1
E ec o die a y a y acids on calci ied ao ic oo o mice wi h
me abolic synd ome
Ma ia C Na anjo
a
, Bea iz Be mudez
b
, Inda a Ga cia
a
, Se gio Lopez
a
, Rocio
Abia
a
, F ancisco JG Mu iana
a
, Se gio Mon se a -de la Paz
a,
*
a
Labo a o y o Cellula and Molecula Nu i ion, Ins i u o de la G asa, CSIC.
C a. de U e a Km. 1, 41013 Se ille, Spain
b
Depa men o Cell Biology, Facul y o Biology, Uni e si y o Se ille. C/
P o eso Ga cia Gonzalez s/n, 41012 Se ille, Spain
*Co esponding Au ho :
Se gio Mon se a -de la Paz
Labo a o y o Cellula and Molecula Nu i ion, Ins i u o de la G asa, CSIC.
C a. de U e a Km. 1, Campus Uni e si a io Pablo de Ola ide, Edi icio 46,
41013 Se ille (Spain)
Tel: +34 954 611 550 (Ex . 360)
E-mail: [email protected]
Running i le: Fa y acids on ao ic calci ica ion in Me S
Page 2 o 22Food & Func ion
This is he pee e iewed e sion o he ollowing a icle: Die a y a y acids on ao ic
oo calci ica ion in mice wi h me abolic synd ome. Food Func ., 2017, 8, 1468-1474
DOI: 10.1039/C7FO00143F
2
ABSTRACT
Me abolic synd ome (Me S) is associa ed wi h obesi y, dyslipidemia, ype 2
diabe es, and ch onic low-g ade in lamma ion. The aim o his s udy was o
de e mine he ole o high- a low-choles e ol die s (HFLCDs) ich in SFAs
(HFLCD-SFAs), MUFAs (HFLCD-MUFAs) o MUFAs plus omega-3 long-
chain PUFAs (HFLCD-PUFAs) on ascula calci ica ion by he modula ion o
RANKL/RANK/OPG sys em in ao ic oo s om Lep
ob/ob
LDLR
−/−
mice. Animals
ed wi h HFLCD-SFAs had inc eased weigh and a g ea e a he oma plaque
size, calci ica ion, and RANKL/CATHK exp ession in ao ic oo han mice on
MUFA-en iched die s, he la e s inc easing OPG exp ession in ao ic oo s.
Ou s udy demons a es ha compa ed o die a y SFAs, MUFAs om oli e oil
p o ec agains a he oscle osis by in e e ing on ascula calci ica ion ia he
RANKL/RANK/OPG sys em in he se ing o Me S. These indings open
oppo uni ies o de eloping no el nu i ional s a egies wi h oli e oil as he
mos impo an die a y sou ce o MUFAs (no ably oleic acid) o p e en
ca dio ascula complica ions in he Me S.
Keywo ds: oli e oil, RANKL, os eop o ege in, me abolic synd ome, ascula
calci ica ion, a he oscle osis.
Page 3 o 22 Food & Func ion
3
INTRODUCTION
Dyslipidemia, insulin esis ance, and obesi y, he de ining
componen s o he me abolic synd ome (Me S), a e well-known isk ac o s
implica ed in he ae iology and pa hogenesis o ce ain ca dio ascula
diseases (CVDs) such as a he oscle osis, he main cause o CVD dea h in
de eloped and some de eloping coun ies.
1
Recen ly, inc easing in e es has
ocused on unde s anding how a he oscle o ic pa hology is ela ed o a
common plaque cons i uen : calcium mine al deposi s. Impo an s udies in
he las decade ha e now spawned a model whe ein calci ica ion in
a he oscle o ic plaque is iewed as an ac i e, complex, and p esumably
egula ed p ocess ha exhibi s in iguing simila i ies o bone emodelling.
2
A he oscle o ic calci ica ion appea s o esul om induc ion o os eogenic
di e en ia ion in subpopula ions o ascula cells by in lamma o y ac o s such
as ecep o ac i a o o nuclea ac o -κB (RANK) ligand (RANKL) and
ca hepsin K (CATHK).
3
In con as , os eop o ege in (OPG) is a glycop o ein
membe o he TNF ecep o supe amily ha unc ions as a soluble decoy
subs a e o RANK and compe es wi h RANKL, inhibi ing RANK-RANKL
in e ac ions o os eoclas p oli e a ion and di e en ia ion, and bone
deg ada ion.
