An improved system for estradiol-dependent regulation of gene expression in yeast

BioMed Cen al Page 1 o 9 (page numbe no o ci a ion pu poses) Mic obial Cell Fac o ies Open Access Technical No es An imp o ed sys em o es adiol-dependen egula ion o gene exp ession in yeas Ma ía J Quin e o1, Douglas Maya1, Miguel A é alo-Rod íguez2, Ángel Cebolla2 and Sebas ián Chá ez*1 Add ess: 1Depa amen o de Gené ica, Uni e sidad de Se illa, A da. Reina Me cedes 6, E41012-Se ille, Spain and 2Biomedal, SL, E41092-Se ille, Spain Email: Ma ía J Quin e o - [email protected]; Douglas Maya - [email protected]; Miguel A é alo-Rod íguez - [email p o ec ed]; Ángel Cebolla - [email protected]; Sebas ián Chá ez* - scha [email protected] * Co esponding au ho Abs ac Backg ound: Saccha omyces ce e isiae is widely u ilized in basic esea ch as a model euka yo ic o ganism and in bio echnology as a hos o he e ologous p o ein p oduc ion. Bo h ac i i ies demand he use o highly egula ed sys ems, able o p o ide accu a e con ol o gene exp ession in unc ional analysis, and imely ecombinan p o ein syn hesis du ing e men a i e p oduc ion. The igh ly egula ed GAL1-10 p omo e is commonly used. Howe e , induc ion o he GAL sys em equi es he p esence o he a he expensi e induce galac ose and he absence o glucose in he cul u e media. An al e na i e o egula e ansc ip ion d i en by GAL p omo e s, ee o gene al me abolic changes, is he inco po a ion o he hyb id Gal4-ER-VP16 p o ein de eloped by D. Pica d. This chime ic p o ein p o ides galac ose-independen ac i a ion o ansc ip ion om GAL p omo e s in esponse o β-es adiol, e en in he p esence o glucose. Howe e , cons i u i e exp ession o his ansac i a o esul s in ela i ely high basal ac i i y o he GAL p omo e s, he e o e limi ing he gene exp ession capaci y ha is equi ed o a numbe o applica ions. Resul s: In o de o imp o e his exp ession ool, we ha e in oduced addi ional egula o y elemen s allowing a simul aneous con ol o bo h he abundance and he in insic ac i i y o he Gal4-ER-VP16 chime ic ansac i a o . The mos e icien combina ion was ob ained by placing he coding sequence o he hyb id ac i a o unde he con ol o he GAL1 p omo e . This con igu a ion esul s in an ampli ica ion eedback loop ha is igge ed by he ho mone, and ul ima ely leads o he enhanced egula ion o ecombinan genes when hese a e also d i en by a GAL1 p omo e . The basal exp ession le el o his sys em is as low as ha o na i e GAL-d i en genes in glucose-con aining media. Conclusion: The eedback egula o y loop ha we ha e enginee ed allows a 250- old induc ion o he egula ed gene, wi hou inc easing he basal ac i i y o he a ge p omo e , and achie ing a 12- old highe egula ion e iciency han he p e ious con igu a ion. Published: 20 Ma ch 2007 Mic obial Cell Fac o ies 2007, 6:10 doi:10.1186/1475-2859-6-10 Recei ed: 6 No embe 2006 Accep ed: 20 Ma ch 2007 This a icle is a ailable om: h p://www.mic obialcell ac o ies.com/con en /6/1/10 © 2007 Quin e o e al; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed. Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 2 o 9 (page numbe no o ci a ion pu poses) Backg ound Recombinan DNA exp ession cons i u es a majo app oach in gene unc ion s udies ha na u ally comple- men gene ic and genomic esea ch. Well- egula ed exp ession sys ems p o ide an in aluable ool o in es i- ga e he cellula oles o no el genes, ei he in hei o igi- nal cellula en i onmen , o in specialized hos o ganisms. Thus, hese sys ems can be u ilized o obse e he biological e ec s o he con olled exp ession (o lack o i ) o a gi en DNA sequence. Ve y o en hey also p o- ide he means o p oduce and pu i y a desi ed gene p od- uc , opening he way o he comp ehensi e analysis and manu ac u e o p o eins o bio echnological in e es . S. ce e isiae has been widely employed as a hos o ganism in he exp ession o he e ologous p o eins [1-7], using egula ed sys ems de eloped o allow low basal, highly inducible p o ein p oduc ion. In his sense, imely exp es- sion du ing