JOURNAL OF BACTERIOLOGY,
0021-9193/00/$04.00⫹0Ma . 2000, p. 1507–1514 Vol. 182, No. 6
Copy igh © 2000, Ame ican Socie y o Mic obiology. All Righ s Rese ed.
A Gene Clus e In ol ed in Me al Homeos asis in he Cyanobac e ium
Synechocys is sp. S ain PCC 6803
MARIO GARCI
´A-DOMI
´NGUEZ, LUIS LOPEZ-MAURY, FRANCISCO J. FLORENCIO, AND JOSE
´C. REYES*
Ins i u o de Bioquı´mica Vege al y Fo osı´n esis, Uni e sidad de Se illa-CSIC, E-41092 Se illa, Spain
Recei ed 18 Oc obe 1999/Accep ed 14 Decembe 1999
A gene clus e composed o nine open eading ames (ORFs) in ol ed in Ni
2ⴙ
,Co
2ⴙ
, and Zn
2ⴙ
sensing and
ole ance in he cyanobac e ium Synechocys is sp. s ain PCC 6803 has been iden i ied. The clus e includes an
Ni
2ⴙ
esponse ope on and a Co
2ⴙ
esponse sys em, as well as a Zn
2ⴙ
esponse sys em p e iously desc ibed.
Exp ession o he Ni
2ⴙ
esponse ope on (n s) was induced in he p esence o Ni
2ⴙ
and Co
2ⴙ
. Reduced Ni
2ⴙ
ole ance was obse ed ollowing dis up ion o wo ORFs o he ope on (n sA and n sD). We also show ha he
n sD gene encodes a pu a i e Ni
2ⴙ
pe mease whose ca boxy- e minal egion is a me al binding domain. The
Co
2ⴙ
esponse sys em is composed o wo di e gen ly ansc ibed genes, co R and co T, mu an s o which
showed dec eased Co
2ⴙ
ole ance. Addi ionally, co R mu an s showed an absence o Co
2ⴙ
-dependen induc ion
o co T, indica ing ha Co R is a ansc ip ional ac i a o o co T. To ou knowledge, Co R is he i s
Co
2ⴙ
-sensing ansc ip ion ac o desc ibed. Ou da a sugges ha his egion o he Synechocys is sp. s ain
PCC 6803 genome is in ol ed in sensing and homeos asis o Ni
2ⴙ
,Co
2ⴙ
, and Zn
2ⴙ
.
A abo e c i ical concen a ions, essen ial ansi ion me al
ions such as Ni
2⫹
,Co
2⫹
, and Zn
2⫹
a e oxic, being, o exam-
ple, po en inhibi o s o p ocesses such as espi a ion and pho-
osyn hesis (see, o example, e e ences 4, 22, 28, and 39). In
addi ion, ansi ion me als a e equi ed o he ca aly ic ac i i y
o a numbe o enzymes because o hei edox ac i i y and
hei high cha ge densi y, which allows he pola iza ion o
subs a es and he s abiliza ion o ansi ion s a e in e medi-
a es. Bac e ia ha e e ol ed sensing, seques e ing, and ans-
po sys ems ha allow a p ecise homeos asis o hese me als.
Du ing he las yea s i has became clea ha mic obial
Ni
2⫹
,Zn
2⫹
, and Co
2⫹
up ake is media ed by nonspeci ic ans-
po sys ems o di alen ca ions (33) and by high-a ini y spe-
ci ic sys ems. Two ypes o high-a ini y anspo e s ha e been
iden i ied: (i) mul icomponen ATP-binding casse e anspo
sys ems (such as NikABCDE o Ni
2⫹
o ZnuABC o Zn
2⫹
)
(31, 37) and (ii) one-componen anspo e s (such as NixA,
U eH, HupN, and HoxN o Ni
2⫹
and NhlF o Co
2⫹
) (12, 16,
23, 27, 29) which a e in eg al memb ane p o eins wi h eigh
ansmemb ane-spanning helices.
Mos o he s udies on Co
2⫹
,Zn
2⫹
, and Ni
2⫹
expo and
esis ance ha e been ca ied ou wi h he soil chemoli ho o-
phic Alcaligenes s ains (now designed Rals onia), whe e h ee
sequence- ela ed di alen ca ion e lux ope ons, called czc
( o Cd
2⫹
,Zn
2⫹
, and Co
2⫹
esis ance) (32), cn ( o Co
2⫹
and
Ni
2⫹
esis ance) (25), and ncc ( o Ni
2⫹
,Co
2⫹
, and Cd
2⫹
e-
sis ance) (47), ha e been desc ibed. Zn
2⫹
-dependen e lux
ATPases ha e been ecen ly cha ac e ized o Esche ichia coli
(zn A) (3) and o he cyanobac e ium Synechocys is sp. s ain
PCC 6803 (ziaA) (51). Zn A and ZiaA belong o he P- ype
ATPase amily ( ecen ly e iewed in e e ence 40), which in-
cludes he bac e ial Cd
2⫹
anspo e CadA (34) and bac e ial
Cu
2⫹
anspo e s (20, 35, 38).
Much less is known abou how Ni
2⫹
,Zn
2⫹
, and Co
2⫹
a e
sensed and how me al binding p o okes p o ein con o ma-
ional changes ha de e mine egula o y esponses. Two ypes
o Zn
2⫹
- esponsi e egula o s ha e been ecen ly desc ibed.
Zn R is a Me R-like ansc ip ional ac i a o o zn A exp es-
sion in E. coli (7). In con as , Synechococcus sp. s ain PCC
7942 Sm B (19), Synechocys is sp. s ain PCC 6803 ZiaR (51),
and S aphylococcus au eus Zn R (49) a e ansc ip ional e-
p esso s ha belong o he A sR-Sm A amily o helix- u n-
helix DNA binding p o eins. Al hough he o e all e na y
s uc u e o hese ep esso s is conse ed, he me al binding
si e may be unique o each speci ic membe o he amily (9).
Regula ion o he czc e lux ope on o Rals onia eu opha is
cu en ly unde ac i e s udy, and a leas h ee p o eins, CzcD,
CzcR, and CzcS, seem o be in ol ed in me al sensing (55).
The only nickel-speci ic esponsi e egula o epo ed is NikR,
a Fu - ela ed DNA binding p o ein ha ep esses he an-
sc ip ion o he E. coli nikABCDE ope on in he p esence o
high Ni
2⫹
concen a ions (11). Finally, no Co
2⫹
-speci ic senso
p o eins ha e been epo ed so a .
We epo in he p esen wo k he iden i ica ion and cha -
ac e iza ion o a me al- egula ed gene clus e in he unicellula
cyanobac e ium Synechocys is sp. s ain PCC 6803. The clus e
comp ises nine open eading ames (ORFs) o ganized in o
i e ansc ip ional uni s and seems o be esponsible o Ni
2⫹
,
Co
2⫹
, and Zn
2⫹
homeos asis in Synechocys is sp. s ain PCC
6803.
MATERIALS AND METHODS
S ains and g ow h condi ions. Synechocys is sp. s ain PCC 6803 was g own
pho oau o ophically a 30°C in BG11 medium (43) supplemen ed wi h1go
NaHCO
3
pe li e (BG11C) and bubbled wi h a con inuous s eam o 1% ( ol/
ol) CO
2
in ai unde con inuous illumina ion (50 ␮mol o pho ons pe m
2
pe
s; whi e ligh om luo escen lamps). Fo pla e cul u es, BG11C liquid medium
was supplemen ed wi h 1% (w / ol) aga . Kanamycin was added o a inal
concen a ion o 50 o 200 ␮g/ml when equi ed. BG11C medium was supple-
men ed wi h di e en concen a ions o ZnSO
4
, CdCl
2
, CoCl
2
, CuSO
4
, NiSO
4
,
and MgCl
2
when indica ed.
