A icle
Molecula mechanism o mRNA ep ession in ans
by a P oQ-dependen small RNA
Alexand e Smi no
1,†
, Chuan Wang
1,†
, Lisa L D ew y
1
& Jö g Vogel
1,2,*
Abs ac
Resea ch in o pos - ansc ip ional con ol o mRNAs by small
noncoding RNAs (sRNAs) in he model bac e ia Esche ichia coli and
Salmonella en e ica has mainly ocused on sRNAs ha associa e
wi h he RNA chape one H q. Howe e , he ecen disco e y o he
p o ein P oQ as a common binding pa ne ha s abilizes a
dis inc la ge class o s uc u ed sRNAs sugges s ha addi ional
RNA egulons exis in hese o ganisms. The cellula unc ions and
molecula mechanisms o hese new P oQ-dependen sRNAs a e
la gely unknown. He e, we epo in Salmonella Typhimu ium he
mode-o -ac ion o RaiZ, a P oQ-dependen sRNA ha is made om
he 30end o he mRNA encoding ibosome-inac i a ing p o ein
RaiA. We show ha RaiZ is a base-pai ing sRNA ha ep esses in
ans he mRNA o his one-like p o ein HU-a. RaiZ o ms an RNA
duplex wi h he ibosome-binding si e o hupA mRNA, acili a ed
by P oQ, o p e en 30S ibosome loading and p o ein syn hesis
o HU-a. Simila i ies and di e ences be ween P oQ- and H q-
media ed egula ion will be discussed.
Keywo ds HU-a; P oQ; RaiZ; small RNA; ansla ion inhibi ion
Subjec Ca ego ies Mic obiology, Vi ology & Hos Pa hogen In e ac ion;
P o ein Biosyn hesis & Quali y Con ol; RNA Biology
DOI 10.15252/embj.201696127 | Recei ed 20 No embe 2016 | Re ised 5
Feb ua y 2017 | Accep ed 10 Feb ua y 2017 | Published online 23 Ma ch 2017
The EMBO Jou nal (2017)36:1029–1045
In oduc ion
Many i no all o ganisms use small base-pai ing RNAs o modula e
mRNA exp ession a he pos - ansc ip ional le el (Go ski e al,
2017; Kunne e al, 2014). These egula o y pa hways o en ely
upon a conse ed RNA-binding p o ein, p ima y examples o which
a e A gonau e amily membe s in he mic oRNA pa hway o euka y-
o es (Hun zinge & Izau alde, 2011; Meis e , 2013) and he Sm-like
p o ein H q in p oka yo es (Bossi & Figue oa-Bossi, 2016; De Lay
e al, 2013; Updeg o e e al, 2016; Vogel & Luisi, 2011; Wagne &
Romby, 2015). In ense wo k on hese pa hways o e he pas
decade has e ealed he exis ence o la ge pos - ansc ip ional
ne wo ks ha a ec almos e e y cellula aspec and i al he
complexi y o p ima y gene exp ession con ol a he le el o an-
sc ip ion.
The H q pa hway has been pa icula ly well mapped in he
G am-nega i e model bac e ia Esche ichia coli (Melamed e al, 2016;
Schu e al, 2015; T ee e al, 2014), Salmonella en e ica (Holmq is
e al, 2016), Vib io chole a (Papen o e al, 2015a) and Pseudo-
monas (Sonnlei ne e al, 2008), in which he p o ein se es wo
gene al unc ions: p o ec ing he H q-associa ed small noncoding
RNAs (sRNAs) om cellula nucleases and helping hem o ecog-
nize hei a ge mRNAs. Mos H q-associa ed sRNAs bind o hei
a ge s nea he si e o ansla ional ini ia ion (Melamed e al, 2016;
Wa e s e al, 2016) and, he e o e, his class o ibo egula o s
p ima ily ep ess p o ein syn hesis h ough s e ic in e e ence wi h
30S ibosome binding (Balbon ı
´ne al, 2010; Bou ie e al, 2008;
Mo i a e al, 2006; Udekwu & Wagne , 2007). Howe e , addi ional
mechanisms o ep ession ha e been epo ed which include deposi-
ion o H q wi hin he mRNA 50un ansla ed egion (50UTR)
(Desnoye s & Masse
´, 2012) as well as a ge des abiliza ion by
ec ui men o endo ibonuclease RNase E o he mRNA coding
sequence (CDS) (Bandy a e al, 2012; P ei e e al, 2009). Con e -
sely, H q-associa ed sRNAs also egula e some mRNAs posi i ely by
a leas wo di e en mechanisms, ou compe ing ansla ion-incom-
pe en s uc u es in he mRNA 50- egion (Papen o e al, 2015b;
Sope e al, 2010) o inc easing mRNA s abili y by masking RNase E
clea age si es (F o
¨hlich e al, 2013; Papen o e al, 2013). The same
H q-associa ed sRNA may use mul iple seed egions (Coo nae
e al, 2013; Lee & Go esman, 2016; Sha ma e al, 2011) and no
ewe han ou di e en mechanisms o con ol i s ull sui e o
a ge mRNAs (Feng e al, 2015). H q is impo an o hese sRNA–
mRNA in e ac ions which a e usually impe ec and canno be e i-
cien ly o med wi hou assis ance (Moll e al, 2003; Molle e al,
2002; Sob e o & Val e de, 2012; Updeg o e e al, 2015; Zhang e al,
2002). Impo an ly, H q only in e ac s wi h single-s anded egions
o i s ligands and, once he sRNA–mRNA duplex has been o med, i
ypically dissocia es and is a ailable o bind o he sRNAs (Fende
e al, 2010; Hopkins e al, 2011; Ishikawa e al, 2012).