e men a ion is impo an o p e en a p ema- u e me abolic bu den and any possible oxic e ec h oughou he cul u e g owing-phase ha migh lead o a educ ion in p o ein yields, o o gene ic ins abili y. Yeas -de i ed ansc ip ional p omo e s used in he abo e men ioned sys ems a e, along wi h o he s, hose o he MET3 gene, nega i ely egula ed by he amino acid me hionine [8], he PHO5 gene, nega i ely egula ed by ino ganic phospha e [9], he CUP1 gene, ac i a ed by Cu2+ ions [10], and he GAL1 and GAL10 genes, ac i a ed by galac ose and ep essed by glucose [11,12]. O he yeas sys ems designed o igh ly egula ed gene exp ession inco po a e ansc ip ional elemen s de i ed om bac e- ia, like hose inducible o ep essible by e acycline (Te - O and Te -On) [13,14]. Exp ession sys ems based on he GAL1-10 p omo e a e among he s onges ones [15]. Unde na u al condi ions, exp ession o he GAL1 and GAL10 genes depends on he p oduc o he GAL4 gene, which ac i a es he GAL1-10 p omo e in he p esence o galac ose and he absence o glucose [16], a majo disad an age when he me abolic changes associa ed o his swi ch in ca bon sou ce a e el- e an o he s udy. In addi ion, he high cos o he induce can p eclude scaling up p oduc ion o a comme - cially aluable p o ein using his sys em. A good al e na- i e o egula e ansc ip ion d i en by GAL p omo e s is he inco po a ion o he hyb id p o ein de eloped by D. Pica d and co-wo ke s, a chime ical ansc ip ional ac i a- o ha combines he DNA binding domain o Gal4 wi h he ho mone binding domain o human es ogen ecep- o and he ansac i a ion domain o he he pex i us p o ein VP16 [17]. This sys em pe mi s he β-es adiol- inducible exp ession o ecombinan genes placed unde he con ol o GAL p omo e s, in a manne ha is inde- penden o he p esence o absence o galac ose o glu- cose. The sys em is i ually independen o media o mula ion and a oids undesi ed physiological changes associa ed wi h ca bon sou ce swi ch, bu he cons i u i e exp ession o he chime ic ansac i a o p oduces inc eased basal ac i i ies o he a ge p omo e s. The epo ed e ec s o he ansac i a o on he basal ac i i y o GAL p omo e s ange be ween 2.3- [18] and 11.4- old [17]. In his epo we desc ibe an imp o ed yeas exp es- sion pla o m based on he sys em desc ibed by Lou ion e al [17]. This imp o emen elies on linked egula o y cascades o posi i e eedback loops ha ampli y he ac i- a ing signal o he induce molecule. Bo h he cascade and he loop modula e simul aneously he abundance o he ansac i a o and i s in insic ac i i y, esul ing in low-basal, highly inducible gene exp ession sys ems. Resul s and Discussion A na i e GAL p omo e does no elimina e he basal inc ease p oduced by Gal4-ER-VP16 In o de o explo e possible ways o imp o e he e iciency o he yeas es ogen- egula ed sys em desc ibed by Lou- ion e al [17], we i s es ed i he high basal ac i i y le - els epo ed by hese au ho s we e due o he use o a i icial GAL p omo e s, combining a numbe o Gal UAS used o he CYC1 TATA sequences. To his end, we meas- u ed he e ec o a cons i u i e Gal4-ER-VP16 ansac i a- o on he exp ession o a epo e gene (lacZ), placed unde he con ol o a na i e GAL1 p omo e , in he absence o β-es adiol. We ound ha he cons i u i e Gal4-ER-VP16 [17] p oduced a 13.3- old inc ease in he ac i i y o he na i e GAL1 p omo e (Fig 1A). Addi ion o β-es adiol o he cul u e medium p oduced a u he 32.4- old inc ease in he ac i i y o he na i e GAL1 p o- mo e (Fig 1A), his induc ion being weake han ha epo ed by Lou ion e al. o he a i icial GAL p omo e s (be ween 100 and 200- old) [17]. The e o e, a na i e GAL p omo e would no imp o e he egula ion capaci y o an exp ession sys em based on he Gal4-ER-VP16 p o ein. An es adiol-induced ansc ip ional cascade We in es iga ed he possibili y o linking he Gal4-ER- VP16- egula ed sys em ups eam o a second, β-es adiol- dependen exp ession sys em. As his second sys em we chose a GAL1 p omo e -d i en human es ogen ecep o (ER) and a a ge epo e o his ansac i a o (ERE- lacZ), consis ing o