METHODS
published: 21 Sep embe 2018
doi: 10.3389/ ncel.2018.00313
E ec i e Knockdown o Gene
Exp ession in P ima y Mic oglia Wi h
siRNA and Magne ic Nanopa icles
Wi hou Cell Dea h o In lamma ion
Alejand o Ca illo-Jimenez1,2†,Ma Puigdellí ol3†,Anna Vilal a3,Jose Luis Vene o1,2,
Guy Cha les B own3,Pe e S Geo ge-Hyslop4and Miguel Angel Bu guillos4*‡
1Depa amen o de Bioquímica y Biología Molecula , Facul ad de Fa macia, Uni e sidad de Se illa, Se ille, Spain, 2Ins i u o de
Biomedicina de Se illa (IBiS), Hospi al Uni e si a io Vi gen del Rocío, CSIC, Uni e sidad de Se illa, Se ille, Spain,
3Depa men o Biochemis y, Uni e si y o Camb idge, Camb idge, Uni ed Kingdom, 4Depa men o Clinical Neu osciences,
Camb idge Ins i u e o Medical Resea ch, Uni e si y o Camb idge, Camb idge, Uni ed Kingdom
Edi ed by:
A hu Liesz,
Ludwig-Maximilians-Uni e si ä
München, Ge many
Re iewed by:
Jose L. Labandei a-Ga cia,
Uni e sidade de San iago de
Compos ela, Spain
Li Tian,
Uni e si y o Ta u, Es onia
*Co espondence:
Miguel Angel Bu guillos
[email p o ec ed]
†These au ho s ha e con ibu ed
equally o his wo k
‡P esen add ess:
Miguel Angel Bu guillos,
Depa men o Biochemis y,
Uni e si y o Camb idge, Camb idge,
Uni ed Kingdom
Recei ed: 30 May 2018
Accep ed: 29 Augus 2018
Published: 21 Sep embe 2018
Ci a ion:
Ca illo-Jimenez A, Puigdellí ol M,
Vilal a A, Vene o JL, B own GC,
S Geo ge-Hyslop P and
Bu guillos MA (2018) E ec i e
Knockdown o Gene Exp ession in
P ima y Mic oglia Wi h siRNA and
Magne ic Nanopa icles Wi hou Cell
Dea h o In lamma ion.
F on . Cell. Neu osci. 12:313.
doi: 10.3389/ ncel.2018.00313
Mic oglia, he esiden immune cells o he b ain, ha e mul iple unc ions in physiological
and pa hological condi ions, including Alzheime ’s disease (AD). The use o p ima y
mic oglial cell cul u es has p o ed o be a aluable ool o s udy mic oglial biology unde
a ious condi ions. Howe e , mo e ad anced ans ec ion me hodologies o p ima y
cul u ed mic oglia a e s ill needed, as cu en me hodologies p o ide low ans ec ion
e iciency and induce cell dea h and/o in lamma o y ac i a ion o he mic oglia. He e, we
desc ibe an easy, and e ec i e me hod based on he Glial-Mag me hod (OZ Biosciences)
using magne ic nanopa icles and a magne o success ully ans ec p ima y mic oglia
cells wi h di e en small in e e ing RNAs (siRNAs). This me hod does no equi e
specialis acili ies o speci ic aining and does no induce cell oxici y o in lamma o y
ac i a ion. We demons a e ha his p o ocol success ully dec eases he exp ession o
wo key genes associa ed wi h AD, he igge ing ecep o exp essed in myeloid cells 2
(TREM2) and CD33, in p ima y mic oglia cell cul u es.
Keywo ds: mic oglia, siRNA, ans ec ion, TREM2, CD33, CGC, Alzheime ’s disease
INTRODUCTION
Mic oglia a e he esiden issue mac ophages o he cen al ne ous sys em (CNS) whe e
hey su ey o insul s ha may a ec he homeos asis o he sys em (Ke enmann e al., 2011;
Boche e al., 2013). They play se e al oles unde physiological condi ions, including synap ic
p uning (Scha e e al., 2012; Um, 2017), bu a e also impo an du ing neu odegene a i e
diseases (Hi sch and Huno , 2009; Rayap olu e al., 2013; Nalls e al., 2014; Ul ich e al.,
2014; Sims e al., 2017; Kang e al., 2018b). In he case o Alzheime ’s disease (AD), ea ly
s udies in he 1990s showed he p esence o ac i a ed immune cells in he b ains o deceased
people a ec ed by AD (Eikelenboom e al., 1994), which sugges ed he hypo hesis ha he
neu oin lamma o y esponse plays a de imen al ole du ing he disease p og ession. This
hypo hesis has been suppo ed by many o he epo s, including some ecen genome-wide
associa ion s udies (GWAS) showing ha se e al polymo phisms in inna e immune genes
a e isk ac o s o de elop AD (Rayap olu e al., 2013; Mha e e al., 2015; Sims e al., 2017).
F on ie s in Cellula Neu oscience | www. on ie sin.o g 1Sep embe 2018 | Volume 12 | A icle 313
Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
Mechanis ic s udies in mic oglia cells hea ily depends on
in i o app oaches using di e en mic oglia cells lines (e.g., BV2,
CHME3), induced plu ipo en s em cell (iPS) de i ed cells
o oden p ima y mic oglia cell cul u es. Cell lines a e
con enien because hey do no equi e isola ion and can be
expanded inde ini ely o p o ide high yields. Howe e , du ing
immo aliza ion and epea ed passaging, hey may ha e acqui ed
di e en ea u es ha a e no p esen unde physiological
condi ions in p ima y mic oglia cells (Bu o sky e al., 2014).
Wo king wi h iPS cells is also a e y aluable ool due o hei
capabili ies o be ans o med in o di e en cell ypes, including
mic oglia cells. On he o he hand, he p ocess o expansion
and ans o ma ion o iPS cells in o mic oglia cells is a labo ious
and complica ed p ocedu e, wi h se e al di e en p o ocols o
ollow in he li e a u e (Mu a e al., 2016; B ownjohn e al.,
2018).
Hence, wo king wi h p ima y mic oglia cell cul u es is
impo an . Howe e , wo king wi h p ima y mic oglia cell
cul u es p esen s challenges. One o he main limi a ions is
he low yield p oduced om each animal and hei limi ed
su i al ime pe iod in he absence o as ocy es. Also, p ima y
mic oglia cell cul u es a e di icul cells o ans ec , p o iding
low e iciency o ans ec ion and also a e qui e ulne able
o dea h when using adi ional me hods o ans ec ion. One
way o sol e his p oblem has been o gene a e di e en
ansgenic mouse lines, as in he case o igge ing ecep o
exp essed in myeloid cells 2 (TREM2; Tu nbull e al., 2006;
Cheng e al., 2018; Filipello e al., 2018). P ima y mic oglia
cells a e hen isola ed om hese mice. Howe e , his p ocess
is expensi e and akes se e al mon hs be o e you ob ained
he desi ed ansgenic line. An al e na i e o gene a ion o
ansgenic mice has been he use o ansduc ion sys ems o
o e exp ess o silence he exp ession o di e en p o ein a ge s.
