and
in ol e ne wo ks o hund eds o p o eins, se e al mo e suscep ibili y genes a e likely o exis .
The p esen ly known a ian s explain less han hal o all b eas cance s cases.[1,7]
In Tunisia, he incidence o b eas cance has inc eased o e he pas yea s and now accoun s
o some 30% o all emale cance s.[8] Founde mu a ions in BRCA1 and BRCA2 ha e been
de ec ed in abou 25% o amilial b eas cance pa ien s bu he majo i y o amilial cases ha e
emained unexplained.[9-11] In he p esen s udy, we pe o med exome sequencing o
ge mline DNA om six BRCA1 and BRCA2 mu a ion-nega i e Tunisian pa ien s wi h amilial
b eas cance o unco e addi ional suscep ibili y genes. A no el c.1067_1086del19 mu a ion in
RCC1 was u he geno yped in a b eas cance case-con ol associa ion s udy.
Me hods
S udy Popula ion
The Tunisian pa ien s included in his s udy (n=159, including 92 amilial and 67 spo adic cases)
had been e e ed o he Salah Azaiz Cance Ins i u e, Tunis, be ween 2008-2010 (48 amilial
and 67 spo adic cases) and be ween 2016-2017 (44 amilial cases). The mean age a diagnosis
was 46 yea s ( ange 33–81 yea s) o spo adic and 41 yea s ( ange 23-82 yea s) o amilial
cases, wi h 10 (15%) o he spo adic cases and 41 (45%) o he amilial cases diagnosed below
age 40. Among he spo adic cases, 28% o he umou s we e ER- e and 30% we e PR- e. Among
4
he amilial cases, 35% o he umou s we e ER- e and 34% we e PR- e. Heal hy emale
con ols (n = 400) ma ched o e hnici y we e selec ed om he Depa men o He edi a y and
Congeni al Diso de s, Cha les Nicolle Hospi al, Tunis biobank. The mean age o he heal hy
women was 37 yea s a he ime o blood d aw. In o med consen was ob ained om all
pa icipan s and app o ed by he E hical Commi ee o he ins i u e in Tunis. Six high- isk b eas
cance amilies, nega i e o any pa hological BRCA1 and BRCA2 mu a ion, wi h a leas h ee
cases o mul i-gene a ional b eas cance we e selec ed o whole exome sequencing. Selec ed
exome a ian s we e hen geno yped in he emaining Tunisian b eas cance pa ien s (n=153)
and popula ion con ols (n=400). To e alua e popula ion speci ici y, he RCC1 dele ion was
geno yped in addi ional b eas cance pa ien s om Saudi A abia (n=101) and I an (n=116).
These se ies ha e been desc ibed p e iously.[12,13]
Whole-Exome Sequencing
Exome sequencing was pe o med on six genomic DNA samples (3 µg) om Tunisian pa ien s
wi h amilial b eas cance a 100x co e age. Fo his pu pose, exonic sequences we e en iched
using he Su eSelec XT Huma All Exon V6 lib a y (Agilen Technologies, San a Cla a, CA, USA)
and we e sequenced on a HiSeq2500 pla o m (Illumina Inc., San Diego, CA, USA). Raw exome
sequencing da a we e called, de-mul iplexed and aligned acco ding o he GATK pipeline, and
a ian s we e anno a ed using he SnpE ool (h p://snpe .sou ce o ge.ne /). Mu a ions we e
il e ed acco ding o hei absence o low p e alence (MAF< 0.001) in he NCBI SNP and/o
1000Genomes da abases and acco ding o hei p edic ed e ec s. We p io i ized unca ing
mu a ions in genes wi h a known ole in DNA eplica ion o DNA epai , because hese
pa hways a e pa icula ly impo an in b eas cance e iology. We iden i ied ou such genes
wi h a e o no el unca ing mu a ions in single exomes: MCM7, POLE, POLN, and RCC1
(Supplemen a y Table S1). O hese, he mu a ion in POLE was no con i med by Sange
sequencing and may ha e cons i u ed a alse posi i e. The mu a ions in MCM7 (p.A g527Te )
and POLN (c.467_470del4) we e con i med by Sange sequencing, bu no addi ional ca ie s
we e obse ed in a case-only sc eening o ou Tunisian b eas cance se ies. A lis o a ian s in
any gene o in e es is a ailable upon eques .
