BioMed Cen al
Page 1 o 9
(page numbe no o ci a ion pu poses)
Mic obial Cell Fac o ies
Open Access
Technical No es
An imp o ed sys em o es adiol-dependen egula ion o gene
exp ession in yeas
Ma ía J Quin e o1, Douglas Maya1, Miguel A é alo-Rod íguez2,
Ángel Cebolla2 and Sebas ián Chá ez*1
Add ess: 1Depa amen o de Gené ica, Uni e sidad de Se illa, A da. Reina Me cedes 6, E41012-Se ille, Spain and 2Biomedal, SL, E41092-Se ille,
Spain
Email: Ma ía J Quin e o - [email protected]; Douglas Maya - [email protected]; Miguel A é alo-Rod íguez - [email p o ec ed];
Ángel Cebolla - [email protected]; Sebas ián Chá ez* - scha [email protected]
* Co esponding au ho
Abs ac
Backg ound: Saccha omyces ce e isiae is widely u ilized in basic esea ch as a model euka yo ic
o ganism and in bio echnology as a hos o he e ologous p o ein p oduc ion. Bo h ac i i ies
demand he use o highly egula ed sys ems, able o p o ide accu a e con ol o gene exp ession
in unc ional analysis, and imely ecombinan p o ein syn hesis du ing e men a i e p oduc ion.
The igh ly egula ed GAL1-10 p omo e is commonly used. Howe e , induc ion o he GAL sys em
equi es he p esence o he a he expensi e induce galac ose and he absence o glucose in he
cul u e media. An al e na i e o egula e ansc ip ion d i en by GAL p omo e s, ee o gene al
me abolic changes, is he inco po a ion o he hyb id Gal4-ER-VP16 p o ein de eloped by D.
Pica d. This chime ic p o ein p o ides galac ose-independen ac i a ion o ansc ip ion om GAL
p omo e s in esponse o β-es adiol, e en in he p esence o glucose. Howe e , cons i u i e
exp ession o his ansac i a o esul s in ela i ely high basal ac i i y o he GAL p omo e s,
he e o e limi ing he gene exp ession capaci y ha is equi ed o a numbe o applica ions.
Resul s: In o de o imp o e his exp ession ool, we ha e in oduced addi ional egula o y
elemen s allowing a simul aneous con ol o bo h he abundance and he in insic ac i i y o he
Gal4-ER-VP16 chime ic ansac i a o . The mos e icien combina ion was ob ained by placing he
coding sequence o he hyb id ac i a o unde he con ol o he GAL1 p omo e . This
con igu a ion esul s in an ampli ica ion eedback loop ha is igge ed by he ho mone, and
ul ima ely leads o he enhanced egula ion o ecombinan genes when hese a e also d i en by a
GAL1 p omo e . The basal exp ession le el o his sys em is as low as ha o na i e GAL-d i en
genes in glucose-con aining media.
Conclusion: The eedback egula o y loop ha we ha e enginee ed allows a 250- old induc ion
o he egula ed gene, wi hou inc easing he basal ac i i y o he a ge p omo e , and achie ing a
12- old highe egula ion e iciency han he p e ious con igu a ion.
Published: 20 Ma ch 2007
Mic obial Cell Fac o ies 2007, 6:10 doi:10.1186/1475-2859-6-10
Recei ed: 6 No embe 2006
Accep ed: 20 Ma ch 2007
This a icle is a ailable om: h p://www.mic obialcell ac o ies.com/con en /6/1/10
© 2007 Quin e o e al; licensee BioMed Cen al L d.
This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0),
which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed.
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 2 o 9
(page numbe no o ci a ion pu poses)
Backg ound
Recombinan DNA exp ession cons i u es a majo
app oach in gene unc ion s udies ha na u ally comple-
men gene ic and genomic esea ch. Well- egula ed
exp ession sys ems p o ide an in aluable ool o in es i-
ga e he cellula oles o no el genes, ei he in hei o igi-
nal cellula en i onmen , o in specialized hos
o ganisms. Thus, hese sys ems can be u ilized o obse e
he biological e ec s o he con olled exp ession (o lack
o i ) o a gi en DNA sequence. Ve y o en hey also p o-
ide he means o p oduce and pu i y a desi ed gene p od-
uc , opening he way o he comp ehensi e analysis and
manu ac u e o p o eins o bio echnological in e es .
S. ce e isiae has been widely employed as a hos o ganism
in he exp ession o he e ologous p o eins [1-7], using
egula ed sys ems de eloped o allow low basal, highly
inducible p o ein p oduc ion. In his sense, imely exp es-
sion du ing e men a ion is impo an o p e en a p ema-
u e me abolic bu den and any possible oxic e ec
h oughou he cul u e g owing-phase ha migh lead o
a educ ion in p o ein yields, o o gene ic ins abili y.