In pa icula , he use o len i i al ec o s has p o en o be
e ec i e o his pu pose (Masuda e al., 2013). Howe e ,
he whole p ocess can be challenging and equi es he use
o speci ic ma e ial (like class II secu i y hoods) and special
aining o di e en ype o asks such as design o he
i us’ sequence, choosing he igh bac e ial s ain o a oid
genomic ea angemen s while ampli ying he i al ec o ,
s abili y o you i al s ock o eeze and haw cycles, e iciency
o ansduc ion depending on he concen a ion o you i us
( i us i e ing), o he usage o di e en eagen s ( o ins ance
polyb ene o ib onec in) o dec ease he epulsi e cha ges o
he i us wi h he cell memb anes o inc ease he ansduc ion
e iciency.
He e, we desc ibe a simple me hod o knockdown he
exp ession o di e en genes in p ima y mic oglia by using
small in e e ing RNA (siRNA) and he Magne o ec ionTM
p inciple pa en ed by OZ Biosciences as a me hod o ans ec ion.
The Magne o ec ionTM me hod allow us o associa e nucleic
acids (in his case siRNA), wi h speci ic magne ic nanopa icles
(made o i on oxide which is ully deg adable). The esul ing
molecula complexes a e hen concen a ed and anspo ed
in o cells h ough an app op ia e magne ic ield. The e o e,
he exploi a ion o a magne ic o ce exe ed upon he
siRNAs allows a e y apid concen a ion o he en i e
applied siRNA dose on cells, so ha 100% o he cells
ge in con ac wi h a signi ican ec o dose and p omo es
cellula up ake. The cellula up ake o he gene ic ma e ial
is accomplished by endocy osis and pinocy osis, wo na u al
biological p ocesses. Consequen ly, memb ane a chi ec u e and
s uc u e emain in ac in con as o o he physical ans ec ion
me hods ha damage, c ea e hole o elec oshock he cell
memb anes.
To illus a e he use o his me hod in p ima y mic oglia we
ha e knocked down he exp ession o TREM2 and CD33, wo
impo an genes whose mu a ions a e conside ed a isk ac o o
de elop AD (G iciuc e al., 2013; Colonna and Wang, 2016).
MATERIALS AND METHODS
Reagen s
LPS om Salmonella en e ica se o ype yphimu ium (Sigma,
ca alog numbe L6511) was used o his s udy. Isolec in GS-IB4
om G i onia simplici olia (Alexa Fluo 568 conjuga e)
was pu chased om The mo Fishe (ca alog numbe I21412).
Glial-Mag ki was pu chased om OZ Biosciences (ca alog
numbe KGL00250). The p o ocol used is based on he
manu ac u e ’s ecommenda ion, which we ha e op imized o a
24-well pla e o ma (Supplemen a y Figu e S1). The di e en
siRNAs (posi i e—siGLO— and nega i e con ols—non-
a ge ing— and siTREM2 and siCD33) we e pu chased om
Dha macon (Ho izon) and hei sequences and ca alogs numbe s
a e p o ided in Table 1. A comple e lis o p ime s (o de ed
h ough Sigma Ald ich) wi h hei sequences is p o ided in
Table 2.
Animals
Two o i e days-old wild- ype mice (C57BL/6 backg ound) and
a s (Wis a ) we e ob ained om Cha les Ri e Labo a o ies. All
expe imen s we e pe o med in acco dance wi h he UK Animals
(Scien i ic P ocedu es) Ac (1986) and we e app o ed by he
Camb idge Uni e si y local e hical commi ee.
TABLE 1 | Sequence and ca alog numbe s o he di e en small in e e ing RNAs
(siRNAs).
siRNA Ca alog numbe Sequence
siRNA non- a ge ing (1) D-001810-10 UGGUUUACAUGUCGACUAA
siRNA non- a ge ing (2) D-001810-10 UGGUUUACAUGUUGUGUGA
siRNA non- a ge ing (3) D-001810-10 UGGUUUACAUGUUUUCUGA
siRNA non- a ge ing (4) D-001810-10 UGGUUUACAUGUUUUCCUA
Mouse siCD33 (1) J-047562-09 CAAUAAGAGACCCGGGACA
Mouse siCD33 (2) J-047562-10 GCUCAAUGUUACCCGGAAA
Mouse siCD33 (3) J-047562-11 GGAGCUUGCUGUUUAGGCA
Mouse siCD33 (4) J-047562-12 GAGAACCUUUUGUGAGAUA
Mouse siTREM2 (1) J-040918-09 CGGAGGUACGUGAGAGAAU
Mouse siTREM2 (2) J-040918-10 GGUCAGAGGGCUGGACUGU
Mouse siTREM2 (3) J-040918-11 CCUGCGUUCUCCUGAGCAA
Mouse siTREM2 (4) J-040918-12 CUGAGUGGGAGGAGAACUA
Ra siTREM2 (1) J-082332-09 CAGAAUGGGAGCACGGUCA
Ra siTREM2 (2) J-082332-10 CGUCUGUACUUUGGACAUU
Ra siTREM2 (3) J-082332-11 UAUCCCGGGAGCAGGAAUA
Ra siTREM2 (4) J-082332-12 CCGAGGAGUCAGAGAGUUU
F on ie s in Cellula Neu oscience | www. on ie sin.o g 2Sep embe 2018 | Volume 12 | A icle 313
Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
TABLE 2 | Sequence o p ime s.
Name o Fo wa d Re e se
gene sequence (50→30) sequence (50→30)
Ac b (mouse) CCACACCCGCCACCAGTTCG CCCATTCCCACCATCACACC
Ac b ( a ) AAGACCTCTATGCCAACAC TGATCTTCATGGTGCTAGG
Cd33 (mouse) ATGAGAGAGCTGGTCCTGGT CCCATGTGCACTGACAGCTT
Il1-β(mouse) GTGCTGTCGGACCCATATGA AGGCCACAGGTATTTTGTCGT
Nos2 (mouse) CTGGGGCAGTGGAGAGATTT TTGTCTCTGGGTCCTCTGGT
Tn α(mouse) GGTGCCTATGTCTCAGCCTC ACTGATGAGAGGGAGGCCAT
T em2 (mouse) TCATCTCTTTTCTGCACTTC TCATAAGTACATGACACCCTC
T em2 ( a ) AAACAAGATCTGACACAAGG CGTCATAAGTACATGACACC
Gene a ion o P ima y Mic oglia Cul u es
F om Pos na al Mouse and Ra s
P ima y mic oglia cul u es we e p epa ed om mice and a
pups a pos na al day P1–5 which we e sac i iced by decapi a ion.
B ains we e emo ed in ice-cold Ca2+- and Mg2+- ee Hanks
Bu e ed Sal Solu ion (HBSS, In i ogen) con aining 10 µg/ml
gen amicin (Sigma). Co ical hemisphe es we e dissec ed and
meninges, blood essels as well as whi e ma e we e emo ed.
