Dietary fatty acids on aortic root calcification in mice with metabolic syndrome

1 E ec o die a y a y acids on calci ied ao ic oo o mice wi h me abolic synd ome Ma ia C Na anjo a , Bea iz Be mudez b , Inda a Ga cia a , Se gio Lopez a , Rocio Abia a , F ancisco JG Mu iana a , Se gio Mon se a -de la Paz a, * a Labo a o y o Cellula and Molecula Nu i ion, Ins i u o de la G asa, CSIC. C a. de U e a Km. 1, 41013 Se ille, Spain b Depa men o Cell Biology, Facul y o Biology, Uni e si y o Se ille. C/ P o eso Ga cia Gonzalez s/n, 41012 Se ille, Spain *Co esponding Au ho : Se gio Mon se a -de la Paz Labo a o y o Cellula and Molecula Nu i ion, Ins i u o de la G asa, CSIC. C a. de U e a Km. 1, Campus Uni e si a io Pablo de Ola ide, Edi icio 46, 41013 Se ille (Spain) Tel: +34 954 611 550 (Ex . 360) E-mail: [email protected] Running i le: Fa y acids on ao ic calci ica ion in Me S Page 2 o 22Food & Func ion This is he pee e iewed e sion o he ollowing a icle: Die a y a y acids on ao ic oo calci ica ion in mice wi h me abolic synd ome. Food Func ., 2017, 8, 1468-1474 DOI: 10.1039/C7FO00143F 2 ABSTRACT Me abolic synd ome (Me S) is associa ed wi h obesi y, dyslipidemia, ype 2 diabe es, and ch onic low-g ade in lamma ion. The aim o his s udy was o de e mine he ole o high- a low-choles e ol die s (HFLCDs) ich in SFAs (HFLCD-SFAs), MUFAs (HFLCD-MUFAs) o MUFAs plus omega-3 long- chain PUFAs (HFLCD-PUFAs) on ascula calci ica ion by he modula ion o RANKL/RANK/OPG sys em in ao ic oo s om Lep ob/ob LDLR −/− mice. Animals ed wi h HFLCD-SFAs had inc eased weigh and a g ea e a he oma plaque size, calci ica ion, and RANKL/CATHK exp ession in ao ic oo han mice on MUFA-en iched die s, he la e s inc easing OPG exp ession in ao ic oo s. Ou s udy demons a es ha compa ed o die a y SFAs, MUFAs om oli e oil p o ec agains a he oscle osis by in e e ing on ascula calci ica ion ia he RANKL/RANK/OPG sys em in he se ing o Me S. These indings open oppo uni ies o de eloping no el nu i ional s a egies wi h oli e oil as he mos impo an die a y sou ce o MUFAs (no ably oleic acid) o p e en ca dio ascula complica ions in he Me S. Keywo ds: oli e oil, RANKL, os eop o ege in, me abolic synd ome, ascula calci ica ion, a he oscle osis. Page 3 o 22 Food & Func ion 3 INTRODUCTION Dyslipidemia, insulin esis ance, and obesi y, he de ining componen s o he me abolic synd ome (Me S), a e well-known isk ac o s implica ed in he ae iology and pa hogenesis o ce ain ca dio ascula diseases (CVDs) such as a he oscle osis, he main cause o CVD dea h in de eloped and some de eloping coun ies. 1 Recen ly, inc easing in e es has ocused on unde s anding how a he oscle o ic pa hology is ela ed o a common plaque cons i uen : calcium mine al deposi s. Impo an s udies in he las decade ha e now spawned a model whe ein calci ica ion in a he oscle o ic plaque is iewed as an ac i e, complex, and p esumably egula ed p ocess ha exhibi s in iguing simila i ies o bone emodelling. 2 A he oscle o ic calci ica ion appea s o esul om induc ion o os eogenic di e en ia ion in subpopula ions o ascula cells by in lamma o y ac o s such as ecep o ac i a o o nuclea ac o -κB (RANK) ligand (RANKL) and ca hepsin K (CATHK). 