a minimal CYC1 p omo e used o h ee es ogen- esponsi e elemen s (ERE) and d i ing lacZ ansc ip ion. The combina ion o he GAL1p -con olled ER wi h he cons i u i ely exp essed Gal4-ER-VP16 would p oduce a ansc ip ional cascade ha should be ac i e only in he p esence o ho mone. I s inal ac i a o (ER) is con olled by β-es adiol, a bo h i s exp ession le el and i s ansac i a o ac i i y (Fig 2A). As shown in Fig. 1B, in he p esence o galac ose he GAL1p -ER/ERE-lacZ sys em alone showed e y low ac i a ion when 1 μM β-es adiol was added (3.2- old induc ion). This is a poo induc ion Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 3 o 9 (page numbe no o ci a ion pu poses) alue, in compa ison o p e ious s udies o ER-dependen egula ion in yeas [19-22], p obably due o he high in insic ac i i y o he ERE-lacZ epo e . Howe e , com- bina ion o he GAL1p -ER/ERE-lacZ sys em wi h he con- s i u i ely exp essed Gal4-ER-VP16 in he "cascade-like" con igu a ion esul ed in a β-es adiol-inducible sys em wi h a educed basal inc ease and an imp o ed (23.2- old) induc ion le el. The induc ion ime cou ses o he combined ADH1p -Gal4-ER-VP16/GAL1p -ER/ERE-lacZ sys em in glucose plus β-es adiol and he GAL1p -ER/ ERE-lacZ in galac ose we e simila (Fig 3A), indica ing ha he highe complexi y o he cascade sys em does no in ol e a slowe esponse. The cascade induc ion eached a pla eau 10–12 hou s a e he addi ion o he ho mone (Fig 3B). The global e iciency o a egula ed exp ession sys em depends on bo h he induc ion le el and he inc ease in basal ac i i y o he a ge p omo e due o he p esence o i s associa ed ac i a o . In o de o compa e he di e en sys ems es ed we in oduced a new pa ame e , called eg- ula ion e iciency, ob ained as he a io be ween he induc- ion le el and he inc ease in basal ac i i y obse ed wi h each sys em. Thus, he sys em composed by he cons i u- i ely exp essed ADH1p -Gal4-ER-VP16 ansac i a o and he GAL1 p omo e showed a egula ion e iciency o Ho mone-dependen egula ion o β-galac osidase by he di e en sys ems analysed in his wo kFigu e 1 Ho mone-dependen egula ion o β-galac osidase by he di e en sys ems analysed in his wo k. β-galac osidase ac i i ies (Mille uni s) o W303-1A (A, B, C) o BY4741 (D) cells con aining he ollowing plasmids: (A) p416GAL1-lacZ and pHCA/GAL4(1-93)ERVP16; (B) pVi Bx2 and pGAL1-ER; o pVi Bx2, pGAL1-ER and pHCA/GAL4(1-93)ERVP16; (C) p416GAL1-lacZ and p414GAL1-GAL4ERVP16; (D) p416GAL1-lacZ and p415GAL1-GAL4ERVP16. All cul u es we e g own in he p esence o glucose excep when "gal" is w i en, indica ing galac ose-con aining cul u es. In all cases, 5 ml cul u es we e inocula ed om a mid-log p ecul u e o an O.D. (600 nm) o 0.02, and incuba ed o 14 hou s a 30°C in he p esence o he absence o 1 μM β-es adiol. A e age and s anda d de ia ion o a leas h ee independen expe imen s a e ep esen ed. Induc ion ep esen s he a io be ween β-galac osidase ac i i ies (in he p esence and in he absence o β-es adiol). Basal inc ease was calcula ed di iding he β-galac osidase ac i i y de ec ed in he absence o ho mone, by he ac i i y exhibi ed by cells cul u ed in he same condi ions, con aining he same a ge epo e cons uc , bu lacking any es ogen-dependen ans- ac i a o . Regula ion e iciency was calcula ed di iding induc ion by basal inc ease. Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 4 o 9 (page numbe no o ci a ion pu poses) 2.4. A simila ly low alue was exhibi ed by he GAL1p - ER/ERE-lacZ sys em o β-es adiol in he p esence o galac ose. In con as , he ADH1p -Gal4-ER-VP16/ GAL1p -ER/ERE-lacZ sys em showed a egula ion e i- ciency o 38.7, indica ing ha he sequen ial ac ion o wo egula o s is mo e con enien when an accu a e egula- ion is needed. This imp o ed egula ion esul ed om he combina ion o a highe induc ion le el (23.2- old) wi h a sligh educ ion o he basal ac i i y o he ERE-lacZ epo e (0.6- old). Howe e , acco ding o he alues epo ed by Lou ion e al., he egula ion e iciency o hei sys em anged be ween 11.0 and 40.5 [17]. We