Tissue was cu in o small pieces and ans e ed o p e-wa med
HBSS con aining 0.17% ypsin (37◦C), chopped ho oughly and
incuba ed o 15–20 min a 37◦C. Supe na an was emo ed and
he emaining ypsin was neu alized by addi ion o Dulbecco’s
Modi ied Eagle’s Medium (DMEM, In i ogen) supplemen ed
wi h 10% o al bo ine se um (FBS) and gen amicin (10 µg/ml)
in mice. In he case o a s, we added also 1–2 mg o
Deoxy ibonuclease om bo ine panc eas (Sigma) in 25 ml o
DMEM supplemen ed wi h 10% FBS and gen amicin (10 µg/ml).
Tissue was mechanically dissocia ed by epea ed i u a ion
h ough a 10 ml and 5 ml s e ile se ological pipe es and inally
h ough a 1 ml pipe e ip (pipe ed up and down 20 imes
wi h each one o he se ological pipe es), lea ing he suspension
undis u bed o 1 min be o e collec ing he supe na an . The
supe na an was cen i uged a 150 g o 7 min a oom
empe a u e. We disca ded he supe na an and esuspended
he pelle in esh media. The cell suspension was hen il e ed
using i s a 100 µm cell s aine and hen a 40 µm cell s aine
(BD Biosciences, San Jose, CA, USA). Bo h cell s aine s we e
p e iously mois ened wi h 2 ml o comple e media o acili a e
he il e ing p ocess. The cell suspension was cen i uged a 150 g
o 7 min a oom- empe a u e (RT). Supe na an was disca ded,
and he cell pelle was esuspended in DMEM supplemen ed wi h
10% FBS and 10 µg/ml gen amicin (Sigma) and seeded on o
T75 lask (Nunc) coa ed wi h 0.0005% poly-L-lysine (Sigma) in
PBS a a a io o 3–4 pups (mouse) o 1 pup ( a ) pe T75 cell
cul u e lask. A e 24 h, he T75 lask was ca e ully apped o
dislodge sedimen a y cell deb is, and medium was exchanged
(20 ml/ lask). Cul u es we e main ained a 37◦C in a humidi ied
a mosphe e o 5% CO2and allowed o ma u e in i o o
7–14 days be o e ans ec ion. Mic oglial cells we e ha es ed
om con luen as ocy e monolaye s, 14 days a e he ini ial
seeding, by a combina ion o apping he side o he cul u e lask
and gen ly o exed o ∼1-min supe na an con aining de ached
mic oglial cells was collec ed and cen i uged a 150 g o 7 min
a oom empe a u e. These mic oglial cells ound we e pla ed
in o 24-well pla es in condi ioned media o a a io 1:3 (media
om lask: esh media), coa ed wi h 0.0005% poly-L-lysine, a
a densi y o 200,000 cells in 400 µl pe well. Expe imen s we e
pe o med 48 h a e he inal pla ing.
P ima y Ce ebella G anule Cells (CGCs)
Cul u es F om Mouse and Ra Pups
P ima y mixed neu onal/glial cul u es we e p epa ed om
ce ebella o pos na al day 3–5 mice o a pups as p e iously
desc ibed (Kinsne e al., 2005). B ie ly, pups we e killed by
decapi a ion and b ains we e quickly emo ed and placed in
ice-cold HBSS con aining 10 µg/ml gen amicin (Sigma). Then,
he ce ebella we e sepa a ed om he b ains em, and meninges
we e emo ed. The issue was ans e ed in o p e-wa med
Ve sene solu ion (37◦C, In i ogen), cu in o small pieces
and incuba ed o 5 min a 37◦C, 5% CO2. Tissue was hen
mechanically dissocia ed using a s e ile plas ic pas eu pipe es,
and hen, wi h P1000 ips o dec easing ape u e size. A e
each dissocia ion s ep, dissocia ed cells p esen in he Ve sene
solu ion we e added in p e-wa med DMEM supplemen ed wi h
5% ho se se um, 5% FBS, 5 mM 4-(2-Hyd oxye hyl) pipe azine-
1-e hanesul onic acid (HEPES), 20 mM KCl, 2 mM L-glu amine,
13 mM glucose and 10 µg/ml gen amicin (all Sigma). Dissocia ed
cells esuspended in supplemen ed DMEM we e cen i uged a
150 g o 7 min a RT. The cell-suspension was passed h ough
a 40 µm cell-s aine (BD Biosciences, San Jose, CA, USA) and
cells we e seeded on 0.001% poly-L-lysine-coa ed (Sigma) glass
co e slips on o 24-well pla es (Nunc) a a densi y o 2.5 ×105
cells/cm2. The cul u e medium (500 µl/well) was exchanged a e
24 h and cul u es allowed o ma u e in i o o 7–10 days be o e
ans ec ion.
T ans ec ion o siRNA in Mu ine P ima y
Mic oglia Using he OZ Bioscience
Magne ic Pla e Technology
We ollowed he manu ac u e ’s ecommenda ions wi h a ew
modi ica ions (Supplemen a y Figu e S1). The amoun s used
he e e e o a 24-well pla e o ma . In one mic ocen i uge ube
we added 0.6 µl o siRNA (s ock concen a ion is 20 µM) and
we mixed by o exing wi h 100 µl o DMEM wi hou se um o
an ibio ics. The con en s o his ube we e added o a new ube
wi h 0.4 µl o Glial-Mag whe e he con en s we e mixed gen ly
by pipe ing up and down 4–5 imes. The mix was incuba ed a
oom empe a u e o 20 min. Du ing his incuba ion pe iod, we
emo ed 100 µl o media pe well om he pla es whe e p ima y
cells we e seeded using he p e iously desc ibed comple e media
o assu e a inal olume o 400 µl o media pe well. The con en
o he mic ocen i uge ube was hen added d op by d op o
each well oge he wi h 5 µl o Glial boos 100×, he second
componen in he Glial-Mag ki . We placed he cul u e pla e
inside o he cell incuba o on op he magne ic pla e p o ided
by he manu ac u e o 30 min. A e wa ds, we emo ed he
magne ic pla e and le he cells in he incuba o o 3 h a 37◦C.
We hen exchanged he media o condi ioned media sa ed om
mic oglia co-cul u ed wi h as ocy es ( a io 1:3 esh media:
old media; in he case o pu e mic oglial cul u es) o comple e
F on ie s in Cellula Neu oscience | www. on ie sin.o g 3Sep embe 2018 | Volume 12 | A icle 313
Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
media as desc ibed abo e (in he case o ce ebella g anule cell
(CGC) cul u es) and wai ed o 48 h be o e we pe o med he
expe imen s. A desc ip ion o he di e en s eps o ans ec ion
a e included in Supplemen a y Figu e S1. The di e en siRNAs
used o his s udy we e siGLO G een (posi i e con ol o
deli e y #D-001630-01) ON-TARGETplus Non- a ge ing
Pool (#D-001810-10), ON-TARGETplus Mouse Cd33 siRNA
(#L-047462-01), ON-TARGETplus Mouse T em2 siRNA
(#L-040918-01) and ON-TARGETplus Ra T em2 siRNA
(#L-082332-02). The sequences o he di e en siRNAs a e
p o ided in Table 1.