3 In con as , os eop o ege in (OPG) is a glycop o ein membe o he TNF ecep o supe amily ha unc ions as a soluble decoy subs a e o RANK and compe es wi h RANKL, inhibi ing RANK-RANKL in e ac ions o os eoclas p oli e a ion and di e en ia ion, and bone deg ada ion. 4 In e es ingly, i has been epo ed ha OPG-de icien mice de elop bo h os eopo osis and a e ial calci ica ion 5 and ha adminis a ion o soluble OPG o ansgenic OPG o e exp ession may e ain he de elopmen o a he oscle osis. 6 P e ious s udies ca ied ou by ou g oup ha e epo ed ha he ype o die a y a in he meals may ha e a g ea e impac on os eoclas induc ion and ma u a ion ia RANKL/RANK/OPG sys em. 7 Die a y sa u a ed Page 4 o 22Food & Func ion 4 a y acids (SFAs) as compa ed o monounsa u a ed a y acids (MUFAs) and omega-3 long-chain polyunsa u a ed a y acids (PUFAs) ha e been ound o be he mos po en induce o in i o os eoclas ogenesis. Howe e , i is unknown whe he a die a y a ich in MUFAs wi hou (oli e oil) o wi h omega- 3 long chain PUFAs (oli e oil + EPA and DHA) compa ed o a die a y a ich in SFAs (cow´s milk c eam) may ha e bene i s in a he oscle osis and ascula calci ica ion by he modula ion o he RANKL/RANK/OPG sys em. Taken oge he , he global aim o his pape is o assess he in luence o die s en iched in SFAs, MUFAs o MUFAs + omega-3 long-chain PUFAs on calci ied ao ic oo s om mice wi h Me S (Lep ob/ob LDLR −/− ). MATERIALS AND METHODS Fa y acid composi ion o die a y a s The a y acid composi ion o die a y a s [cow's milk c eam, ich in SFAs; e ined oli e oil, ich in MUFAs; and e ined oli e oil plus eicosapen aenoic acid (EPA) and docosahexaenoic acid (DHA), ich in MUFAs and omega-3 long-chain PUFAs] was de e mined by he me hod desc ibed in EEC/796/2002, 8 using a gas ch oma og aphy sys em (HP-5890, Hewle -Packa d, Palo-Al o, USA) equipped wi h lame ioniza ion de ec o and a SP-2380 capilla y column (Supelco, Belle on e, USA, 30 m x 0.32 mm) packed wi h cyanop opyl siloxane (0.25 µm). The ini ial column empe a u e was 165 ºC, which was held o 10 min, hen p og ammed om 165 ºC o 200 ºC a 1.5 ºC/min. Injec o and de ec o empe a u e we e 250 ºC, wi h he ca ie gas H 2 . The a y acid composi ion o di e en die a y a s is de ailed in Table 1. Page 5 o 22 Food & Func ion 5 Animal die s and expe imen al design Male Lep ob/ob LDLR −/− mice b ed on o a C57BL/6J backg ound (B6.Cg-Lepob Ldl m1He /J, The Jackson Labo a o y, Ba Ha bo , ME, USA) was used o he s udy. These mice a e obese and de elop plasma lipid al e a ions ha closely e lec Me S- ela ed hype lipidaemia. 9 All die s we e p epa ed by Panlab Labo a oi es (SAFE, Augy, F ance) and p esen ed as pelle s o he animals. Mice ecei ed one o he ollowing die s o 8 weeks: a s anda d no mal- a die (low- a low-choles e ol die , LFLCD) con aining 3% ene gy as a , used as con ol, o high- a low-choles e ol die s (HFLCDs), which con ained 24% ene gy as a . All he die s we e based on he s anda d oden die A04-10, con aining 0.01% choles e ol, 20 mg/kg BHT, and 3% binde . Th ee di e en HFLCDs we e p epa ed by eplacing he a sou ce om A04-10 die by cow's milk c eam (21% ene gy) (HFLCD-SFAs), e ined oli e oil (21% ene gy) (HFLCD-MUFAs) o e ined oli e oil (20% ene