5
PCR Analysis and Sange Sequencing
Genomic DNA samples we e ampli ied by PCR using he p ime pai 5´-
GCCACCCATTTTGCCTGTAG– 3´ and 5´-CTCACCATCCTTGGTCACAG– 3´, and PCR p oduc s we e
sepa a ed on a 3% aga ose gel. PCR p oduc sizes we e 220 bp o he wild ype and 201 bp o
he mu an allele. Fo semi-quan i a i e agmen analysis, a FAM-labelled o wa d p ime was
used. PCR p oduc s we e hen mixed wi h GeeSa™500 LIZ Size S anda d and loaded on o a
3130 Gene ic Analyze (Applied Biosys ems). Loss o he e ozygosi y (LOH) was de e mined as
ela i e peak heigh a io o umou e sus ma ched ge mline DNA sample. Using peak a ea
a ios ga e simila esul s. Fo di ec sequencing, PCR p oduc s om mu a ion ca ie s we e
pu i ied and di ec ly sequenced using BigDye e mina o 3.1 chemis y on a 3130 Gene ic
Analyze (Applied Biosys ems). The ollowing GenBank e e ence sequence was used o a ian
anno a ion: RCC1, NM_001048194.
S a is ical Analyses
Case-con ol analyses we e pe o med wi h 2x2 ables using wo-sided Fishe ´s exac es s
(because a leas one cell had an expec ed equency less han 5), and a p- alue < 0.05 was
conside ed signi ican . RCC1 was he i s gene o be sc eened in his s udy so ha we ha e no
applied co ec ion o mul iple es ing. We omi ed he 6 hypo hesis-gene a ing amilies wi h
ully sequenced exomes, including he ini ial mu a ion ca ie and he daugh e , om he
subsequen b eas cance case-con ol associa ion s udy.
Resul s
Exome sequencing on ge m-line DNA samples om six BRCA1/BRCA2 mu a ion-nega i e
Tunisian pa ien s wi h amilial b eas cance e ealed a he e ozygous ca ie o a no el
ameshi mu a ion, c.1067_1086del19, in RCC1, ha is he gene o Regula o o Ch omosome
Condensa ion 1 (Suppl. Fig. S1). The ameshi dele ion o 19 nucleo ides was subsequen ly
con i med in he a ec ed daugh e , who had b eas cance a age 44 (IV.1), and in one o wo
daugh e s who we e heal hy a he ime o analysis (IV.2; age 39); he mu a ion was also
ansmi ed o he heal hy young g anddaugh e in he a ec ed lineage (V.1) (Fig. 1). The

6
RCC1*c.1067_1086del19 mu a ion has no been lis ed in he NCBI SNP da abase no has i been
epo ed by he Exome Agg ega ion Conso ium.
The po en ial associa ion be ween he RCC1*c.1067_1086del19 mu a ion and b eas cance
was hen in es iga ed in a se o 86 amilial and 67 spo adic b eas cance pa ien s om
Tunisia. Unexpec edly, he mu a ion was de ec ed in u he i e un ela ed cases, including ou
amilial cases (F75, F79, F83, F104) and one spo adic case (S27) (Fig. 2, Suppl. Fig. S2),
comp ising a 4.7% ca ie equency among pa ien s wi h amily his o y o b eas cance and
1.5% among spo adic cases. By con as , no single mu a ion ca ie was ound among 400
heal hy emale con ols om he gene al Tunisian popula ion. The di e ence in ca ie
equencies was nominally signi ican o all b eas cance cases and con ols (p=0.0015, 2d )
and o amilial b eas cance s. all con ols (p= 0.0009, 2d ). The ExAc da abase eco ds loss o
unc ion mu a ions in RCC1 in only 4/48035 indi iduals which again is signi ican ly di e en
om he 5/153 pa ien s wi h a RCC1 mu a ion in ou b eas cance se ies (p= 3.8x10-11, 2 d ).