he e- o e conclude ha he ansc ip ional cascade assembled in hese s udies, al hough esul ing in a mode a ely low basal ac i i y o he a ge p omo e , does no signi ican ly imp o e he egula ion e iciency o he o iginal Gal4-ER- VP16-dependen sys em. An es adiol- igge ed sel -induced egula o y loop As an al e na i e app oach, and in o de o p e en he inc ease in basal ac i i y o GAL p omo e s p oduced by he cons i u i e exp ession o Gal4-ER-VP16, we placed he ansc ip ion o his chime ic ansac i a o unde he con ol o a GAL1 p omo e . The esul ing sys em, designed as a sel -inducible egula o y loop igge ed by β- es adiol is depic ed in Fig 2B. Fi s , we measu ed he exp ession o a GAL1p -lacZ epo e cons uc in cells con aining his egula o y loop in he absence o es ogen, inding no inc ease in he basal ac i i y o he GAL1 p o- mo e , bu a he a small dec ease (Fig 1C). When hese Synop ic explana ion o he wo es ogen-induced egula o y sys ems desc ibed in his wo kFigu e 2 Synop ic explana ion o he wo es ogen-induced egula o y sys ems desc ibed in his wo k. A. β-es adiol- induced ansc ip ional cascade. B. β-es adiol- igge ed sel -induced egula o y loop. Boxes indica e coding egions; a ows indica e ac i a ion. GAL4-ER-VP16 ADH1 p omo e ER GAL1 p omo e ß-es adiol Regula ed gene ERE-con aining p omo e A GAL4-ER-VP16 GAL1 p omo e Regula ed gene ß-es adiol GAL1 p omo e B Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 5 o 9 (page numbe no o ci a ion pu poses) cells we e cul u ed in he p esence o 1 μM β-es adiol, we measu ed a 247.5- old induc ion o lacZ exp ession. Al hough he o e all maximal ac i i y was 3.5- old highe when he ac i a o was cons i u i ely exp essed (Fig 1A,C), he induc ion o he loop exceeded he highes induc ion le el epo ed by Lou ion e al. [17] and i was 7 imes highe han ha p oduced by he cons i u i ely exp essed Gal4-ER-VP16 sys em on he same a ge p o- mo e (Fig 1A). Conside ing al oge he he small educ ion in basal ac i - i y and he conside able induc ion le el obse ed, he esul ing egula ion e iciency o he sel -inducing sys em was e y high (495.0). Al hough he basal ac i i ies o he Induc ion ime-cou se o he es ogen-dependen ansc ip ional cascade and o he es adiol- igge ed egula o y loopFigu e 3 Induc ion ime-cou se o he es ogen-dependen ansc ip ional cascade and o he es adiol- igge ed egu- la o y loop. A. 25 ml glucose selec i e medium we e inocula ed wi h W303-1A yeas cells, con aining plasmids pVi Bx2, pHCA/GAL4(1-93)ERVP16 and pGAL1-ER. A simila olume o galac ose selec i e medium was inocula ed wi h yeas cells con aining plasmids pVi Bx2 and pGAL1-ER. A e adding 1 μM β-es adiol (sol ed in e hanol), o simila amoun s o e hanol, samples we e aken a he indica ed ime poin s and assayed o β-galac osidase (Mille uni s). A ep esen a i e expe imen is shown. B. 24 hou s ime-cou se o W303-1A yeas cells, con aining he cascade sys em (plasmids pVi Bx2, pHCA/GAL4(1- 93)ERVP16 and pGAL1-ER) a e adding 1 μM β-es adiol, compa ed wi h W303-1A yeas cells con aining he loop sys em (plasmids p416GAL1-lacZ and p414GAL1-GAL4ERVP16) a e adding wo di e en ho mone conen a ion (1 μM and 50 nM). The expe imen s we e pe o med as in A. To acili a e compa ison, he esul s we e ep esen ed as he pe cen age o he maximal alues eached by each cul u e, excep o he loop 50 nM es adiol, wich was e e ed o he maximal alue o he loop cul u e con aining 1 μM es adiol. A ep esen a i e expe imen is shown. 