gy) plus EPA+DHA in he o m o e hyl es e s (1% ene gy) (HFLCD-PUFAs). The cow’s milk c eam p o ided an addi ional amoun o 0.006% choles e ol by weigh . All he die s con ained equal p opo ion o p o ein (19.5% ene gy) and ca bohyd a e was used o adjus he o al ene gy con en . A e weaning, mice we e andomly alloca ed in o 4 g oups (n = 10 pe g oup) as ollows: (1) g oup ha ecei ed LFLCD; (2) g oup ha ecei ed HFLCD-SFAs; (3) g oup ha ecei ed HFLCD-MUFAs; and (4) g oup ha ecei ed HFLCD-PUFAs. Body weigh , ood, and wa e in ake we e daily e alua ed (da a no shown). Sac i ice o all animals was ca ied ou wi hin animal acili ies (Ins i u o de Biomedicina de Se illa, IBiS) a he beginning o he ligh cycle and a e 10 h o ood dep i a ion. Animals we e Page 6 o 22Food & Func ion 6 eu hanized wi h an o e dose o pen oba bi al (1:10 in PBS, 150 mg/kg body weigh ). Hea samples we e collec ed upon sac i ice. All animal p o ocols ecei ed app op ia e ins i u ional app o al (Animal Ca e and Use Commi ee o he Uni e si y o Se ille) and we e pe o med acco ding o he o icial ules o mula ed in he Spanish law on he ca e and use o expe imen al animals (UE Di ec i e o 2010: 2010/63/UE; RD 53/2013). Immunohis ochemis y Mouse hea was dissec ed, ixed in 1% pa a o maldehyde, and embedded in pa a in. Size o a he oscle o ic lesions was de e mined as p e iously desc ibed. 10 Se ial sec ions (6 µm) o he ao ic oo we e cu and s ained wi h haema oxylin-eosin (HE) o mo phome ic analysis and ou ine quali a i e examina ion o collagen con en , nec osis, and amoun o in lamma o y B (B220) and C (CD3) cells. Aliza in Red (AR) s aining was pe o med o de ec ascula calci ica ion. Co esponding sec ions on sepa a e slides we e s ained wi h an ibodies agains RANKL, OPG, and CATHK (AbCAM, Camb idge, UK). Subsequen ly, slides we e incuba ed wi h an a idin-bio in-complex (Eli e ec o -s ain ABC, PK-6100) and s ained wi h AEC (Vec o , pe oxidase subs a e ki , SK-4200). Th ee di e en slides om each animal we e used o he quan i ica ion o ei he his ological and immunohis ochemical s aining. Samples we e cap u ed a 20× magni ica ions by a Leica DM3000 ligh mic oscope (Leica, We zla , Ge many) and an independen ope a o , in a blinde manne , pe o med his ological analyses using Quan ime wi h Qwin3 quan i ica ion so wa e (Leica). RNA isola ion and RT-qPCR Page 7 o 22 Food & Func ion 7 To al RNA was ex ac ed by using T isu e Reagen (Bioline). RNA quali y was assessed by A 260 /A 280 a io in a NanoD op ND-1000 Spec opho ome e (The mo Scien i ic). B ie ly, RNA (250 ng) was subjec ed o e e se ansc ip ion (iSc ip , Bio-Rad, Mad id, Spain). An amoun o 20 ng o he esul ing cDNA was used as a empla e o eal- ime PCR ampli ica ions. The mRNA le els o speci ic genes we e de e mined in a CFX96 sys em (Bio-Rad). Fo each PCR eac ion, cDNA empla e was added o B illian SYBR g een QPCR Supe mix (Bio-Rad) con aining he p ime pai s o ei he gene o o glyce aldehyde 3-phospha e dehyd ogenase (GAPDH) as a housekeeping gene (Table 2). All ampli ica ion eac ions we e pe o med in iplica e and a e age h eshold cycle (C ) numbe s o he iplica es we e used o calcula e he ela i e mRNA exp ession o candida e genes. 