ORIGINAL RESEARCH ARTICLE
published: 05 Augus 2013
doi: 10.3389/ pls.2013.00291
A con ibu ion o he s udy o plan de elopmen e olu ion
based on gene co-exp ession ne wo ks
F ancisco J. Rome o-Campe o1, E a Lucas-Reina2, Fa ima E. Said2,JoséM.Rome o
2and
Fede ico Val e de2*
1Depa men o Compu e Science and A i icial In elligence, Uni e sidad de Se illa, Se illa, Spain
2Molecula Plan De elopmen and Me abolism, Ins i u o de Bioquímica Vege al y Fo osín esis, Consejo Supe io de In es igaciones Cien í icas y Uni e sidad de
Se illa, Se illa, Spain
Edi ed by:
Madelaine E. Ba le , B igham
Young Uni e si y, USA
Re iewed by:
S ephan Wenkel, Uni e si y o
Tuebingen, Ge many
Enamul Huq, The Uni e si y o
Texas a Aus in, USA
Idan E oni, New Yo k Uni e si y,
USA
*Co espondence:
Fede ico Val e de, Molecula Plan
De elopmen and Me abolism
G oup,Ins i u o de Bioquímica
Vege al y Fo osín esis, Consejo
Supe io de In es igaciones
Cien í icasy Uni e sidad de Se illa,
49 h, Ame ico Vespucio A enue,
41092 Se illa, Spain
e-mail: ede ico. al e de@
ib .csic.es
Pho o ophic euka yo es a e among he mos success ul o ganisms on Ea h due
o hei unpa alleled e iciency a cap u ing ligh ene gy and ixing ca bon dioxide
o p oduce o ganic molecules. A conse ed and e icien ne wo k o ligh -dependen
egula o y modules could be a he bases o his success. This egula o y sys em
con e ed ea ly ad an ages o pho o ophic euka yo es ha allowed o specializa ion,
complex de elopmen al p ocesses and mode n plan cha ac e is ics. We ha e
s udied ligh -dependen gene egula o y modules om algae o plan s employing
in eg a i e-omics app oaches based on gene co-exp ession ne wo ks. Ou s udy e eals
some ema kably conse ed ways in which euka yo ic pho o ophs deal wi h day leng h
and ligh signaling. He e we desc ibe how a amily o A abidopsis ansc ip ion ac o s
in ol ed in pho ope iod esponse has e ol ed om a single algal gene acco ding o he
inno a ion, ampli ica ion and di e gence heo y o gene e olu ion by duplica ion. These
modi ica ions o he gene co-exp ession ne wo ks om he ancien unicellula g een algae
Chlamydomonas einha d ii o he mode n b assica A abidopsis haliana may hin on he
e olu ion and specializa ion o plan s and o he o ganisms.
Keywo ds: pho ope iod, e olu ion, gene co-exp ession ne wo ks, Chlamydomonas,Physcomi ella,A abidopsis
INTRODUCTION
Day leng h, o pho ope iod, egula es s a egic de elopmen al
p ocesses in plan s. I cons i u es a key ex e nal signal o eed
he ci cadian hy hms wi h he needed in o ma ion o main ain
he se o he day (Imaizumi, 2010) and is also c i ical o disce n
seasons (Jackson, 2009). Thus, pho ope iodic signals egula e
c ucial de elopmen al esponses such as do mancy; ge mina-
ion; senescence o he ansi ion om ege a i e o ep oduc i e
s ages (Val e de, 2011). The lo al ansi ion is one o he mos
conse ed e olu iona y p ocesses in angiospe ms (Rome o and
Val e de, 2009; Se ano e al., 2009) due o i s cen al ole in p o-
ducing new plan gene a ions and in he ansmission o acqui ed
cha ac e is ics. Many o he key genes in ol ed in he lo al an-
si ion a e conse ed in an in e -species dependen manne as
well as many o he ex e nal cues ha igge he ep oduc i e
esponse (Amasino, 2010). Acco ding o his, he esponse o he
h ee mos impo an ex e nal agen s ha con ol ep oduc ion,
namely empe a u e, nu ien s and day leng h, a e egula ed by
a se o in e -species gene egula o y ne wo ks wi h conse ed
unc ions (Ausín e al., 2005).