E. coli DH5␣(Be hesda Resea ch Labo a o ies) g own in Lu ia b o h medium
as desc ibed p e iously (46) was used o plasmid cons uc ion and eplica ion.
E. coli BL21 g own in Lu ia b o h medium supplemen ed wi h 2% glucose was
used o exp ession o glu a hione S- ans e ase (GST)–C-N sD o GST p o-
eins. E. coli s ains we e supplemen ed wi h 100 ␮g o ampicillin pe ml when
equi ed.
Inse ional mu agenesis o Synechocys is sp. s ain PCC 6803 genes. Loci
sl 0794, sl 0796, sl 0797, and sll0794 we e inac i a ed by in e up ion wi h a
kanamycin esis ance casse e (C.K1) (14). Fo his, DNA agmen s con aining
* Co esponding au ho . Mailing add ess: Ins i u o de Bioquı´mica
Vege al y Fo osı´n esis, Cen o de In es igaciones Cien ı´ icas Isla de la
Ca uja, C/. Ame´ ico Vespucio s/n, 41092 Se illa, Spain. Phone: 34
954489518. Fax: 34 954460065. E-mail: [email p o ec ed].
1507
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om
loci sl 0794, sl 0796, sl 0797, and sll0794 we e ampli ied by PCR om he cosmid
CS1377 (p o ided by Kazusa DNA Resea ch Ins i u e) and cloned in o pGEM-T
(P omega). sl 0794 was ampli ied by using oligonucleo ides ni 1 and ni 2 (Table
1) and cloned in o pGEM-T o gene a e pNIQ7. Ta ge ing ec o s we e gene -
a ed by inse ing he C.K1 casse e in o he EcoRI si e o sl 0794 in he same
o ien a ion as he n s ope on [pNIQ8(⫹)] o in he in e se o ien a ion
[pNIQ8(⫺)]. sl 0796 was ampli ied by using oligonucleo ides n p1 and n p2
(Table 1) and cloned in o pGEM-T o gene a e pNIQ1. Ta ge ing ec o s we e
gene a ed by inse ing he C.K1 casse e in o he Bs EII si e o sl 0796 in he
same o ien a ion as he n s ope on [pNIQ2(⫹)] o in he in e se o ien a ion
[pNIQ2(⫺)]. sl 0797 was ampli ied by using oligonucleo ides co 1 and co 2
(Table 1) and cloned in o pGEM-T o gene a e pNIQ10. The a ge ing ec o
was gene a ed by inse ing he C.K1 casse e in o he EcoNI si e o sl 0797 in he
opposi e o ien a ion o he sl 0797 gene (pNIQ12). sll0794 was ampli ied by
using oligonucleo ides m 1 and m 2 (Table 1) and cloned in o pGEM-T o
gene a e pNIQ3. The a ge ing ec o was gene a ed by inse ing he C.K1
casse e in o he HindIII si e o sll0794 in he same o ien a ion as he sll0794
ORF [pNIQ4(⫹)]. All a ge ing ec o s we e used o ans o m Synechocys is sp.
s ain PCC 6803 s ain as p e iously desc ibed (15).
Co ec in eg a ion and comple e seg ega ion o he mu an s ains we e
es ed by Sou he n blo ing. Fo his, o al DNA om cyanobac e ia was isola ed
as p e iously desc ibed (8). DNA was diges ed and elec opho esed in 0.7%
aga ose gels in a T is-bo a e-EDTA bu e sys em (46), and hen DNA was
ans e ed o nylon Z-p obe memb anes (Bio-Rad, He cules, Cali .). DNA
p obes we e
32
P labeled wi h a andom-p ime ki (Pha macia, Uppsala, Sweden)
using [␣-
32
P]dCTP (3,000 Ci/mmol).
RNA isola ion and No he n blo hyb idiza ion. To al RNA was isola ed om
25-ml samples o Synechocys is sp. s ain PCC 6803 cul u es a he mid-exponen-
ial g ow h phase (3 o 5 ␮g o chlo ophyll/ml). Ex ac ions we e pe o med by
o exing cells in he p esence o phenol-chlo o o m and acid-washed baked
glass beads (0.25- o 0.3-mm diame e ; B aun, Melsungen, Ge many) as p e i-
ously desc ibed (17).
Fo No he n blo analyses, 15 ␮g o o al RNA was loaded pe lane and
elec opho esed in 1.2% aga ose dena u ing o maldehyde gels. T ans e o
nylon memb anes (Hybond N-Plus; Ame sham), p ehyb idiza ion, hyb idiza ion,
and washes we e in acco dance wi h Ame sham ins uc ion manuals. P obes o
No he n blo hyb idiza ion we e PCR syn hesized using he ollowing oligonu-
cleo ides pai s: nia3-nia4, p obe a; n p1-n p2, p obe b; m 1-m 2, p obe c; and
co 1-co 2, p obe d(Table 1). DNA p obes we e
32
P labeled wi h a andom-
p ime ki (Pha macia) using [␣-
32
P]dCTP (3,000 Ci/mmol). All o he il e s
we e s ipped and ep obed wi h a HindIII-BamHI 580-bp p obe om plasmid
pAV1100 ha con ains he cons i u i ely exp essed RNase P RNA gene ( npB)
om Synechocys is sp. s ain PCC 6803 (56). To de e mine coun s pe minu e o
adioac i e a eas in No he n blo hyb idiza ions, an Ins an Image Elec onic
Au o adiog aphy appa a us (Packa d Ins umen Company, Me iden, Conn.)
was used.
Pu i ica ion o GST–C-N sD and me al a ini y ch oma og aphy. The las 126
bp o he n sD ORF, which encodes he las 42 amino acids o N sD, was
ampli ied by PCR using he oligonucleo ides n h1 and n h2 (Table 1). The
esul ing DNA agmen was diges ed wi h EcoRI and XhoI and cloned in o
pGEX-4T-3 in phase wi h he GST gene o gene a e pGEX-C-N sD. GST–C-
N sD usion p o ein and GST we e exp essed in E. coli BL21 om he plasmids
pGEX-C-N sD and pGEX-4T-3, espec i ely. One li e o cul u e was g own in
Lu ia b o h medium supplemen ed wi h 2% glucose o an op ical densi y a 600
nm o 0.6, induced wi h 1 mM isop opyl-␤-D- hiogalac opy anoside o 2.5 h,
ha es ed by cen i uga ion, and esuspended in 20 ml o phospha e-bu e ed
saline bu e (150 mM NaCl, 16 mM Na
2
HPO
4
,4mMNaH
2
PO
4
, pH 7.2)
supplemen ed wi h 1 mM phenylme hylsul onyl luo ide. Cells we e b oken by
sonica ion, and insoluble deb is was pelle ed by cen i uga ion a 18,000 ⫻g o
15 min. The supe na an was hen applied o a glu a hione-aga ose bead column
(Pha macia) (1-ml bed olume). A e ex ensi e washing wi h phospha e-bu -
e ed saline bu e , GST o GST–C-N sD p o eins we e elu ed wi h 3 ml o 50
mM T is HCl (pH 8.0) con aining 10 mM educed glu a hione. Glu a hione was
hen emo ed by gel il a ion in a Sephadex G-25 column. In e ac ion o GST–
C-N sD o GST wi h Ni
2⫹
,Co
2⫹
,Zn
2⫹
,Cu
2⫹
,o Mg
2⫹
was in es iga ed by
me al ion a ini y ch oma og aphy. A 0.5-ml po ion o His-bind esin (No agen)
was loaded wi h 0.5 ml o 0.5 M ZnSO
4
, CoCl
2
, CuSO
4
, NiSO
4
, o MgCl
2
in
wa e and hen equilib a ed in 0.5 M sodium chlo ide–50 mM T is HCl (pH 8.0)
(bu e A). Abou 30 ␮g o pu i ied GST–C-N sD o GST p o eins we e applied
o he columns. Unbound p o eins we e emo ed by washing wi h bu e A.