Clinical-pa hological cha ac e is ics o b eas cance pa ien s wi h he RCC1 mu a ion a e
summa ized in Table 1. Mu a ion ca ie s had a median age a diagnosis o 46.5 yea s, and he
mu a ion was associa ed wi h es ogen ecep o -posi i e umou s in 5 o 6 cases. When we
geno yped RCC1*c.1067_1086del19 in ma ched umo DNA om mu a ion ca ie s, he
mu a ion was obse ed in he he e ozygous s a e in only wo b eas umo s, whe eas loss o
he e ozygosi y (LOH) was obse ed in ou umou s (Table 1, Fig. 2). In e es ingly, all ou
umou s wi h LOH showed loss o he mu an allele, aising he possibili y o a selec i e
disad an age a he s age o umou p og ession. Rela i e peak heigh a ios in hese ou
umou samples we e 6%, 7%, 15% and 42%, espec i ely. The e was no ob ious co ela ion o
LOH wi h o he umou a iables bu numbe s we e small. To u he e alua e he popula ion
speci ici y o he mu a ion, he RCC1*c.1067_1086del19 mu a ion was also geno yped in b eas
cance pa ien s om Saudi A abia (n=101) and I an (n=116). No ca ie was iden i ied in hese
se ies, sugges ing a speci ic occu ence o RCC1*c.1067_1086del19 in he Tunisian popula ion.
7
Discussion
This s udy p o ides i s e idence o a mu a ion in RCC1 as a b eas cance suscep ibili y allele.
RCC1 is a ch oma in-bound guanine-nucleo ide eleasing ac o ha p omo es he exchange o
GDP by GTP in he Ras- ela ed nuclea p o ein, Ran.[14] I has ini ially been iden i ied as a
egula o o he onse o ch omosome condensa ion in he S phase.[15] The RCC1-Ran
complex ( oge he wi h o he p o eins) ac s as a componen o a signal ansmission pa hway
ha de ec s un eplica ed DNA and p e en s i o en e mi osis.[16] RCC1 c ea es he aniso opy
o he dis ibu ion o RanGTP ( he RanGTP g adien ) unde lying mi o ic spindle assembly and
nuclea po e and nuclea en elope o ma ion.[17] RCC1-dependen ac i a ion o Ran
accele a es cell cycle and DNA epai and inhibi s DNA damage-induced cell senescence.[18]
Hence, RCC1 is a well-known key p o ein in assu ing he ideli y o DNA eplica ion and
subsequen en y o ai h ully eplica ed ch omosomes in o cell di ision.
In he p esen s udy, we iden i y h ough exome sequencing and associa ion by geno yping a
no el mu a ion in RCC1 ha has exclusi ely been ound in Tunisian b eas cance pa ien s.
Consis en wi h a gene ic p edisposi ion, he mu a ion was mainly de ec ed in amilial cases
whe e i accoun ed o 4% o he hi he o unexplained cases. RCC1 has no p e iously been
implica ed in cance isk, al hough a homolog o RCC1, RCCD1, is encoded nea one o he
b eas cance suscep ibili y loci iden i ied h ough genome-wide associa ion s udies.[19-21] By
con as wi h low-pene ance a ian s a he RCCD1 locus, he RCC1 mu a ion desc ibed he e is
a unca ing mu a ion. Due o he absence o his mu a ion in con ols, he e ec size could no
be de e mined bu i is likely o be high. Mi o ic spindle assembly has as a c ucial and
ulne able unc ion o a oiding aneuploidy and is also a ge ed by he edi a y mu a ions in
o he cance synd omes.[22]
The s uc u e o human RCC1 has been sol ed o 1.7-A esolu ion by X- ay c ys allog aphy and
consis s o a se en-bladed p opelle o med om in e nal epea s o 51-68 esidues pe
blade.[23] The ameshi p.RLGLGEG356del s caused by he Tunisian mu a ion would elimina e
blade 7 and he ca boxy- e minal hal o blade 1. This disables RCC1 o o m he molecula clasp
ha igh ens he ci cula bel o he ing s uc u e, a equi emen o he binding o Ran.[23] I
is p esen ly unknown whe he he p.RLGLGEG356del s can gi e ise o any s able abe an
8
p o ein, bu he absence o RCC1 would simila ly p e en i s moni o unc ion in DNA
eplica ion and mi o ic en y.