Yeas -de i ed ansc ip ional p omo e s used in he abo e
men ioned sys ems a e, along wi h o he s, hose o he
MET3 gene, nega i ely egula ed by he amino acid
me hionine [8], he PHO5 gene, nega i ely egula ed by
ino ganic phospha e [9], he CUP1 gene, ac i a ed by
Cu2+ ions [10], and he GAL1 and GAL10 genes, ac i a ed
by galac ose and ep essed by glucose [11,12]. O he yeas
sys ems designed o igh ly egula ed gene exp ession
inco po a e ansc ip ional elemen s de i ed om bac e-
ia, like hose inducible o ep essible by e acycline (Te -
O and Te -On) [13,14].
Exp ession sys ems based on he GAL1-10 p omo e a e
among he s onges ones [15]. Unde na u al condi ions,
exp ession o he GAL1 and GAL10 genes depends on he
p oduc o he GAL4 gene, which ac i a es he GAL1-10
p omo e in he p esence o galac ose and he absence o
glucose [16], a majo disad an age when he me abolic
changes associa ed o his swi ch in ca bon sou ce a e el-
e an o he s udy. In addi ion, he high cos o he
induce can p eclude scaling up p oduc ion o a comme -
cially aluable p o ein using his sys em. A good al e na-
i e o egula e ansc ip ion d i en by GAL p omo e s is
he inco po a ion o he hyb id p o ein de eloped by D.
Pica d and co-wo ke s, a chime ical ansc ip ional ac i a-
o ha combines he DNA binding domain o Gal4 wi h
he ho mone binding domain o human es ogen ecep-
o and he ansac i a ion domain o he he pex i us
p o ein VP16 [17]. This sys em pe mi s he β-es adiol-
inducible exp ession o ecombinan genes placed unde
he con ol o GAL p omo e s, in a manne ha is inde-
penden o he p esence o absence o galac ose o glu-
cose. The sys em is i ually independen o media
o mula ion and a oids undesi ed physiological changes
associa ed wi h ca bon sou ce swi ch, bu he cons i u i e
exp ession o he chime ic ansac i a o p oduces
inc eased basal ac i i ies o he a ge p omo e s. The
epo ed e ec s o he ansac i a o on he basal ac i i y
o GAL p omo e s ange be ween 2.3- [18] and 11.4- old
[17]. In his epo we desc ibe an imp o ed yeas exp es-
sion pla o m based on he sys em desc ibed by Lou ion
e al [17]. This imp o emen elies on linked egula o y
cascades o posi i e eedback loops ha ampli y he ac i-
a ing signal o he induce molecule. Bo h he cascade
and he loop modula e simul aneously he abundance o
he ansac i a o and i s in insic ac i i y, esul ing in
low-basal, highly inducible gene exp ession sys ems.
Resul s and Discussion
A na i e GAL p omo e does no elimina e he basal
inc ease p oduced by Gal4-ER-VP16
In o de o explo e possible ways o imp o e he e iciency
o he yeas es ogen- egula ed sys em desc ibed by Lou-
ion e al [17], we i s es ed i he high basal ac i i y le -
els epo ed by hese au ho s we e due o he use o
a i icial GAL p omo e s, combining a numbe o Gal UAS
used o he CYC1 TATA sequences. To his end, we meas-
u ed he e ec o a cons i u i e Gal4-ER-VP16 ansac i a-
o on he exp ession o a epo e gene (lacZ), placed
unde he con ol o a na i e GAL1 p omo e , in he
absence o β-es adiol. We ound ha he cons i u i e
Gal4-ER-VP16 [17] p oduced a 13.3- old inc ease in he
ac i i y o he na i e GAL1 p omo e (Fig 1A). Addi ion o
β-es adiol o he cul u e medium p oduced a u he
32.4- old inc ease in he ac i i y o he na i e GAL1 p o-
mo e (Fig 1A), his induc ion being weake han ha
epo ed by Lou ion e al. o he a i icial GAL p omo e s
(be ween 100 and 200- old) [17]. The e o e, a na i e GAL
p omo e would no imp o e he egula ion capaci y o
an exp ession sys em based on he Gal4-ER-VP16 p o ein.