The weal h o molecula insigh gained o he H q ne wo k o e -
shadows he ac ha hese sRNAs cons i u e only a hi d o he
~300 sRNAs ha ha e been anno a ed in, o example, Salmonella
(Colgan e al, 2016; Wes e mann e al, 2016). Mo eo e , g owing
e idence sugges s ha egula ion by H q ep esen s only a pa o
1RNA Biology G oup, Ins i u e o Molecula In ec ion Biology, Uni e si y o Wü zbu g, Wü zbu g, Ge many
2Helmhol z Ins i u e o RNA-based In ec ion Resea ch (HIRI), Wü zbu g, Ge many
*Co esponding au ho . Tel: +49 931 3182 575; Fax: +49 931 3182 578; E-mail: [email p o ec ed]e
†
These au ho s con ibu ed equally o his wo k
ª2017 The Au ho s. Published unde he e ms o he CC BY 4.0license The EMBO Jou nal Vol 36 |No8|2017 1029
pos - ansc ip ional egula o y p ocesses in bac e ia. Many
mic obes, such as Helicobac e o Mycobac e ium, lack an H q
homologue al oge he (Chao & Vogel, 2010; Sha ma e al, 2010;
Wagne & Romby, 2015), and in S aphylococcus, H q is lowly
exp essed and dispensable o mRNA egula ion (Bohn e al, 2007;
Romilly e al, 2012). E en in canonical H q-con aining E. coli and
S. en e ica, a numbe o unc ional H q-independen sRNA species
ha e been desc ibed. They include mos cis-ac ing an isense RNAs
(asRNAs), which employ ex ensi e pe ec base pai ing o ep ess
mRNAs encoded on he opposi e s and (Geo g & Hess, 2011;
Thomason & S o z, 2010). Plasmid-encoded asRNAs o en use
highly speci ic RNA chape ones (e.g. FinO, Rom) o assis hese
unc ions, whe eas ch omosomally encoded asRNAs a e adi ion-
ally belie ed o ope a e in a p o ein-independen manne (Wagne &
Romby, 2015). The e a e se e al addi ional specialized RNA–p o ein
complexes; o example, CRISPR RNAs ely on dedica ed molecula
machine y p o ided by Cas p o eins ( an de Oos e al, 2014) and
Y-like sRNAs associa e wi h Ro p o eins and PNPase o assis he
deg ada ion o s uc u ed RNAs (Chen e al, 2013). Na u ally,
sRNAs ha do no employ base-pai ing in e ac ions o pe o m hei
unc ions bu seques e ce ain egula o y p o eins a e also usually
H q independen (Babi zke & Romeo, 2007; Go
¨pel e al, 2013;
Wassa man & S o z, 2000). Howe e , addi ional p o eins, o he
han H q, ha de ine hei own la ge classes o sRNAs ha e
emained unknown.
Recen ly, we applied G ad-seq (RNA-seq-coupled pa i ioning o
he ansc ip ome by densi y g adien cen i uga ion) o isualize
he biochemical s uc u e o Salmonella Typhimu ium’s RNA
ensemble acco ding o hei in ol emen in ibonucleop o eins
(RNPs) (Smi no e al, 2016). While cosedimen a ion wi h H q
explains he beha iou o ~20% o sRNAs, many addi ional sRNAs
a e appa en ly in ol ed in di e en RNPs. Using sRNAs o his la e
class as bai s, we subsequen ly iden i ied p o ein P oQ as a common
binding pa ne .
P oQ is a conse ed abundan RNA-binding p o ein o he P oQ/
FinO amily ha is widely sp ead in a-, b- and c-p o eobac e ia
(A aiech e al, 2016; Chaulk e al, 2010, 2011; Glo e e al, 2015;
Smi no e al, 2016) and whose solu ion s uc u e has ecen ly been
sol ed in E. coli (Gonzales e al, 2017). We ha e demons a ed ha
P oQ associa es wi h se e al hund ed cellula ansc ip s, including
dozens o sRNAs and ha his p o ein has a p o ound impac on
bac e ial gene exp ession and physiology. On a e age, P oQ-
associa ed sRNAs end o be mo e olded han H q-dependen
sRNAs, sugges ing ha P oQ p e e en ially binds ansc ip s wi h
ex ensi e seconda y s uc u e. While some o hese sRNAs a e pa
o known and pu a i e ype I oxin–an i oxin sys ems o we e
implica ed in mRNA egula ion by ea lie s udies, mos a e o
unknown unc ion (Smi no e al, 2016).
He e, we epo he cha ac e iza ion o a P oQ-dependen sRNA
and he associa ed molecula unc ion o he p o ein. We show
ha he RaiZ sRNA ( o me ly known as STnc2090; Chao e al,
2012) is induced upon en y in s a iona y phase and ha i ac s in
ans o down egula e he ansla ion o he hupA mRNA, which
encodes he a-subuni o he bac e ial his one-like p o ein HU.
RaiZ o ms a base-pai ing in e ac ion wi h he hupA ibosome-
binding si e (RBS) o ep ess ansla ion. P oQ has a double ole in
his egula ion: (i) i is necessa y o he in acellula s abiliza ion
o RaiZ, and (ii) i oge he wi h he RaiZ-hupA duplex p e en s
30S ibosome loading. These esul s lay he ounda ion o a mech-
anis ic explo a ion o a ge egula ion by he new la ge class o
P oQ-associa ed sRNAs.
Resul s
Biogenesis o he RaiZ sRNA by 30mRNA p ocessing
RaiZ was ini ially iden i ied as candida e sRNA STnc2090 in a sc een
o H q-associa ed ansc ip s in Salmonella Typhimu ium (Chao
e al, 2012). I o igina es om he highly conse ed aiA gene (en-
coding a cold shock-inducible ibosome-inac i a ing p o ein) o
which i co e s he las hi d o he CDS and he en i e 30UTR. The
RaiZ RNA sequence is conse ed in se e al en e obac e ia ha a e
closely ela ed o Salmonella (Fig 1A).
No he n blo p obing o S. Typhimu ium o al RNA samples
showed ha RaiZ is p ima ily exp essed in he s a iona y phase
(OD
600
>2) o in a g ow h medium ha induces he Salmonella
pa hogenici y island-1 (SPI-1) and less in he exponen ial phase o
unde Salmonella pa hogenici y island-2 (SPI-2)-inducing condi ions
(Fig 1B), in acco dance wi h a ailable global RNA-seq p o iling da a
(K o
¨ge e al, 2013). In bo h S. en e ica and E. coli, we de ec ed wo
majo RaiZ species, a 160-n o m (RaiZ) and a 122-n p ocessed
sRNA (RaiZ-S), wi h a cumula i e abundance o up o 50–60 copies
pe cell (Fig EV1). Howe e , he e a e no ansc ip ion s a si es
wi hin he aiA CDS (K o
¨ge e al, 2012), sugges ing ha RaiZ is
p oduced by endonucleoly ic clea age o he aiA mRNA. The clea -
age si e in he pa en al aiA mRNA ha yields RaiZ is A/U- ich
(Fig 1A), sugges ing i would be a good subs a e o he majo
mRNA p ocessing enzyme RNase E (Mackie, 2013). Indeed, while in
wild- ype Salmonella RaiZ is e icien ly p oduced a bo h 28°C and
44°C, he aiA mRNA accumula es in a he mosensi i e ne-3071
mu an (Api ion & Lassa , 1978) upon shi ing o he non-pe missi e
empe a u e, and RaiZ is no longe p oduced (Fig 1C), which is also
con i med by ou ecen genomewide analysis o RNase E clea age
si es (Chao e al, 2017). This suppo s a model whe eby RaiZ a ises
om RNase E-media ed mRNA u no e , simila o he biogenesis o
he 30-end-de i ed sRNAs CpxQ and S oC (Chao & Vogel, 2016;
Miyakoshi e al, 2015a).