0 10 20 30 40 50 60 70 02468 Time (h) ß-galac osidase (U) ERE-lacZ, GAL1p -ER (gal) ERE-lacZ, GAL1p -ER (gal) + 1M ß-es adiol ERE-lacZ, GAL1p -ER, ADH1p -GAL4-ER-VP16 ERE-lacZ, GAL1p -ER, ADH1p -GAL4-ER-VP16 + 1M ß-es adiol A B 0 20 40 60 80 100 120 0 5 10 15 20 25 Time (h) ß-galac osidase (%) Loop 1 M ß-es adiol Loop 50 nM ß-es adiol Cascade 1M ß-es adiol Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 6 o 9 (page numbe no o ci a ion pu poses) loop sys em a e close o ze o, and he e o e his numbe should be conside ed cau iously, i ep esen s one o de o magni ude highe han he alues ound o he cons i- u i ely exp essed Gal4-ER-VP16 sys em o he ansc ip- ional cascade desc ibed abo e. The igh e egula ion o his loop sys em in ol ed an exponen ial kine ic o induc- ion a he han linea kine ic shown by he cascade sys- em, as indica ed by he induc ion ime-cou ses shown in Fig 3B. Howe e , bo h he cascade and he loop sys ems eached he maximal induc ion 10–12 hou s a e adding he ho mone (Fig 3B). The high e iciency o his egula o y loop is no es ic ed o he W303 yeas gene ic backg ound. When we in o- duced he GAL1p -GAL4ERVP16/GAL1p -lacZ sys em in an S288C-de i a i e s ain (BY4741), simila induc ion le els (246- old) and egula ion e iciency (176) we e ob ained (Fig 1D). Mo eo e , in he S288C backg ound he maximal ac i i ies we e highe han in W303 (Fig 1C,D). In o de o cha ac e ize he loop sys em u he , we in es- iga ed i s dependence on Gal4 and Gal80, he wo spe- ci ic egula o s o he GAL1 p omo e . As shown in Fig 1D, he absence o he Gal4 ac i a o did no a ec signi i- can ly ei he he basal o he induced le els. In he absence o he Gal80 ep esso , he basal ac i i y o he GAL1 p o- mo e was inc eased, as could be expec ed. Again he loop sys em caused a signi ican induc ion in his backg ound (Fig 1D). These esul s sugges ha he loop sys em can be Ho mone-dependence and swi ch-o ime cou se o he β-es adiol- igge ed sel -induced egula o y loopFigu e 4 Ho mone-dependence and swi ch-o ime cou se o he β-es adiol- igge ed sel -induced egula o y loop. 5 ml glucose cul u es o W303-1A cells con aining plasmids p416GAL1-lacZ and p414GAL1-GAL4ERVP16 we e inocula ed as in Fig 1 and g own o 14 hou s in he p esence o he indica ed concen a ion o β-es adiol and assayed o β-galac osidase. The a e age and s anda d de ia ion o h ee di e en expe imen s is ep esen ed. B. 100 ml glucose medium we e inocula ed wi h yeas cells con aining plasmids p416GAL1-lacZ and p414GAL1-GAL4ERVP16 and g own un il s a iona y phase (19 h) in he p esence o 50 nM es adiol. Cells we e hen washed h ee imes by cen i uga ion and used o inocula e a new 100 ml cul u e lacking β-es adiol, a a OD(600 nm) o 0.2. Se en hou s la e (a ow) cells we e washed again and used o inocula e a new cul- u e a a OD(600 nm) o 0.2. As a con ol, a 100 ml glucose cul u e was inocula ed a a OD(600 nm) o 0.2, om a sa u a ed p ecul u e g own in galac ose. Samples we e aken a he indica ed imes and assayed o β-galac osidase ac i i y. A ep esen - a i e expe imen is shown 0 20 40 60 80 100 120 log [ß-es adiol] (M) ß-galac osidase (%) -10 -8 -6 -5 -7 -9 0 20 40 60 80 100 120 0 5 10 15 20 25 30 Time (h) ß-galac osidase (%) Loop swi ch-o GAL1p -lacZ gal-glu A B Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 7 o 9 (page numbe no o ci a ion pu poses) easily adap ed o o he euka yo ic cells lacking he Gal4 and Gal80 egula o s. We also measu ed he ho mone dose- esponse o he loop sys em. The le els ob ained a e cul u ing he yeas cells wi h inc easing concen a ions o es adiol a e shown in Fig 4A. Maximal induc ion was obse ed a abou 1 μM and he hal -maximal esponse a 0.05 μM. These alues a e one o de o magni ude highe han hose epo ed o he cons i u i ely exp essed Gal4-ER-VP16 sys em [17] and o he ho mone-dependence o ER in yeas [19,21]. In ac , he dose esponse o he loop sys em does no show he ypical sha p inc ease o ho mone ecep o s, sugges ing ha he sel -induced loop acili a es o ob ain in e media e le els o exp ession. Mo eo e , he ime cou se o he induc ion a sub-op imal ho mone concen- a ion (50 nM) also indica ed an exponen ial kine ic, bu a his ligand concen a ion he loop sys em eached he pla eau 2–4 hou s ea lie han he cul u e ac i a ed wi h 1 μM ho mone (Fig 3B). We also es ed i he ac i e loop could be swi ched-o by emo ing β-es adiol om he medium. As shown in Fig 4B, i e hou s and wo cell duplica ions a e emo ing he ho mone, cells e ained nea ly 70% o he β-galacosi- dase ac i i y. A new einocula ion and eigh mo e hou s we e needed o educe