Quan i ica ion o Cell Numbe s in CGCs
and Pu e Mic oglia Cul u es and Analysis
o he Pe cen age o Cells T ans ec ed
Wi h siGLO
Following he same p o ocol o ans ec ion as wi h p ima y
co ical mic oglia cells, 3 h and 30 min a e ans ec ion
CGC cul u es we e washed once in PBS and ixed wi h 4%
pa a o maldehyde (PFA, in PBS, pH 7.4), and washed h ee
mo e imes wi h PBS. Then, ixed cul u es we e s ained wi h
he nuclea dye Hoechs 33342 (5 µg/mL) and 568- agged
isolec in-B4 (1 µg/mL) was used o iden i y mic oglia. Heal hy
and apop o ic (ch oma in-condensed) neu ons we e ecognized
by hei dis inc nuclea mo phology, whe eas bigge and mo e
di use nuclei s ained by Hoechs 33342 we e sco ed as as ocy es.
siGLO was used o assess he % o cells ha we e ans ec ed.
The % o siGLO posi i e cells was measu ed as 100×(numbe
o mic oglia o as ocy es o neu ons ha con ain siGLO/ o al
numbe o mic oglia o as ocy es o neu ons).
Simila ly, bo h CGC cul u es and pu e mic oglia cul u es
we e kep inside he incuba o 48 h a e ans ec ion. Then,
cells we e s ained wi h Hoechs 33342, and 568- agged isolec in-
B4, as p e iously indica ed. In all he expe imen s, ou
mic oscopic ields/well (be ween 150 and 250 neu ones pe ield)
in 1–2 wells/condi ion we e quan i ied o a single expe imen .
To al cell densi ies and % o siGLO posi i e cells we e e alua ed
using a Leica DMI6000 CS mic oscope and cell densi ies we e
quan i ied using he cell coun e plugin on ImageJ so wa e.
RT-qPCR Analysis
To al RNA was ex ac ed using he QIAzol Reagen (QIAGEN)
ollowing he manu ac u e ’s ins uc ions. Using he Re e Aid
Fi s S and cDNA Syn hesis Ki (The mo Scien i ic, UK), 1 µg
o he o al RNA was ans o med in o cDNA. RT-qPCR was
pe o med using he MESA BLUE SYBR Assay (Eu ogen ec,
UK). Resul s we e calcula ed using del a C me hod and
ep esen ed as absolu e alues wi h a bi a y uni s. β-ac in
was used as he housekeeping gene. The p ime sequences a e
p o ided in Table 2.
P epa a ion o Labeled Neu onal Deb is
To gene a e s ained neu onal deb is, mouse and a CGCs
o igina ed om P3 o P5 we e used (which a e 90% neu ons).
Cells we e washed wice wi h PBS and a e he second
wash, 100 µl o PBS was le in he well (24-well pla e
o ma ) in o which he cells we e sc aped. Then he cells we e
passed 5–10 imes h ough a 27G sy inge needle. A e ha ,
we incuba ed he neu onal deb is wi h e ame hyl hodamine
(TAMRA; 50 µM) o 20 min a oom empe a u e wi h agi a ion
and p o ec ion om ligh . Excess o TAMRA was emo ed using
a 5 kDa spin column (spin columns we e p e iously le in he
hood o 15 min unde UV ligh ). Columns we e washed wice
wi h PBS (200 µl) a 8,050 g o 10 min be o e s ained deb is
(200 µl) wi h 200 µl o PBS we e added and cen i uged a 8,050
g o 10 min wice. A e each cen i uga ion, PBS con aining
ee TAMRA was disca ded and eplaced wi h 200 µl o esh
PBS. A e he second wash s ained deb is om he column
was collec ed and p o ein concen a ion was measu ed using
Pie ceTM BCA p o ein assay ki (The moFishe Scien i ic).
Analysis o Phagocy osis by Flow
Cy ome y
Mic oglial phagocy ic ac i i y was assessed by e alua ing he
up ake a e o TAMRA-s ained neu onal deb is as p e iously
shown (Ho nik e al., 2016) wi h sligh modi ica ions. B ie ly,
pu e mic oglia cul u es we e incuba ed wi h TAMRA-s ained
neu onal deb is (60 µg/ml) o 1 h inside he cell incuba o .
The cul u e media was hen emo ed and 100 µl o 1×
ypsin (0.1%) was added o each well and incuba ed o 5 min
in he incuba o . To s op he eac ion, 500 µl o cul u e
medium was added. Cells we e collec ed and ans e ed o a
mic ocen i uge ube and cen i uged o 5 min a 150 ga
oom empe a u e. The supe na an was emo ed, and cells we e
ixed wi h 50 µl o 4% PFA (in PBS) o 15 min a oom
empe a u e using agi a ion. A e cen i uga ion a 150 g o
5 min a oom empe a u e, PFA was emo ed and cells we e
esuspended in 100 µl o cold PBS. Samples we e kep on
ice be o e he analysis by low cy ome y. The FL3 (exci a ion
640 nm, emission >670 nm; ed; TAMRA in neu onal deb is)
luo escence o he cells was measu ed using a BD Accu i
C6 low cy ome e (BD Biosciences, San Jose, CA, USA). Cells
no ea ed wi h TAMRA-s ained neu onal deb is we e used
o se he low cy ome y ga es. The a e age o he TAMRA-
posi i e luo escence in cells ea ed wi h non- a ge ing siRNA
was de e mined and compa ed o he luo escence o cells
ea ed wi h he TREM2 siRNA. Values we e no malized o
he luo escence o cells ea ed wi h non- a ge ing siRNA and
TAMRA-s ained neu onal deb is. Flow cy ome y analysis was
pe o med using BD Accu i C6 so wa e.
Quan i ica ion o IL-6 Release In o he
Media
Supe na an s o he di e en cell cul u e ea men s we e
collec ed and as eeze on d y ice and s o ed a −80◦C un il
u he use. We analyzed he con en o IL-6 in he media by
using he Mouse IL-6 ELISA MAXTM Deluxe Se s (Biolegend Ca .
No. 431304) ollowing manu ac u e ’s ins uc ions.
S a is ical Analysis
Da a no mali y and homogenei y o a iances we e analyzed
using he Shapi o-Wilk and he Le ene’s es s, espec i ely. All
F on ie s in Cellula Neu oscience | www. on ie sin.o g 4Sep embe 2018 | Volume 12 | A icle 313
Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
da a we e no mally dis ibu ed. Resul s we e es ed o s a is ical
signi icance using one-way ANOVA analysis o he a iance
wi h a Tukey’s mul iple compa isons pos hoc analysis using
he S a g aphics o G aphPad P ism so wa e. Fo hose esul s
ha do no show homogenei y o a iance, an unequal a iance
wo- ailed es , (Welch’s es ) was used. P<0.05 was
conside ed s a is ically signi ican . The numbe o independen
expe imen s and s a is ical es used is desc ibed in he ele an
igu e legends. Each independen expe imen ep esen s a
sepa a e mouse o a li e .