An es adiol-induced ansc ip ional cascade
We in es iga ed he possibili y o linking he Gal4-ER-
VP16- egula ed sys em ups eam o a second, β-es adiol-
dependen exp ession sys em. As his second sys em we
chose a GAL1 p omo e -d i en human es ogen ecep o
(ER) and a a ge epo e o his ansac i a o (ERE-
lacZ), consis ing o a minimal CYC1 p omo e used o
h ee es ogen- esponsi e elemen s (ERE) and d i ing lacZ
ansc ip ion. The combina ion o he GAL1p -con olled
ER wi h he cons i u i ely exp essed Gal4-ER-VP16 would
p oduce a ansc ip ional cascade ha should be ac i e
only in he p esence o ho mone. I s inal ac i a o (ER) is
con olled by β-es adiol, a bo h i s exp ession le el and
i s ansac i a o ac i i y (Fig 2A). As shown in Fig. 1B, in
he p esence o galac ose he GAL1p -ER/ERE-lacZ sys em
alone showed e y low ac i a ion when 1 μM β-es adiol
was added (3.2- old induc ion). This is a poo induc ion
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 3 o 9
(page numbe no o ci a ion pu poses)
alue, in compa ison o p e ious s udies o ER-dependen
egula ion in yeas [19-22], p obably due o he high
in insic ac i i y o he ERE-lacZ epo e . Howe e , com-
bina ion o he GAL1p -ER/ERE-lacZ sys em wi h he con-
s i u i ely exp essed Gal4-ER-VP16 in he "cascade-like"
con igu a ion esul ed in a β-es adiol-inducible sys em
wi h a educed basal inc ease and an imp o ed (23.2-
old) induc ion le el. The induc ion ime cou ses o he
combined ADH1p -Gal4-ER-VP16/GAL1p -ER/ERE-lacZ
sys em in glucose plus β-es adiol and he GAL1p -ER/
ERE-lacZ in galac ose we e simila (Fig 3A), indica ing
ha he highe complexi y o he cascade sys em does no
in ol e a slowe esponse. The cascade induc ion eached
a pla eau 10–12 hou s a e he addi ion o he ho mone
(Fig 3B).
The global e iciency o a egula ed exp ession sys em
depends on bo h he induc ion le el and he inc ease in
basal ac i i y o he a ge p omo e due o he p esence o
i s associa ed ac i a o . In o de o compa e he di e en
sys ems es ed we in oduced a new pa ame e , called eg-
ula ion e iciency, ob ained as he a io be ween he induc-
ion le el and he inc ease in basal ac i i y obse ed wi h
each sys em. Thus, he sys em composed by he cons i u-
i ely exp essed ADH1p -Gal4-ER-VP16 ansac i a o
and he GAL1 p omo e showed a egula ion e iciency o
Ho mone-dependen egula ion o β-galac osidase by he di e en sys ems analysed in his wo kFigu e 1
Ho mone-dependen egula ion o β-galac osidase by he di e en sys ems analysed in his wo k. β-galac osidase
ac i i ies (Mille uni s) o W303-1A (A, B, C) o BY4741 (D) cells con aining he ollowing plasmids: (A) p416GAL1-lacZ and
pHCA/GAL4(1-93)ERVP16; (B) pVi Bx2 and pGAL1-ER; o pVi Bx2, pGAL1-ER and pHCA/GAL4(1-93)ERVP16; (C)
p416GAL1-lacZ and p414GAL1-GAL4ERVP16; (D) p416GAL1-lacZ and p415GAL1-GAL4ERVP16. All cul u es we e g own in
he p esence o glucose excep when "gal" is w i en, indica ing galac ose-con aining cul u es. In all cases, 5 ml cul u es we e
inocula ed om a mid-log p ecul u e o an O.D. (600 nm) o 0.02, and incuba ed o 14 hou s a 30°C in he p esence o he
absence o 1 μM β-es adiol. A e age and s anda d de ia ion o a leas h ee independen expe imen s a e ep esen ed.
Induc ion ep esen s he a io be ween β-galac osidase ac i i ies (in he p esence and in he absence o β-es adiol). Basal
inc ease was calcula ed di iding he β-galac osidase ac i i y de ec ed in he absence o ho mone, by he ac i i y exhibi ed by
cells cul u ed in he same condi ions, con aining he same a ge epo e cons uc , bu lacking any es ogen-dependen ans-
ac i a o . Regula ion e iciency was calcula ed di iding induc ion by basal inc ease.
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 4 o 9
(page numbe no o ci a ion pu poses)
2.4. A simila ly low alue was exhibi ed by he GAL1p -
ER/ERE-lacZ sys em o β-es adiol in he p esence o
galac ose. In con as , he ADH1p -Gal4-ER-VP16/
GAL1p -ER/ERE-lacZ sys em showed a egula ion e i-
ciency o 38.7, indica ing ha he sequen ial ac ion o wo
egula o s is mo e con enien when an accu a e egula-
ion is needed. This imp o ed egula ion esul ed om
he combina ion o a highe induc ion le el (23.2- old)
wi h a sligh educ ion o he basal ac i i y o he ERE-lacZ
epo e (0.6- old). Howe e , acco ding o he alues
epo ed by Lou ion e al., he egula ion e iciency o
hei sys em anged be ween 11.0 and 40.5 [17]. We he e-
o e conclude ha he ansc ip ional cascade assembled
in hese s udies, al hough esul ing in a mode a ely low
basal ac i i y o he a ge p omo e , does no signi ican ly
imp o e he egula ion e iciency o he o iginal Gal4-ER-
VP16-dependen sys em.