11 The magni ude o change o mRNA exp ession o candida e genes was calcula ed by using he s anda d 2 -(∆∆C ) me hod. All da a we e no malized o endogenous e e ence (GAPDH) gene con en and exp essed as ela i e old- change o con ol. S a is ical analysis All alues in he igu es and ex a e exp essed as he a i hme ic mean ± SD. Da a we e e alua ed wi h G aph Pad P ism Ve sion 5.01 so wa e. The s a is ical signi icance o any di e ence in each pa ame e among he g oups was e alua ed by one-way analysis o a iance (ANOVA), using Tukey's es o mul iple compa ison analysis. P alues o <0.05 we e conside ed s a is ically signi ican . RESULTS AND DISCUSSION Page 8 o 22Food & Func ion 8 The li e a u e o en e e s o “Medi e anean die ” as p o ec i e due o i s con en in oleic acid (MUFA) and mino cons i uen s om oli e oil, which play a ole in he p e en ion o many pa hological condi ions such as ca dio ascula and heuma ic diseases by imp o ing classical isk ac o s and by p omo ing in ense an i-in lamma o y e ec s. 12-16 This s udy is he i s o add ess he e ec s o p edominan a y acids in die a y a s on ascula calci ica ion in mice wi h Me S. We used male mice homozygous o he ob/ob and Ldl m1He a ge ed mu a ions lacking he ho mone lep in and LDL ecep o on o a C57BL/6J backg ound. When subjec ed o a HFLCD ich in SFAs, hese animals become obese, hype insulinemic, and de elop se e e dyslipidaemia (Table 3), which a e pa hological mani es a ions analogous o hose cha ac e is ics o human Me S. 17 A he oscle o ic lesion de elopmen (Fig. 1A) and calci ica ion (Fig. 1B) we e assessed in he ao ic oo o Lep ob/ob LDLR −/− mice a e 8 weeks eeding on LFLCD (con ol) and HFLCDs (HFLCD-SFAs, HFLCD-MUFAs o HFLCD-PUFAs). As depic ed in Fig. 1C, he animals ed wi h he HFLCDs (HFLCD-SFAs > HFLCD-MUFAs = HFLCD- PUFAs) had an inc eased plaque size by means o HE s aining when compa ed o animals ed wi h he LFLCD. Simila pa e n o calci ica ion by means o AR s aining was obse ed in plaque a eas (Fig. 1D). Calci ica ion is a hallma k o a he oscle osis bu i s ole in plaque up u e has long been con o e sial. 18 I has been p oposed ha a he oscle o ic plaque p oceeds h ough p og essi e s ages whe e ins abili y and up u e can be ollowed by calci ica ion, pe haps o p o ide s abili y o an uns able lesion. 19 Cu en expe imen al models indica e ha ascula calci ica ion likely in ol es signalling media o s, such as OPG, RANKL, and Page 9 o 22 Food & Func ion 9 CATHK, adi ionally associa ed wi h bone emodelling. 20 Vascula calci ica ion was also assessed in plaque a eas o ao ic oo o Lep ob/ob LDLR −/− mice a e 8 weeks eeding on LFLCD (con ol) o HFLCDs (HFLCD-SFAs, HFLCD-MUFAs o HFLCD-PUFAs) by immunohis ochemical s aining o RANKL (Fig. 2A), OPG (Fig. 2B), and CATHK (Fig. 2C). Immunohis ochemical quan i ica ion e ealed ha only animals ed wi h HFLCD-SFAs inc eased RANKL (Fig. 2D) and CATHK (Fig. 2F) posi i e cells in plaque a eas. Howe e , i was no ewo hy o obse e a ma kedly dec eased accumula ion o OPG posi i e cells in plaque a eas o animals ed wi h HFLCD-SFAs when compa ed o o he die a y g oups (Fig. 2E). HFLCD- SFAs also inc eased RANK (Fig. 3A) and dec eased OPG (Fig. 3B) gene exp ession, in addi ion o