RESULTS
Deli e y o siRNA and E icacy o
Knockdown in P ima y Mic oglia Cells
Ou i s expe imen was o assess he amoun o Glial-Mag
necessa y o ob ain a sa is ac o y deli e y a e o a luo escen ly-
labeled RNA oligonucleo ide (siGLO G een 6-FAM, hence o h
e e ed as siGLO) in o he p ima y mic oglial cells. Fo ha
eason, in a 24-well pla e o ma we added di e en olumes o
Glial-Mag oge he wi h a ixed dose o siGLO (same dose as
used wi h siRNA TREM2 o siCD33) o he p ima y mic oglial
cells. Th ee hou s and 30 min a e ea men wi h siGLO, cells
we e collec ed o analyze he deg ee o deli e y o siGLO by
low cy ome y (Figu es 1A,B). We obse ed a simila deg ee o
deli e y a all doses es ed ( olume pe well o Glial-Mag added:
0.4 µl/500 µl, 0.6 µl/500 µl, 0.7 µl/500 µl and 0.8 µl/500 µl),
esul ing in 83%–93% o he mic oglia con aining siGLO a his
ime poin (Figu es 1A,B). Subsequen ly, all he expe imen s
we e conduc ed wi h he lowes dose o Glial-Mag (0.4 µl/500 µl
pe well).
We hen used speci ic siRNAs agains ei he TREM2 o
CD33, combined wi h he magne ic nanopa icles o he
Glial-Mag medium, and incuba ed wi h he mic oglia on
op o a magne o enable pene a ion o he siRNAs,
as desc ibed in he ‘‘Ma e ials and Me hods’’ sec ion and
Supplemen a y Figu e S1. We hen analyzed he e icacy o
knockdown by siTREM2 and siCD33 a he mRNA le el
measu ed by RT-qPCR in mouse p ima y co ical mic oglia.
In bo h cases, we obse ed ha he mRNA le el was
dec eased by abou 60%, 48 h a e siRNA ans ec ion
(Figu es 1C,D).
E ec o P o ocol on Mic oglial Su i al
and In lamma o y Response
An e ec i e ans ec ion p o ocol o p ima y mic oglia cells
should aim o minimize he impac o e he su i al o he
cells in he cul u e h ough s ess, and nei he should induce
pe se an in lamma o y esponse o p ime i . We wan ed o
know i ou me hod o ans ec ion mee s hese c i e ia. A e
7–10 days in cul u e, p ima y cul u es we e ans ec ed in he
absence o p esence o siRNA non- a ge ing (siNT) and we
es ed he e ec o ans ec ion o e su i al in p ima y co ical
mic oglia cells (48 h pos - ans ec ion, Figu es 2A,B) and also
in neu onal/glia mixed cul u es ob ained om he ce ebellum
(3 h 30 min pos - ans ec ion Supplemen a y Figu es S2A,B
FIGURE 1 | Small in e e ing RNA (siRNA) deli e y and e iciency ans ec ion
analysis using he Glial-Mag echnology. (A,B) Assessmen o he deli e y o
siGLO eagen h ough low cy ome y ep esen ed by do plo s and his og am
in o mouse p ima y co ical mic oglia cells using inc easing amoun s o
Glial-Mag. Analysis o igge ing ecep o exp essed in myeloid cells 2
(TREM2; C) and CD33 (D) gene exp ession a e ans ec ion wi h speci ic
siRNA measu ed by oom- empe a u e (RT)-qPCR. Resul s a e p esen ed as
mean (B–D) ±SD (B,C). Da a a e om one (A,B) o i e (C) o h ee (D)
independen expe imen s. ∗∗P<0.01 and ∗∗∗ P<0.001. All analyses we e
pe o med using wo- ailed Welch’s - es .
and 48 h pos - ans ec ion, Figu es 2C,D). Fo his eason, we
analyzed mic oglial densi y o he p ima y co ical mic oglia
cells and also neu onal, mic oglia and as ocy e densi ies in
neu onal/glial mixed cul u es (Supplemen a y Figu es S2A–D)
o wild ype mouse and a . In p ima y co ical mic oglial
cul u es, we ound no nega i e e ec o e su i al in bo h species
48 h a e ans ec ion (Figu es 2A,B). In he neu onal/glial
mixed cul u es we ound no e ec o e he neu onal popula ion
(Figu e 2C) bu we could obse e a sligh change in he
densi y o mic oglia (inc ease in mouse and a dec ease in
a s compa ed o naï e mic oglia) 48 h a e ans ec ion
(Figu e 2D).
We also ans ec ed ou p ima y neu onal/glia mixed cul u es
wi h siGLO o 3 h and 30 mins in mouse and a (shown
he e as g een do s, Supplemen a y Figu es S2B–D) and we
obse ed ha i was e icien ly inco po a ed no only in he
cy oplasm o mic oglia cells (≈80% o o al p ima y mic oglia
we e siGLO posi i e, as indica ed by IB4 s aining), bu also in
as ocy es (≈40%–50% o o al p ima y as ocy es we e siGLO
posi i e, as indica ed by highe nuclei mo phology shown by
F on ie s in Cellula Neu oscience | www. on ie sin.o g 5Sep embe 2018 | Volume 12 | A icle 313

Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
FIGURE 2 | E ec o Glial-Mag echnology o e cell su i al and glia
p oli e a ion upon 48 h ans ec ion in p ima y co ical mic oglial and ce ebella
g anule cells (CGCs) p ima y cul u es in wild ype mouse and a s.
(A) Rep esen a i e images and inse s showing mic oglia (IB4, g een), PI (as a
nec o ic ma ke , ed) and nuclei (Hoechs , blue) s aining in co ical p ima y
cul u es om wild ype mouse and a ans ec ed wi h o wi hou siRNA
non- a ge ing (siNT). (B) Quan i a i e analysis showing mic oglial densi y in
mouse and a co ical p ima y cul u es ans ec ed wi h o wi hou siNT.
(C,D) Quan i a i e analysis showing neu onal (C) and mic oglia and as ocy e
densi y (D) in mouse and a CGC p ima y cul u es ans ec ed wi h o wi hou
siNT. (E) Analysis o IL-6 elease in o he media in naï e and 48 h ans ec ed
siNT ea ed cells ±LPS ea men (8 h; 10 ng/ml). Resul s a e p esen ed as
mean ±SEM (B–D) and ±SD (E). Quan i a i e analysis o cell numbe s in
(B–D) ep esen ou mic oscopic ields (mouse) o ou mic oscopic ields in
duplica e o iplica e ( a ) o each condi ion om h ee independen
expe imen s o bo h mouse and a . Da a a e om i e ( o naï e and siNT)
and o h ee (naï e + LPS and siNT + LPS) independen expe imen s in (E).