4
In e es ingly, i has been epo ed ha OPG-de icien mice
de elop bo h os eopo osis and a e ial calci ica ion
5
and ha adminis a ion o
soluble OPG o ansgenic OPG o e exp ession may e ain he de elopmen
o a he oscle osis.
6
P e ious s udies ca ied ou by ou g oup ha e epo ed ha he
ype o die a y a in he meals may ha e a g ea e impac on os eoclas
induc ion and ma u a ion ia RANKL/RANK/OPG sys em.
7
Die a y sa u a ed
Page 4 o 22Food & Func ion
4
a y acids (SFAs) as compa ed o monounsa u a ed a y acids (MUFAs) and
omega-3 long-chain polyunsa u a ed a y acids (PUFAs) ha e been ound o
be he mos po en induce o in i o os eoclas ogenesis. Howe e , i is
unknown whe he a die a y a ich in MUFAs wi hou (oli e oil) o wi h omega-
3 long chain PUFAs (oli e oil + EPA and DHA) compa ed o a die a y a ich
in SFAs (cow´s milk c eam) may ha e bene i s in a he oscle osis and ascula
calci ica ion by he modula ion o he RANKL/RANK/OPG sys em. Taken
oge he , he global aim o his pape is o assess he in luence o die s
en iched in SFAs, MUFAs o MUFAs + omega-3 long-chain PUFAs on
calci ied ao ic oo s om mice wi h Me S (Lep
ob/ob
LDLR
−/−
).
MATERIALS AND METHODS
Fa y acid composi ion o die a y a s
The a y acid composi ion o die a y a s [cow's milk c eam, ich
in SFAs; e ined oli e oil, ich in MUFAs; and e ined oli e oil plus
eicosapen aenoic acid (EPA) and docosahexaenoic acid (DHA), ich in
MUFAs and omega-3 long-chain PUFAs] was de e mined by he me hod
desc ibed in EEC/796/2002,
8
using a gas ch oma og aphy sys em (HP-5890,
Hewle -Packa d, Palo-Al o, USA) equipped wi h lame ioniza ion de ec o and
a SP-2380 capilla y column (Supelco, Belle on e, USA, 30 m x 0.32 mm)
packed wi h cyanop opyl siloxane (0.25 µm). The ini ial column empe a u e
was 165 ºC, which was held o 10 min, hen p og ammed om 165 ºC o 200
ºC a 1.5 ºC/min. Injec o and de ec o empe a u e we e 250 ºC, wi h he
ca ie gas H
2
. The a y acid composi ion o di e en die a y a s is de ailed in
Table 1.
Page 5 o 22 Food & Func ion
5
Animal die s and expe imen al design
Male Lep
ob/ob
LDLR
−/−
mice b ed on o a C57BL/6J backg ound
(B6.Cg-Lepob Ldl m1He /J, The Jackson Labo a o y, Ba Ha bo , ME, USA)
was used o he s udy. These mice a e obese and de elop plasma lipid
al e a ions ha closely e lec Me S- ela ed hype lipidaemia.
9
All die s we e
p epa ed by Panlab Labo a oi es (SAFE, Augy, F ance) and p esen ed as
pelle s o he animals. Mice ecei ed one o he ollowing die s o 8 weeks: a
s anda d no mal- a die (low- a low-choles e ol die , LFLCD) con aining 3%
ene gy as a , used as con ol, o high- a low-choles e ol die s (HFLCDs),
which con ained 24% ene gy as a . All he die s we e based on he s anda d
oden die A04-10, con aining 0.01% choles e ol, 20 mg/kg BHT, and 3%
binde . Th ee di e en HFLCDs we e p epa ed by eplacing he a sou ce
om A04-10 die by cow's milk c eam (21% ene gy) (HFLCD-SFAs), e ined
oli e oil (21% ene gy) (HFLCD-MUFAs) o e ined oli e oil (20% ene gy) plus
EPA+DHA in he o m o e hyl es e s (1% ene gy) (HFLCD-PUFAs). The
cow’s milk c eam p o ided an addi ional amoun o 0.006% choles e ol by
weigh . All he die s con ained equal p opo ion o p o ein (19.5% ene gy) and
ca bohyd a e was used o adjus he o al ene gy con en .