Bound polypep ides we e elu ed wi h 0.5 ml o 0.4 M imidazole in bu e A.
P o eins we e hen analyzed by sodium dodecyl sul a e-polyac ylamide gel elec-
opho esis (SDS-PAGE) (24) and Coomassie blue s aining. Quan i ies o bound
and unbound p o eins we e de e mined by he me hod o B ad o d (5).
Compu e me hods. The BLAST p og am (1) was used o sc een he ans-
la ed nucleo ides da abases. The CLUSTAL X p og am was used o gene a e
sequence alignmen s (53). Pu a i e memb ane-spanning egions we e iden i y
using di e en algo i hms (18, 57).
RESULTS AND DISCUSSION
A me al- egula ed gene clus e in Synechocys is sp. s ain
PCC 6803. Analysis o he ully sequenced Synechocys is sp.
s ain PCC 6803 genome (21) allowed us o iden i y a egion o
he ch omosome con aining h ee ORFs whose deduced
amino acid sequences a e clea ly ela ed o me al anspo
p o eins (see below). The egion ex ends 12 kb and comp ises
nine genes o ganized in o i e pu a i e ansc ip ion uni s (Fig.
1A). ORF sl 0798 has been epo ed o encode a Zn
2⫹
-depen-
den e lux ATPase (ZiaA) whose exp ession is Zn
2⫹
depen-
den (51). A pu a i e ope on composed o wo ORFs, sll0793
and sll0792, sepa a ed by 11 bp appea s ups eam om he
ziaA gene and in he opposi e o ien a ion. sll0792 encodes
ZiaR, he ansc ip ional ep esso o ziaA. sll0793 is a pu a i e
memb ane p o ein ha does no sha e signi ican homology
wi h any o he p o ein in he EMBL-GenBank da abase (51).
Me al-dependen exp ession o he emaining h ee pu a i e
ansc ip ional uni s was analyzed by No he n blo ing. Fo
his, ou p obes we e used o hyb idize o al RNA ob ained
om mid-log-phase Synechocys is sp. s ain PCC 6803 cells
g own in BG11C medium and exposed du ing1h oa15␮M
concen a ion o ei he ZnSO
4
, CdCl
2
, CoCl
2
, CuSO
4
, NiSO
4
,
o MgCl
2
(Fig. 1B). Con ol cells we e no exposed o added
me als. P obes a(in e nal o sl 0793) and b(in e nal o
sl 0796) hyb idized s ongly wi h RNA ob ained om Ni
2⫹
-
exposed Synechocys is sp. s ain PCC 6803 cells and weakly
wi h RNA om Co
2⫹
-exposed cells. P obe c(ORF sll0794)
showed no hyb idiza ion wi h RNA om any o he condi ions
es ed. P obe d, co esponding o ORF sl 0797, hyb idized
s ongly wi h RNA om Co
2⫹
-exposed cells and weakly wi h
RNA om Zn
2⫹
-exposed cells. T ansc ip le els o he RNase
P RNA ( npB gene) (56) emained unchanged unde all es ed
condi ions (Fig. 1B).
These esul s demons a e he me al-dependen exp ession
o wo o he ansc ip ion uni s o he egion. These da a,
oge he wi h he esul s o Thelwell e al. (51) abou ziaA and
ziaR genes, allow us o de ine he exis ence o a me al- egu-
la ed gene clus e in Synechocys is sp. s ain PCC 6803.
n s is a nickel esis ance ope on. As shown abo e, a simila
pa e n o induc ion was ound using p obes om ORFs
sl 0793, and sl 0796 (Fig. 1B). The ac ha bo h p obes hy-
b idized wi h RNA o abou 6 kb, oge he wi h he s uc u e
o he egion, sugges s ha ORFs sl 0793, sl 0794, sl 0795, and
sl 0796 o m a ansc ip ional uni . Since Ni
2⫹
p o oked he
highes induc ion o his ansc ip ion uni , he genes we e
named n s o Ni
2⫹
esponse sys em. The n s induc ion depen-
dence on concen a ion was s udied by using No he n blo
expe imen s. The ope on was induced a Ni
2⫹
concen a ions
o abo e 0.45 ␮M. An Ni
2⫹
concen a ion o abo e 17 ␮M did
no p o oke highe accumula ion o he n s mRNA (Fig. 2A
TABLE 1. Oligonucleo ides used in his wo k
Oligo-
nucleo ide Sequence
nia3 .....................5⬘CCCAATTTGAGGTGGTGTGATG3⬘
nia4 .....................5⬘ATAAAGGCAAGGGCTAGAGCAG3⬘
n p1.....................5⬘CCCATATGGGCAAACTACCGCCTATC3⬘
n p2.....................5⬘CGGGTAGTTTAAGGACTCGCC3⬘
m 1......................5⬘AGAAGGGGGAGTTACAACCATGC3⬘
m 2......................5⬘AGGCGAGTCCTTAAACTACCG3⬘
co 1.....................5⬘GATCATCCCGATGCAGTGGCG3⬘
co 2.....................5⬘GCACAGGGAGAAGCCACCACG3⬘
ni 1......................5⬘CGGTGCGCTCTTCTTCTAAGG3⬘
ni 2......................5⬘TTAGTGCGTAGTCCCCGATAG3⬘
n h1.....................5⬘GATGGAATTCAGGATTTTGGCACGAACATTC3⬘
n h2.....................5⬘AAAGCTCGAGAGGGAAAGGATGGTGAAAG3⬘
1508 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om
and da a no shown). Time cou se analysis indica ed ha n s
mRNA was al eady induced 15 min a e me al addi ion and
inc eased almos linea ly, a leas du ing he i s 4ho ea -
men (Fig. 2B and C).
In o de o ge in o ma ion abou he unc ion o n s genes,
we ha e analyzed hei deduced amino acid sequences. The
ORF sl 0793 (n sB) and sl 0794 (n sA) p oduc s showed clea
sequence simila i y wi h he R. eu opha czcB and czcA gene
p oduc s, espec i ely (32). While N sA displays 35% iden i y
and 55% simila i y wi h CzcA h oughou he en i e amino
acid sequence, N sB and CzcB show signi ican simila i y (34%
iden i y and 45% simila i y) only in a cen al 80-amino-acid
egion ( om amino acid 54 o 132 o he N sB sequence). The
czcABC gene p oduc s o m a memb ane-bound p o ein com-
plex ca alyzing Co
2⫹
,Zn
2⫹
, and Cd
2⫹
e lux by a p o on/ca ion
an ipo e in R. eu opha. CzcA is hough o be he inne
memb ane p o ein esponsible o he e lux ac i i y (48). CzcB
is a pe iplasmic p o ein p obably in ol ed in memb ane usion
ha b idges he inne and he ou e cell memb anes o g am-
nega i e bac e ia (41). The p o ein encoded by ORF sl 0795
(n sC) is no homologous o p o eins encoded by he czc o
ela ed ope ons. In e es ingly, he N sC ca boxy- e minal (C-
e minal) egion sha es signi ican simila i y (26 o 30% iden-
i y in abou 140 amino acids) wi h Neisse ia gono hoeae au-
olysin A and bac e iophage-encoded lysozymes. In addi ion,
compu e analysis o he N sC sequence indica ed he exis-
ence o wo pu a i e ansmemb ane helices in he amino-
e minal egion o he p o ein (amino acids 24 o 47 and 70 o
89 om he N sC sequence). Finally, he sl 0796 (n sD) p od-
uc is a 445-amino-acid p o ein which shows signi ican amino
acid sequence iden i y o he n eB gene p oduc . The n e locus
was iden i ied as a low-le el Ni
2⫹
esis ance de e minan in
Alcaligenes xylosoxidans 31A (47), di e en om he high-le el
Ni
2⫹
esis ance de e minan (ncc) homologous o he czc sys-
em.