he β-galac osidase ac i i y below 10% o he ini ial alues. The compa ison wi h he swi ch- o o a galac ose-ac i a ed GAL1p ::lacZ, by ans e ing he cells om galac ose o glucose, ules-ou ha he slow inac i a ion o he loop migh be due o he high s abili y o β-galac osidase (Fig 4B). One possible explana ion o hese esul s is ha he esidual amoun s o es adiol emaining inside he cell we e su icien o main ain he ac i a ion o he sys em. An al e na i e explana ion migh be ha , once he egula o y loop has been igge ed, he sys em emains epigene ically ac i e wi hou needing addi ional inpu s. In any case, his cha ac e is ic o he sys em makes i sui able o egula ing gene exp ession in hose indus ial applica ions equi ing he absence o β- es adiol in he inal p oduc . In his s udy we ha e es ed wo new egula ion s a egies: a ansc ip ional cascade and a eed back egula o y loop. In bo h cases we ha e ob ained e y low le els o inc ease in basal ac i i y and conside able le els o induc ion, especially in he eed back loop. Bo h sys ems sha e a basic ea u e: he induce ac s on he ansac i a o simul aneously a wo le els: i s in insic ac i i y and i s abundance. We belie e ha his scheme can be used o imp o e he egula ion capaci y o o he exp ession sys ems, whose egula o s p oduce high basal ac i i y o he a ge p omo e s. Conclusion The coo dina ed con ol o he exp ession o an es ogen- esponsi e ansc ip ional ac i a o wi h i s in insic ac i- a ion ampli ies syne gis ically he egula o y capaci y o he a ge p omo e . The ansc ip ional cascade desc ibed in his wo k, com- posed by a cons i u i ely exp essed Gal4-ER-VP16 ansac- i a o and a GAL1p -d i en es ogen ecep o , does no inc ease he basal ac i i y o he ERE-con aining a ge p omo e , main aining he egula ion e iciency o he p e ious sys em. The sel -induced egula o y loop ha we ha e enginee ed allows a 250- old induc ion o he egula ed gene, wi hou inc easing he basal ac i i y o he a ge p omo e . The global egula ion e iciency o his eed back loop exceeds he es ogen-induced exp ession sys ems ha ha e been p e iously designed o yeas cells. I s ho mone-depend- ence, mo e g adual han he one usually exhibi ed by nuclea ecep o s, allows in e media e le els o egula- ion. The loop sys em does no depend on he speci ic eg- ula o s o he GAL1 p omo e , acili a ing i s adap a ion o o he euka yo ic en i onmen s. Me hods S ain and plasmids The yeas s ains used in his s udy we e W303-1A (MATa ade2-1 can1-100 his3-11, 15 leu2-3,112 p1-1 u a3-1) [23] BY4741 (MATa his3 Δ 1 leu2 Δ 0 me 15 Δ 0 u a3 Δ 0) [24] and he gal4 Δ and gal80 Δ de i a i e o BY4741 conse ed in he EUROSCARF collec ion. Table 1: Plasmids used in his wo k Plasmid Rele an ea u es Re e ence p416GAL1-lacZ URA3, CEN, GAL1p ::lacZ [26] pHCA/GAL4(1-93)ERVP16 HIS3, CEN, ADH1p ::GAL4ERVP16 [17] pVi Bx2 URA3, CEN, ERE-CYC1p ::lacZ [30] pGAL1-ER LEU2, CEN, GAL1p ::ER This s udy p414GAL1-GAL4ERVP16 TRP1, CEN,GAL1p ::GAL4ERVP16 This s udy p415GAL1-GAL4ERVP16 LEU2, CEN,GAL1p ::GAL4ERVP16 This s udy pP6HEG0 human ER [25] pRS415 LEU2, CEN [27] p414GAL1 TRP1, CEN, GAL1p [26] Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 8 o 9 (page numbe no o ci a ion pu poses) All plasmids used in his s udy we e cen ome ic and a e desc ibed in Table 1. Plasmid pGAL1-ER was cons uc ed by inse ing a 2.1 kb BamHI DNA agmen om plasmid pP6HEG0 [25], con aining he cDNA o human es ogen ecep o , in o he BamHI si e p esen in p414GAL1 [26], immedia ely downs eam om he GAL1 p omo e . Plas- mid p414GAL1-GAL4ERVP16 was cons uc ed by inse - ing a 1,5 kb PCR agmen (oligos ATGAAGCTACTGTCTTCTATCGA and TCACTATAG- GGCGAATTGG) om pHCA/GAL4(1-93)ERVP16, encoding he chime ic ansac i a o GAL4ERVP16 [17], in o pGEMT-easy (P omega), gene a ing pGEMT- GAL4ERVP16. A 1.5 kb SpeI agmen om his plasmid was inse ed in o he SpeI si e p esen in p414GAL1 [26], immedia ely downs eam om he GAL1 p omo e . Plas- mid p415GAL1-GAL4ERVP16 was cons uc ed by liga ing he 2.6 kb P uII agmen om p414GAL1-GAL4ERVP16 o he