A e weaning, mice we e andomly alloca ed in o 4 g oups (n =
10 pe g oup) as ollows: (1) g oup ha ecei ed LFLCD; (2) g oup ha
ecei ed HFLCD-SFAs; (3) g oup ha ecei ed HFLCD-MUFAs; and (4)
g oup ha ecei ed HFLCD-PUFAs. Body weigh , ood, and wa e in ake we e
daily e alua ed (da a no shown). Sac i ice o all animals was ca ied ou
wi hin animal acili ies (Ins i u o de Biomedicina de Se illa, IBiS) a he
beginning o he ligh cycle and a e 10 h o ood dep i a ion. Animals we e
Page 6 o 22Food & Func ion

6
eu hanized wi h an o e dose o pen oba bi al (1:10 in PBS, 150 mg/kg body
weigh ). Hea samples we e collec ed upon sac i ice. All animal p o ocols
ecei ed app op ia e ins i u ional app o al (Animal Ca e and Use Commi ee
o he Uni e si y o Se ille) and we e pe o med acco ding o he o icial ules
o mula ed in he Spanish law on he ca e and use o expe imen al animals
(UE Di ec i e o 2010: 2010/63/UE; RD 53/2013).
Immunohis ochemis y
Mouse hea was dissec ed, ixed in 1% pa a o maldehyde, and
embedded in pa a in. Size o a he oscle o ic lesions was de e mined as
p e iously desc ibed.
10
Se ial sec ions (6 µm) o he ao ic oo we e cu and
s ained wi h haema oxylin-eosin (HE) o mo phome ic analysis and ou ine
quali a i e examina ion o collagen con en , nec osis, and amoun o
in lamma o y B (B220) and C (CD3) cells. Aliza in Red (AR) s aining was
pe o med o de ec ascula calci ica ion. Co esponding sec ions on
sepa a e slides we e s ained wi h an ibodies agains RANKL, OPG, and
CATHK (AbCAM, Camb idge, UK). Subsequen ly, slides we e incuba ed wi h
an a idin-bio in-complex (Eli e ec o -s ain ABC, PK-6100) and s ained wi h
AEC (Vec o , pe oxidase subs a e ki , SK-4200). Th ee di e en slides om
each animal we e used o he quan i ica ion o ei he his ological and
immunohis ochemical s aining. Samples we e cap u ed a 20× magni ica ions
by a Leica DM3000 ligh mic oscope (Leica, We zla , Ge many) and an
independen ope a o , in a blinde manne , pe o med his ological analyses
using Quan ime wi h Qwin3 quan i ica ion so wa e (Leica).
RNA isola ion and RT-qPCR
Page 7 o 22 Food & Func ion
7
To al RNA was ex ac ed by using T isu e Reagen (Bioline). RNA
quali y was assessed by A
260
/A
280
a io in a NanoD op ND-1000
Spec opho ome e (The mo Scien i ic). B ie ly, RNA (250 ng) was subjec ed
o e e se ansc ip ion (iSc ip , Bio-Rad, Mad id, Spain). An amoun o 20 ng
o he esul ing cDNA was used as a empla e o eal- ime PCR
ampli ica ions. The mRNA le els o speci ic genes we e de e mined in a
CFX96 sys em (Bio-Rad). Fo each PCR eac ion, cDNA empla e was added
o B illian SYBR g een QPCR Supe mix (Bio-Rad) con aining he p ime pai s
o ei he gene o o glyce aldehyde 3-phospha e dehyd ogenase (GAPDH)
as a housekeeping gene (Table 2). All ampli ica ion eac ions we e pe o med
in iplica e and a e age h eshold cycle (C ) numbe s o he iplica es we e
used o calcula e he ela i e mRNA exp ession o candida e genes.
11
The
magni ude o change o mRNA exp ession o candida e genes was
calcula ed by using he s anda d 2
-(∆∆C )
me hod. All da a we e no malized o
endogenous e e ence (GAPDH) gene con en and exp essed as ela i e old-
change o con ol.
S a is ical analysis
All alues in he igu es and ex a e exp essed as he a i hme ic
mean ± SD. Da a we e e alua ed wi h G aph Pad P ism Ve sion 5.01
so wa e. The s a is ical signi icance o any di e ence in each pa ame e
among he g oups was e alua ed by one-way analysis o a iance (ANOVA),
using Tukey's es o mul iple compa ison analysis. P alues o <0.05 we e
conside ed s a is ically signi ican .