An es adiol- igge ed sel -induced egula o y loop
As an al e na i e app oach, and in o de o p e en he
inc ease in basal ac i i y o GAL p omo e s p oduced by
he cons i u i e exp ession o Gal4-ER-VP16, we placed
he ansc ip ion o his chime ic ansac i a o unde he
con ol o a GAL1 p omo e . The esul ing sys em,
designed as a sel -inducible egula o y loop igge ed by β-
es adiol is depic ed in Fig 2B. Fi s , we measu ed he
exp ession o a GAL1p -lacZ epo e cons uc in cells
con aining his egula o y loop in he absence o es ogen,
inding no inc ease in he basal ac i i y o he GAL1 p o-
mo e , bu a he a small dec ease (Fig 1C). When hese
Synop ic explana ion o he wo es ogen-induced egula o y sys ems desc ibed in his wo kFigu e 2
Synop ic explana ion o he wo es ogen-induced egula o y sys ems desc ibed in his wo k. A. β-es adiol-
induced ansc ip ional cascade. B. β-es adiol- igge ed sel -induced egula o y loop. Boxes indica e coding egions; a ows
indica e ac i a ion.
GAL4-ER-VP16
ADH1
p omo e
ER
GAL1 p omo e
ß-es adiol
Regula ed gene
ERE-con aining p omo e
A
GAL4-ER-VP16
GAL1 p omo e
Regula ed gene
ß-es adiol
GAL1 p omo e
B
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 5 o 9
(page numbe no o ci a ion pu poses)
cells we e cul u ed in he p esence o 1 μM β-es adiol, we
measu ed a 247.5- old induc ion o lacZ exp ession.
Al hough he o e all maximal ac i i y was 3.5- old highe
when he ac i a o was cons i u i ely exp essed (Fig
1A,C), he induc ion o he loop exceeded he highes
induc ion le el epo ed by Lou ion e al. [17] and i was
7 imes highe han ha p oduced by he cons i u i ely
exp essed Gal4-ER-VP16 sys em on he same a ge p o-
mo e (Fig 1A).
Conside ing al oge he he small educ ion in basal ac i -
i y and he conside able induc ion le el obse ed, he
esul ing egula ion e iciency o he sel -inducing sys em
was e y high (495.0). Al hough he basal ac i i ies o he
Induc ion ime-cou se o he es ogen-dependen ansc ip ional cascade and o he es adiol- igge ed egula o y loopFigu e 3
Induc ion ime-cou se o he es ogen-dependen ansc ip ional cascade and o he es adiol- igge ed egu-
la o y loop. A. 25 ml glucose selec i e medium we e inocula ed wi h W303-1A yeas cells, con aining plasmids pVi Bx2,
pHCA/GAL4(1-93)ERVP16 and pGAL1-ER. A simila olume o galac ose selec i e medium was inocula ed wi h yeas cells
con aining plasmids pVi Bx2 and pGAL1-ER. A e adding 1 μM β-es adiol (sol ed in e hanol), o simila amoun s o e hanol,
samples we e aken a he indica ed ime poin s and assayed o β-galac osidase (Mille uni s). A ep esen a i e expe imen is
shown. B. 24 hou s ime-cou se o W303-1A yeas cells, con aining he cascade sys em (plasmids pVi Bx2, pHCA/GAL4(1-
93)ERVP16 and pGAL1-ER) a e adding 1 μM β-es adiol, compa ed wi h W303-1A yeas cells con aining he loop sys em
(plasmids p416GAL1-lacZ and p414GAL1-GAL4ERVP16) a e adding wo di e en ho mone conen a ion (1 μM and 50 nM).
The expe imen s we e pe o med as in A. To acili a e compa ison, he esul s we e ep esen ed as he pe cen age o he
maximal alues eached by each cul u e, excep o he loop 50 nM es adiol, wich was e e ed o he maximal alue o he
loop cul u e con aining 1 μM es adiol. A ep esen a i e expe imen is shown.
0
10
20
30
40
50
60
70
02468
Time (h)
ß-galac osidase (U)
ERE-lacZ, GAL1p -ER (gal)
ERE-lacZ, GAL1p -ER (gal) + 1M ß-es adiol
ERE-lacZ, GAL1p -ER, ADH1p -GAL4-ER-VP16
ERE-lacZ, GAL1p -ER, ADH1p -GAL4-ER-VP16 + 1M ß-es adiol
A
B
0
20
40
60
80
100
120
0 5 10 15 20 25
Time (h)
ß-galac osidase (%)
Loop 1 M ß-es adiol
Loop 50 nM ß-es adiol
Cascade 1M ß-es adiol

Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 6 o 9
(page numbe no o ci a ion pu poses)
loop sys em a e close o ze o, and he e o e his numbe
should be conside ed cau iously, i ep esen s one o de
o magni ude highe han he alues ound o he cons i-
u i ely exp essed Gal4-ER-VP16 sys em o he ansc ip-
ional cascade desc ibed abo e. The igh e egula ion o
his loop sys em in ol ed an exponen ial kine ic o induc-
ion a he han linea kine ic shown by he cascade sys-
em, as indica ed by he induc ion ime-cou ses shown in
Fig 3B. Howe e , bo h he cascade and he loop sys ems
eached he maximal induc ion 10–12 hou s a e adding
he ho mone (Fig 3B).