an up- egula ion o CATHK gene (Fig. 3C) in he ao ic oo s o animals. Ou indings a e in line wi h p e ious e idence o he e ec s o high in akes o SFAs on plaque ins abili y and in lamma ion (including a ise in TNFα se um le els), and o MUFAs and PUFAs on ca dio ascula p o ec ion. 9,21,22 Fu he mo e, he os eoclas ogenic po ency o die a y a y acids (SFAs >>> MUFAs = PUFAs) has ecen ly been associa ed wi h an unbalance o p o-os eoclas ogenic (RANKL) and an i-os eoclas ogenic (OPG) cy okines. 7 Taken oge he , hese obse a ions demons a e ha a y acids in p o-obesi y/obesogenic die s a e pi o al in e ms o egula ing ascula calci ica ion in he con ex o a he oscle osis in he se ing o Me S. Ou s udy demons a es ha compa ed o die a y SFAs, MUFAs om oli e oil p e en agains a he oscle osis by in e e ing on ascula calci ica ion ia RANKL/RANK/OPG sys em and CATHK in he se ing o Me S. Page 10 o 22Food & Func ion 16 Table 1. Fa y acid composi ion o die a y a s. Cow’s milk c eam Re ined oli e oil Re ined oli e oil plus EPA + DHA Fa y acid g/100 g o a y acid 10:0, cap ic 2.5 ± 0.1 - - 12:0, lau ic 3.1 ± 0.4 - - 14:0, my is ic 10.9 ± 0.9 - - 16:0, palmi ic 35.5 ± 0.8 20.4 ± 0.9 20.5 ± 0.6 16:1(n-7), palmi oleic 3.6 ± 0.3 1.0 ± 0.2 0.8 ± 0.1 18:0, s ea ic 11.5 ± 0.8 5.7 ± 0.1 4.5 ± 0.4 18:1(n-9), oleic 25.3 ± 0.7 61.9 ± 1.2 61.5 ± 1.0 18:2(n-6), linoleic 4.3 ± 0.8 8.0 ± 0.7 8.0 ± 0.5 18:3(n-3), α-linolenic 0.4 ± 0.1 1.0 ± 0.1 0.9 ± 0.0 20:5(n-3), eicosapen aenoic - - 0.9 ± 0.1 22:6(n-3), docosahexaenoic - - 0.7 ± 0.1 O he s 3.0 ± 1.7 2.1 ± 1.1 2.0 ± 0.9 SFAs 63.5 ± 1.9 a 26.1 ± 1.0 b 25.0 ± 0.9 b MUFAs 28.9 ± 0.8 b 62.8 ± 1.4 a 62.4 ± 1.0 a PUFAs 4.7 ± 0.8 c 9.0 ± 0.7 b 10.6 ± 0.7 a Values a e exp essed as he mean ± SD (n = 3) and hose ma ked wi h di e en lowe case le e in he same ow a e s a is ically di e en (P < 0.05). Page 17 o 22 Food & Func ion 17 Table 2. De ailed in o ma ion abou p ime s’ sequences used in his s udy. Ta ge GenBank accession Numbe Di ec ion Sequence (5´  3´) CATK NM_000396 Fo wa d Re e se TTCTGCTGCTACCTGTGGTG CCAGGTGGTTCATAGCCAGT GAPDH NM_001289746 Fo wa d Re e se CACATGGCCTCCAAGGAGTAAG CCAGCAGTGAGGGGTCTCTCT OPG NM_002546 Fo wa d Re e se GGCAACACAGCTCACAAGAA CTGGGTTTGCATGCCTTTAT RANK NM_001270949 Fo wa d Re e se GGTGCAGCCTCTAACTCCTG TTGAGACCAGGCTGGGTAAC Page 18 o 22Food & Func ion 18 Table 3. Food in ake, inal body and ela i e weigh s, and biochemical analysis. Con ol SFAs MUFAs PUFAs Food in ake (g/wk/animal) 26.17 ± 4.43 a 30.07 ± 5.21 a 29.01 ± 7.72 a 30.49 ± 5.53 a Final body weigh (g) 28.62 ± 2.71 c 35.19 ± 2.32 a 30.93 ± 1.11 b 30.67 ± 1.49 b Body weigh gain (g) 8.97 ± 0.70 c 16.13 ± 1.88 a 10.32 ± 0.45 b 10.41 ± 0.57 b Se um pa ame e s TC (mmol/L) 3.61 ± 0.22 b 4.12 ± 0.18 a 3.97 ± 0.19 a 4.01 ± 0.14 a TG (mmol/L) 0.37 ± 0.08 c 0.92 ± 0.13 a 0.58 ± 0.09 b 0.59 ± 0.07 b Values a e exp essed as he mean ± SD (n = 10) and hose ma ked wi h di e en lowe case le e in he same ow a e s a is ically di e en (P < 0.05). Page 19 o 22 Food & Func ion Figu e 1 179x135mm (300 x 300 DPI) Page 20 o 22Food & Func ion Figu e 2 186x174mm (300 x 300 DPI) Page 21 o 22 Food & Func ion Figu e 3 85x163mm (300 x 300 DPI) Page 22 o 22Food & Func ion