The homologies displayed by he N s p o eins oge he wi h
he pa e n o exp ession o hei genes sugges ed ha he N s
sys em is in ol ed in Ni
2⫹
and Co
2⫹
ole ance in Synechocys is
sp. s ain PCC 6803. In o de o e i y his hypo hesis, wo
di e en n s mu an s we e gene a ed by inse ion o kanamycin
esis ance casse es (C.K1) (14) in o he n sA and n sD genes
(Fig. 3A). In o de o abolish pola e ec s, C.K1 casse es we e
inse ed in bo h o ien a ions. Since he C.K1 casse e is lacking
a ansc ip ion e mina o (J. C. Reyes, unpublished obse a-
ion), inse ional mu agenesis in he same o ien a ion as he
n s ope on does no supp ess ansc ip ion o he genes down-
s eam o he inse ion poin . Simila esul s we e ob ained o
bo h o ien a ions, and he e o e only mu an s wi h he np
gene in he same o ien a ion as he n s genes a e shown.
n sA::C.K1 and n sD::C.K1 Synechocys is s ains we e iable,
and hei g ow h a es in BG11C medium we e compa able o
hose o he wild- ype s ain (da a no shown). G ow h o
FIG. 1. Me al-dependen exp ession o he Synechocys is ansi ion me al- esis an clus e . (A) ORF o ganiza ion o he me al- egula ed clus e om Synechocys is
sp. s ain PCC 6803. (B) To al RNA was isola ed om mid-log-phase Synechocys is sp. s ain PCC 6803 cells exposed o 1h oa15␮M concen a ion o he indica ed
me al ions. Con ol cells we e no exposed o added me als (⫺). Fi een mic og ams o o al RNA was dena u ed, sepa a ed by elec opho esis in a 1.2% aga ose gel,
blo ed, and hyb idized wi h p obes a o das indica ed in panel A (see Ma e ials and Me hods). The il e s we e s ipped and ehyb idized wi h an npB gene p obe
as a con ol. Es ima ed sizes o he ansc ip s (in nucleo ides [n]) a e indica ed.
VOL. 182, 2000 A METAL TOLERANCE GENE CLUSTER IN CYANOBACTERIA 1509
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om
n sA::C.K1 and n sD::C.K1 mu an s was also examined in
Zn
2⫹
-, Ni
2⫹
-, and Co
2⫹
-supplemen ed BG11C medium. No -
mal g ow h was obse ed in Zn
2⫹
-o Co
2⫹
-con aining medium
(da a no shown); howe e , a educed ole ance o Ni
2⫹
was
clea ly obse ed o bo h n s mu an s (Fig. 3B). In e es ingly
he le el o Ni
2⫹
ole ance o he n sA::C.K1 s ain was lowe
han ha o he n sD::C.K1 s ain. While n sA::C.K1 mu an s
we e unable o g ow in medium con aining 7 ␮MNi
2⫹
,
n sD::C.K1 mu an cells we e sensi i e only o concen a ions
o abo e 12 ␮MNi
2⫹
. These da a sugges ha N sD and N sA
migh o m pa o wo independen sys ems o Ni
2⫹
ole -
ance. This is in good ag eemen wi h he da a epo ed o A.
xylosoxidans, whe e he ncc and n e loci o m wo independen
sys ems o Ni
2⫹
esis ance (47). Since n sB- and n sA-homol-
ogous genes has been ound o be in ol ed in hea y-me al
e lux, i seems logical o specula e ha he N sB and N sA
p o eins o m an Ni
2⫹
e lux sys em in Synechocys is sp. s ain
PCC 6803. A di e ence be ween he N s sys em om Synecho-
cys is sp. s ain PCC 6803 and he Czc sys em om R. eu opha
is he lack o a CzcC homolog in he cyanobac e ial Ni
2⫹
esponse sys em. Dele ion o he czcC gene esul s in a loss o
Cd
2⫹
and Co
2⫹
esis ance, bu no Zn
2⫹
esis ance, sugges ing
ha CzcC is in ol ed in subs a e speci ici y bu no in he
anspo ac i i y o he complex (32).
The amino- e minal pa o N sD is a me al binding do-
main. As p e iously men ioned, he closes N sD homolog is
he p oduc o he A. xylosoxidans n eB gene, which has no
been cha ac e ized. N sD shows also e y signi ican sequence
simila i y o se e al membe s o he majo acili a o supe -
amily (MFS) (36). MFS anspo e s a e single polypep ides,
con aining 12 o 14 ansmemb ane-spanning egions, capable
o anspo ing small solu es in esponse o a chemiosmo ic
g adien . Compu e analysis o he N sD amino acid sequence
indica ed he exis ence o 12 pu a i e ansmemb ane helices
dis ibu ed along he i s 400 amino acids o he p o ein (Fig.
4A). These da a, aken oge he wi h he pheno ype o he
n sD mu an s, sugges ha N sD is a membe o he MFS o
pe meases in ol ed in Ni
2⫹
expo . In e es ingly, he N sD
p o ein does no show sequence simila i y wi h a amily o
well-cha ac e ized Ni
2⫹
pe meases including U eH, HupN,
and HoxN (12, 16, 27). These p o eins show a common opol-
ogy, wi h eigh memb ane-spanning segmen s. The second
ansmemb ane helix includes a pu a i e Ni
2⫹
binding mo i
(HX
4
DH) whose mu a ion comple ely abolishes anspo ac-
i i y (13). This mo i is no p esen in he pu a i e ansmem-
b ane helices o N sD. The s ongly hyd ophilic C- e minal
pa o N sD con ains a ema kably high numbe o his idine
esidues (12 ou o 40 amino acids), which a e gene ally con-
side ed o be po en ial me al ligands. In o de o es whe he
his domain o N sD is in ol ed in me al binding, a chime ic
p o ein comp ising amino acids 403 o 445 o N sD (C-N sD)
used o he GST was exp essed in E. coli (Fig. 4B). The
GST–C-N sD usion p o ein was pu i ied by a ini y ch oma-
og aphy on glu a hione-aga ose. One majo band o abou 31
kDa ( usion p o ein be ween he GST [26 kDa] and he C-
N sD domain [5 kDa]) was isible a e SDS-PAGE and Coo-
massie blue s aining. In e ac ion o GST o GST–C-N sD wi h
Ni
2⫹
,Co
2⫹
,Zn
2⫹
,Cu
2⫹
, and Mg
2⫹
was e alua ed by me al
a ini y ch oma og aphy. Fo his, GST o GST–C-N sD usion
p o eins we e loaded in o His-bind esin chela ing columns
cha ged wi h he app op ia e ions. Abou 90% o he GST–C-
N sD usion p o ein was e ained by he Ni
2⫹
-, Co
2⫹
-, and
Cu
2⫹
-con aining columns (Fig. 4C and D). Abou 60% o he
GST–C-N sD p o ein was also e ained in he Zn
2⫹
-con aining
column. In con as , GST–C-N sD was no e ained in he
Mg
2⫹
-cha ged column (Fig. 4C and D). GST p o ein was no
e ained by any o he me al columns (Fig. 4C). These esul s
suppo a ole o he hyd ophilic C- e minal pa o N sD as
a me al binding domain. Ou da a sugges ha his domain has
a low speci ici y o me al binding, which has been p e iously
shown o his idine- ich p o eins (58). His idine- ich domains
ha e been ound in U eE, HypB, and CooJ, which a e small
soluble p o eins ha a e in ol ed in p ocessing Ni
2⫹
o u ease
and hyd ogenases (30, 42, 58). In e es ingly, i has been shown
ha a unca ed e sion o U eE which lacks he his idine- ich
C- e minal egion s ill binds Ni
2⫹
and unc ions in i o (6).