biges P uII agmen o pRS415 [27]. Yeas ans o ma ion was ca ied ou using s anda d me hods [28]. T ans o man s we e ou inely assayed o plasmid s abili y, by eplica-pla ing a e non-selec i e cul u ing. Those ans o man s con aining mo e han one plasmid did no show abno mal le els o plasmid ins a- bili y. Cul u e condi ions Yeas ans o man s we e cul u ed a 30°C in comple e syn he ic medium, wi h 2% glucose o 2% galac ose as he ca bon sou ce [28]. Liquid cul u es we e incuba ed in o bi al shake s a 120 pm. β-es adiol (SIGMA E-1024- 1G) was added when indica ed om a 2.5 mM s ock solu- ion in e hanol. Equi alen amoun s o e hanol we e added o con ol cul u es. β -galac osidase assays β-galac osidase assays we e pe o med as desc ibed p e i- ously [29] using a cell-pe meabiliza ion me hod [28]. Ac i i ies we e calcula ed as Mille uni s. Yeas s ains con- aining epo e s alone we e assayed in he p esence o emp y exp ession ec o s. Expe imen s we e pe o med a leas h ee imes, al hough in igu es ep esen ing ime- cou se expe imen s only one is shown. In all cases he ep- lica e p oduced simila esul s. Compe ing in e es s The Uni e si y o Se ille is cu en ly applying o a pa en co e ing he applica ions o he esul s desc ibed in his wo k. Biomedal, SL p o ided a pa o he unding equi ed o de elop his wo k and has signed a licence ag eemen wi h he Uni e si y o Se ille, in o de o b ing o he ma ke some applica ions o hese esul s. Au ho s' con ibu ions MJQ ca ied ou mos o he expe imen s and con ibu ed o hei design. DM pe o med some expe imen s. MAR pa icipa ed in he design o some expe imen s and con- ibu ed o d a he manusc ip . AC con ibu ed o he design o some expe imen s and, oge he wi h SC, con- cei ed he ini ial app oaches. SC pe o med some expe i- men s, coo dina ed all he wo k and d a ed he manusc ip . Acknowledgemen s We hank D. Pica d o kindly p o iding plasmid pHCA/GAL4(1- 93)ERVP16 and Benjami Piña o plasmids pVi Bx2 and pP6HEG0. This wo k was suppo ed by he Spanish Minis y o Educa ion and Science (FIT-010000-2003-110 and CIT-010000-2005-32), by he Andalusian Go - e nmen (CVI271) and by Biomedal, SL. Re e ences 1. Ce eghino GPL, C egg JM: Applica ions o yeas in bio echnol- ogy: p o ein p oduc ion and gene ic analysis. Cu en Opinion in Bio echnology 1999, 10:422-427. 2. Gellissen G, Hollenbe g CP: Applica ion o yeas s in gene exp ession s udies: a compa ison o Saccha omyces ce e i- siae, Hansenula polymo pha and Kluy e omyces lac is -- a e iew. Gene 1997, 190:87-97. 3. Hinnen A, Bux on F, Chaudhu i B, Heim J, Ho ige T, Meyhack B, Pohlig G: Gene exp ession in ecombinan yeas . Biop ocess Technol 1995, 22:121-193. 4. Goeddel DV: Sys ems o he e ologous gene exp ession. Me h- ods Enzymol 1990, 185:3-7. 5. Hinnen A, Meyhack B, Heim J: He e ologous gene exp ession in yeas . Bio echnology (Reading, Mass) 1989, 13:193-213. 6. Po o D, Saue M, B andua di P, Ma ano ich D: Recombinan p o- ein p oduc ion in yeas s. Mol Bio echnol 2005, 31:245-259. 7. Gellissen G, Melbe K, Janowicz ZA, Dahlems UM, Weydemann U, Pion ek M, S asse AW, Hollenbe g CP: He e ologous p o ein p oduc ion in yeas . An onie Van Leeuwenhoek 1992, 62:79-93. 8. Moun ain HA, Bys om AS, La sen JT, Ko ch C: Fou majo an- sc ip ional esponses in he me hionine/ h eonine biosyn- he ic pa hway o Saccha omyces ce e isiae. Yeas 1991, 7:781-803. 9. K ame RA, DeChia a TM, Schabe MD, Hillike S: Regula ed exp ession o a human in e e on gene in yeas : con ol by phospha e concen a ion o empe a u e. P oc Na l Acad Sci U S A 1984, 81:367-370. 10. Mac eadie IG, Ho ai is O, Ve kuylen AJ, Sa in KW: Imp o ed shu - le ec o s o cloning and high-le el Cu(2+)-media ed exp ession o o eign genes in yeas . Gene 1991, 104:107-111. 11. Wes RW J ., Yocum RR, P ashne M: Saccha omyces ce e isiae GAL1-GAL10 di e gen p omo e egion: loca ion and unc- ion o he ups eam ac i a ing sequence UASG. Mol Cell Biol 1984, 4:2467-2478. 