scieee Science in your language
[en] (orig)

Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity

Abstract

Chia (Salvia hispanica L.) seed has high potential in the development of functional food due to its protein content with a special amino acid profile. Among the hematopoietic-derived cells, monocytes are endowed with high plasticity, responsible for their pro- and anti-inflammatory function in M1 and M2 phenotype polarization, respectively. Indeed, monocytes are involved in several oxidative- and inflammatory-associated disorders such as cancer, obesity, and cardiovascular and neurodegenerative diseases. This study was designed to investigate the role of chia protein hydrolysates (CPHs) in primary human monocyte–macrophage plasticity response using biochemical, RT-qPCR, and ELISA assays. Our results showed that CPHs reduce ROS and nitrite output, as pro inflammatory cytokine secretion, and enhance the expression and release of anti-inflammatory cytokines. In addition, CPHs reverse LPS-associated M1 polarization into M2. These findings open new opportunities for developing nutritional strategies with chia as a dietary source of biopeptides to prevent the development and progression of oxidative- and inflammatory-related diseases.

Read accessible full text

Antioxidant and Immunomodulatory Properties of Chia Protein Hydrolysates in Primary Human Monocyte–Macrophage Plasticity

Author: Villanueva Lazo, Álvaro; Montserrat de la Paz, Sergio; Grao Cruces, Elena; Pedroche, Justo; Toscano, Rocío; Millán, Francisco; Millán Linares, María del Carmen
Publisher: MDPI
Year: 2022
DOI: 10.3390/foods11050623
Source: https://idus.us.es/bitstreams/edc1a145-daa7-4e6c-851d-f5bc2ef75e13/download


Ci a ion: Villanue a-Lazo, A.;
Mon se a -de la Paz, S.; G ao-C uces,
E.; Ped oche, J.; Toscano, R.; Millan,
F.; Millan-Lina es, M.C. An ioxidan
and Immunomodula o y P ope ies
o Chia P o ein Hyd olysa es in
P ima y Human Monocy e–
Mac ophage Plas ici y. Foods 2022,11,
623. h ps://doi.o g/10.3390/
oods11050623
Academic Edi o : S an Kubow
Recei ed: 21 Janua y 2022
Accep ed: 10 Feb ua y 2022
Published: 22 Feb ua y 2022
Publishe ’s No e: MDPI s ays neu al
wi h ega d o ju isdic ional claims in
published maps and ins i u ional a il-
ia ions.
Copy igh : © 2022 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
oods
A icle
An ioxidan and Immunomodula o y P ope ies
o Chia P o ein Hyd olysa es in P ima y Human
Monocy e–Mac ophage Plas ici y
Al a o Villanue a-Lazo 1, Se gio Mon se a -de la Paz 2,* , Elena G ao-C uces 2, Jus o Ped oche 1,
Rocio Toscano 2, F ancisco Millan 1and Ma ia C. Millan-Lina es 2
1Plan P o ein G oup, Depa men o Food and Heal h, Ins i u o de la G asa-CSIC, Ca e e a de U e a Km 1,
Campus Uni e si a io Pablo de Ola ide, Edi icio 46, 41013 Se ille, Spain;
[email p o ec ed] (A.V.-L.); j.ped [email p o ec ed] (J.P.); [email p o ec ed] (F.M.)
2
Depa men o Medical Biochemis y, Molecula Biology and Immunology, School o Medicine, Uni e sidad
de Se illa, A . D . Fed iani 3, 41071 Se ille, Spain; [email p o ec ed] (E.G.-C.); [email p o ec ed] (R.T.);
[email p o ec ed] (M.C.M.-L.)
*Co espondence: [email p o ec ed]
Abs ac :
Chia (Sal ia hispanica L.) seed has high po en ial in he de elopmen o unc ional ood
due o i s p o ein con en wi h a special amino acid p o ile. Among he hema opoie ic-de i ed
cells, monocy es a e endowed wi h high plas ici y, esponsible o hei p o- and an i-in lamma o y
unc ion in M1 and M2 pheno ype pola iza ion, espec i ely. Indeed, monocy es a e in ol ed in
se e al oxida i e- and in lamma o y-associa ed diso de s such as cance , obesi y, and ca dio ascula
and neu odegene a i e diseases. This s udy was designed o in es iga e he ole o chia p o ein
hyd olysa es (CPHs) in p ima y human monocy e–mac ophage plas ici y esponse using biochemical,
RT-qPCR, and ELISA assays. Ou esul s showed ha CPHs educe ROS and ni i e ou pu , as p o-
in lamma o y cy okine sec e ion, and enhance he exp ession and elease o an i-in lamma o y
cy okines. In addi ion, CPHs e e se LPS-associa ed M1 pola iza ion in o M2. These indings open
new oppo uni ies o de eloping nu i ional s a egies wi h chia as a die a y sou ce o biopep ides
o p e en he de elopmen and p og ession o oxida i e- and in lamma o y- ela ed diseases.