O ganisms wi h high-a ini y up ake sys ems o Ni
2⫹
ha e
U eE-like p o eins lacking he his idine- ich egion (26), lead-
ing o he sugges ion ha he his idine- ich egion unc ions o
s o e Ni
2⫹
ions (6). One possibili y is ha he his idine- ich
C- e minal egion o N sD is used o s o e me al ions ha a e
going o be anspo ed.
FIG. 2. Ni
2⫹
concen a ion dependence and ime cou se o he exp ession o
n s. (A) The indica ed concen a ion o NiSO
4
was added o mid-log-phase
Synechocys is sp. s ain PCC 6803 cells g own in BG11C medium. A e 1 h, cells
we e ha es ed and o al RNA was isola ed, p ocessed, and hyb idized as de-
sc ibed o Fig. 1, using an n sB gene p obe (p obe a[Fig. 1]). (B) A 17 ␮M
concen a ion o NiSO
4
was added o mid-log-phase Synechocys is sp. s ain PCC
6803 cells g own in BG11C medium. Samples o o al RNA isola ion we e aken
a he indica ed imes. RNA was p ocessed and hyb idized as o Fig. 1, using an
n sB gene p obe. (C) Radioac i e signals o he ime cou se expe imen we e
quan i ied wi h a Ins an Image Elec onic Au o adiog aphy appa a us. Le els o
n s ope on mRNA we e no malized wi h he npB signal, and plo s o ela i e
mRNA le els e sus ime we e d awn.
1510 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om
A Me R- ela ed ansc ip ion ac i a o in ol ed in Co
2ⴙ
sensing. The n s ope on was induced by Co
2⫹
(Fig. 1), sug-
ges ing ha i migh be in ol ed in Co
2⫹
ole ance. Howe e ,
n sD::C.K1 and n sA::C.K1 mu an cells did no show educed
ole ance o Co
2⫹
. These da a oge he wi h he pa e n o
hyb idiza ion ob ained wi h p obe din Fig. 1 sugges ed he
exis ence o an al e na i e sys em in ol ed in Co
2⫹
homeos a-
sis. The ORF sl 0797 p oduc sha es clea homology wi h ca -
FIG. 3. Ni
2⫹
ole ance o Synechocys is n sA::C.K1 and n sD::C.K1 mu an s. (A) Schema ic ep esen a ion o he n s genomic egion in he wild- ype s ain and si es
o inse ion o he C.K1 casse e in he n sA::C.K1 and n sD::C.K1 mu an s. The C.K1 casse e was inse ed in bo h o ien a ions, as indica ed. B, Bs EII; E, EcoRI. (B)
Ni
2⫹
ole ance o wild- ype Synechocys is sp. s ain PCC 6803 (WT) and Synechocys is n sA::C.K1 and n sD::C.K1 mu an s. Mu an s wi h he C.K1 casse e in he same
o ien a ion as he n s genes a e shown. Ten old se ial dilu ions we e spo ed on BG11C pla es, supplemen ed wi h he indica ed concen a ions o NiSO
4
, and
pho og aphed a e 10 days o g ow h.
FIG. 4. Analysis o N sD p o ein. (A) P edic ion o N sD memb ane-spanning egions. The p obabili y o ansmemb ane egions was calcula ed by using he
TM-p ed p og am (18). (B) Schema ic ep esen a ion o GST–C-N sD p o ein. The chime ic p o ein comp ises amino acids 403 o 445 o N sD (C- e minal domain,
C-N sD) used o GST. His idine esidues a e unde lined. (C and D) The in e ac ion o GST o GST–C-N sD p o eins wi h me als was analyzed by me al
ch oma og aphy. His-bind esin columns we e loaded wi h ei he Mg
2⫹
,Ni
2⫹
,Zn
2⫹
,Co
2⫹
,o Cu
2⫹
. Abou 30 ␮g o pu i ied GST–C-N sD o GST was applied o he
columns. Unbound (lanes U) ( low h ough) and bound (lanes B) (imidazole-elu ed) ac ions we e analyzed by SDS-PAGE (12% polyac ylamide) and Coomassie blue
s aining (C), and p o ein was quan i ied by he me hod o B ad o d (5). (D).
VOL. 182, 2000 A METAL TOLERANCE GENE CLUSTER IN CYANOBACTERIA 1511
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om

ion- anspo ing P- ype ATPases, such as he bac e ial Cd
2⫹
anspo e CadA o he bac e ial Cu
2⫹
anspo e s C aA,
PacS, CopA, and CopB ( e iewed in e e ence 40). The closes
homolog o he sl 0797 p oduc is ZiaA (sl 0798), he Zn
2⫹
-
dependen ATPase om Synechocys is sp. s ain PCC 6803
(51), encoded by ano he gene o he clus e (Fig. 1A). Induc-
ion o sl 0797 mRNA by Co
2⫹
sugges ed ha he sl 0797 gene
p oduc migh be in ol ed in he homeos asis o his ca ion.
This hypo hesis was in es iga ed by in e up ing he sl 0797
gene wi h a kanamycin esis ance casse e (Fig. 5A) and es ing
he me al ole ance o he esul ing mu an s ain. G ow h o
sl 0797::C.K1 mu an s in Zn
2⫹
-, Ni
2⫹
-, and Co
2⫹
-supple-
men ed BG11C medium was examined. No mal g ow h was
obse ed in Zn
2⫹
-o Ni
2⫹
-con aining medium (da a no
shown); howe e , a educed ole ance o Co
2⫹
was de ec ed
(Fig. 5B). This esul indica es ha he sl 0797 ORF is in ol ed
in Co
2⫹
ole ance. Since he sl 0797 p oduc shows clea ho-
mology wi h ca ion- anspo ing P- ype ATPases, ou da a
poin o he sl 0797 p oduc as a Co
2⫹
e lux pump. Based on
his ole in Co
2⫹
anspo , he sl 0797 ORF was designed co T
( o cobal esponse anspo e ). The ac ha co T is also
weakly induced by Zn
2⫹
sugges s ha his ATPase migh be
in ol ed in Zn
2⫹
ole ance. Howe e , he co T mu an cells did
no show educed Zn
2⫹
ole ance. A p obable eason o his
esul is he exis ence o a Zn
2⫹
-speci ic ATPase, ZiaA, able o
con ol Zn
2⫹
homeos asis (51). Ano he possibili y is ha
Zn
2⫹
is a g a ui ous induce o co T gene exp ession.
A 81 bp ups eam o co T and in he opposi e o ien a ion
appea s he ORF sll0794 (Fig. 1A). Sequence analysis e ealed
ha sll0794 encodes a 370-amino-acid p o ein wi h wo di e -
en domains. Thus, he amino- e minal domain (amino acids
10 o 70) sha es s ong simila i y wi h he DNA binding do-
mains o componen s o he Me R amily o DNA binding
p o eins (50). In con as , he C- e minal egion, om amino
acid 170 o 358, shows signi ican simila i y (30% iden i y in
180 amino acids) o p eco in isome ases (p eco in-8x me h-
ylmu ases) om di e en o igins (Fig. 6) (10, 52). P eco in
isome ase, he p oduc o he gene cobH, is in ol ed in he
FIG. 5. Co
2⫹
ole ance o Synechocys is co T::C.K1 and co R::C.K1 mu an s. (A) Schema ic ep esen a ion o he co R-co T genomic egion. The si es o inse ion
o he C.K1 casse e in he co T::C.K1 and co R::C.K1 mu an s a e shown. The nucleo ide sequence o he co R-co T in e genic egion is also shown. Pu a i e ⫺10 and
⫺35 boxes o he co T p omo e a e boxed. A hyphena ed in e ed epea (13-6-13) wi h one misma ch is ma ked wi h a ows. The s a codons o co T and co R a e
unde lined. (B) Co
2⫹
ole ance o wild- ype Synechocys is sp. s ain PCC 6803 (WT) and he co T::C.K1 and co R::C.K1 mu an s. Ten old se ial dilu ions we e spo ed
on BG11C pla es, supplemen ed wi h he indica ed concen a ions o CoCl
2
, and pho og aphed a e 10 days o g ow h.