The high e iciency o his egula o y loop is no es ic ed
o he W303 yeas gene ic backg ound. When we in o-
duced he GAL1p -GAL4ERVP16/GAL1p -lacZ sys em in
an S288C-de i a i e s ain (BY4741), simila induc ion
le els (246- old) and egula ion e iciency (176) we e
ob ained (Fig 1D). Mo eo e , in he S288C backg ound
he maximal ac i i ies we e highe han in W303 (Fig
1C,D).
In o de o cha ac e ize he loop sys em u he , we in es-
iga ed i s dependence on Gal4 and Gal80, he wo spe-
ci ic egula o s o he GAL1 p omo e . As shown in Fig 1D,
he absence o he Gal4 ac i a o did no a ec signi i-
can ly ei he he basal o he induced le els. In he absence
o he Gal80 ep esso , he basal ac i i y o he GAL1 p o-
mo e was inc eased, as could be expec ed. Again he loop
sys em caused a signi ican induc ion in his backg ound
(Fig 1D). These esul s sugges ha he loop sys em can be
Ho mone-dependence and swi ch-o ime cou se o he β-es adiol- igge ed sel -induced egula o y loopFigu e 4
Ho mone-dependence and swi ch-o ime cou se o he β-es adiol- igge ed sel -induced egula o y loop. 5
ml glucose cul u es o W303-1A cells con aining plasmids p416GAL1-lacZ and p414GAL1-GAL4ERVP16 we e inocula ed as in
Fig 1 and g own o 14 hou s in he p esence o he indica ed concen a ion o β-es adiol and assayed o β-galac osidase. The
a e age and s anda d de ia ion o h ee di e en expe imen s is ep esen ed. B. 100 ml glucose medium we e inocula ed wi h
yeas cells con aining plasmids p416GAL1-lacZ and p414GAL1-GAL4ERVP16 and g own un il s a iona y phase (19 h) in he
p esence o 50 nM es adiol. Cells we e hen washed h ee imes by cen i uga ion and used o inocula e a new 100 ml cul u e
lacking β-es adiol, a a OD(600 nm) o 0.2. Se en hou s la e (a ow) cells we e washed again and used o inocula e a new cul-
u e a a OD(600 nm) o 0.2. As a con ol, a 100 ml glucose cul u e was inocula ed a a OD(600 nm) o 0.2, om a sa u a ed
p ecul u e g own in galac ose. Samples we e aken a he indica ed imes and assayed o β-galac osidase ac i i y. A ep esen -
a i e expe imen is shown
0
20
40
60
80
100
120
log [ß-es adiol] (M)
ß-galac osidase (%)
-10 -8 -6 -5
-7
-9
0
20
40
60
80
100
120
0 5 10 15 20 25 30
Time (h)
ß-galac osidase (%)
Loop swi ch-o
GAL1p -lacZ gal-glu
A
B
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 7 o 9
(page numbe no o ci a ion pu poses)
easily adap ed o o he euka yo ic cells lacking he Gal4
and Gal80 egula o s.
We also measu ed he ho mone dose- esponse o he loop
sys em. The le els ob ained a e cul u ing he yeas cells
wi h inc easing concen a ions o es adiol a e shown in
Fig 4A. Maximal induc ion was obse ed a abou 1 μM
and he hal -maximal esponse a 0.05 μM. These alues
a e one o de o magni ude highe han hose epo ed o
he cons i u i ely exp essed Gal4-ER-VP16 sys em [17]
and o he ho mone-dependence o ER in yeas [19,21].
In ac , he dose esponse o he loop sys em does no
show he ypical sha p inc ease o ho mone ecep o s,
sugges ing ha he sel -induced loop acili a es o ob ain
in e media e le els o exp ession. Mo eo e , he ime
cou se o he induc ion a sub-op imal ho mone concen-
a ion (50 nM) also indica ed an exponen ial kine ic, bu
a his ligand concen a ion he loop sys em eached he
pla eau 2–4 hou s ea lie han he cul u e ac i a ed wi h 1
μM ho mone (Fig 3B).
We also es ed i he ac i e loop could be swi ched-o by
emo ing β-es adiol om he medium. As shown in Fig
4B, i e hou s and wo cell duplica ions a e emo ing
he ho mone, cells e ained nea ly 70% o he β-galacosi-
dase ac i i y. A new einocula ion and eigh mo e hou s
we e needed o educe he β-galac osidase ac i i y below
10% o he ini ial alues. The compa ison wi h he swi ch-
o o a galac ose-ac i a ed GAL1p ::lacZ, by ans e ing
he cells om galac ose o glucose, ules-ou ha he slow
inac i a ion o he loop migh be due o he high s abili y
o β-galac osidase (Fig 4B). One possible explana ion o
hese esul s is ha he esidual amoun s o es adiol
emaining inside he cell we e su icien o main ain he
ac i a ion o he sys em. An al e na i e explana ion migh
be ha , once he egula o y loop has been igge ed, he
sys em emains epigene ically ac i e wi hou needing
addi ional inpu s. In any case, his cha ac e is ic o he
sys em makes i sui able o egula ing gene exp ession in
hose indus ial applica ions equi ing he absence o β-
es adiol in he inal p oduc . In his s udy we ha e es ed
wo new egula ion s a egies: a ansc ip ional cascade
and a eed back egula o y loop. In bo h cases we ha e
ob ained e y low le els o inc ease in basal ac i i y and
conside able le els o induc ion, especially in he eed
back loop. Bo h sys ems sha e a basic ea u e: he induce
ac s on he ansac i a o simul aneously a wo le els: i s
in insic ac i i y and i s abundance. We belie e ha his
scheme can be used o imp o e he egula ion capaci y o
o he exp ession sys ems, whose egula o s p oduce high
basal ac i i y o he a ge p omo e s.