Keywo ds:
chia; Sal ia hispanica L.; immunonu i ion; myeloid cells; oligopep ides; ood-de i ed pep ides
1. In oduc ion
Heal hy die a y habi s a e no enough o ea disease s a us, and i is necessa y o
ind no el d ug ea men s and o de elop new unc ional componen s, which can ac
as p e en i e he apy o se e al diseases ela ed o oxida i e and in lamma o y ch onic
s a es [
1
]. Hence, ood-de i ed unc ional o bioac i e compounds such as pep ides can
be included in he de elopmen o unc ional oods. Bioac i e pep ides migh be ob ained
by gas oin es inal diges ion, e men a ion, o con olled hyd olysis p ocesses using ex-
ogenous p o eases [
2
]. Small pep ides and amino acids migh c oss he na u al in es inal
ba ie , en e he bloods eam, and play an impo an ole in he immune sys em con-
olling oxida i e and in lamma o y pa hways [
3
]. Rega ding ex ensi e hyd olysa es o
exogenous p o eases,
in i o
s udies wi h seed p o ein hyd olysa es ha e shown an iox-
idan biological ac i i y, choles e ol lowe ing capaci y, immunomodula o y p ope ies,
and angio ensin-con e ing enzyme (ACE) inhibi ion, among o he s [
4
]. Fo ins ance, he
li e a u e epo s many legume hyd olysa es which exe biological ac i i y [
5
], such as
an i-in lamma o y and immunomodula o y e ec s o soy [
6
] and in he GPETAFLR pep ide
(Gly-P o-Glu-Th -Ala-Phe-Leu-A g), isola ed om lupine hyd olysa es [
7
]. In addi ion,
biological ac i i y has been ound in o he ege able seeds such as ice b an hyd olysa es,
p omo ing a e ioscle osis esolu ion [
8
], and hemp hyd olysa es, p e en ing oxida ion
and neu oin lamma ion [9].
Foods 2022,11, 623. h ps://doi.o g/10.3390/ oods11050623 h ps://www.mdpi.com/jou nal/ oods
Foods 2022,11, 623 2 o 13
Chia (Sal ia hispanica L.) is a na i e plan om he cen al egion o Sou h Ame ica [
10
]
and is conside ed as a “supe ood” due o i s unc ional p ope ies [
11
]. Chia has a high
con en o bene icial a y acids as linolenic acid (C18:3,
ω−
3), linoleic acid (C18:2,
ω−
6),
and oleic acid (C18,
ω−
9), which a e ela ed o he educ ion in choles e ol le els and blood
p essu e [
12
]. Chia seeds a e also ich in an ioxidan s, B i amins, mine als, and ibe , hei
p o ein con en (15–24%) has been highligh ed in compa ison o o he seeds [
13
–
17
]. The
sul u -con aining amino acid con en as well as a ginine, aspa ic acid, and glu amic acid
con en exe impo an unc ions in p o ein unc ionali y [
16
,
18
–
21
]. The e o e, chia gi es
he oppo uni y o ob ain bioac i e pep ides, which exe bene icial e ec s on human heal h.
Chia hyd olysa es ha e been demons a ed o be a e y e icien unc ional ing edien in a
wide ange o oods, as ACE inhibi o s [
22
], and as an i-in lamma o y agen s [
23
]. O he
ecen s udies ha e epo ed ha pep ides om he enzyma ic hyd olysis o chia p o ein
ha e an ibac e ial ac i i y agains G am-posi i e (S. au eus) and G am-nega i e (E. coli)
mic oo ganisms and inhibi choles e ol syn hesis [
24
]. Howe e , o ou knowledge, he
an i-oxidan and an i-in lamma o y e ec s o chia on monocy e pola iza ion and plas ici y
ha e no been desc ibed ye .
In ecen yea s, oxida i e s ess and in lamma ion ha e been linked o immune
cells and ch onic non-communicable diseases such as cance , ca dio ascula disease,
Alzheime ’s, Pa kinson’s, a h i is, diabe es, and obesi y, which a e esponsible o a
leas 70% o mo ali y a ound he wo ld [
25
]. Pa icula ly, human p ima y monocy es
ha e been widely used in s udies o ch onic in lamma o y s a us [
7
,
9
,
26
,
27
]. Th ough hei
plas ic na u e, monocy es can exe mul iple oles du ing he immune esponse cou se [
28
].
No mally, monocy es a e di e en ia ed in a simple manne in o wo subse s: classical mono-
cy es in M1 pola iza ion s a us, which exe p o-oxidan and p o-in lamma o y esponse,
and non-classical monocy es in M2 pola iza ion s a us, which exe an -oxida i e and an i-
in lamma o y esponse. The M1 and M2 pola iza ion s a us may be di e en ia ed by he
exp ession o CD14 and CD16 su ace ecep o s [
29
–
31
]. Hence, mac ophage ac i a ion can
occu h ough he ecogni ion o pa hogen-associa ed molecula pa e n (PAMP) pa hway
be ween lipopolysaccha ide (LPS) molecules and pa hogen ecogni ion ecep o s, including
oll-like ecep o s (TLRs), p o eins ha play a key ole in he inna e immune sys em, wi h
nuclea ac o -kappa B (NF-
κ
b) ac i a ion [
32
]. In his connec ion, in e e on gamma (IFN
γ
)
is one o he mos po en induce s o classical mac ophage ac i a ion (M1 mac ophages)
and is esponsible o oxidan and p o-in lamma o y agen s [
33
]. In addi ion, IL-4 is one o
he mos po en induce s o non-classical mac ophage ac i a ion (M2 mac ophages), and
he p oduc ion o an i-in lamma o y cy okines es ablishes he wound-healing s a e ha
accompanies he esolu ion o he in lamma o y s a e and he ca abasis o adap i e immune
esponses [34].