The pho ope iodic lowe ing pa hway in ol es a se ies o genes
ha a e in luenced by ligh and ci cadian signals o o ches a e
a esponse ha ensu es he bes momen o he yea o lowe .
Thus, long-day (LD) plan s lowe as he day leng hens and sho -
day (SD) plan s lowe when days s a o sho en. In he model
species A abidopsis, a acul a i e LD plan , a de ailed knowledge
o he gene pa hways in ol ed in he pho ope iod lo al ansi ion
has been accumula ed and solid mechanisms ha e been p oposed
o explain i s lowe ing beha io (Fo na a e al., 2010). In his
pa hway, he ole o he gene CONSTANS (CO) is c ucial because
i s ine con ol a se e al egula o y le els (Val e de e al., 2004)
assu e ha he plan igge s he lowe ing esponse exac ly a he
p ecise momen o he yea . I modula es he exp ession o he
lo igen FLOWERING LOCUS T (FT) gene in he lea ascula u e,
whose p o ein, eaching he me is em, igge s he ep oduc i e
de elopmen al p og am, e en ually p oducing lowe s (Co besie
e al., 2007). While many genes ha e been disco e ed in his eg-
ula o y module, dealing wi h p o ein s abili y (Jang e al., 2008;
Láza o e al., 2012), modula ing he ligh esponse o he p o-
eins (Yu e al., 2008)o hei unc ion(Kim e al., 2007), he
in eg a ion o he pa hway wi hin o he lowe ing ou es o he
ou pu genes ha igge he lowe ing ansi ion a e less known.
Due o he cha ac e is ic a ached- o- he-soil beha io o plan s,
a complex ne wo k o egula o y p ocesses is in he base o hei
physiological esponses. These complex sys ems can be be e
analysed employing holis ic and in eg a i e app oaches (Usadel
e al., 2009; Tohge and Fe nie, 2012).
The las yea s ha e seen a bloom o massi e da a acquisi ion
echniques o app oach plan biology in a holis ic and in eg a-
i e way, pa icula ly in ansc ip ional in o ma ion (Me zke ,
2010). Mic oa ays i s and Nex -Gene a ion Sequencing (NGS)
la e ha e p o ided eno mous amoun o gene exp ession
da a o a mul i ude o plan species in di e en physiolog-
ical/geno ypic condi ions and de elopmen al s ages (Schliesky
www. on ie sin.o g Augus 2013 | Volume 4 | A icle 291 |1
Rome o-Campe o e al. Conse ed ligh signaling in plan s
e al., 2012). These da a can also be en iched by u he expe -
imen al app oaches and include his in o ma ion in o he gene
co-exp ession ne wo ks gene a ed. The e o e, when ying o
analyze he de elopmen al esponse o a plan o an ex e nal
condi ion we can combine da a om gene co-exp ession anal-
yses gene a ed using mic oa ay and/o NGS app oaches wi h
physiological da a such as he ime o lowe , he weigh o he
plan o he chlo ophyll con en . This helps o associa e a pa -
icula plan beha io o a pa icula gene exp ession pa e n.
Thus, he le els o complexi y poised by he eno mous amoun s
o da a gene a ed a di e en egula o y le els, such as ansc ip-
omics, p o eomics and me abolomics can be app oached wi h
an in eg a i e and holis ic pe spec i e employing ne wo k ools
o educe noise and ind no el pa e ns o o ganiza ion. When
an e olu iona y app oach co e ing he his o y o gene ne wo ks
wi hin he phylogeny o o ganisms is employed, an in e es ing
ela ion be ween unc ion and di e se p ocesses, such as de el-
opmen al p ocesses, s a s o be un eiled. This could help o
explain many o he in iguing in e wines be ween e olu ion and
de elopmen obse ed in di e en o ganisms (Mülle , 2007).