Conclusion
The coo dina ed con ol o he exp ession o an es ogen-
esponsi e ansc ip ional ac i a o wi h i s in insic ac i-
a ion ampli ies syne gis ically he egula o y capaci y o
he a ge p omo e .
The ansc ip ional cascade desc ibed in his wo k, com-
posed by a cons i u i ely exp essed Gal4-ER-VP16 ansac-
i a o and a GAL1p -d i en es ogen ecep o , does no
inc ease he basal ac i i y o he ERE-con aining a ge
p omo e , main aining he egula ion e iciency o he
p e ious sys em.
The sel -induced egula o y loop ha we ha e enginee ed
allows a 250- old induc ion o he egula ed gene, wi hou
inc easing he basal ac i i y o he a ge p omo e . The
global egula ion e iciency o his eed back loop exceeds
he es ogen-induced exp ession sys ems ha ha e been
p e iously designed o yeas cells. I s ho mone-depend-
ence, mo e g adual han he one usually exhibi ed by
nuclea ecep o s, allows in e media e le els o egula-
ion. The loop sys em does no depend on he speci ic eg-
ula o s o he GAL1 p omo e , acili a ing i s adap a ion o
o he euka yo ic en i onmen s.
Me hods
S ain and plasmids
The yeas s ains used in his s udy we e W303-1A (MATa
ade2-1 can1-100 his3-11, 15 leu2-3,112 p1-1 u a3-1) [23]
BY4741 (MATa his3
Δ
1 leu2
Δ
0 me 15
Δ
0 u a3
Δ
0) [24] and
he gal4
Δ
and gal80
Δ
de i a i e o BY4741 conse ed in
he EUROSCARF collec ion.
Table 1: Plasmids used in his wo k
Plasmid Rele an ea u es Re e ence
p416GAL1-lacZ URA3, CEN, GAL1p ::lacZ [26]
pHCA/GAL4(1-93)ERVP16 HIS3, CEN, ADH1p ::GAL4ERVP16 [17]
pVi Bx2 URA3, CEN, ERE-CYC1p ::lacZ [30]
pGAL1-ER LEU2, CEN, GAL1p ::ER This s udy
p414GAL1-GAL4ERVP16 TRP1, CEN,GAL1p ::GAL4ERVP16 This s udy
p415GAL1-GAL4ERVP16 LEU2, CEN,GAL1p ::GAL4ERVP16 This s udy
pP6HEG0 human ER [25]
pRS415 LEU2, CEN [27]
p414GAL1 TRP1, CEN, GAL1p [26]
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 8 o 9
(page numbe no o ci a ion pu poses)
All plasmids used in his s udy we e cen ome ic and a e
desc ibed in Table 1. Plasmid pGAL1-ER was cons uc ed
by inse ing a 2.1 kb BamHI DNA agmen om plasmid
pP6HEG0 [25], con aining he cDNA o human es ogen
ecep o , in o he BamHI si e p esen in p414GAL1 [26],
immedia ely downs eam om he GAL1 p omo e . Plas-
mid p414GAL1-GAL4ERVP16 was cons uc ed by inse -
ing a 1,5 kb PCR agmen (oligos
ATGAAGCTACTGTCTTCTATCGA and TCACTATAG-
GGCGAATTGG) om pHCA/GAL4(1-93)ERVP16,
encoding he chime ic ansac i a o GAL4ERVP16 [17],
in o pGEMT-easy (P omega), gene a ing pGEMT-
GAL4ERVP16. A 1.5 kb SpeI agmen om his plasmid
was inse ed in o he SpeI si e p esen in p414GAL1 [26],
immedia ely downs eam om he GAL1 p omo e . Plas-
mid p415GAL1-GAL4ERVP16 was cons uc ed by liga ing
he 2.6 kb P uII agmen om p414GAL1-GAL4ERVP16
o he biges P uII agmen o pRS415 [27].
Yeas ans o ma ion was ca ied ou using s anda d
me hods [28]. T ans o man s we e ou inely assayed o
plasmid s abili y, by eplica-pla ing a e non-selec i e
cul u ing. Those ans o man s con aining mo e han one
plasmid did no show abno mal le els o plasmid ins a-
bili y.