Wi hin he amewo k o hese c i e ia, he main objec i e o his esea ch was o
s udy he an ioxidan and an i-in lamma o y e ec s o chia (Sal ia hispanica L.) p o ein
hyd olysa e on p ima y human monocy es, as well as i s abili y o e-p og am he monocy e–
mac ophage sys em.
2. Ma e ials and Me hods
2.1. Isola ion o Chia P o ein
Chia seeds (Sal ia hispanica L.) we e supplied by he Au onomous Uni e si y o Nue o
Leon (Sain Nicholas de Los Ga za, Mexico). Chia p o ein isola e (CPI) was ob ained by
Plan P o ein G oup’s pilo plan in he Ins i u o de la G asa (IG-CSIC, Se ille, Spain) om
de a ed chia lou using he me hod o Lqa i [
35
] wi h some modi ica ions. B ie ly, de a ed
chia meal was ex ac ed wi h 0.25% Na
2
SO
3
(w/ ) a pH 10.5 o 1 h. A e cen i uging
he ex ac in a decan e o 15 min, supe na an was eco e ed, and pelle was ex ac ed
again. Bo h supe na an s we e adjus ed o he isoelec ic poin o chia p o ein (pH 4.0) and
cen i uged again. The esul ing p ecipi a e was washed wi h dis illed wa e , adjus ed o
pH 4.0, and cen i uged o emo e esidual sal s and o he non-p o ein compounds. Finally,
he p ecipi a ed p o eins we e a omized and s o ed a oom empe a u e.
Foods 2022,11, 623 3 o 13
2.2. P oduc ion o Chia P o ein Hyd olysa e
Acco ding o Villanue a-Lazo e al. [
36
], chia p o ein hyd olysa e (CPH) was ob ained
om CPI a e 15 min o hyd olysis wi h Alcalase 2.4 L (No ozymes, Mad id, Spain), since
i was he hyd olysa e ha showed be e an ihype ensi e and an ioxidan p ope ies.
B ie ly, 50 g o CPI was dissol ed in wa e in a a io o 7.5% (w/ ). A e adjus ing pH
o 8.0, hyd olysis was ca ied ou wi h comme cial enzyme Alcalase 2.4 L (No ozymes,
Mad id, Spain) a 50
◦
C and wi h an enzyme concen a ion o 0.3 Anson uni s (AU)/g
p o ein, main aining pH a 8 wi h 1 N NaOH. Incuba ion wi h his enzyme was ca ied
ou o 15 min. Nex , he enzyme was inac i a ed a 90
◦
C o 10 min by imme sing he
sample in a he mos a ic ba h. The deg ee o hyd olysis eached, de ined as he pe cen age
o pep ide bonds clea ed, was calcula ed by de e mining p o ein con en and he numbe
o ee amino g oups wi h he TNBS me hod [
37
]. The sample was hyd olyzed wi h 6 N
HCl o 24 h o de e mine he o al numbe o amino g oups.
2.3. Chemical Cha ac e iza ion o Chia Isola e and P o ein Hyd olysa e
The p o ein con en de e mina ion was ca ied ou by elemen al mic oanalysis o ni o-
gen con en (x6.25) using a LECO CN-828 analyze (S . Joseph, MI, USA). The amino acid
de e mina ion was ca ied ou using he me hod o Alaiz e al. wi h sligh modi ica ions [
38
].
The samples (4–6 mg) we e hyd olyzed wi h 4 mL o HCl 6N a 110
◦
C o 24 h in ubes
sealed unde ni ogen. The acid hyd olysa e was de i a ized wi h die hyl e hoxyme hylen-
emalona e, and D,L-
α
-aminobu y ic acid was used as he in e nal s anda d. Amino acid
con en was de e mined wi h ul a-high-pe o mance liquid ch oma og aphy, using a bi-
na y sys em g adien , (A) 25 mM sodium ace a e and 0.02% sodium azide
(pH 6.0)
and
(B) ace oni ile, in an Acqui y A c equipped wi h a 2998PDA De ec o , a Sample Manage
FTN-R, and a Qua e na y Sol en Manage -R (Acqui y A c, Wa e s Co po a ion, Mil o d,
MA, USA) and a 3
×
150 mm e e sed-phase column (XSelec
®
HSS T3, 2.5
µ
m) (Wa e s
Co po a ion, Mil o d, MA, USA). The Yus me hod was used o de e mine he yp ophan
con en [
39
]. Samples (20–24 mg) we e hyd olyzed wi h 3 mL o 4 N NaOH a 110
◦
C o
4 h in closed ubes and unde a ni ogen a mosphe e. Mois u e was calcula ed by weigh
di e ence be ween ini ial sample and d y sample a 110
◦
C o cons an weigh . Ash con en
was also de e mined by g a ime y, wi h samples being incine a ed a
550 ◦C
o 36 h
using he di ec igni ion me hod. Fibe con en was de e mined acco ding o Lee [
40
]. This
me hod is based on diges ion o samples by he mos able
α
-amylase enzymes, p o ease,
and amyloglucosidase and subsequen de e mina ion o esul ing esidue by g a ime y.