FIG. 6. Sequence alignmen o he Co R C- e minal domain wi h p eco in
isome ase (CobH) amino acid sequences om di e en o igins. COBH_SALTY,
CobH om Salmonella en e ica se o a Typhimu ium; COBH_SYNY, CobH
om Synechocys is sp. s ain PCC 6803; COBH_METJA, CobH om Me hano-
coccus jannaschii; COBH_PSEDE, CobH om Pseudomonas deni i icans. Iden-
ical amino acids a e ma ked wi h as e isks; conse a i e changes a e ma ked
wi h colons o do s (as de ined by CLUSTAL X [53]).
1512 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om
biosyn he ic pa hway o cobalamin. In cobalamin a cobal a om
is held by coo dina ion bonds o he ni ogen a oms o he ou
py ole ings o co in ( e iewed in e e ence 44). P eco in
isome ase ca alyzes he syn hesis o hyd ogenoby inic acid
om p eco in-8x by ans e ing a me hyl g oup om C-11 o
C-12. I has been shown ha p eco in isome ase is able o
igh ly bind hyd ogenoby inic acid, a class o co inoid ing
(52). I is also known ha co inoids a e able o bind cobal
unde ce ain condi ions (54). The ac ha he sll0794 gene
p oduc con ains a domain homologous o p eco in isome ase
and ano he domain in ol ed in DNA binding sugges ed he
a ac i e hypo hesis ha his p o ein was in ol ed in ansc ip-
ional egula ion media ed by Co
2⫹
. We ha e been unable o
de ec he co R mRNA (Fig. 1B), indica ing ha Co R is
exp essed a e y low le els, consis en wi h i s possible egu-
la o y ole. Because o his egula o y ole, sll0794 was named
co R ( o cobal esponse egula o ).
In o de o e i y his hypo hesis, he co R gene was in e -
up ed by a kanamycin esis ance casse e (Fig. 5A). The e-
sul ing Synechocys is mu an s ain (co R::C.K1) was iable and
g ew no mally in BG11C medium. G ow h o he co R::C.K1
mu an s ain was also examined in Zn
2⫹
-, Ni
2⫹
-, and Co
2⫹
-
supplemen ed BG11C medium. No mal g ow h was obse ed
in Zn
2⫹
-o Ni
2⫹
-con aining medium (da a no shown); how-
e e , a educed g ow h in Co
2⫹
-con aining medium was ob-
se ed (Fig. 5B). These da a, oge he wi h he esul s o he
sequence analysis commen ed on abo e, sugges ed a ole o
Co R as a posi i e egula o o a Co
2⫹
esponse elemen . One
ob ious candida e o be egula ed by Co R was he co T gene.
Exp ession o di e en ansc ip ional uni s o he clus e was
analyzed in he co R::C.K1 mu an . No he n blo expe imen s
showed ha Co
2⫹
- and Zn
2⫹
-dependen induc ion o he co T
mRNA was absen in co R::C.K1 cells (Fig. 7). In con as ,
Ni
2⫹
-o Co
2⫹
-dependen induc ion o he n s ope on was no
a ec ed in his s ain (Fig. 7). These da a indica e ha Co R is
a ansc ip ional ac i a o o co T exp ession, which esponds
bo h o Co
2⫹
and, o a lesse ex en , o Zn
2⫹
. Ou da a also
indica e ha he low Co
2⫹
ole ance o he co R::C.K1 s ain is
a consequence o he absence o co T induc ion.
P omo e s dependen on Me R-like p o eins ha e an un-
usual s uc u e (2, 50). Unlike egula sigma-70-dependen
p oka yo ic p omo e s, in which he ⫺35 and ⫺10 consensus
elemen s a e sepa a ed by 16- o 18-bp-long space s, he p o-
mo e s egula ed by Me R- ype p o eins ha e 19- o 20-bp-
long space s. In ypical Me R-like-dependen p omo e s his
space egion con ains long in e ed- epea sequences which
a e he DNA binding si es o he Me R-like p o eins. Se-
quence analysis o he co R-co T in e genic egion e ealed a
pu a i e Me R- ype p omo e wi h a 20-bp space and a 13-
bp–13-bp in e ed epea in he o m AAACCTTGACATT-
N
6
-AATGTTAAGGTTT (Fig. 5A). Ou p esen hypo hesis is
ha his in e ed epea is he DNA a ge o Co R, which in
he p esence o Co
2⫹
is able o p omo e ansc ip ional ac i-
a ion o co T. While his a icle was unde e iew Ru he o d
e al. epo ed expe imen s ha con i m ha Co R binds o he
co R-co T in e genic egion (45). How is Co R able o sense
Co
2⫹
? One ob ious possibili y is ha he p eco in isome ase-
homologous domain o Co R binds some class o co inoid
ing. Co
2⫹
binding o he co inoid ing would p o oke a
change in he ansc ip ional unc ion o he p o ein. Howe e ,
Ru he o d e al. show da a sugges ing ha he me al and he
co inoid ing bind o di e en domains (45). Thei model
p edic s ha he binding o hyd ogenoby inic acid o he p e-
co in isome ase domain o Co R p e en s cobal -media ed
con o ma ional change equi ed o ac i a ion. The p o ein
Co R is an in e es ing example o how an enzyma ic p o ein
domain (p eco in isome ase) has been adap ed du ing e olu-
ion o a sensing and egula o y unc ion.
In conclusion, we ha e desc ibed he exis ence in Synecho-
cys is sp. s ain PCC 6803 o a gene clus e composed o nine
ORFs in ol ed in hea y-me al ole ance. While i e o he
gene p oduc s seem o ca y ou unc ions ela ed o me al
expo , wo o he genes encode p o eins in ol ed in me al
sensing and egula ion. The emaining wo p o eins encoded
by he clus e show no clea homologs in he da abases, and
hei ole in me al esis ance is an open ques ion. Finally, how
and why nine genes wi h ela ed unc ions ha e been clus e ed
in a egion o he Synechocys is sp. s ain PCC 6803 genome a e
in e es ing ques ions ha emain o be add essed.
ACKNOWLEDGMENTS
We hank he Kazusa DNA Resea ch Ins i u e and S. Taba a o
p o iding CS1377 cosmid DNA. We a e g a e ul o E. San e o o
c i ical eading o he manusc ip .
M. Ga cı´a-Domı´nguez was he ecipien o a ellowship om he
Spanish Minis e io de Educacio´n y Cul u a. This wo k was suppo ed
by g an PB97-0732 om DGESIC and by Jun a de Andalucı´a (g oup
CV1-0112).
REFERENCES
1. Al schul, S. F., T. L. Madden, A. A. Scha e , J. Zhang, Z. Zhang, W. Mille ,
and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new gene a ion
o p o ein da abase sea ch p og ams. Nucleic Acids Res. 25:3389–3402.
2. Ansa i, A. Z., J. E. B adne , and T. V. O’Hallo an. 1995. DNA-bend mod-
ula ion in a ep esso - o-ac i a o swi ching mechanism. Na u e 374:371–
375.
3. Bea d, S. J., R. Hashim, J. Memb illo-He nandez, M. N. Hughes, and R. K.
Poole. 1997. Zinc(II) ole ance in Esche ichia coli K-12: e idence ha he
zn A gene (o732) encodes a ca ion anspo ATPase. Mol. Mic obiol. 25:
883–891.