Cul u e condi ions
Yeas ans o man s we e cul u ed a 30°C in comple e
syn he ic medium, wi h 2% glucose o 2% galac ose as he
ca bon sou ce [28]. Liquid cul u es we e incuba ed in
o bi al shake s a 120 pm. β-es adiol (SIGMA E-1024-
1G) was added when indica ed om a 2.5 mM s ock solu-
ion in e hanol. Equi alen amoun s o e hanol we e
added o con ol cul u es.
β
-galac osidase assays
β-galac osidase assays we e pe o med as desc ibed p e i-
ously [29] using a cell-pe meabiliza ion me hod [28].
Ac i i ies we e calcula ed as Mille uni s. Yeas s ains con-
aining epo e s alone we e assayed in he p esence o
emp y exp ession ec o s. Expe imen s we e pe o med a
leas h ee imes, al hough in igu es ep esen ing ime-
cou se expe imen s only one is shown. In all cases he ep-
lica e p oduced simila esul s.
Compe ing in e es s
The Uni e si y o Se ille is cu en ly applying o a pa en
co e ing he applica ions o he esul s desc ibed in his
wo k. Biomedal, SL p o ided a pa o he unding
equi ed o de elop his wo k and has signed a licence
ag eemen wi h he Uni e si y o Se ille, in o de o b ing
o he ma ke some applica ions o hese esul s.
Au ho s' con ibu ions
MJQ ca ied ou mos o he expe imen s and con ibu ed
o hei design. DM pe o med some expe imen s. MAR
pa icipa ed in he design o some expe imen s and con-
ibu ed o d a he manusc ip . AC con ibu ed o he
design o some expe imen s and, oge he wi h SC, con-
cei ed he ini ial app oaches. SC pe o med some expe i-
men s, coo dina ed all he wo k and d a ed he
manusc ip .
Acknowledgemen s
We hank D. Pica d o kindly p o iding plasmid pHCA/GAL4(1-
93)ERVP16 and Benjami Piña o plasmids pVi Bx2 and pP6HEG0. This
wo k was suppo ed by he Spanish Minis y o Educa ion and Science
(FIT-010000-2003-110 and CIT-010000-2005-32), by he Andalusian Go -
e nmen (CVI271) and by Biomedal, SL.
Re e ences
1. Ce eghino GPL, C egg JM: Applica ions o yeas in bio echnol-
ogy: p o ein p oduc ion and gene ic analysis. Cu en Opinion in
Bio echnology 1999, 10:422-427.
2. Gellissen G, Hollenbe g CP: Applica ion o yeas s in gene
exp ession s udies: a compa ison o Saccha omyces ce e i-
siae, Hansenula polymo pha and Kluy e omyces lac is -- a
e iew. Gene 1997, 190:87-97.
3. Hinnen A, Bux on F, Chaudhu i B, Heim J, Ho ige T, Meyhack B,
Pohlig G: Gene exp ession in ecombinan yeas . Biop ocess
Technol 1995, 22:121-193.
4. Goeddel DV: Sys ems o he e ologous gene exp ession. Me h-
ods Enzymol 1990, 185:3-7.
5. Hinnen A, Meyhack B, Heim J: He e ologous gene exp ession in
yeas . Bio echnology (Reading, Mass) 1989, 13:193-213.
6. Po o D, Saue M, B andua di P, Ma ano ich D: Recombinan p o-
ein p oduc ion in yeas s. Mol Bio echnol 2005, 31:245-259.
7. Gellissen G, Melbe K, Janowicz ZA, Dahlems UM, Weydemann U,
Pion ek M, S asse AW, Hollenbe g CP: He e ologous p o ein
p oduc ion in yeas . An onie Van Leeuwenhoek 1992, 62:79-93.
8. Moun ain HA, Bys om AS, La sen JT, Ko ch C: Fou majo an-
sc ip ional esponses in he me hionine/ h eonine biosyn-
he ic pa hway o Saccha omyces ce e isiae. Yeas 1991,
7:781-803.
9. K ame RA, DeChia a TM, Schabe MD, Hillike S: Regula ed
exp ession o a human in e e on gene in yeas : con ol by
phospha e concen a ion o empe a u e. P oc Na l Acad Sci U
S A 1984, 81:367-370.
10. Mac eadie IG, Ho ai is O, Ve kuylen AJ, Sa in KW: Imp o ed shu -
le ec o s o cloning and high-le el Cu(2+)-media ed
exp ession o o eign genes in yeas . Gene 1991, 104:107-111.
11. Wes RW J ., Yocum RR, P ashne M: Saccha omyces ce e isiae
GAL1-GAL10 di e gen p omo e egion: loca ion and unc-
ion o he ups eam ac i a ing sequence UASG. Mol Cell Biol
1984, 4:2467-2478.
12. Yocum RR, Hanley S, Wes R J ., P ashne M: Use o lacZ usions o
delimi egula o y elemen s o he inducible di e gen
GAL1-GAL10 p omo e in Saccha omyces ce e isiae. Mol
Cell Biol 1984, 4:1985-1998.
13. Fishman GI, Kaplan ML, Bu ick PM: Te acycline- egula ed ca -
diac gene exp ession in i o. J Clin In es 1994, 93:1864-1868.