RaiZ is a P oQ-dependen sRNA
Al hough RaiZ was ini ially iden i ied h ough i s co-pu i ica ion
wi h H q (Chao e al, 2012), i has now eme ged as a op ligand o
P oQ, showing high en ichmen in p e ious RIP-seq da a ob ained
wi h a ch omosomally FLAG- agged P oQ p o ein (Fig 2A) (Smi no
e al, 2016). In addi ion, P oQ has been shown o bind bo h he
longe and he sho e RaiZ o ms in he low nanomola ange, indi-
ca ing a s ong in e ac ion (Smi no e al, 2016). As shown in
Fig 2B, a P oQ-RaiZ complex is o med wi h high speci ici y and is
e en no a ec ed by he p esence o a 500- old excess o RNA.
Using single-s and-speci ic Pb(II) ea men and he double-s and-
speci ic RNase V1, we p obed he na i e s uc u e and iden i ied he
P oQ-p o ec ed si es o RaiZ (Fig 2C and Appendix Fig S1). In good
ag eemen wi h in silico p edic ions (see Ma e ials and Me hods),
bo h RaiZ and RaiZ-S con ain se e al s uc u ed egions, including a
la ge domain wi h an in e nal loop and a small hai pin nex o he
The EMBO Jou nal Vol 36 |No8|2017 ª2017 The Au ho s
The EMBO Jou nal Mechanism o P oQ-dependen sRNA Alexand e Smi no e al
1030
in insic e mina o , sepa a ed by a long uns uc u ed cen al space
(Fig 2D). P oQ p o ec s p ima ily he wo 30- e minal s em-loops
and he base o he la ge 50- e minal s uc u ed domain. These bind-
ing p e e ences esemble hose o he p o ein FinO which is a well-
cha ac e ized plasmid-encoded homologue o P oQ ha in e ac s
wi h he base o a s em-loop and he adjacen single-s anded
egions o he FinP sRNA (A hu e al, 2011). Mo eo e , a Legio-
nella P oQ homologue, RocC, also appea s o ecognize he Rho-
independen e mina o o i s majo a ge , he RocR sRNA (A aiech
e al, 2016). This binding mode is also in ag eemen wi h ou ecen
analysis o he P oQ in i o in e ac ome which shows ha P oQ
s ongly p e e s s uc u ed RNAs (Smi no e al, 2016).
A
BC
Figu e 1. RaiZ is a p ocessed en e obac e ial sRNA.
A Mul iple alignmen o aiA loci om en e obac e ia. Highly conse ed posi ions a e shown in ed; in a ian ones a e ma ked wi h as e isks.
B RaiZ exp ession in WT bac e ia g own in LB o in SPI-1- and SPI-2-inducing media was isualized by no he n blo ing.
C RNase E inac i a ion comp omises he aiA mRNA p ocessing and RaiZ p oduc ion. Unlike he WT allele, he he mosensi i e ne-3071 a ian gi es ise o an RNase
E p o ein which is only ac i e a empe a u es below 37°C, as can be assessed by he cha ac e is ic accumula ion o a 5S RNA p ecu so , 9S RNA, upon a shi o a
non-pe missi e empe a u e o 44°C (Api ion & Lassa , 1978).
Sou ce da a a e a ailable online o his igu e.
ª2017 The Au ho s The EMBO Jou nal Vol 36 |No8|2017
Alexand e Smi no e al Mechanism o P oQ-dependen sRNA The EMBO Jou nal
1031
B
RaiZ
RaiZ-P oQ
- + + + + + + + + - + + + + + + + +P oQ, 15 nM
- - - -
1:1
2:1
5:1
10:1
20:1
50:1
Cold RaiZ excess Cold yeas RNA excess
C
RaiZ-S
RaiZ-S-P oQ
D
5’-UGAUCAACA
G
G
A
A
AC
G
G
CAAUAAAGUGCAGCACAAA GAAGCAGAAGAAGAGUAGUCCCU
CCC
A
C
G
U
U
G
C
UGC
G
U
A
G
A
A
A
C
UA
UCGCC
U
UCG
UUUU
-10
1
/
/
/
/
/
-20
-30 10
20
_
30
40
50
_
/
/
//
70 80
100
110
/
120
_90
aiAbamD
pheL
pheA
RaiZ
RaiZ-S
P oQ-3xFLAG
coIP
P oQ-3xFLAG
lysa e
WT coIP
WT lysa e
7000
7000
1000
1000
A
*
100:1
1:1
2:1
5:1
10:1
20:1
50:1
100:1
*
- + + + + + + + + - + + + + + + + +P oQ, 15 nM
- - - -
2:1
5:1
10:1
20:1
50:1
100:1
Cold RaiZ-S excess Cold yeas RNA excess
500:1
2:1
5:1
10:1
20:1
50:1
100:1
500:1
/
Pb(II) clea age si e
RNase V1 clea age si e
Pb(II) clea age si e p o ec ed by P oQ
RNase V1 clea age si e p o ec ed by P oQ
C OH T1 0 250 500 0 250 500 nM P oQ
Pb(II) RNase V1
P o ec ed
by P oQ
24
21
17
14
12
11
26
32
37
40
44
47
51
56
59
62
65
68
71
73
76
92
97
90
88
P o ec ed
by P oQ
38
103
105
111/112/113
Figu e 2.
The EMBO Jou nal Vol 36 |No8|2017 ª2017 The Au ho s
The EMBO Jou nal Mechanism o P oQ-dependen sRNA Alexand e Smi no e al
1032
In line wi h ea lie obse a ions showing ha RaiZ e icien ly
in e ac s in i o wi h H q (Chao e al, 2012; Smi no e al, 2016),
we con i med he o ma ion o a s able RaiZ-H q complex in i o
(Fig EV2). The e o e, RaiZ was ound o engage in s ong in e ac-
ions wi h bo h P oQ and H q in i o and in i o (Figs 2 and EV2),
which p omp ed us o e alua e he impac o each RNA chape one
on RaiZ s abili y. RaiZ was equally well p oduced in wild- ype and
Dh q Salmonella, bu ailed o accumula e in a Dp oQ s ain (Fig 3A;
Smi no e al, 2016). Analysis o he RaiZ hal -li e in bac e ia
ea ed wi h i ampicin o a es ansc ip ion clea ly indica ed ha
o he wo RNA chape ones, only P oQ was equi ed o RaiZ s abil-
i y, whe eas h q dele ion did no signi ican ly a ec he hal -li e o
he sRNA (Fig 3B). The RaiZ s abili y de ec in Dp oQ could no be
escued by o e exp ession o he sRNA e en om a high-copy plas-
mid (Fig EV3), indica ing ha P oQ p ima ily a ec s he hal -li e o
RaiZ and no he ansc ip ion o aiA. The e o e, al hough bo h
RNA chape ones bind RaiZ wi h high a ini y, only P oQ was
equi ed o i s s abili y.