2.4. Isola ion o P ima y Human Monocy es
Pe iphe al blood mononuclea cells (PBMCs) we e ob ained om bu y coa s dona ed
by Cen o Regional de T ans usiones Sanguíneas y Banco de Tejidos de la p o incia de
Se illa y Huel a. PBMCs we e isola ed by cen i uga ion on a g adien wi h Ficoll (Sigma,
Mad id, Spain) [
31
] and monocy es we e sepa a ed om PBMCs by posi i e selec ion using
CD14 mic obeads and LS columns on a midiMACS sys em (Mil enyi Bio ec, Mad id, Spain)
acco ding o he manu ac u e ’s ins uc ions. A e isola ion, monocy es we e suspended
in RPMI 1640 medium supplemen ed wi h L-glu amine, penicillin, s ep omycin, and 1%
hea -inac i a ed e al bo ine se um. Fo ea men s, 5
×
10
5
monocy es/well we e seeded
in 24-well pla es in p esence o absence o LPS (100 ng/mL) (Sigma, Mad id, Spain) and
ea ed wi h CPH a 50 and 100 µg/mL o 24 h.
2.5. Cell Viabili y (MTT)
Cell iabili y was de e mined using he 3-(4,5-dime hyl iazol-2-yl)-2,5-diphenyl e azo-
lium b omide (MTT) me hod. Monocy es we e seeded in a 96-well pla e in a 1
×
10
5
densi y and incuba ed (5% CO
2
a 37
◦
C in a CO
2
incuba o ) (The mo Con Elec on Co -
po a ion, Wal ham, MA, USA) o 24 h in he p esence o CPH a he concen a ion ange
25–200 µg/mL
. Then, an aqueous solu ion o MTT was added a 0.5 mg/mL, and he
pla e was incuba ed o 2 h (5% CO
2
a 37
◦
C in a CO
2
incuba o ). Fo mazan c ys als
Foods 2022,11, 623 4 o 13
we e dissol ed in dime hyl sul oxide (DMSO), and he abso bance was de e mined by
using a Mul iskan Spec um (The mo Labsys ems, Gulph Mills, PA, USA) a 570 nm wi h
620 nm co ec ion.
2.6. Di e en ia ion and Pola iza ion o Mac ophages M1/M2
Monocy es (5
×
10
5
pe well) we e incuba ed o 6 days in he p esence o ecombinan
human M-CSF (25 ng/mL) o ob ain di e en ia ed M0 mac ophages. These cells we e hen
cul u ed in RPMI 1640 supplemen ed wi h L-glu amine, penicillin, s ep omycin, and 10%
FBS. Fo pola iza ion o M1 and M2, M0 mac ophages we e exposed o LPS (100 ng/mL)
plus IFN
γ
(20 ng/mL) and IL-4 (20 ng/mL), espec i ely, o an addi ional 24 h. To e alua e
he e ec o CPH on mac ophage pola iza ion, M1 mac ophages we e exposed o 50 and
100 µg/mL o CPH o 24 h.
2.7. Reac i e Oxygen Species (ROS) P oduc ion
ROS in acellula le els we e de e mined using CellROX eagen (The mo Fishe
Scien i ic, Mad id, Spain). A e
in i o
s imula ion wi h LPS a 100 ng/mL, monocy es
we e exposed o 50 and 100
µ
g/mL o CPH o 24 h and hen wi h CellROX (5
µ
M) o
30 min
. Cells we e washed wi h phospha e-bu e ed saline (PBS), and he luo escence
signal was analyzed in a Fluo oskan Mic opla e Fluo ome e (The mo Fishe Scien i ic). Cell
au o luo escence was measu ed unde he same condi ions, bu wi hou adding CellROX.
Da a shown e e o pe cen age o in acellula ROS p oduc ion and o compa ison wi h a
posi i e con ol (100% ROS p oduc ion) a e cell ea men in LPS p esence.
2.8. Ni i e P oduc ion
The ni ic oxide (NO) p oduc ion was measu ed in co-cul u ed supe na an using he
G iess me hod in p e iously LPS-ac i a ed monocy es incuba ed wi h CPH a
50–100 µg/mL
.
G iess eagen (Sigma-Ald ich, Mad id, Spain) was added a he same olume o co-cul u e
supe na an in a 96-well pla e. The abso bance was measu ed in iplica e samples a
540 nm using he Mul iskan Spec um. The NO concen a ion was calcula ed om he
calib a ion cu e om se ial dilu ion o NO2.
2.9. Cy okine Quan i ica ion
Le els o umo al nec osis ac o (TNF)-
α
, in e leukin (IL)-1
β
, IL-6, and IL-10 in
cul u e supe na an s we e de e mined by an enzyme-linked immunoso ben assay (ELISA),
ollowing he ins uc ions o he manu ac u e (Diaclone, Besancon, F ance).
2.10. RNA Isola ion and RT-qPCR
To al RNA was ex ac ed using T isu e Reagen (Bioline). An A
260
/A
280
a io in a
NanoD op ND-1000 spec opho ome e (The mo Scien i ic, Mad id, Spain) was used o
assay RNA quali y. Subsequen ly, RNA (1
µ
g) was subjec ed o e e se ansc ip ion (iSc ip ,
Bio-Rad, Mad id, Spain). An amoun o 10 ng o esul ing cDNA was used as a empla e
o eal- ime PCR ampli ica ions. The mRNA le els o speci ic genes we e de e mined in
a CFX96 sys em (Bio-Rad) con aining p ime pai s o ei he gene o o glyce aldehyde
3-phospha e dehyd ogenase (GAPDH) and hypoxan hine phospho ibosyl ans e ase 1
(HPRT) as housekeeping genes. All ampli ica ion eac ions we e pe o med in iplica e
wi h a e age h eshold cycle (C ) numbe s o magni ude o change in mRNA exp ession o
candida e genes, quan i ied wi h he s anda d 2
−(∆∆C )
me hod. All da a we e no malized
o endogenous e e ence (GAPDH and HPRT) gene con en and exp essed as pe cen age o
con ols. P ime s used o he ampli ica ions a e de ailed in Table 1.