Sequence simila i y cons i u es he classical app oach o assign
po en ial unc ions o genes and o s udy hei e olu iona y his-
o y (Lajoie e al., 2010). This me hodology ocuses on he com-
pa ison be ween indi idual genes and do no ake in o accoun
ha genes pe o m hei unc ion in coo dina ion wi h many
o he genes. In his espec , sequence simila i y has been shown
o be incomple e when p edic ing pheno ypic di e ences be ween
species. Fo example, he genes in ol ed in he human and
chimpanzee b ains sha e e y high sequence simila i ies ha do
no co espond wi h he ma ked pheno ypic di e ences be ween
hem (Oldham e al., 2006). Holis ic and in eg a i e app oaches
such as gene co-exp ession ne wo ks ha ake in o accoun he
o ches a ion among genes a e eme ging as powe ul ools o p e-
dic gene unc ion and o in e hei e olu iona y his o y. This
me hodology assumes ha i a g oup o genes a e co-exp essed
hey should ha e simila unc ions and a common e olu iona y
his o y. In hese ne wo ks, genes a e ep esen ed as nodes and
an edge is es ablished be ween wo nodes i he exp ession p o-
iles o he co esponding genes exhibi a co ela ion alue high
enough o p o ide e idence o co-exp ession. The opological
analysis o hese ne wo ks such as he dis ibu ion o he num-
be o neighbo s o each gene, he numbe o co-exp essed genes
o a gi en gene, can p o ide in o ma ion abou hei unc ion
and e olu iona y his o y (Aoki e al., 2007; Usadel e al., 2009).
In his pape , we ha e s udied he e olu ion o he co-
exp ession sub-ne wo ks o modules a ound he pho ope iod
cen al amily o CO-Like genes, CONSTANS (CO) homologs,
in h ee model species whose genome is a ailable: he g een
unicellula alga Chlamydomonas einha d ii (C CO gene), he
moss Physcomi ella pa ens (PpCOL genes) and he highe plan
A abidopsis haliana (A COL genes). These species a e landma ks
o he e olu iona y lineage o plan s. Mic oa ays o RNA-seq
da abase expe imen s ha e been used o cons uc gene co-
exp ession ne wo ks. Phylogene ic analyses ha e been combined
oge he wi h unc ional en ichmen analyses in o de o be e
unde s and he e olu ion o he CO-Like (COLs) amily be ween
he species and hei unc ional specializa ion. This combina ion
o gene exp ession da a analysis, gene on ology (GO) e m en ich-
men and phylogene ic s udies cons i u es a no el me hodology o
s udy gene unc ion and e olu ion. The app oach is no es ic ed
o ou case s udy and can be applied o he s udy o sub-ne wo ks
o modules o o he ansc ip ion ac o s. Th ough he analysis
o he e olu ion o gene ne wo ks we can s udy gene duplica-
ion and di e si ica ion and how his has a ec ed he ne wo ks.
Addi ionally, ou me hodology could be a use ul ool o iden-
i y homologous genes ela ed o he same speci ic p ocess and
he e o e p edic ue gene o hology. Finally, ou analysis can
also be used o explain why and o wha ex en di e en signal-
ing pa hways a e linked in an o ganism and, he e o e, cons i u e
a aluable ool o unde s and plan plas ici y.
MATERIALS AND METHODS
PLANT, ALGAL MATERIAL, AND GROWTH CONDITIONS
A abidopsis haliana 35S:CO-GR (Simon e al., 1996) ansgenic
lines we e g own in MS pla es. Seeds we e p e iously incuba ed
4daysa 4
◦C in he da k be o e sowing unde 16 h ligh /8 h da k
cycle (long-day, LD) wi h empe a u e anging om 22◦C(day)
o 18◦C(nigh )a 75µE/m2ligh in ensi y. In he expe imen
employing dexame hasone (DEX) 1 µg/mL and cycloheximide
(CHX) 1mM chemicals we e added 10 days a e sowing a ZT0
and lea samples ha es ed 4 h a e he d ug ea men , consid-
e ing Zei gebe Time 0 (ZT0) he momen a which he ligh s a e
swi ched on.