All analyses we e pe o med using one-way ANOVA and Tukey’s mul iple
compa isons pos hoc es . n.s s ands o non-signi ican . ∗P<0.05 and
∗∗P<0.01 compa ed o naï e condi ion. Scale ba , 50 µm.
Hoechs s aining) and neu ons (only ≈20% o he o al neu ons
we e siGLO posi i e; Supplemen a y Figu es S2B–D). Al hough
some g een do s seemed o be loca ed a he ex acellula
space, he majo i y o siGLO s aining was loca ed inside he
di e en cell ypes, sugges ing ha mos o he siRNA used is
e icien ly aken up by he cells (Supplemen a y Figu es S2B,C).
T ans ec ion wi h siGLO nei he induced signi ican changes in
neu onal densi y no a ec ed he numbe o apop o ic neu ons
3 h and 30 min a e ans ec ion (Supplemen a y Figu e S2A).
The same was ue in e ms o a ec ing mic oglial densi y.
Howe e , a small dec ease in he as ocy ic popula ion was
obse ed. These da a indica e ha Glial-Mag me hod no only
e icien ly ans ec s co ical mic oglia cul u es bu can also be
FIGURE 3 | Analysis o he e ec o TREM2 knockdown o e he phagocy ic
and in lamma o y esponses and o e he exp ession o o he TREM amily
membe s. (A) Rep esen a i e do blo s compa ing he phagocy ic esponse
o e ame hyl hodamine (TAMRA)-labeled neu onal deb is (TAMRA-ND)
be ween siNT and siRNA TREM2 ea ed cells in mouse. (B) Quan i a i e
analysis o phagocy osis no malized o siNT TAMRA-ND ea ed cells in
mouse. (C) E ec o TREM2 knockdown o e Nos2, Il-1βand Tn -αgene
exp ession upon LPS ea men (8 h; 10 ng/ml) in mouse. (D) Analysis o
TREM2 knockdown on he exp ession o o he TREM amily membe s
(TREM2, TREM1, TREML1 and TREML2) in mouse. Resul s a e p esen ed as
mean ±SD. Da a a e om h ee (B,C) and i e (D) independen expe imen s.
All analyses we e pe o med using wo- ailed Welch’s es . n.s s ands o
non-signi ican . ∗P<0.05 and ∗∗∗P<0.001 and n.s s ands o
non-signi ican .
used o ans ec neu onal/glia mixed cul u es wi hou g ea ly
a ec ing he su i al o neu ons and glial cells.
To es whe he his ans ec ion p o ocol a ec s he
in lamma o y esponse o mic oglia, we quan i ied he le els
o IL-6, a p o-in lamma o y cy okine, in he media o he
ans ec ed mic oglial cells. No s a is ical di e ence was obse ed
in he elease o IL-6 in o he media be ween naï e (un ea ed)
and siNT- ea ed cells (Figu e 2E). Fu he mo e, he e was also
no di e ence in he IL-6 p oduc ion o naï e and siNT cells
subsequen ly exposed o LPS (10 ng/ml) o 8 h, indica ing ha
his ans ec ion me hod does no ei he inhibi o p ime he
in lamma o y esponse in hese cells.
Func ional Analysis o TREM2 Knockdown
Once we had es ablished ha ou sys em does no ha e an impac
o e he in lamma o y esponse, we nex assessed he e ec o
F on ie s in Cellula Neu oscience | www. on ie sin.o g 6Sep embe 2018 | Volume 12 | A icle 313
Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
TREM2 knockdown o e mic oglial unc ion. Many s udies ha e
ocused on he e ec ha mu a ions o loss o TREM2 ha e
on mic oglial unc ions such as phagocy osis and in lamma o y
esponse. Fo his eason, we measu ed he e ec o he siRNA
o TREM2 on mic oglial phagocy osis o neu onal deb is and
he in lamma o y esponse induced by LPS. T ans ec ion o he
mic oglia wi h siNT had li le e ec on phagocy osis o neu onal
deb is compa ed o non- ans ec ed cells (naï e) ea ed wi h
neu onal deb is (Supplemen a y Figu e S3A), consis en wi h
no e ec on in lamma o y ac i a ion (Figu e 2). In con as , we
ound ha knockdown o TREM2 caused a small bu s a is ically
signi ican inc ease in mic oglial phagocy osis o neu onal deb is
in mice (Figu es 3A,B) and in a s (Supplemen a y Figu es
3B–D) compa ed o siNT cells ea ed wi h neu onal deb is cells.
Rega ding he in lamma o y esponse, we ound ha knockdown
o TREM2 educed NOS2 exp ession o LPS-ac i a ed mic oglia
in mice, while TNF-αand IL-1βexp ession le els emained
unal e ed (Figu e 3C).
Some in i o s udies ha e shown ha he knock down
o TREM2 exp ession lead o an a i ac ual inc ease in he
exp ession o TREML1 (Kang e al., 2018a), which hinde s
he in e p e a ion o TREM2 knockdown e ec s. We assessed
whe he TREM2 knockdown in ou s udy was associa ed
wi h a de egula ion in he exp ession le els o o he TREM
amily membe s. We analyzed he exp ession o TREM1,
TREML1 and TREML2 by RT-qPCR. Ou esul s demons a ed
ha TREM2 knockdown using Glial-Mag me hod does no
induce a de egula ion on he le els o exp ession o o he
membe s o he TREM amily (Figu e 3D).
DISCUSSION
In his s udy, we p esen a simple me hod o success ully deli e
siRNA and knockdown o gene exp ession in p ima y mic oglia
based on binding o he siRNA o magne ic nanopa icles and
magne -induced pene a ion o he cells. This me hod does no
equi e speci ic aining o he use o specialized equipmen o
knocking down he exp ession o di e en a ge s. We obse e
wi h ou me hod a high deli e y a e (83%–93% o cells), e en
using a 3 h and 30 min incuba ion wi h he siGLO p obe.
Fu he mo e, we ound ha by using his me hod we can deli e
enough siRNA o induce a 60% knockdown o TREM2 and
CD33 in mice and 40% knockdown o TREM2 in a s 48 h
a e ans ec ion. An addi ional ad an age o his ans ec ion
me hod is he low oxici y and non-p iming e ec o e he
in lamma o y esponse in he cul u es. The lack o p iming e ec
will p o ide mo e us wo hy da a based only on he knockdown
o ou a ge gene and no due o an a i ac gene a ed by
he me hodology employed (as in he case discussed in Kang
e al., 2018a). Ou esul s demons a ed ha he educ ion in
TREM2 exp ession obse ed a e 48 h o ans ec ion does
no induce a de egula ion in he exp ession le els o o he
TREM- ela ed amily membe s. These da a co ela e wi h o he
in i o s udies in which he au ho s did no ind a de egula ion
o TREML1 in he o iginal TREM2 knock ou mice line
(Tu nbull e al., 2006) o TREM2 knock ou mice gene a ed by
CRISPR/Cas9 echnology (Kang e al., 2018a).