Foods 2022,11, 623 5 o 13
Table 1. P ime sequences o RT-qPCR gene exp ession analysis.
Ta ge GenBank
Accession Numbe
Fo wa d
Re e se Sequence (50→30)
iNOS NM_ 000625 Fo wa d
Re e se
ACCCAGACTTACCCCTTTGG
GCCTGGGGTCTAGGAGAGAC
IL1βNM_000576 Fo wa d
Re e se
GGGCCTCAAGGAAAAGAATC
TTCTGCTTGAGAGGTGCTGA
IL6 NM_000600 Fo wa d
Re e se
TACCCCCAGGAGAAGATTCC
TTTTCTGCCAGTGCCTCTTT
TNFαNM_000594 Fo wa d
Re e se
TCCTTCAGACACCCTCAACC
AGGCCCCAGTTTGAATTCTT
IL10 NM_000572 Fo wa d
Re e se
GCCTAACATGCTTCGAGATC
TGATGTCTGGGTCTTGGTTC
CCR7 NM_007719.2 Fo wa d
Re e se
GTGTGCTTCTGCCAAGATGA
CCACGAAGCAGATGACAGAA
MRC1 NM_ 138806 Fo wa d
Re e se
GGCGGTGACCTCACAAGTAT
ACGAAGCCATTTGGTAAACG
HPRT NM_001289746 Fo wa d
Re e se
ACCCCACGAAGTGTTGGATA
AAGCAGATGGCCACAGAACT
GAPDH NM_001289746 Fo wa d
Re e se
CACATGGCCTCCAAGGAGTAAG
CCAGCAGTGAGGGTCTCTCT
2.11. S a is ical Analysis
All alues a e exp essed as a i hme ic means
±
s anda d de ia ion (SD). Da a we e
e alua ed wi h G aphPad P ism Ve sion 6.01 so wa e (San Diego, CA, USA). The s a is ical
signi icance o any di e ence in each pa ame e among he g oups was e alua ed by one-
way analysis o a iance (ANOVA), ollowing Tukey’s mul iple compa ison es as a pos
hoc es . p alues less han 0.05 we e conside ed s a is ically signi ican .
3. Resul s
3.1. Chemical Cha ac e iza ion o he CPI and CPH
CPH was ob ained om CPI a e 15 min hyd olysis wi h Alcalase 2.4 L, eaching
a deg ee o hyd olysis o 36.2% and a p o ein con en o 75.03%. Table 2shows p o ein,
mois u e, ash, ibe , and o he con en s p esen ed in CPH.
Table 2.
Chemical composi ion (g/100 g) o chia p o ein p oduc s. CPI, chia p o ein isola e; CPH,
chia p o ein hyd olysa e ob ained a e 15 min o hyd olysis wi h Alcalase 2.4 L.
CPI CPH
P o ein (%) 82.85 ±0.11 75.03 ±0.45
Mois u e (%) 4.80 ±0.30 7.18 ±0.08
Ash (%) 0.13 ±0.09 6.45 ±0.17
Fibe (%) 11.01 ±0.80 11.20 ±0.70
O he * (%) 1.21 0.14
Da a a e means ±SD, n= 3. * 100 −(P o ein(%) + Mois u e (%) + Ash(%) + Fibe (%)).
The amino acid p o ile o CPH is shown in Table 3. In addi ion, CPI amino acid analysis
esul s and FAO/WHO/UNU nu i ional ecommenda ions o adul s o essen ial amino
acids a e p esen ed. I highligh s he p esence o nega i ely cha ged amino acids, glu amic
acid and aspa ic acid (176.2 and 85.2 mg/g p o ein, espec i ely), as well as a ginine
(108 mg/g p o ein) in CPI. These esul s a e simila o hose ob ained by CPH.

Foods 2022,11, 623 6 o 13
Table 3.
Summa y o he adul indispensable amino acid composi ion and equi emen s o chia
p o ein p oduc s. CPI, chia p o ein isola e; CPH, chia p o ein hyd olysa e ob ained a e 15 min o
hyd olysis wi h Alcalase.
Indispensable Amino Acid
P o ein CPI CPH 2007
FAO/WHO/UNU a,b
His idine 37.9 ±2.9 39.2 ±0.5 15
Isoleucine 35.2 ±0.3 35.1 ±0.0 30
Leucine 70.4 ±4.6 72.2 ±0.7 59
Lysine 46.4 ±1.4 48.1 ±0.6 45
Me hionine + cys eine 40.5 ±1.9 40.3 ±1.2 22
Me hionine 21.9 ±1.8 21.1 ±2.1 16
Cys eine 18.6 ±1.9 19.2 ±0.4 6
Phenylalanine + y osine 136.7 ±1.9 135.5 ±1.1 38
Th eonine 38.4 ±2.1 38.0 ±0.3 23
T yp ophan 48.1 ±0.6 49.3 ±0.3 6
Valine 46.9 ±0.9 47.6 ±0.8 39
To al indispensable amino acids 500.5 505.3 277
Dispensable Amino Acid
P o ein
Aspa ic acid 85.2 ±1.7 84.5 ±1.3
Glu amic acid 176.2 ±2.7 178.3 ±1.9
Se ine 71.9 ±1.6 70.2 ±0.7
Glycine 44.5 ±2.4 45.0±0.6
A ginine 108.0 ±2.9 105.3 ±1.1
Alanine 48.0 ±1.2 49.1 ±0.4
P oline 23.1±1.0 17.6 ±0.3
To al dispensable amino acids 556.9 550
Da a a e shown in % and
±
SD, n= 3.
a
FAO/WHO/UNU. Sco ing pa e n mg/g p o ein equi emen in adul s.
b
FAO and FINUT 2017. Die a y p o ein quali y e alua ion in human nu i ion. FAO Food and Nu i ion Pape
NO. 92.