Chlamydomonas einha d ii cell-wall de icien mu an CW15
(Da ies and Plaski , 1971)andpNIA:C CO (Se ano e al., 2009)
ansgenic line we e g own in s i ed conical cylind ical lasks
con aining Sueoka NO−
3(Sueoka e al., 1967)unde LDcondi-
ions in con ol ooms a 22◦Cand50µE/m2. Algal cells we e
ha es ed a 4 days a ZT4, 4 h a e he ligh s wen on. Plan s
and algae we e g own in a model SG-1400 phy o on (Radibe
SA, Spain).
RNA ISOLATION AND Q-PCR
RNA was isola ed om A abidopsis seedlings (0.1 g lea issue)
and Chlamydomonas (20 ml o an exponen ial phase cul u e)
employing, in bo h cases, he TRIZOL (In i ogen) p o ocol as
desc ibed by he manu ac u e . In sho , he sample was mixed
wi h 1ml o TRIZOL and 0.2 ml o chlo o o m, he mix u e was
hen cen i uged a 16,000 g o 10 min a 4◦C. The supe na an
was ea ed wi h 1 olume o 2-p opanol, incuba ed 15 min a
oom empe a u e and cen i uged a 16,000 g o 10 min a 4◦C.
0.75 ml 3 M LiCl was added o he pelle and incuba ed o
>10 min a oom empe a u e and cen i uged a 16,000 g o
10 min a 4◦C. The pelle was washed wi h 80% ( / ) e hanol and
cen i uged a 16,000 g o 10 min a 4◦C. The inal RNA sam-
ple was suspended in 30 µl o DEPC ea ed wa e and quan i ied
employing a ND-1000 Spec opho ome e (Nanod op).
1µg o TRIZOL isola ed RNA was used o syn hesize cDNA
employing he Quan i ec® Re e se ki (Qiagen) ollowing he
ins uc ion ecommended by he manu ac u e . cDNA was
dilu ed o a inal concen a ion o 10 ng/µLands o eda −20◦C
un il Q-PCR was pe o med. P ime s o ampli y he 3 ans-
la ed egion o A CO, A SSS, A FAD, A GS, A ZEP, A WRKY33,
A UBQ10, C CO, C SSS, C FAD, C GS, C ZEP,C ATG8,and
F on ie s in Plan Science | Plan E olu ion and De elopmen Augus 2013 | Volume 4 | A icle 291 |2
Rome o-Campe o e al. Conse ed ligh signaling in plan s
C TUB (Table 1) we e designed employing an Oligo analyze
p og am (In eg a ed DNA echnologies, h p://eu.id dna.com/
analyze /Applica ions/OligoAnalyze /). Q-PCR was pe o med in
a Mul icolo Real-Time PCR De ec ion Sys em iQTM5 om
Bio-Rad in a 10 µL eac ion: p ime concen a ion 0.2 µM, 10
ng cDNA and 5 µL SensiFAST TM SYBR & Fluo escein Ki
(Bioline). Each sample was measu ed by iplica e. The Q-PCR
p og am consis ed in (1) 1 cycle (95◦C, 2 min); (2) 40 cycle (95◦C,
5s; 60
◦C o A abidopsis p ime s and 65◦C oChlamydomonas
p ime s, 10 s and 72◦C,6s)(iii)1cycle(72
◦C, 6 s). Fluo escence
was measu ed a he end o each ex ension s ep and he mel -
ing cu e was pe o med be ween 55 and 95◦C. The ini ial
concen a ion o candida e and e e ence gene was calcula ed
by means o LingRegPCR so wa e e sion 11.0 (Ruij e e al.,
2009). No malized da a was calcula ed di iding he a e age o
ou eplica es o each sample o he candida e and e e ence
genes.