RESULTS AND DISCUSSION
Page 8 o 22Food & Func ion
8
The li e a u e o en e e s o “Medi e anean die ” as p o ec i e
due o i s con en in oleic acid (MUFA) and mino cons i uen s om oli e oil,
which play a ole in he p e en ion o many pa hological condi ions such as
ca dio ascula and heuma ic diseases by imp o ing classical isk ac o s and
by p omo ing in ense an i-in lamma o y e ec s.
12-16
This s udy is he i s o
add ess he e ec s o p edominan a y acids in die a y a s on ascula
calci ica ion in mice wi h Me S. We used male mice homozygous o he ob/ob
and Ldl
m1He
a ge ed mu a ions lacking he ho mone lep in and LDL ecep o
on o a C57BL/6J backg ound. When subjec ed o a HFLCD ich in SFAs,
hese animals become obese, hype insulinemic, and de elop se e e
dyslipidaemia (Table 3), which a e pa hological mani es a ions analogous o
hose cha ac e is ics o human Me S.
17
A he oscle o ic lesion de elopmen
(Fig. 1A) and calci ica ion (Fig. 1B) we e assessed in he ao ic oo o
Lep
ob/ob
LDLR
−/−
mice a e 8 weeks eeding on LFLCD (con ol) and HFLCDs
(HFLCD-SFAs, HFLCD-MUFAs o HFLCD-PUFAs). As depic ed in Fig. 1C,
he animals ed wi h he HFLCDs (HFLCD-SFAs > HFLCD-MUFAs = HFLCD-
PUFAs) had an inc eased plaque size by means o HE s aining when
compa ed o animals ed wi h he LFLCD. Simila pa e n o calci ica ion by
means o AR s aining was obse ed in plaque a eas (Fig. 1D).
Calci ica ion is a hallma k o a he oscle osis bu i s ole in plaque
up u e has long been con o e sial.
18
I has been p oposed ha
a he oscle o ic plaque p oceeds h ough p og essi e s ages whe e ins abili y
and up u e can be ollowed by calci ica ion, pe haps o p o ide s abili y o an
uns able lesion.
19
Cu en expe imen al models indica e ha ascula
calci ica ion likely in ol es signalling media o s, such as OPG, RANKL, and
Page 9 o 22 Food & Func ion
9
CATHK, adi ionally associa ed wi h bone emodelling.
20
Vascula
calci ica ion was also assessed in plaque a eas o ao ic oo o
Lep
ob/ob
LDLR
−/−
mice a e 8 weeks eeding on LFLCD (con ol) o HFLCDs
(HFLCD-SFAs, HFLCD-MUFAs o HFLCD-PUFAs) by immunohis ochemical
s aining o RANKL (Fig. 2A), OPG (Fig. 2B), and CATHK (Fig. 2C).
Immunohis ochemical quan i ica ion e ealed ha only animals ed wi h
HFLCD-SFAs inc eased RANKL (Fig. 2D) and CATHK (Fig. 2F) posi i e cells
in plaque a eas. Howe e , i was no ewo hy o obse e a ma kedly
dec eased accumula ion o OPG posi i e cells in plaque a eas o animals ed
wi h HFLCD-SFAs when compa ed o o he die a y g oups (Fig. 2E). HFLCD-
SFAs also inc eased RANK (Fig. 3A) and dec eased OPG (Fig. 3B) gene
exp ession, in addi ion o an up- egula ion o CATHK gene (Fig. 3C) in he
ao ic oo s o animals. Ou indings a e in line wi h p e ious e idence o he
e ec s o high in akes o SFAs on plaque ins abili y and in lamma ion
(including a ise in TNFα se um le els), and o MUFAs and PUFAs on
ca dio ascula p o ec ion.
9,21,22
Fu he mo e, he os eoclas ogenic po ency o
die a y a y acids (SFAs >>> MUFAs = PUFAs) has ecen ly been associa ed
wi h an unbalance o p o-os eoclas ogenic (RANKL) and an i-os eoclas ogenic
(OPG) cy okines.
7
Taken oge he , hese obse a ions demons a e ha a y
acids in p o-obesi y/obesogenic die s a e pi o al in e ms o egula ing
ascula calci ica ion in he con ex o a he oscle osis in he se ing o Me S.
Ou s udy demons a es ha compa ed o die a y SFAs, MUFAs
om oli e oil p e en agains a he oscle osis by in e e ing on ascula
calci ica ion ia RANKL/RANK/OPG sys em and CATHK in he se ing o
Me S.