3.2. CPH Dec eases Oxida i e S ess in Human P ima y Monocy es
Once he hyd olysa e was cha ac e ized, he an i-in lamma o y and an ioxidan e ec
es s we e ca ied ou , and he i s s ep was o e i y i he hyd olysa e p oduces a cy o oxic
e ec on he p ima y human monocy es. Fo his pu pose, hey we e incuba ed o 24 h
up o doses o 200
µ
g/mL, e i ying ha he e was no cy o oxic e ec (Figu e 1A). Taking
in o accoun he MTT assay, CPH doses o 50 and 100
µ
g/mL we e used o es an ioxidan
and an i-in lamma o y ac i i y o CPH. LPS signi ican ly inc eased bo h in acellula ROS
(Figu e 1B) and ni i e (Figu e 1C) compa ed o uns imula ed cells (C). On he o he hand,
as can be seen in Figu e 1B, he cells ha we e s imula ed wi h LPS and ea ed wi h CPH
dec eased ROS p oduc ion, a dec ease ha is g ea e , al hough no s a is ically signi ican ,
when inc easing he concen a ion o he CPH. The same e ec is obse ed in Figu e 1C
ega ding he p oduc ion o ni i es. In his case he inc ease in he concen a ion o CPH
p oduces a dec ease in he p oduc ion o ni i es which is s a is ically signi ican . In addi ion,
LPS-s imula ed cells showed highe iNOS gene exp ession compa ed o uns imula ed cells
(Figu e 1D), and he CPH ea men dec eased iNOS gene exp ession in LPS-s imula ed
human p ima y monocy es. This dec ease was signi ican ly less when inc easing he
concen a ion o CPH.
Foods 2022,11, 623 7 o 13
Foods 2022, 11, x FOR PEER REVIEW 7 o 13
ea ed wi h CPH dec eased ROS p oduc ion, a dec ease ha is g ea e , al hough no s a-
is ically signi ican , when inc easing he concen a ion o he CPH. The same e ec is ob-
se ed in Figu e 1C ega ding he p oduc ion o ni i es. In his case he inc ease in he
concen a ion o CPH p oduces a dec ease in he p oduc ion o ni i es which is s a is i-
cally signi ican . In addi ion, LPS-s imula ed cells showed highe iNOS gene exp ession
compa ed o uns imula ed cells (Figu e 1D), and he CPH ea men dec eased iNOS gene
exp ession in LPS-s imula ed human p ima y monocy es. This dec ease was signi ican ly
less when inc easing he concen a ion o CPH.
Figu e 1. Cell iabili y (A), p oduc ion o ROS (B), and ni iles (C) exp essed as luo escence/ab-
so bance and iNOS mRNA le els (D) compa ed o LPS-s imula ed cells a e CPH ea men a 50
and 100 µg/mL o 24 h in human p ima y monocy es. The alues a e p esen ed as means ± SD (n =
3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
3.3. CPH Dec eases P o-In lamma o y Cy okine Le els and Gene Exp ession in Human P ima y
Monocy es
P o-in lamma o y cy okine (IL-1β, IL-6, and TNFα) and an i-in lamma o y cy okine
(IL-10) gene exp ession was e alua ed in o de o de e mine po en ial an i-in lamma o y
e ec s o CPH. LPS signi ican ly inc eased he p oduc ion o IL-1β (Figu e 2A), IL-6 (Fig-
u e 2B), and TNFα (Figu e 2C) compa ed o uns imula ed cells (C). The p o-in lamma o y
gene exp ession inc ease was signi ican ly educed by CPH a 100 µg/mL. Con e sely,
LPS dec eased he p oduc ion o an i-in lamma o y cy okine IL-10 (Figu e 2D), and CPH
a 100 µg/mL es o ed he p oduc ion o his cy okine o uns imula ed cell le els.
Figu e 1.
Cell iabili y (
A
), p oduc ion o ROS (
B
), and ni iles (
C
) exp essed as luo es-
cence/abso bance and iNOS mRNA le els (
D
) compa ed o LPS-s imula ed cells a e CPH ea men
a 50 and 100
µ
g/mL o 24 h in human p ima y monocy es. The alues a e p esen ed as
means ±SD
(n= 3). Di e en le e s deno e s a is ical di e ences (p< 0.05).