When using mixed neu onal-glial cul u es, we ound ha his
me hod does no dis inguish be ween mic oglia, neu ons and
as ocy es, as siGLO en e ed all cell ypes in hese cul u es. This
is a disad an age i aiming o a ge speci ically mic oglia, bu an
ad an age i wan ing o a ge all cells. Howe e , i is impo an o
highligh ha 80% o mic oglial cells inco po a ed siGLO, while
as ocy es and neu ons exhibi ed lowe a es o siGLO up ake.
In his a icle, we assessed he e ec o knocking down
TREM2 on di e en aspec s o mic oglial biology. The e is some
con o e sy in he li e a u e abou wha ole plays TREM2 in
he con ol o di e en aspec s o mic oglia biology, including
he con ol o he in lamma o y and phagocy ic esponses.
While se e al epo s suppo he idea ha TREM2 ac s as
an i-in lamma o y p o ein whose o al deple ion o mu a ion
( o ins ance R47H) p omo es a p oin lamma o y esponse and
educes he phagocy ic esponse, o he epo s demons a e
he opposi e (Li and Zhang, 2018). These s udies sugges ha
TREM2 has di ec and indi ec ac ions ha may be con adic o y.
We ound ha pa ial knockdown o TREM2 exp ession caused
a small (bu s a is ically signi ican ) inc ease in phagocy osis o
neu onal deb is in bo h mice and a s and a small dec ease
in LPS-induced NOS2 exp ession in mice. Ou esul s may
di e om o he epo s published by o he s because o he
le el o TREM2 deple ion in he sys em (pa ial a he han
o al). Ou esul s a e in conco dance wi h hose o mice
lacking one o he wo TREM2 alleles (Ul ich e al., 2014),
whe e he e was li le o no change in in lamma o y ma ke s,
bu a endency o educed NOS2 exp ession. No e ha AD
is associa ed wi h loss o unc ion mu a ions in only one
TREM2 gene, whe eas loss-o - unc ion in bo h TREM2 genes
esul s in a di e en disease: Nasu-Hakola disease. Thus, in
p inciple, pa ial knockdown o TREM2 may gi e a be e
idea o mic oglial pheno ype esul ing om he AD-associa ed
mu a ions in TREM2. Al hough TREM2 is known o media e
mic oglial phagocy osis o neu onal deb is (Kawabo i e al.,
2015), mic oglia ha e se e al o he phagocy ic ecep o s, and loss
o TREM2 is known o change he exp ession o a wide ange o
mic oglial genes ha migh in p inciple accoun o ou inding
o a small inc ease in mic oglial phagocy osis o neu onal deb is.
In conclusion, we conside ha his easy me hod will allow
many esea che s o del e deepe in o mic oglia mechanis ic
s udies o many aspec s o mic oglia biology using p ima y
mic oglia cell cul u es.
AUTHOR CONTRIBUTIONS
AC-J and MP pe o med all he expe imen s, excep o he wise
no ed. AC-J and MB pe o med he phagocy osis analysis. MP
pe o med and analyzed neu onal, mic oglial and as ocy ic
su i al in p ima y pu e mic oglial cul u es and CGCs.
AV con ibu ed o concei ing and se ing up he neu onal
deb is gene a ion p o ocol, deb is labeling, low cy ome y
p o ocol and helped o p epa e he p ima y mic oglia cell
cul u es. MB pe o med he RT-qPCR and helped p epa e
he p ima y pu e mic oglia cul u es. JV, GB and PS-H we e
in ol ed in he s udy design. MB, AC-J and MP analyzed and
in e p e ed he da a. MB w o e he i s d a o he manusc ip .
F on ie s in Cellula Neu oscience | www. on ie sin.o g 7Sep embe 2018 | Volume 12 | A icle 313
Ca illo-Jimenez e al. siRNA Magne o ec ion in P ima y Mic oglia
AC-J and MP con ibu ed on w i ing he manusc ip . All
au ho s discussed he esul s and commen ed on o edi ed he
manusc ip .
FUNDING
AC-J was suppo ed by a p e-doc o al ellowship om Spanish
Minis e io de Educación, Cul u a y Depo e. The esea ch was
suppo ed by g an s om Alzheime ’s Resea ch UK (ARUK)
Camb idge Ne wo k Pump P iming G an and he Inno a i e
Medicines Ini ia i e 2 Join Unde aking unde g an ag eemen
No 115976 (PHAGO conso ium).
SUPPLEMENTARY MATERIAL
The Supplemen a y Ma e ial o his a icle can be ound
online a : h ps://www. on ie sin.o g/a icles/10.3389/ ncel.
2018.00313/ ull#supplemen a y-ma e ial
REFERENCES
Boche, D., Pe y, V. H., and Nicoll, J. A. (2013). Re iew: ac i a ion pa e ns
o mic oglia and hei iden i ica ion in he human b ain. Neu opa hol. Appl.
Neu obiol. 39, 3–18. doi: 10.1111/nan.12011
B ownjohn, P. W., Smi h, J., Solanki, R., Lohmann, E., Houlden, H., Ha dy, J.,
e al. (2018). Func ional s udies o missense TREM2 mu a ions in human s em
cell-de i ed mic oglia. S em Cell Repo s 10, 1294–1307. doi: 10.1016/j.s emc .
2018.03.003
Bu o sky, O., Jed ychowski, M. P., Moo e, C. S., Cialic, R., Lanse , A. J.,
Gab iely, G., e al. (2014). Iden i ica ion o a unique TGF-β-dependen
molecula and unc ional signa u e in mic oglia. Na . Neu osci. 17, 131–143.
doi: 10.3410/ .718201335.793497715
Cheng, Q., Danao, J., Tal eja, S., Wen, P., Yin, J., Sun, N., e al. (2018).
TREM2-ac i a ing an ibodies ab oga e he nega i e pleio opic e ec s o he
Alzheime ’s disease a ian TREM2R47H on mu ine myeloid cell unc ion.
J. Biol. Chem. 293, 12620–12633. doi: 10.1074/jbc.RA118.001848
Colonna, M., and Wang, Y. (2016). TREM2 a ian s: new keys o deciphe
Alzheime disease pa hogenesis. Na . Re . Neu osci. 17, 201–207.
doi: 10.1038/n n.2016.7
Eikelenboom, P., Zhan, S. S., an Gool, W. A., and Allsop, D. (1994). In lamma o y
mechanisms in Alzheime ’s disease. T ends Pha macol. Sci. 15, 447–450.
Filipello, F., Mo ini, R., Co adini, I., Ze bi, V., Canzi, A., Michalski, B., e al.
(2018). The mic oglial inna e immune ecep o TREM2 is equi ed o
synapse elimina ion and no mal b ain connec i i y. Immuni y 15, 979–991.
doi: 10.1016/j.immuni.2018.04.016
G iciuc, A., Se ano-Pozo, A., Pa ado, A. R., Lesinski, A. N., Asselin, C. N.,
Mullin, K., e al. (2013). Alzheime ’s disease isk gene CD33 inhibi s mic oglial
up ake o amyloid be a. Neu on 78, 631–643. doi: 10.3410/ .718003795.