◀Figu e 2. RaiZ is a P oQ-binding sRNA.
A The ead dis ibu ion a ound he Salmonella aiAZ locus o a P oQ-3xFLAG RIP-seq expe imen pe o med in he ansi ion phase (Smi no e al,2016). The uppe wo
lanes show coIP ac ions ob ained by immunop ecipi a ion wi h an i-FLAG an ibodies om a p oQ-3xFLAG and a con ol WT s ain wi hou a ag; he lowe wo
lanes show he co esponding o al cell lysa es. The linea scale (numbe o eads) is shown on he le . All genes a e on he same (+) s and. Rep esen a i e o ou
independen expe imen s.
B RaiZ/RaiZ-S speci ically in e ac s wi h P oQ. Compe i ion expe imen s we e ca ied ou in he p esence o ei he speci ic (cold RaiZ o RaiZ-S) o nonspeci ic (yeas
RNA) compe i o s. As e isks ma k RaiZ o RaiZ-S dime s obse ed unde hese condi ions. Rep esen a i e o wo independen expe imen s.
CIn i o oo p in ing assay o he RaiZ-S/P oQ complex. RaiZ-S is 50-labelled. C , unclea ed RNA; OH, alkaline ladde ; T1, RNase T1ladde . Nucleo ide posi ions a e
shown on he le . Rep esen a i e o wo independen expe imen s. See also Appendix Fig S1 o he oo p in ing assay on he long o m o RaiZ.
D The seconda y s uc u e o RaiZ, based on he RNA old p edic ion and he s uc u e p obing da a shown in (C) and Appendix Fig S1. The i s nucleo ide o RaiZ-S is
“1”.
Sou ce da a a e a ailable online o his igu e.
A
WT
Δ aiAΔRaiΖ
Δp oQ
Δh q
WT + pJV300
Δp oQ + pJV300
Δp oQ + pP oQ
aiA mRNA
RaiZ
RaiZ-S
B
Time a e Ri , min 0 1 2 4 8 16 32 0 1 2 4 8 16 32
aiA mRNA
p oQ+Δp oQ
aiA mRNA
h q+
Δh
q
RaiZ
RaiZ-S
RaiZ
RaiZ-S
5S RNA
Figu e 3. RaiZ is a P oQ-dependen sRNA.
A S eady-s a e le els o RaiZ a e comp omised by p oQ dele ion bu una ec ed by h q dele ion. To al RNA om he co esponding s ains was isola ed a he ansi ion
phase and analysed by no he n blo ing. D aiADRaiZ lacks he comple e aiA-RaiZ locus, pJV300 is an emp y con ol plasmid, and pP oQ is a ans-complemen ing
plasmid.
B RaiZ s abili y was assessed in all ou possible gene ic backg ounds wi h espec o h q and p oQ genes. Cells we e g own o he ansi ion phase, i ampicin was
added o a es ansc ip ion, and o al RNA samples we e collec ed a e he speci ied ime in e als and quan i ied by densi ome y a e no he n blo ing.
Sou ce da a a e a ailable online o his igu e.
ª2017 The Au ho s The EMBO Jou nal Vol 36 |No8|2017
Alexand e Smi no e al Mechanism o P oQ-dependen sRNA The EMBO Jou nal
1033
RaiZ pos - ansc ip ionally egula es hupA, encoding
a his one-like p o ein
To ob ain insigh in o he unc ion o RaiZ, we pe o med a pulse-
exp ession analysis (Masse
´e al, 2005; Papen o e al, 2006) wi h
he RaiZ sequence cloned in o a mul icopy plasmid unde he
con ol o an a abinose-inducible p omo e . RaiZ exp ession was
induced o 10 min in he exponen ial phase (when he ch omoso-
mal sRNA is ba ely exp essed; Fig 1B), ollowed by RNA-seq o
de e mine exp ession changes on he genomewide le el. We
obse ed a ep oducible 6.9 2.0- old (mean SD) down egula-
ion o a single mRNA encoding he a-subuni o he his one-like
p o ein HU, hupA (Fig 4A). Since he sho ime o induc ion makes
seconda y e ec s on gene exp ession unlikely (Sha ma & Vogel,
2009), we conside ed hupA a di ec a ge o RaiZ.
To alida e his egula ion, we o e exp essed RaiZ unde con ol
o a cons i u i e p omo e in a s ain ca ying a ch omosomally
FLAG- agged allele o hupA (Fig 4B). In he con ol s ain, he hupA
mRNA accumula ed almos exclusi ely in he exponen ial phase,
whe eas he co esponding p o ein le els emained cons an
h oughou g ow h. In con as , RaiZ o e exp ession a ec ed he
a ge a bo h he mRNA and p o ein le els, esul ing in an
8.2 2.9- old (mean SD) dec ease in HU-ap oduc ion. These
esul s we e co obo a ed by he use o luo escen epo e
AB
C
Figu e 4. RaiZ nega i ely egula es hupA exp ession.
A Fold changes o Salmonella RNA le els 10 min a e induc ion o RaiZ o e exp ession, as measu ed by RNA-seq o he o al RNA. Di e en ially egula ed genes (as
compa ed o he con ol) a e highligh ed wi h colou . Da a poin s co espond o mean genewise old changes in wo independen expe imen s, and he ba s show
he ange.
B Cons i u i e exp ession o RaiZ leads o he down egula ion o HU-ap oduc ion. Wes e n (uppe wo panels) and no he n blo (lowe h ee panels) analyses we e
pe o med on o al p o ein and RNA isola ed om a hupA-3xFLAGD aiADRaiZ s ain cons i u i ely exp essing o no RaiZ.
C RaiZ ep esses exp ession o a hupA luo escen epo e cons uc . Cons i u i e exp ession o RaiZ speci ically ep esses a hupA-GFP epo e con aining he hupA
50UTR and he i s 15 codons o he hupA CDS (cons i u i ely exp essed on a pXG10 plasmid), bu does no a ec a hupB-GFP epo e . Rep esen a i e image om
ou independen expe imen s. See also Fig 6B o quan i ica ion o luo escence in he same s ains measu ed by FACS.