3.3. CPH Dec eases P o-In lamma o y Cy okine Le els and Gene Exp ession in Human
P ima y Monocy es
P o-in lamma o y cy okine (IL-1
β
, IL-6, and TNF
α
) and an i-in lamma o y cy okine
(IL-10) gene exp ession was e alua ed in o de o de e mine po en ial an i-in lamma o y
e ec s o CPH. LPS signi ican ly inc eased he p oduc ion o IL-1
β
(Figu e 2A), IL-6
(Figu e 2B), and TNF
α
(Figu e 2C) compa ed o uns imula ed cells (C). The p o-in lamma o y
gene exp ession inc ease was signi ican ly educed by CPH a 100
µ
g/mL. Con e sely, LPS
dec eased he p oduc ion o an i-in lamma o y cy okine IL-10 (Figu e 2D), and CPH a
100 µg/mL es o ed he p oduc ion o his cy okine o uns imula ed cell le els.
In line wi h he esul s ob ained o cy okine gene exp ession, LPS inc eased he elease
o p o-in lamma o y cy okines (Figu e 3A–C) and dec eased he elease o IL-10 (Figu e 3D).
In all hese cases, CPH signi ican ly dec eased he elease o p o-in lamma o y cy okines
and inc eased IL-10 le el.
3.4. CPH P omo es M2 Pola iza ion and Dec eases he P o-In lamma o y S a e in Human
Monocy e-De i ed Mac ophages
Di e en mic oen i onmen s and signals p omo e mac ophage pola iza ion. Mac ophages
show speci ic pheno ypes ha co espond o classical (M1) and al e na i e (M2) pheno ypes.
Non-pola ized mac ophages, a e LPS and IFN
γ
incuba ion, we e di e en ia ed in o M1
mac ophages. Mac ophages showed an inc ease in CCR7 gene exp ession, M1 pola iza ion
ma ke (Figu e 4A), and a dec ease in MRC1 gene exp ession. An M2 pola iza ion ma ke
(Figu e 4B) was ound. When M1 pola ized mac ophages we e ea ed wi h CPH, CCR7
gene exp ession dec eased, and MRC1 gene exp ession inc eased.
Foods 2022,11, 623 8 o 13
Foods 2022, 11, x FOR PEER REVIEW 8 o 13
Figu e 2. P o-in lamma o y (A–C) and an i-in lamma o y (D) cy okine p oduc ion in human p i-
ma y LPS-s imula ed monocy es a e CPH ea men a 50 and 100 µg/mL o 24 h. The alues a e
p esen ed as means ± SD (n = 3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
In line wi h he esul s ob ained o cy okine gene exp ession, LPS inc eased he e-
lease o p o-in lamma o y cy okines (Figu e 3A–C) and dec eased he elease o IL-10 (Fig-
u e 3D). In all hese cases, CPH signi ican ly dec eased he elease o p o-in lamma o y
cy okines and inc eased IL-10 le el.
Figu e 3. P o-in lamma o y (A–C) and an i-in lamma o y (D) cy okine gene exp ession in human
p ima y LPS-s imula ed monocy es a e CPH ea men a 50 and 100 µg/mL o 24 h. The alues
a e p esen ed as means ± SD (n = 3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
3.4. CPH P omo es M2 Pola iza ion and Dec eases he P o-In lamma o y S a e in Human Mon-
ocy e-De i ed Mac ophages
Figu e 2.
P o-in lamma o y (
A
–
C
) and an i-in lamma o y (
D
) cy okine p oduc ion in human p ima y
LPS-s imula ed monocy es a e CPH ea men a 50 and 100
µ
g/mL o 24 h. The alues a e
p esen ed as means ±SD (n= 3). Di e en le e s deno e s a is ical di e ences (p< 0.05).
Foods 2022, 11, x FOR PEER REVIEW 8 o 13
Figu e 2. P o-in lamma o y (A–C) and an i-in lamma o y (D) cy okine p oduc ion in human p i-
ma y LPS-s imula ed monocy es a e CPH ea men a 50 and 100 µg/mL o 24 h. The alues a e
p esen ed as means ± SD (n = 3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
In line wi h he esul s ob ained o cy okine gene exp ession, LPS inc eased he e-
lease o p o-in lamma o y cy okines (Figu e 3A–C) and dec eased he elease o IL-10 (Fig-
u e 3D). In all hese cases, CPH signi ican ly dec eased he elease o p o-in lamma o y
cy okines and inc eased IL-10 le el.
Figu e 3. P o-in lamma o y (A–C) and an i-in lamma o y (D) cy okine gene exp ession in human
p ima y LPS-s imula ed monocy es a e CPH ea men a 50 and 100 µg/mL o 24 h. The alues
a e p esen ed as means ± SD (n = 3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
3.4. CPH P omo es M2 Pola iza ion and Dec eases he P o-In lamma o y S a e in Human Mon-
ocy e-De i ed Mac ophages
Figu e 3.
P o-in lamma o y (
A
–
C
) and an i-in lamma o y (
D
) cy okine gene exp ession in human
p ima y LPS-s imula ed monocy es a e CPH ea men a 50 and 100
µ
g/mL o 24 h. The alues
a e p esen ed as means ±SD (n= 3). Di e en le e s deno e s a is ical di e ences (p< 0.05).
Foods 2022,11, 623 9 o 13
Foods 2022, 11, x FOR PEER REVIEW 9 o 13
Di e en mic oen i onmen s and signals p omo e mac ophage pola iza ion. Mac o-
phages show speci ic pheno ypes ha co espond o classical (M1) and al e na i e (M2)
pheno ypes. Non-pola ized mac ophages, a e LPS and IFNγ incuba ion, we e di e en-
ia ed in o M1 mac ophages. Mac ophages showed an inc ease in CCR7 gene exp ession,
M1 pola iza ion ma ke (Figu e 4A), and a dec ease in MRC1 gene exp ession. An M2
pola iza ion ma ke (Figu e 4B) was ound. When M1 pola ized mac ophages we e
ea ed wi h CPH, CCR7 gene exp ession dec eased, and MRC1 gene exp ession in-
c eased.