RCC1 mu a ions may become disad an ageous a la e s ages o umou p og ession which
depends on high eplica i e ac i i y o as p oli e a ion. In ac , RCC1 blockage is being
in es iga ed as po en ial he apeu ic means agains agg essi e b eas umou s.[24] Selec i e
ad an age may explain why he RCC1 mu an allele is p e e en ially los and why RCC1 a ely
acqui es soma ic mu a ions in b eas ca cinomas. I is possible ha he loss o he
c.1067_1086del19 mu an allele is a spu ious obse a ion, gi en he small numbe o umou
samples a hand. Al e na i ely, i could se e o emo e an in acellula ba ie o un es ic ed
p oli e a ion, such as a dominan nega i e p.RLGLGEG356del s p o ein ha migh e ain i s
abili y o nucleosome binding [25] bu blocks in e ac ion wi h Ran.[23] I such a scena io is
common, mo e b eas cance suscep ibili y genes and hei d i e mu a ions may ha e been
missed in p e ious sequencing s udies solely based on umou ma e ial.
In summa y, we he e desc ibe a unca ing mu a ion in RCC1 ha was exclusi ely ound in
b eas cance pa ien s om he Tunisian popula ion. These da a p o ide compelling gene ic
e idence o RCC1 as a no el b eas cance suscep ibili y gene and encou age u he sea ch o
ge mline RCC1 mu a ions in cance pa ien s om o he popula ions.
9
Disclosu e o Po en ial Con lic s o In e es
No po en ial con lic s o in e es we e disclosed by he au ho s.
Au ho s' Con ibu ions
Concep ion and design: A. Riahi, M. Kha a , T. Dö k
De elopmen o me hodology: A. Riahi, N. Bogdano a, R. Ge e s
Acquisi ion o da a (p o ided animals, acqui ed and managed pa ien s, p o ided acili ies, e c.):
A. Riahi, H. Radmanesh, P. Schü mann, R. Ge e s, R. Meddeb, T. Dö k
Analysis and in e p e a ion o da a (e.g., s a is ical analysis, bios a is ics, compu a ional
analysis): A. Riahi, R. Ge e s, T. Dö k
W i ing, e iew, and/o e ision o he manusc ip : A. Riahi, H. Radmanesh, P. Schü mann, N.
Bogdano a, R. Ge e s, R. Meddeb, M. Kha a , T. Dö k
Adminis a i e, echnical, o ma e ial suppo (i.e., epo ing o o ganizing da a, cons uc ing
da abases): A. Riahi, R. Ge e s, T. Dö k
S udy supe ision: A. Riahi, M. Kha a , T. Dö k
G an Suppo
This wo k was unded by a g an om he Ge man Minis y o Educa ion and Resea ch and he
Tunisian Minis y o Highe Educa ion and Scien i ic Resea ch (TUNGER-70).
Acknowledgmen s
We co dially hank he amilies who ook pa in his s udy. We g a e ully acknowledge he
suppo o clinicians a he Salah Azaiz Cance Ins i u e in Tunis, and D . Abdel-Hadi and
P o esso El-Ha i h o samples o b eas cance pa ien s om he Uni e si y Clinics o
Dammam.
16
Figu es
Figu e 1: Iden i ica ion and seg ega ion analysis o he RCC1*c.1067_1086del19 mu a ion.
A: Pedig ee o he amily 89. +/-, he e ozygous RCC1*c.1067_1086del19; +/+, wild- ype;
*, indi idual who unde wen whole exome sequencing.
B: Valida ion by di ec sequencing o RCC1*c.1067_1086del19. (B.2, IV.1: he e ozygous; B.1,
IV.3: wild ype).
C: Aga ose gel elec opho esis o de ec ion o he e ozygous RCC1*c.1067_1086del19 ca ie s
(IV.2, IV.1, V.1, III.1) by p oduc size and he e oduplex o ma ion; NC, nega i e con ol.