Sou ce da a a e a ailable online o his igu e.
The EMBO Jou nal Vol 36 |No8|2017 ª2017 The Au ho s
The EMBO Jou nal Mechanism o P oQ-dependen sRNA Alexand e Smi no e al
1034
cons uc s (Fig 4C). When a g p CDS was cloned in ame wi h 15
N- e minal esidues o HU-ap eceded by he hupA mRNA 50UTR
and unde con ol o a cons i u i e p omo e , o e exp ession o
RaiZ esul ed in signi ican ly lowe luo escence, compa ed o a
s ain ca ying he emp y pJV300 plasmid. RaiZ o e exp ession did
no a ec a g p epo e p eceded by an un ela ed 50UTR unde he
con ol o he same cons i u i e p omo e (Fig 4C, pXG1) o an anal-
ogously cons uc ed hupB epo e (see also Appendix Fig S2).
These da a indica e ha o he wo subuni s o HU, encoded by
hupA and hupB, only HU-ais subjec o pos - ansc ip ional egula-
ion by RaiZ, and his egula ion depended on i s 50UTR and/o he
s a codon-p oximal po ion o he hupA CDS. In line wi h abo e
da a (Fig 3), his egula ion was no a ec ed by a Dh q mu a ion,
sugges ing ha H q is no equi ed o RaiZ-media ed hupA ep es-
sion (Fig EV4).
RaiZ is a base-pai ing ans-ac ing sRNA
Since RaiZ e icien ly ep essed ansla ion o a GFP epo e
p eceded by he hupA 50UTR and a ew s a codon-p oximal
codons (Fig 4C), we hypo hesized ha RaiZ may a ge he RBS o
he hupA mRNA, as seen wi h many H q-dependen sRNAs (De Lay
e al, 2013; Vogel & Luisi, 2011). Indeed, ex ensi e hough impe ec
pai ing, in ol ing a o al o 23 bases on ei he side and co e ing he
ups eam egion o he s a codon, was p edic ed be ween he wo
RNAs (Fig 5A and Appendix Fig S2). In ag eemen wi h his p edic-
ion, he wo RNAs in e ac ed e icien ly in i o, o ming a duplex
wi h appa en K
d
o ~80 nM (Fig 5B), which is simila o he a ini y
o o he p edic ed P oQ-dependen sRNAs o which a ge s a e
known (Da euille e al, 2007; Ellis e al, 2015; Han e al, 2010;
Sil a e al, 2013; Smi no e al, 2016).
S uc u e p obing o he RaiZ-hupA mRNA duplex alida ed his
a ge ing model (Figs 5C and EV5) and e ealed se e al in e es ing
ea u es o he in e ac ion. I showed a high deg ee o symme y
in ol ing an ups eam single-s anded egion and a downs eam
s em-loop in bo h RNAs (Fig 5A). The s em-loop in each RNA
o med base-pai ing in e ac ions wi h he opposi e single-s anded
s e ch and he s em-loop o he pa ne , esul ing in a long impe ec
duplex. In RaiZ (bo h he long and he sho o ms), he si es
conce ned included he sho hai pin ups eam o he e mina o and
he adjacen po ion o he long single-s anded space , whe eas in
he hupA mRNA hey co e ed ~30 nucleo ides o he 50UTR immedi-
a ely adjacen o he s a codon (Fig 5A). The pe ec ly base-pai ed
cen al egion o he duplex unde wen a s ong si e-speci ic clea age
by RNase III in i o (Figs 5C and EV5), indica i e o an ex ensi e
and s able in e ac ion. In e es ingly, RaiZ-S con e ed mo e e icien
RNase III clea age han he longe RaiZ (Fig EV5B), sugges ing ha
he p ocessed sRNA is pa icula ly ap o he in e ac ion and ep e-
sen s he ac i e egula o y o m o he sRNA.
To e i y whe he he down egula ion o he hupA mRNA by
RaiZ elies on he same in e ac ion in i o, we designed mu an
e sions o bo h pa ne s by swapping wo nucleo ides engaged in
he s onges s e ch o he in e molecula duplex (Fig 5A). The
mu an RNAs ailed o o m s able complexes wi h hei wild- ype
pa ne s and con e he cha ac e is ic s ong RNase III clea age in
he co ec posi ion in i o (Fig EV5A and B). As expec ed, ec opic
exp ession o RaiZ unde he con ol o a cons i u i e p omo e in a
Salmonella s ain lacking he aiA-RaiZ locus demons a ed ha
only he wild- ype RaiZ and RaiZ-S we e able o ep ess hupA
exp ession. RaiZ and RaiZ-S con aining he U81A, U82A mu a ions
in he base-pai ing egion, ailed o achie e a simila le el o down-
egula ion, despi e accumula ing o he same le els (Fig 6A). In e -
es ingly, when using he ull-size RaiZ cons uc , he RaiZ-S species
accumula ed, indica ing ha he long RaiZ o m con ains all s uc-
u al elemen s necessa y o co ec RaiZ ma u a ion.
When we used ou GFP epo e sys em o assess he e ec o hese
nucleo ide subs i u ions on he hupA egula ion in i o,weagain
obse ed a signi ican dec ease in luo escence when bo h wild- ype
RaiZ and he hupA 50UTR-con olled g p cons uc we e co-exp essed
(Fig 6B). On he con a y, ep ession was comple ely elie ed by
mu a ions in ei he RaiZ (U81A, U82A) o he hupA 50UTR (A-11U,
A-10U). Impo an ly, combina ion o bo h mu an pa ne s, which
es o es base pai ing, escued wild- ype le els o ep ession (Fig 6B).
Al oge he , hese esul s p o e ha RaiZ down egula es hupA ia a
base-pai ing in e ac ion wi h i s 50UTR nea he RBS.