Figu e 4. Mac ophage pola iza ion ma ke gene exp ession, CCR7, M1 pola iza ion ma ke (A) and
MRC1, M2 pola iza ion ma ke (B). M0 mac ophages we e incuba ed wi h LPS + IFNγ (M1 con ol),
IL-4 (M2 con ol), o LPS + IFNγ + CPH (50 and 100 μg/mL o 24 h). Values a e p esen ed as means
± SD (n = 3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
Non-pola ized mac ophages a e LPS and IFNγ ea men showed an inc ease in
TNFα, p o-in lamma o y cy okine, gene exp ession and elease (Figu e 5A), and elease
(Figu e 5B) and a dec ease in IL-10, an i-in lamma o y cy okine, gene exp ession (Figu e
5C), and elease (Figu e 5D). When ea ed wi h CPH, p o-in lamma o y cy okine gene
exp ession and elease dec eased, and an i-in lamma o y cy okine gene exp ession and
elease inc eased.
Figu e 5. TNFα, M1 mac ophage pola iza ion-associa ed cy okine, gene exp ession (A), and elease
(B) and IL-10, M2 mac ophage pola iza ion-associa ed cy okine, gene exp ession (C), and elease
Figu e 4.
Mac ophage pola iza ion ma ke gene exp ession, CCR7, M1 pola iza ion ma ke (
A
) and
MRC1, M2 pola iza ion ma ke (
B
). M0 mac ophages we e incuba ed wi h LPS + IFN
γ
(M1 con ol),
IL-4 (M2 con ol), o LPS + IFN
γ
+ CPH (50 and 100
µ
g/mL o 24 h). Values a e p esen ed as
means ±SD (n= 3). Di e en le e s deno e s a is ical di e ences (p< 0.05).
Non-pola ized mac ophages a e LPS and IFN
γ
ea men showed an inc ease in
TNF
α
, p o-in lamma o y cy okine, gene exp ession and elease (Figu e 5A), and elease
(Figu e 5B) and a dec ease in IL-10, an i-in lamma o y cy okine, gene exp ession
(Figu e 5C), and elease (Figu e 5D). When ea ed wi h CPH, p o-in lamma o y cy okine
gene exp ession and elease dec eased, and an i-in lamma o y cy okine gene exp ession
and elease inc eased.
Foods 2022, 11, x FOR PEER REVIEW 9 o 13
Di e en mic oen i onmen s and signals p omo e mac ophage pola iza ion. Mac o-
phages show speci ic pheno ypes ha co espond o classical (M1) and al e na i e (M2)
pheno ypes. Non-pola ized mac ophages, a e LPS and IFNγ incuba ion, we e di e en-
ia ed in o M1 mac ophages. Mac ophages showed an inc ease in CCR7 gene exp ession,
M1 pola iza ion ma ke (Figu e 4A), and a dec ease in MRC1 gene exp ession. An M2
pola iza ion ma ke (Figu e 4B) was ound. When M1 pola ized mac ophages we e
ea ed wi h CPH, CCR7 gene exp ession dec eased, and MRC1 gene exp ession in-
c eased.
Figu e 4. Mac ophage pola iza ion ma ke gene exp ession, CCR7, M1 pola iza ion ma ke (A) and
MRC1, M2 pola iza ion ma ke (B). M0 mac ophages we e incuba ed wi h LPS + IFNγ (M1 con ol),
IL-4 (M2 con ol), o LPS + IFNγ + CPH (50 and 100 μg/mL o 24 h). Values a e p esen ed as means
± SD (n = 3). Di e en le e s deno e s a is ical di e ences (p < 0.05).
Non-pola ized mac ophages a e LPS and IFNγ ea men showed an inc ease in
TNFα, p o-in lamma o y cy okine, gene exp ession and elease (Figu e 5A), and elease
(Figu e 5B) and a dec ease in IL-10, an i-in lamma o y cy okine, gene exp ession (Figu e
5C), and elease (Figu e 5D). When ea ed wi h CPH, p o-in lamma o y cy okine gene
exp ession and elease dec eased, and an i-in lamma o y cy okine gene exp ession and
elease inc eased.
Figu e 5. TNFα, M1 mac ophage pola iza ion-associa ed cy okine, gene exp ession (A), and elease
(B) and IL-10, M2 mac ophage pola iza ion-associa ed cy okine, gene exp ession (C), and elease
Figu e 5.
TNF
α
, M1 mac ophage pola iza ion-associa ed cy okine, gene exp ession (
A
), and elease
(
B
) and IL-10, M2 mac ophage pola iza ion-associa ed cy okine, gene exp ession (
C
), and elease (
D
).
M0 mac ophages we e incuba ed wi h LPS + IFN
γ
(M1 con ol), IL-4 (M2 con ol), o LPS + INF
γ
+ CPH (50 and 100
µ
g/mL o 24 h). Values a e p esen ed as means
±
SD (n= 3). Di e en le e s
deno e s a is ical di e ences (p< 0.05).
4. Discussion
Al hough in ecen yea s chia seeds (Sal ia hispanica L.) ha e become inc easingly
impo an o he ood indus y due o hei high nu i ional con en and bene icial heal h