4. Bea d, S. J., M. N. Hughes, and R. K. Poole. 1995. Inhibi ion o he cy o-
ch ome bd- e mina ed NADH oxidase sys em in Esche ichia coli K-12 by
di alen me al ca ions. FEMS Mic obiol. Le . 131:205–210.
5. B ad o d, M. M. 1976. A apid and sensi i e me hod o quan i a ion o
mic og am quan i ies o p o ein u ilizing he p inciple o p o ein-dye bind-
ing. Anal. Biochem. 72:248–254.
6. B ayman, T. G., and R. P. Hausinge . 1996. Pu i ica ion, cha ac e iza ion,
and unc ional analysis o a unca ed Klebsiella ae ogenes U eE u ease
accesso y p o ein lacking he his idine- ich ca boxyl e minus. J. Bac e iol.
178:5410–5416.
7. B ocklehu s , K. R., J. L. Hobman, B. Lawley, L. Blank, S. J. Ma shall, N. L.
B own, and A. P. Mo by. 1999. Zn R is a Zn(II)- esponsi e Me R-like
ansc ip ional egula o o zn A in Esche ichia coli. Mol. Mic obiol. 31:
893–902.
8. Cai, Y., and C. P. Wolk. 1990. Use o a condi ionally le hal gene in Anabaena
sp. s ain PCC 7120 o selec o double ecombinan s and o en ap inse ion
FIG. 7. Loss o co T induc ion in he co R::C.K1 mu an . To al RNA was
isola ed om mid-log-phase wild- ype Synechocys is sp. s ain PCC 6803 (WT) o
om Synechocys is co R::C.K1 mu an cells exposed o 1h oa15␮M concen-
a ion o he indica ed me al ions. Con ol cells we e no exposed o added
me als (⫺). RNA was isola ed, p ocessed, and hyb idized as desc ibed o Fig. 1,
using an n sB o a co T gene p obe (p obes aand d, espec i ely [Fig. 1A]). The
il e s we e s ipped and ehyb idized wi h an npB gene p obe as a con ol.
VOL. 182, 2000 A METAL TOLERANCE GENE CLUSTER IN CYANOBACTERIA 1513
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om
sequences. J. Bac e iol. 172:3138–3145.
9. Cook, W. J., S. R. Ka , K. B. Taylo , and L. M. Hall. 1998. C ys al s uc u e
o he cyanobac e ial me allo hionein ep esso Sm B: a model o me al-
lo egula o y p o eins. J. Mol. Biol. 275:337–346.
10. C ouze , J., B. Came on, L. Cauchois, S. Rigaul , M. C. Rouyez, F. Blanche,
D. Thibau , and L. Debussche. 1990. Gene ic and sequence analysis o an
8.7-kilobase Pseudomonas deni i icans agmen ca ying eigh genes in-
ol ed in ans o ma ion o p eco in-2 o coby inic acid. J. Bac e iol. 172:
5980–5990.
11. De Pina, K., V. Desja din, M. A. Mand and-Be helo , G. Gio dano, and
L. F. Wu. 1999. Isola ion and cha ac e iza ion o he nikR gene encoding a
nickel- esponsi e egula o in Esche ichia coli. J. Bac e iol. 181:670–674.
12. Ei inge , T., and B. F ied ich. 1991. Cloning, nucleo ide sequence, and
he e ologous exp ession o a high-a ini y nickel anspo gene om Alcali-
genes eu ophus. J. Biol. Chem. 266:3222–3227.
13. Ei inge , T., L. Wol am, O. Degen, and C. An hon. 1997. A Ni2⫹binding
mo i is he basis o high a ini y anspo o he Alcaligenes eu ophus nickel
pe mease. J. Biol. Chem. 272:17139–17144.
14. Elhai, J., and C. P. Wolk. 1988. A e sa ile class o posi i e-selec ion ec o s
based on he non iabili y o palind ome-con aining plasmids ha allows
cloning in o long polylinke s. Gene 68:119–138.
15. Fe ino, F., and F. Chau a . 1989. A p omo e -p obe ec o -hos sys em o
he cyanobac e ium, Synechocys is PCC6803. Gene 84:257–266.
16. Fu, C., S. Ja edan, F. Moshi i, and R. J. Maie . 1994. Bac e ial genes
in ol ed in inco po a ion o nickel in o a hyd ogenase enzyme. P oc. Na l.
Acad. Sci. USA 91:5099–5103.
17. Ga cı´a-Domı´nguez, M., and F. J. Flo encio. 1997. Ni ogen a ailabili y and
elec on anspo con ol he exp ession o glnB gene (encoding PII p o ein)
in he cyanobac e ium Synechocys is sp. PCC 6803. Plan Mol. Biol. 35:
723–734.
18. Ho mann, K., and W. S o el. 1993. TMbase—a da abase o memb ane
spanning p o ein segmen s. Biol. Chem. Hoppe-Seyle 347:166.
19. Huckle, J. W., A. P. Mo by, J. S. Tu ne , and N. J. Robinson. 1993. Isola ion
o a p oka yo ic me allo hionein locus and analysis o ansc ip ional con ol
by ace me al ions. Mol. Mic obiol. 7:177–187.
20. Kanama u, K., S. Kashiwagi, and T. Mizuno. 1994. A coppe - anspo ing
P- ype ATPase ound in he hylakoid memb ane o he cyanobac e ium
Synechococcus species PCC7942. Mol. Mic obiol. 13:369–377.
21. Kaneko, T., S. Sa o, H. Ko ani, A. Tanaka, E. Asamizu, Y. Nakamu a, N.
Miyajima, M. Hi osawa, M. Sugiu a, S. Sasamo o, T. Kimu a, T. Hosouchi,
A. Ma suno, A. Mu aki, N. Nakazaki, K. Na uo, S. Okumu a, S. Shimpo, C.
Takeuchi, T. Wada, A. Wa anabe, M. Yamada, M. Yasuda, and S. Taba a.
1996. Sequence analysis o he genome o he unicellula cyanobac e ium
Synechocys is sp. s ain PCC6803. II. Sequence de e mina ion o he en i e
genome and assignmen o po en ial p o ein-coding egions. DNA Res. 3:
109–136.
22. Kleine , D. 1978. Inhibi ion o he espi a o y sys em in Azo obac e
inelandii by di alen ansi ion me al ions. FEBS Le . 96:364–366.
23. Komeda, H., M. Kobayashi, and S. Shimizu. 1997. A no el anspo e
in ol ed in cobal up ake. P oc. Na l. Acad. Sci. USA 94:36–41.
24. Laemmli, U. K. 1970. Clea age o s uc u al p o eins du ing he assembly o
he head o bac e iophage T4. Na u e 227:680–685.
25. Liesegang, H., K. Lemke, R. A. Siddiqui, and H. G. Schlegel. 1993. Cha ac-
e iza ion o he inducible nickel and cobal esis ance de e minan cn om
pMOL28 o Alcaligenes eu ophus CH34. J. Bac e iol. 175:767–778.
26. Lu z, S., A. Jacobi, V. Schlensog, R. Bohm, G. Sawye s, and A. Bock. 1991.
Molecula cha ac e iza ion o an ope on (hyp) necessa y o he ac i i y o
he h ee hyd ogenase isoenzymes in Esche ichia coli. Mol. Mic obiol. 5:
123–135.
27. Maeda, M., M. Hidaka, A. Nakamu a, H. Masaki, and T. Uozumi. 1994.
Cloning, sequencing, and exp ession o he mophilic Bacillus sp. s ain
TB-90 u ease gene complex in Esche ichia coli. J. Bac e iol. 176:432–442.