P oQ assis s RaiZ in p e en ing ibosome loading on he
hupA mRNA
The RaiZ-hupA mRNA in e ac ion occu s e y e icien ly and does
no equi e assis ance o ei he P oQ o H q in i o (Fig 5B). Ne e -
heless, P oQ is c i ically equi ed o RaiZ s abili y in he cell
(Fig 3). To de e mine whe he P oQ has a ole in he RaiZ-
dependen hupA ep ession beyond main aining sRNA abundance,
we o e exp essed RaiZ-S in he p oQ
+
and Dp oQ backg ounds,
which esul ed in he sa u a ion o he sRNA le els well beyond he
appa en K
d
in bo h s ains (Fig 7A; he es ima ed esul ing RaiZ-S
concen a ions a e >4lM, see Ma e ials and Me hods o u he
de ail). S ikingly, while hupA exp ession was s ongly ep essed by
RaiZ-S in he p oQ
+
s ain, he sRNA ailed o ully deple e HU-ain
he absence o P oQ. Analogously, whe eas du ing he ansi ion
phase (OD
600
=2) hupA mRNA le el d opped ~4- old in he p oQ
+
s ain compa ed o he same s ain ca ying he con ol plasmid, i
emained cons an a ~75% o con ol in he Dp oQ backg ound
(Fig 7A). The e o e, al hough P oQ has a majo impac on RaiZ
s abili y, hese esul s sugges ha P oQ may also be equi ed o
egula ion downs eam o RaiZ p oduc ion and he RaiZ-hupA
mRNA in e ac ion.
Since RaiZ a ec s HU-ap o ein le els o a g ea e ex en han he
mRNA (Figs 6A and 7A), we hypo hesized ha i p ima ily in e -
e es wi h ansla ion, wi h mRNA des abiliza ion being a seconda y
consequence o lowe ibosome occupancy. Using he oep in
assay, we analysed he e ec o RaiZ-S on 30S ibosome loading on
he hupA ansla ion ini ia ion egion (Fig 7B). In he p esence o
30S subuni s and o mylme hionyla ed ini ia o RNA, a cha ac e is-
ic s ong oep in was obse ed ~15 n ups eam o he s a codon,
indica ing he co ec assembly o he ansla ion ini ia ion complex.
Addi ion o RaiZ-S esul ed in a small bu dose-dependen dec ease
o he oep in signal, demons a ing ha he sRNA is capable o
in e e ing wi h 30S ibosome loading, albei no e icien ly. S ik-
ingly, simul aneous addi ion o bo h RaiZ-S and P oQ esul ed in he
s ong supp ession o he oep in , pa alleled by he appea ance o a
new e e se ansc ip ase s alling si e downs eam, in on o he
egion in ol ed in he base pai ing wi h RaiZ (Fig 7B). This new
signal did no depend on he p esence o 30S subuni s o RNA and
could no be p oduced by P oQ alone, sugges ing ha i co esponds
ª2017 The Au ho s The EMBO Jou nal Vol 36 |No8|2017
Alexand e Smi no e al Mechanism o P oQ-dependen sRNA The EMBO Jou nal
1035
A
B
C
Figu e 5. RaiZ base pai s wi h he RBS o he hupA mRNA.
A The RaiZ/hupA mRNA in e ac ion, based on RNA old and RNAco old p edic ions and s uc u e p obing da a in (C). The s a codon is ed, and A is numbe ed “1”. The
base-pai ing egions a e se in blue and amed. The si es whe e dis up i e poin mu a ions we e in oduced a e highligh ed wi h colou .
B EMSA o he RaiZ/hupA mRNA in e ac ion wi h ei he RNA labelled and a nonlabelled pa ne . Appa en K
d
o he complex is ~80 nM.
C S uc u e p obing assay o he RaiZ-S/hupA mRNA duplex. hupA 50UTR and he p oximal pa o he CDS a e 50-labelled. Nucleo ide posi ions on he le co espond o
he panel (A). Rep esen a i e o wo independen expe imen s.
Sou ce da a a e a ailable online o his igu e.
The EMBO Jou nal Vol 36 |No8|2017 ª2017 The Au ho s
The EMBO Jou nal Mechanism o P oQ-dependen sRNA Alexand e Smi no e al
1036
o a ipa i e complex in ol ing he hupA 50UTR, RaiZ-S and P oQ.
Indeed, a s able e na y complex was obse ed in elec opho e ic
mobili y shi s assay (EMSA) in he p esence o P oQ (Fig 7C).
The e o e, P oQ oge he wi h he RaiZ-hupA mRNA duplex may
u he p e en 30S ibosomes om loading on o and ini ia ing
ansla ion o he hupA mRNA.
Discussion
The as majo i y o cu en ly known P oQ-binding sRNAs a e o
unknown unc ion (Smi no e al, 2016). We ha e p e iously
obse ed ha asRNAs a e en iched in he P oQ in e ac ome,
sugges ing ha his p o ein may be in ol ed in gene exp ession
A
B
Figu e 6. RaiZ-hupA mRNA base pai ing is necessa y o hupA ep ession.
A Cons i u i e exp ession o RaiZ leads o he down egula ion o HU-ap oduc ion only when he p edic ed base-pai ing in e ac ion is undis up ed. Wes e n (uppe wo
panels) and no he n blo (lowe h ee panels) analyses we e pe o med on o al p o ein and RNA isola ed om a hupA-3xFLAGD aiADRaiZ s ain cons i u i ely
exp essing o no RaiZ/RaiZ-S. RaiZ
AA
/RaiZ
AA
-S s and o he sRNAs ca ying he double U81A, U82A subs i u ion wi hin he base-pai ing egion. As e isk shows a ead-
h ough band coming om he exp ession ec o . Rep esen a i e o h ee independen expe imen s.
B Cons i u i e exp ession o RaiZ/RaiZ-S speci ically ep esses a hupA-GFP epo e , con aining he hupA 50UTR and he i s 15 codons o he hupA CDS (cons i u i ely
exp essed on a pXG10 plasmid), bu does no a ec a hupB-GFP epo e . The RaiZ
AA
mu a ion o he mi o ing hupA
UU
subs i u ion (A-10U, A-11U) alle ia es he
ep ession when combined wi h WT pa ne s, bu hey a e ully compensa ed when combined wi h each o he . Lowe panel shows FACS quan i ica ion o h ee
independen expe imen s (mean SD), *P<0.009 ( wo- ailed S uden ’s - es , FDR-adjus ed).
Sou ce da a a e a ailable online o his igu e.
ª2017 The Au ho s The EMBO Jou nal Vol 36 |No8|2017
Alexand e Smi no e al Mechanism o P oQ-dependen sRNA The EMBO Jou nal
1037
Mackie GA (2013) RNase E: a he in e ace o bac e ial RNA p ocessing and
decay. Na Re Mic obiol 11:45 –57
Mangan MW, Lucchini S, Ó C óinín T, Fi zge ald S, Hin on JC, Do man CJ
(2011) Nucleoid-associa ed p o ein HU con ols h ee egulons ha
coo dina e i ulence, esponse o s ess and gene al physiology in
Salmonella en e ica se o a Typhimu ium. Mic obiology 157:1075 –1087
Massé E, Vande pool CK, Go esman S (2005) E ec o RyhB small RNA on
global i on use in Esche ichia coli.J Bac e iol 187:6962 –6971
Meis e G (2013) A gonau e p o eins: unc ional insigh s and eme ging oles.