12. Yocum RR, Hanley S, Wes R J ., P ashne M: Use o lacZ usions o delimi egula o y elemen s o he inducible di e gen GAL1-GAL10 p omo e in Saccha omyces ce e isiae. Mol Cell Biol 1984, 4:1985-1998. 13. Fishman GI, Kaplan ML, Bu ick PM: Te acycline- egula ed ca - diac gene exp ession in i o. J Clin In es 1994, 93:1864-1868. 14. Belli G, Ga i E, Pied a i a L, Aldea M, He e o E: An ac i a o / ep esso dual sys em allows igh e acycline- egula ed gene exp ession in budding yeas . Nucleic Acids Res 1998, 26:942-947. 15. Schneide JC, Gua en e L: Vec o s o exp ession o cloned genes in yeas : egula ion, o e p oduc ion, and unde p o- duc ion. Me hods Enzymol 1991, 194:373-388. 16. Johns on MC M.: Regula ion o ca bon and phospha e u iliza- ion. In The Molecula Biology o he Yeas Saccha omyces Volume 2. Edi ed by: Jones EWPJRBJR. Cold Sp ing Ha bo , NY, Cold Sp ing Ha bo Labo a o y P ess; 1992:193–281. Publish wi h BioMed Cen al and e e y scien is can ead you wo k ee o cha ge "BioMed Cen al will be he mos signi ican de elopmen o dissemina ing he esul s o biomedical esea ch in ou li e ime." Si Paul Nu se, Cance Resea ch UK You esea ch pape s will be: a ailable ee o cha ge o he en i e biomedical communi y pee e iewed and published immedia ely upon accep ance ci ed in PubMed and a chi ed on PubMed Cen al you s — you keep he copy igh Submi you manusc ip he e: h p://www.biomedcen al.com/in o/publishing_ad .asp BioMedcen al Mic obial Cell Fac o ies 2007, 6:10 h p://www.mic obialcell ac o ies.com/con en /6/1/10 Page 9 o 9 (page numbe no o ci a ion pu poses) 17. Lou ion JF, Ha aux-Cop B, Pica d D: Fusion o GAL4-VP16 o a s e oid-binding domain p o ides a ool o g a ui ous induc- ion o galac ose- esponsi e genes in yeas . Gene 1993, 131:129-134. 18. S a o d GA, Mo se RH: Ch oma in emodeling by ansc ip- ional ac i a ion domains in a yeas episome. J Biol Chem 1997, 272:11526-11534. 19. Me zge D, Whi e JH, Chambon P: The human oes ogen ecep- o unc ions in yeas . Na u e 1988, 334:31-36. 20. Leskinen P, Michelini E, Pica d D, Ka p M, Vi a M: Bioluminescen yeas assays o de ec ing es ogenic and and ogenic ac i i y in di e en ma ices. Chemosphe e 2005, 61:259-266. 21. Pie a B, Hee y DM, Lemoine Y, Losson R: Func ional analysis o he human es ogen ecep o using a pheno ypic ansac i- a ion assay in yeas . Gene 1992, 119:237-245. 22. A nold SF, Klo z DM, Collins BM, Vonie PM, Guille e LJ J ., McLach- lan JA: Syne gis ic ac i a ion o es ogen ecep o wi h com- bina ions o en i onmen al chemicals. Science 1996, 272:1489-1492. 23. Ro hs ein R, Helms C, Rosenbe g N: Conce ed dele ions and in e sions a e caused by mi o ic ecombina ion be ween del a sequences in Saccha omyces ce e isiae. Mol Cell Biol 1987, 7:1198-1207. 24. B achmann CB, Da ies A, Cos GJ, Capu o E, Li J, Hie e P, Boeke JD: Designe dele ion s ains de i ed om Saccha omyces ce - e isiae S288C: a use ul se o s ains and plasmids o PCR- media ed gene dis up ion and o he applica ions. Yeas 1998, 14:115-132. 25. G een S, Wal e P, Kuma V, K us A, Bo ne JM, A gos P, Chambon P: Human oes ogen ecep o cDNA: sequence, exp ession and homology o -e b-A. Na u e 1986, 320:134-139. 26. Mumbe g D, Mulle R, Funk M: Regula able p omo e s o Sac- cha omyces ce e isiae: compa ison o ansc ip ional ac i - i y and hei use o he e ologous exp ession. Nucleic Acids Res 1994, 22:5767-5768. 27. Siko ski RS, Hie e P: A sys em o shu le ec o s and yeas hos s ains designed o e icien manipula ion o DNA in Saccha- omyces ce e isiae. Gene ics 1989, 122:19-27. 28. Rose MD Wins on, F. and Hie e , P.: Me hods in Yeas Gene ics: A Labo a o y Cou se Manual. Cold Sp ing Ha bo , NY, Cold Sp ong Ha bo Labo a o y P ess; 1990. 29. Cha ez S, Candau R, T uss M, Bea o M: Cons i u i e ep ession and nuclea ac o I-dependen ho mone ac i a ion o he mouse mamma y umo i us p omo e in Saccha omyces ce e isiae. Mol Cell Biol 1995, 15:6987-6998. 30. Ga cia-Reye o N, G au E, Cas illo M, Lopez de Alda MJ, Ba celo D, Pina B: Moni o ing o endoc ine dis up o s in su ace wa e s by he yeas ecombinan assay. En i on Toxicol Chem 2001, 20:1152-1158.