Page 10 o 22Food & Func ion
16
Table 1. Fa y acid composi ion o die a y a s.
Cow’s milk
c eam
Re ined oli e oil
Re ined oli e
oil plus EPA +
DHA
Fa y acid g/100 g o a y acid
10:0, cap ic 2.5 ± 0.1 - -
12:0, lau ic 3.1 ± 0.4 - -
14:0, my is ic 10.9 ± 0.9 - -
16:0, palmi ic 35.5 ± 0.8 20.4 ± 0.9
20.5 ± 0.6
16:1(n-7), palmi oleic 3.6 ± 0.3 1.0 ± 0.2 0.8 ± 0.1
18:0, s ea ic 11.5 ± 0.8 5.7 ± 0.1 4.5 ± 0.4
18:1(n-9), oleic 25.3 ± 0.7 61.9 ± 1.2 61.5 ± 1.0
18:2(n-6), linoleic 4.3 ± 0.8 8.0 ± 0.7 8.0 ± 0.5
18:3(n-3), α-linolenic 0.4 ± 0.1 1.0 ± 0.1 0.9 ± 0.0
20:5(n-3),
eicosapen aenoic
- - 0.9 ± 0.1
22:6(n-3),
docosahexaenoic
- - 0.7 ± 0.1
O he s 3.0 ± 1.7 2.1 ± 1.1 2.0 ± 0.9
SFAs 63.5 ± 1.9
a
26.1 ± 1.0
b
25.0 ± 0.9
b
MUFAs 28.9 ± 0.8
b
62.8 ± 1.4
a
62.4 ± 1.0
a
PUFAs 4.7 ± 0.8
c
9.0 ± 0.7
b
10.6 ± 0.7
a
Values a e exp essed as he mean ± SD (n = 3) and hose ma ked wi h
di e en lowe case le e in he same ow a e s a is ically di e en (P < 0.05).
Page 17 o 22 Food & Func ion

17
Table 2. De ailed in o ma ion abou p ime s’ sequences used in his s udy.
Ta ge
GenBank
accession
Numbe
Di ec ion
Sequence (5´

3´)
CATK NM_000396
Fo wa d
Re e se
TTCTGCTGCTACCTGTGGTG
CCAGGTGGTTCATAGCCAGT
GAPDH
NM_001289746
Fo wa d
Re e se
CACATGGCCTCCAAGGAGTAAG
CCAGCAGTGAGGGGTCTCTCT
OPG NM_002546
Fo wa d
Re e se
GGCAACACAGCTCACAAGAA
CTGGGTTTGCATGCCTTTAT
RANK NM_001270949
Fo wa d
Re e se
GGTGCAGCCTCTAACTCCTG
TTGAGACCAGGCTGGGTAAC
Page 18 o 22Food & Func ion
18
Table 3. Food in ake, inal body and ela i e weigh s, and biochemical
analysis.
Con ol SFAs MUFAs PUFAs
Food in ake
(g/wk/animal)
26.17 ± 4.43
a
30.07 ± 5.21
a
29.01 ± 7.72
a
30.49 ± 5.53
a
Final body weigh (g) 28.62 ± 2.71
c
35.19 ± 2.32
a
30.93 ± 1.11
b
30.67 ± 1.49
b
Body weigh gain (g) 8.97 ± 0.70
c
16.13 ± 1.88
a
10.32 ± 0.45
b
10.41 ± 0.57
b
Se um pa ame e s
TC (mmol/L) 3.61 ± 0.22
b
4.12 ± 0.18
a
3.97 ± 0.19
a
4.01 ± 0.14
a
TG (mmol/L) 0.37 ± 0.08
c
0.92 ± 0.13
a
0.58 ± 0.09
b
0.59 ± 0.07
b
Values a e exp essed as he mean ± SD (n = 10) and hose ma ked wi h
di e en lowe case le e in he same ow a e s a is ically di e en (P < 0.05).
Page 19 o 22 Food & Func ion
Figu e 1
179x135mm (300 x 300 DPI)
Page 20 o 22Food & Func ion
Figu e 2
186x174mm (300 x 300 DPI)
Page 21 o 22 Food & Func ion
Figu e 3
85x163mm (300 x 300 DPI)
Page 22 o 22Food & Func ion