Na Re Gene 14:447 –459
Melamed S, Pee A, Faigenbaum-Romm R, Ga YE, Reiss N, Ba A, Al u ia Y,
A gaman L, Ma gali H (2016) Global mapping o small RNA- a ge
in e ac ions in bac e ia. Mol Cell 63:884 –897
Miyakoshi M, Chao Y, Vogel J (2015a) C oss alk be ween ABC anspo e
mRNAs ia a a ge mRNA-de i ed sponge o he Gc B small RNA. EMBO J
34:1478 –1492
Miyakoshi M, Chao Y, Vogel J (2015b) Regula o y small RNAs om he 30
egions o bac e ial mRNAs. Cu Opin Mic obiol 24:132 –139
Mok WW, Pa el NH, Li Y (2010) Decoding oxici y: deducing he sequence
equi emen s o IbsC, a ype I oxin in Esche ichia coli.J Biol Chem 285:
41627 –41636
Moll I, Lei sch D, S einhause T, Blasi U (2003) RNA chape one ac i i y o he
Sm-like H q p o ein. EMBO Rep 4:284 –289
Molle T, F anch T, Hoj up P, Keene DR, Bachinge HP, B ennan RG, Valen in-
Hansen P (2002) H q: a bac e ial Sm-like p o ein ha media es RNA-RNA
in e ac ion. Mol Cell 9:23 –30
Mo i a T, Mochizuki Y, Aiba H (2006) T ansla ional ep ession is su icien o
gene silencing by bac e ial small noncoding RNAs in he absence o
mRNA des uc ion. P oc Na l Acad Sci USA 103:4858 –4863
Mo ulsky HJ (2014)In ui i e bios a is ics. New Yo k: Ox o d Uni e si y P ess
Na ille M, Gau he e D (2010) P ema u e e mina o analysis sheds ligh on
a hidden wo ld o bac e ial ansc ip ional a enua ion. Genome Biol 11:
R97
Nechoosh an G, Elg ably-Weiss M, Shea e A, Wes ho E, Al u ia S (2009)A
pH- esponsi e ibo egula o . Genes De 23:2650 –2662
Nichols RJ, Sen S, Choo YJ, Bel ao P, Zie ek M, Chaba R, Lee S, Kazmie czak
KM, Lee KJ, Wong A, Shales M, Lo e S, Winkle ME, K ogan NJ, Typas A,
G oss CA (2011) Pheno ypic landscape o a bac e ial cell. Cell 144:
143 –156
Obe o J, Nab i S, Joos e V, Migno H, Rou ie e-Yani J (2009) The HU egulon
is composed o genes esponding o anae obiosis, acid s ess, high
osmola i y and SOS induc ion. PLoS One 4:e4367
an de Oos J, Wes a ER, Jackson RN, Wiedenhe B (2014) Un a elling he
s uc u al and mechanis ic basis o CRISPR-Cas sys ems. Na Re Mic obiol
12:479 –492
Padalon-B auch G, He shbe g R, Elg ably-Weiss M, Ba uch K, Rosenshine I,
Ma gali H, Al u ia S (2008) Small RNAs encoded wi hin gene ic islands o
Salmonella Typhimu ium show hos -induced exp ession and ole in
i ulence. Nucleic Acids Res 36:1913 –1927
Papen o K, P ei e V, Mika F, Lucchini S, Hin on JC, Vogel J (2006) SigmaE-
dependen small RNAs o Salmonella espond o memb ane s ess by
accele a ing global omp mRNA decay. Mol Mic obiol 62:1674 –1688
Papen o K, Said N, Welsink T, Lucchini S, Hin on JC, Vogel J (2009) Speci ic
and pleio opic pa e ns o mRNA egula ion by A cZ, a conse ed, H q-
dependen small RNA. Mol Mic obiol 74:139 –158
Papen o K, Sun Y, Miyakoshi M, Vande pool CK, Vogel J (2013) Small RNA-
media ed ac i a ion o suga phospha ase mRNA egula es glucose
homeos asis. Cell 153:426 –437
Papen o K, Fo s ne KU, Cong JP, Sha ma CM, Bassle BL (2015a) Di e en ial
RNA-seq o Vib io chole ae iden i ies he VqmR small RNA as a egula o
o bio ilm o ma ion. P oc Na l Acad Sci USA 112:E766 –E775
Papen o K, Espinosa E, Casadesus J, Vogel J (2015b) Small RNA-based
eed o wa d loop wi h AND-ga e logic egula es ex ach omosomal DNA
ans e in Salmonella.P oc Na l Acad Sci USA 112:E4772 –E4781
P ei e V, Si ka A, Tome R, Tedin K, B inkmann V, Vogel J (2007) A small
non-coding RNA o he in asion gene island (SPI-1) ep esses ou e
memb ane p o ein syn hesis om he Salmonella co e genome. Mol
Mic obiol 66:1174 –1191
P ei e V, Papen o K, Lucchini S, Hin on JC, Vogel J (2009) Coding sequence
a ge ing by MicC RNA e eals bac e ial mRNA silencing downs eam o
ansla ional ini ia ion. Na S uc Mol Biol 16:840 –846
Plumb idge JA, Dondon J, Nakamu a Y, G unbe g-Manago M (1985) E ec o
NusA p o ein on exp ession o he nusA,in B ope on in E. coli.Nucleic
Acids Res 13:3371 –3388
Rich e AS, Schlebe ge C, Backo en R, S eglich C (2010) Seed-based INTARNA
p edic ion combined wi h GFP- epo e sys em iden i ies mRNA a ge s o
he small RNA Y 1.Bioin o ma ics 26:1–5
Romilly C, Caldela i I, Pa men ie D, Lioliou E, Romby P, Fech e P (2012)
Cu en knowledge on egula o y RNAs and hei machine ies in
S aphylococcus au eus.RNA Biol 9:402 –413
Sal ail H, Ca on MP, Belange J, Massé E (2013) An agonis ic unc ions
be ween he RNA chape one H q and an sRNA egula e sensi i i y o he
an ibio ic colicin. EMBO J 32:2764 –2778
Saue E, Weichen iede O (2011) S uc u al basis o RNA 30-end ecogni ion
by H q. P oc Na l Acad Sci USA 108:13065 –13070
Schu DJ, Zhang A, Go esman S, S o z G (2015) Al e na i e H q-sRNA
in e ac ion modes dic a e al e na i e mRNA ecogni ion. EMBO J 34:
2557 –2573
Sex on JA, Vogel JP (2004) Regula ion o hype compe ence in Legionella
pneumophila.J Bac e iol 186:3814 –3825
Sha ma CM, Da euille F, Plan inga TH, Vogel J (2007) A small RNA egula es
mul iple ABC anspo e mRNAs by a ge ing C/A- ich elemen s inside
and ups eam o ibosome-binding si es. Genes De 21:2804 –2817
Sha ma CM, Ho mann S, Da euille F, Reignie J, Findeiss S, Si ka A, Chabas
S, Reiche K, Hacke mulle J, Reinha d R, S adle PF, Vogel J (2010) The
p ima y ansc ip ome o he majo human pa hogen Helicobac e pylo i.