14. Belli G, Ga i E, Pied a i a L, Aldea M, He e o E: An ac i a o /
ep esso dual sys em allows igh e acycline- egula ed
gene exp ession in budding yeas . Nucleic Acids Res 1998,
26:942-947.
15. Schneide JC, Gua en e L: Vec o s o exp ession o cloned
genes in yeas : egula ion, o e p oduc ion, and unde p o-
duc ion. Me hods Enzymol 1991, 194:373-388.
16. Johns on MC M.: Regula ion o ca bon and phospha e u iliza-
ion. In The Molecula Biology o he Yeas Saccha omyces Volume 2.
Edi ed by: Jones EWPJRBJR. Cold Sp ing Ha bo , NY, Cold Sp ing
Ha bo Labo a o y P ess; 1992:193–281.
Publish wi h BioMed Cen al and e e y
scien is can ead you wo k ee o cha ge
"BioMed Cen al will be he mos signi ican de elopmen o
dissemina ing he esul s o biomedical esea ch in ou li e ime."
Si Paul Nu se, Cance Resea ch UK
You esea ch pape s will be:
a ailable ee o cha ge o he en i e biomedical communi y
pee e iewed and published immedia ely upon accep ance
ci ed in PubMed and a chi ed on PubMed Cen al
you s — you keep he copy igh
Submi you manusc ip he e:
h p://www.biomedcen al.com/in o/publishing_ad .asp
BioMedcen al
Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10
Page 9 o 9
(page numbe no o ci a ion pu poses)
17. Lou ion JF, Ha aux-Cop B, Pica d D: Fusion o GAL4-VP16 o a
s e oid-binding domain p o ides a ool o g a ui ous induc-
ion o galac ose- esponsi e genes in yeas . Gene 1993,
131:129-134.
18. S a o d GA, Mo se RH: Ch oma in emodeling by ansc ip-
ional ac i a ion domains in a yeas episome. J Biol Chem 1997,
272:11526-11534.
19. Me zge D, Whi e JH, Chambon P: The human oes ogen ecep-
o unc ions in yeas . Na u e 1988, 334:31-36.
20. Leskinen P, Michelini E, Pica d D, Ka p M, Vi a M: Bioluminescen
yeas assays o de ec ing es ogenic and and ogenic ac i i y
in di e en ma ices. Chemosphe e 2005, 61:259-266.
21. Pie a B, Hee y DM, Lemoine Y, Losson R: Func ional analysis o
he human es ogen ecep o using a pheno ypic ansac i-
a ion assay in yeas . Gene 1992, 119:237-245.
22. A nold SF, Klo z DM, Collins BM, Vonie PM, Guille e LJ J ., McLach-
lan JA: Syne gis ic ac i a ion o es ogen ecep o wi h com-
bina ions o en i onmen al chemicals. Science 1996,
272:1489-1492.
23. Ro hs ein R, Helms C, Rosenbe g N: Conce ed dele ions and
in e sions a e caused by mi o ic ecombina ion be ween
del a sequences in Saccha omyces ce e isiae. Mol Cell Biol
1987, 7:1198-1207.
24. B achmann CB, Da ies A, Cos GJ, Capu o E, Li J, Hie e P, Boeke JD:
Designe dele ion s ains de i ed om Saccha omyces ce -
e isiae S288C: a use ul se o s ains and plasmids o PCR-
media ed gene dis up ion and o he applica ions. Yeas 1998,
14:115-132.
25. G een S, Wal e P, Kuma V, K us A, Bo ne JM, A gos P, Chambon
P: Human oes ogen ecep o cDNA: sequence, exp ession
and homology o -e b-A. Na u e 1986, 320:134-139.
26. Mumbe g D, Mulle R, Funk M: Regula able p omo e s o Sac-
cha omyces ce e isiae: compa ison o ansc ip ional ac i -
i y and hei use o he e ologous exp ession. Nucleic Acids Res
1994, 22:5767-5768.
27. Siko ski RS, Hie e P: A sys em o shu le ec o s and yeas hos
s ains designed o e icien manipula ion o DNA in Saccha-
omyces ce e isiae. Gene ics 1989, 122:19-27.
28. Rose MD Wins on, F. and Hie e , P.: Me hods in Yeas Gene ics:
A Labo a o y Cou se Manual. Cold Sp ing Ha bo , NY, Cold
Sp ong Ha bo Labo a o y P ess; 1990.
29. Cha ez S, Candau R, T uss M, Bea o M: Cons i u i e ep ession
and nuclea ac o I-dependen ho mone ac i a ion o he
mouse mamma y umo i us p omo e in Saccha omyces
ce e isiae. Mol Cell Biol 1995, 15:6987-6998.
30. Ga cia-Reye o N, G au E, Cas illo M, Lopez de Alda MJ, Ba celo D,
Pina B: Moni o ing o endoc ine dis up o s in su ace wa e s
by he yeas ecombinan assay. En i on Toxicol Chem 2001,
20:1152-1158.