28. Mallick, N., and L. C. Rai. 1992. Me al induced inhibi ion o pho osyn hesis,
pho osyn he ic elec on anspo chain and ATP con en o Anabaena do-
liolum and Chlo ella ulga is: in e ac ion wi h exogenous ATP. Biomed.
En i on. Sci. 5:241–250.
29. Mobley, H. L., R. M. Ga ne , and P. Baue eind. 1995. Helicobac e pylo i
nickel- anspo gene nixA: syn hesis o ca aly ically ac i e u ease in Esche-
ichia coli independen o g ow h condi ions. Mol. Mic obiol. 16:97–109.
30. Mul ooney, S. B., and R. P. Hausinge . 1990. Sequence o he Klebsiella
ae ogenes u ease genes and e idence o accesso y p o eins acili a ing nickel
inco po a ion. J. Bac e iol. 172:5837–5843.
31. Na a o, C., L. F. Wu, and M. A. Mand and-Be helo . 1993. The nik ope on
o Esche ichia coli encodes a pe iplasmic binding-p o ein-dependen ans-
po sys em o nickel. Mol. Mic obiol. 9:1181–1191.
32. Nies, D. H., A. Nies, L. Chu, and S. Sil e . 1989. Exp ession and nucleo ide
sequence o a plasmid-de e mined di alen ca ion e lux sys em om Alcali-
genes eu ophus. P oc. Na l. Acad. Sci. USA 86:7351–7355.
33. Nies, D. H., and S. Sil e . 1989. Me al ion up ake by a plasmid- ee me al-
sensi i e Alcaligenes eu ophus s ain. J. Bac e iol. 171:4073–4075.
34. Nuci o a, G., L. Chu, T. K. Mis a, and S. Sil e . 1989. Cadmium esis ance
om S aphylococcus au eus plasmid pI258 cadA gene esul s om a cadmi-
um-e lux ATPase. P oc. Na l. Acad. Sci. USA 86:3544–3548.
35. Ode ma , A., H. Su e , R. K ap , and M. Solioz. 1993. P ima y s uc u e o
wo P- ype ATPases in ol ed in coppe homeos asis in En e ococcus hi ae.
J. Biol. Chem. 268:12775–12779.
36. Pao, S. S., I. T. Paulsen, and M. H. Saie , J . 1998. Majo acili a o supe -
amily. Mic obiol. Mol. Biol. Re . 62:1–34.
37. Pa ze , S. I., and K. Han ke. 1998. The ZnuABC high-a ini y zinc up ake
sys em and i s egula o Zu in Esche ichia coli. Mol. Mic obiol. 28:1199–
1210.
38. Phung, L. T., G. Ajlani, and R. Haselko n. 1994. P- ype ATPase om he
cyanobac e ium Synechococcus 7942 ela ed o he human Menkes and Wil-
son disease gene p oduc s. P oc. Na l. Acad. Sci. USA 91:9651–9654.
39. Rai, P. K., N. Mallick, and L. C. Rai. 1994. E ec o Cu and Ni on g ow h,
mine al up ake, pho osyn hesis and enzyme ac i i ies o Chlo ella ulga is a
di e en pH alues. Biomed. En i on. Sci. 7:56–67.
40. Rensing, C., M. Ghosh, and B. P. Rosen. 1999. Families o so -me al-ion-
anspo ing ATPases. J. Bac e iol. 181:5891–5897.
41. Rensing, C., T. P ibyl, and D. H. Nies. 1997. New unc ions o he h ee
subuni s o he CzcCBA ca ion-p o on an ipo e . J. Bac e iol. 179:6871–
6879.
42. Rey, L., J. Impe ial, J. M. Palacios, and T. Ruiz-A gueso. 1994. Pu i ica ion
o Rhizobium leguminosa um HypB, a nickel-binding p o ein equi ed o
hyd ogenase syn hesis. J. Bac e iol. 176:6066–6073.
43. Rippka, R., J. De uelles, J. B. Wa e bu y, M. He dman, and R. Y. S anie .
1979. Gene ics assignmen s, s ain his o ies and p ope ies o pu e cul u es
o cyanobac e ia. J. Gen. Mic obiol. 111:1–61.
44. Ro h, J. R., J. G. Law ence, and T. A. Bobik. 1996. Cobalamin (coenzyme
B12): syn hesis and biological signi icance. Annu. Re . Mic obiol. 50:137–
181.
45. Ru he o d, J. C., J. S. Ca e , and N. J. Robinson. 1999. Cobal -dependen
ansc ip ional swi ching by a dual-e ec o Me R-like p o ein egula es a
cobal -expo ing a ian CPx- ype ATPase. J. Biol. Chem. 274:25827–25832.
46. Samb ook, J., E. F. F i sch, and T. Mania is. 1989. Molecula cloning: a
labo a o y manual, 2nd ed. Cold Sp ing Ha bo Labo a o y P ess, Cold
Sp ing Ha bo , N.Y.
47. Schmid , T., and H. G. Schlegel. 1994. Combined nickel-cobal -cadmium
esis ance encoded by he ncc locus o Alcaligenes xylosoxidans 31A. J. Bac-
e iol. 176:7045–7054.
48. Sil e , S., and L. T. Phung. 1996. Bac e ial hea y me al esis ance: new
su p ises. Annu. Re . Mic obiol. 50:753–789.
49. Singh, V. K., A. Xiong, T. R. Usgaa d, S. Chak aba i, R. Deo a, T. Mis a,
and R. K. Jayaswal. 1999. Zn R is an au o egula o y p o ein and nega i ely
egula es he ch omosomal zinc esis ance ope on zn o S aphylococcus
au eus. Mol. Mic obiol. 33:200–207.
50. Summe s, A. O. 1992. Un wis and shou : a hea y me al- esponsi e an-
sc ip ional egula o . J. Bac e iol. 174:3097–3101.
51. Thelwell, C., N. J. Robinson, and J. S. Tu ne -Ca e . 1998. An Sm B-like
ep esso om Synechocys is PCC 6803 egula es a zinc expo e . P oc. Na l.
Acad. Sci. USA 95:10728–10733.
52. Thibau , D., M. Coude , A. Famechon, L. Debussche, B. Came on, J.
C ouze , and F. Blanche. 1992. The inal s ep in he biosyn hesis o hyd o-
genoby inic acid is ca alyzed by he cobH gene p oduc wi h p eco in-8x as
he subs a e. J. Bac e iol. 174:1043–1049.
53. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G.
Higgins. 1997. The CLUSTAL X windows in e ace: lexible s a egies o
mul iple sequence alignmen aided by quali y analysis olls. Nucleic Acids
Res. 25:4876–4882.
54. Toohey, J. I. 1965. A i amin B12 compound con aining no cobal . P oc.
Na l. Acad. Sci. USA 54:934–942.
55. an de Lelie, D., T. Schwuchow, U. Schwide zky, S. Wue z, W. Baeyens, M.
Me geay, and D. H. Nies. 1997. Two-componen egula o y sys em in ol ed
in ansc ip ional con ol o hea y-me al homoeos asis in Alcaligenes eu o-
phus. Mol. Mic obiol. 23:493–503.
56. Vioque, A. 1992. Analysis o he gene encoding he RNA subuni s o ibo-
nuclease P om cyanobac e ia. Nucleic Acids Res. 20:6331–6337.
57. on Heijne, G. 1992. Memb ane p o ein s uc u e p edic ion, hyd ophobici y
analysis and he posi i e-inside ule. J. Mol. Biol. 225:487–494.
58. Wa , R. K., and P. W. Ludden. 1998. The iden i ica ion, pu i ica ion, and
cha ac e iza ion o CooJ. A nickel-binding p o ein ha is co- egula ed wi h
he Ni-con aining CO dehyd ogenase om Rhodospi illum ub um. J. Biol.
Chem. 273:10019–10025.
1514 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om