Na u e 464:250 –255
Sha ma CM, Papen o K, Pe ni zsch SR, Mollenkop HJ, Hin on JC, Vogel J
(2011) Pe asi e pos - ansc ip ional con ol o genes in ol ed in amino
acid me abolism by he H q-dependen Gc B small RNA. Mol Mic obiol 81:
1144 –1165
Sha ma CM, Vogel J (2009) Expe imen al app oaches o he disco e y and
cha ac e iza ion o egula o y small RNA. Cu Opin Mic obiol 12:536 –546
Sil a IJ, O ega AD, Viegas SC, Ga cia-Del Po illo F, A aiano CM (2013)An
RpoS-dependen sRNA egula es he exp ession o a chape one in ol ed in
p o ein olding. RNA 19:1253 –1265
Si ka A, Lucchini S, Papen o K, Sha ma CM, Rolle K, Binnewies TT, Hin on
JC, Vogel J (2008) Deep sequencing analysis o small noncoding RNA and
mRNA a ge s o he global pos - ansc ip ional egula o , H q. PLoS Gene
4:e1000163
Skunca N, Bosnjak M, K isko A, Pano P, Dze oski S, Smuc T, Supek F (2013)
Phyle ic p o iling wi h cliques o o hologs is enhanced by signa u es o
pa alogy ela ionships. PLoS Compu Biol 9:e1002852
Smi no A, Fo s ne KU, Holmq is E, O o A, Guns e R, Beche D, Reinha d
R, Vogel J (2016) G ad-seq guides he disco e y o P oQ as a majo small
RNA-binding p o ein. P oc Na l Acad Sci USA 113:11591 –11596
The EMBO Jou nal Vol 36 |No8|2017 ª2017 The Au ho s
The EMBO Jou nal Mechanism o P oQ-dependen sRNA Alexand e Smi no e al
1044
Sob e o P, Val e de C (2012) The bac e ial p o ein H q: much mo e han a
me e RNA-binding ac o . C i Re Mic obiol 38:276 –299
Sonnlei ne E, So ge -Domenigg T, Madej MJ, Findeiss S, Hacke mülle J,
Hü enho e A, S adle PF, Bläsi U, Moll I (2008) De ec ion o small RNAs
in Pseudomonas ae uginosa by RNomics and s uc u e-based bioin o ma ic
ools. Mic obiology 154:3175 –3187
Sope T, Mandin P, Majdalani N, Go esman S, Woodson SA (2010) Posi i e
egula ion by small RNAs and he ole o H q. P oc Na l Acad Sci USA 107:
9602 –9607
Thomason MK, S o z G (2010) Bac e ial an isense RNAs: how many a e he e,
and wha a e hey doing? Annu Re Gene 44:167 –188
T ee JJ, G anneman S, McA ee SP, Tolle ey D, Gally DL (2014) Iden i ica ion
o bac e iophage-encoded an i-sRNAs in pa hogenic Esche ichia coli.Mol
Cell 55:199 –213
Udekwu KI, Wagne EG (2007) Sigma E con ols biogenesis o he an isense
RNA MicA. Nucleic Acids Res 35:1279 –1288
Updeg o e TB, Shabalina SA, S o z G (2015) How do base-pai ing small RNAs
e ol e? FEMS Mic obiol Re 39:379 –391
Updeg o e TB, Zhang A, S o z G (2016) H q: he lexible RNA ma chmake .
Cu Opin Mic obiol 30:133 –138
U ban JH, Vogel J (2007) T ansla ional con ol and a ge ecogni ion by
Esche ichia coli small RNAs in i o.Nucleic Acids Res 35:1018 –1037
Uzzau S, Figue oa-Bossi N, Rubino S, Bossi L (2001) Epi ope agging o
ch omosomal genes in Salmonella.P oc Na l Acad Sci USA 98:
15264 –15269
Vogel J, A gaman L, Wagne EG, Al u ia S (2004) The small RNA Is R inhibi s
syn hesis o an SOS-induced oxic pep ide. Cu Biol 14:2271 –2276
Vogel J, Luisi BF (2011) H q and i s cons ella ion o RNA. Na Re Mic obiol 9:
578 –589
Wagne EG, Romby P (2015) Small RNAs in bac e ia and a chaea: who hey
a e, wha hey do, and how hey do i . Ad Gene 90:133 –208
Wassa man KM, S o z G (2000)6S RNA egula es E. coli RNA polyme ase
ac i i y. Cell 101:613 –623
Wa e s SA, McA ee SP, Kudla G, Pang I, Deshpande NP, Amos TG, Wen Leong
K, Wilkins MR, S ugnell R, Gally DL, Tolle ey D, T ee JJ (2016) Small RNA
in e ac ome o pa hogenic E. coli e ealed h ough c osslinking o RNase
E. EMBO J 36:374 –387
Wes e mann AJ, Fo s ne KU, Amman F, Ba quis L, Chao Y, Schul e LN,
Mulle L, Reinha d R, S adle PF, Vogel J (2016) Dual RNA-seq un eils
noncoding RNA unc ions in hos -pa hogen in e ac ions. Na u e 529:
496 –501
Zhang A, Wassa man KM, O ega J, S e en AC, S o z G (2002) The Sm-like H q
p o ein inc eases OxyS RNA in e ac ion wi h a ge mRNAs. Mol Cell 9:
11 –22
License: This is an open access a icle unde he
e ms o he C ea i e Commons A ibu ion 4.0
License, which pe mi s use, dis ibu ion and ep oduc-
ion in any medium, p o ided he o iginal wo k is
p ope ly ci ed.
ª2017 The Au ho s The EMBO Jou nal Vol 36 |No8|2017
Alexand e Smi no e al Mechanism o P oQ-dependen sRNA The EMBO Jou nal
1045