793480355
Hi sch, E. C., and Huno , S. (2009). Neu oin lamma ion in Pa kinson’s disease:
a a ge o neu op o ec ion? Lance Neu ol. 8, 382–397. doi: 10.1016/s1474-
4422(09)70062-6
Ho nik, T. C., Vilal a, A., and B own, G. C. (2016). Ac i a ed mic oglia cause
e e sible apop osis o pheoch omocy oma cells, inducing hei cell dea h by
phagocy osis. J. Cell Sci. 129, 65–79. doi: 10.1242/jcs.174631
Kang, S. S., Ku i, A., Bake , K. E., Liu, C. C., Colonna, M., Ul ich, J. D.,
e al. (2018a). Beha io al and ansc ip omic analysis o T em2-null mice:
no all knockou mice a e c ea ed equal. Hum. Mol. Gene . 27, 211–223.
doi: 10.1093/hmg/ddx366
Kang, Y., Mozley, P. D., Ve ma, A., Schlye , D., Henchcli e, C., Gau hie , S. A.,
e al. (2018b). Nonin asi e PK11195-PET image analysis echniques can de ec
abno mal ce eb al mic oglial ac i a ion in Pa kinson’s disease. J. Neu oimaging
doi: 10.1111/jon.12519 [Epub ahead o p in ].
Kawabo i, M., Kacimi, R., Kauppinen, T., Calosing, C., Kim, J. Y., Hsieh, C. L., e al.
(2015). T igge ing ecep o exp essed on myeloid cells 2 (TREM2) de iciency
a enua es phagocy ic ac i i ies o mic oglia and exace ba es ischemic damage
in expe imen al s oke. J. Neu osci. 35, 3384–3396. doi: 10.1523/jneu osci.2620-
14.2015
Ke enmann, H., Hanisch, U. K., Noda, M., and Ve kh a sky, A. (2011).
Physiology o mic oglia. Physiol. Re . 91, 461–553. doi: 10.1152/phys e .000
11.2010
Kinsne , A., Pilo o, V., Deininge , S., B own, G. C., Coecke, S., Ha ung, T., e al.
(2005). In lamma o y neu odegene a ion induced by lipo eichoic acid om
S aphylococcus au eus is media ed by glia ac i a ion, ni osa i e and oxida i e
s ess and caspase ac i a ion. J. Neu ochem. 95, 1132–1143. doi: 10.1111/j.1471-
4159.2005.03422.x
Li, J. T., and Zhang, Y. (2018). TREM2 egula es inna e immuni y in Alzheime ’s
disease. J. Neu oin lamma ion 15, 107. doi: 10.1186/s12974-018-1148-y
Masuda, T., Tsuda, M., Tozaki-Sai oh, H., and Inoue, K. (2013). Len i i al
ansduc ion o cul u ed mic oglia. Me hods Mol. Biol. 1041, 63–67.
doi: 10.1007/978-1-62703-520-0_8
Mha e, S. D., Tsai, C. A., Rubin, A. J., James, M. L., and And easson, K. I.
(2015). Mic oglial mal unc ion: he hi d ail in he de elopmen o Alzheime ’s
disease. T ends Neu osci. 38, 621–636. doi: 10.1016/j. ins.2015.08.006
Mu a , J., Li, Y., Yuan, B., Mi alipo a, M., Ome , A., Co co an, S., e al. (2016).
E icien de i a ion o mic oglia-like cells om human plu ipo en s em cells.
Na . Med. 22, 1358–1367. doi: 10.1038/nm.4189
Nalls, M. A., Pank a z, N., Lill, C. M., Do, C. B., He nandez, D. G., Saad, M., e al.
(2014). La ge-scale me a-analysis o genome-wide associa ion da a iden i ies
six new isk loci o Pa kinson’s disease. Na . Gene . 46, 989–993. doi: 10.1038/
ng.3043
Rayap olu, S., Mullen, B., Bake , M., Lynch, T., Finge , E., Seeley, W. W.,
e al. (2013). TREM2 in neu odegene a ion: e idence o associa ion o he
p.R47H a ian wi h on o empo al demen ia and Pa kinson’s disease. Mol.
Neu odegene 8:19. doi: 10.1186/1750-1326-8-19
Scha e , D. P., Leh man, E. K., Kau zman, A. G., Koyama, R., Ma dinly, A. R.,
Yamasaki, R., e al. (2012). Mic oglia sculp pos na al neu al ci cui s
in an ac i i y and complemen -dependen manne . Neu on 74, 691–705.
doi: 10.1016/j.neu on.2012.03.026
Sims, R., an de Lee, S. J., Naj, A. C., Bellenguez, C., Bada ina ayan, N.,
Jakobsdo i , J., e al. (2017). Ra e coding a ian s in PLCG2, ABI3 and
TREM2 implica e mic oglial-media ed inna e immuni y in Alzheime ’s
disease. Na . Gene . 49, 1373–1384. doi: 10.1038/ng.3916
Tu nbull, I. R., Gil illan, S., Cella, M., Aoshi, T., Mille , M., Piccio, L., e al. (2006).
Cu ing edge: TREM-2 a enua es mac ophage ac i a ion. J. Immunol. 177,
3520–3524. doi: 10.4049/jimmunol.177.6.3520
Ul ich, J. D., Finn, M. B., Wang, Y., Shen, A., Mahan, T. E., Jiang, H., e al. (2014).
Al e ed mic oglial esponse o Abe a plaques in APPP S1–21 mice he e ozygous
o TREM2. Mol. Neu odegene . 9:20. doi: 10.1186/1750-1326-9-20
Um, J. W. (2017). Roles o glial cells in sculp ing inhibi o y synapses and neu al
ci cui s. F on . Mol. Neu osci. 10:381. doi: 10.3389/ nmol.2017.00381
Con lic o In e es S a emen : The au ho s decla e ha he esea ch was
conduc ed in he absence o any comme cial o inancial ela ionships ha could
be cons ued as a po en ial con lic o in e es .
Copy igh © 2018 Ca illo-Jimenez, Puigdellí ol, Vilal a, Vene o, B own, S Geo ge-
Hyslop and Bu guillos. This is an open-access a icle dis ibu ed unde he e ms
o he C ea i e Commons A ibu ion License (CC BY). The use, dis ibu ion o
ep oduc ion in o he o ums is pe mi ed, p o ided he o iginal au ho (s) and he
copy igh owne (s) a e c edi ed and ha he o iginal publica ion in his jou nal
is ci ed, in acco dance wi h accep ed academic p ac ice. No use, dis ibu ion o
ep oduc ion is pe mi ed which does no comply wi h hese e ms.
F on ie s in Cellula Neu oscience | www. on ie sin.o g 8Sep embe 2018 | Volume 12 | A icle 313