PHYLOGENETIC ANALYSIS
E olu iona y ela ionships among he CO-Like genes o
Chlamydomonas,Physcomi ella and A abidopsis we e analyzed
using p edic ed amino-acid sequences om Phy ozome 9.0
and aligned wi h he p og am MUSCLE (Edga , 2004). This
alignmen was hen used o gene a e a phylogene ic ee applying
he Neighbo -Joining algo i hm (Sai ou and Nei, 1987)wi h
he JTT+G 1.53 as subs i u ion model (Jones e al., 1992). The
boo s ap consensus ee in e ed om 1000 eplica es is aken
o ep esen he e olu iona y his o y o he analyzed p o eins.
The ee is d awn o scale, wi h b anch leng hs in he same
uni s as hose o he e olu iona y dis ances used o in e he
phylogene ic ee. Phylogene ic analyzes we e conduc ed wi h
MEGA5 (Tamu a e al., 2011). Accession numbe s o sequences
usedin healignmen a eshowninTable 2.
IDENTIFICATION OF CONSERVED MOTIFS
The sequences o COL p o eins om he di e en plan s
and algae we e analyzed using he MEME p og am (h p://
meme.nbc .ne /meme/) as desc ibed by Bailey e al. (2009).
Only he h ee main mo i s (2 B-boxes and CCT domain)
we e ep esen ed. The mo i s we e cha ac e ized using he
Table 2 | COL p o ein amily in Clamydomonas, Physcomi ella,and
A abidopsis employed in he phylogene ic s udies o his wo k.
P o ein Gene numbe P o ein Gene numbe
C CO g6302 CO A 5g15840
PpCOL1 Pp1s371_27V6 A COL1 A 5g15850
PpCOL2 Pp1s97_109V6 A COL2 A 3g02380
PpCOL3 Pp1s364_5V6 A COL3 A 2g24790
PpCOL4 Pp1s36_238V6 A COL4 A 5g24930
PpCOL5 Pp1s26_5V6 A COL5 A 5g57660
PpCOL6 Pp1s236_21V6 A COL6 A 1g68520
PpCOL7 Pp1s195_82V6 A COL7 A 1g73870
PpCOL8 Pp1s143_52V6 A COL8 A 1g49130
PpCOL9 Pp1s108_97V6 A COL9 A 3g07650
PpCOL10 Pp1s3_491V6 A COL10 A 5g48250
A COL11 A 4g15250
A COL12 A 3g21880
A COL13 A 2g47890
A COL14 A 2g33500
A COL15 A 1g28050
A COL16 A 1g25440
The le column includes he sho p o ein code numbe as ound in he li e a u e
(PpCOL4-PpCOL10 named in his wo k) and he igh column he gene code
numbe om he co esponding genome da abases (Phy ozome and TAIR).
Table 1 | P ime s employed o Q-PCR expe imen s.
A abidopsis genes Sequence Ampli ied agmen size (bp)
CO 5-CCAATGGACAGAGAAGCCAGG-35-GCATCGTGTTGAACCCTTGC- 3175
A SSS 5-CTGGGGATCATCAGCTACACAATACG-35-CACGTGCGATTAGGAACAGCTC-381
A FAD 5- CGTCGTTAAGTTCCTTCAAGCC -35- CATAGCTTCAATCGAACCGACAG -3157
A GS 5- CCAGCTTCGAACATGGATCC -35-CCTAAGACATTGCTTGATAGAGAACAC-3167
A ZEP 5- CTCCGAAATCGACGAGGAAG -35- TGCAAGGAATAGCTGAAAGCAG -3166
A UBQ10 5- GAAGTTCAATGTTTCGTTTCATGT -35- GGATTATACAAGGCCCCAAAA -3119
A ERF 5- CCAATGTTCAGCAGAATGCC -35- GGACGATGAGAAAGAATTAGGAG -385
A WRKY33 5-TACCGGGCCTTTTGGTTA-35- CCACCACCAACAAAGTTTTG-381
Chlamydomonas genes Sequence bp
C CO 5- CTTCCCGCAAGGCGTATGC -35- GCCTCAATCTCCTCCTTCTTGGC -373
C SSS 5- ACGTGTACCGCTCCATCAGC -35- GCAGCACTCTTGCACTATGCAG -3107
C FAD 5- GACGAGAAGGTCAACTACAAGCC -35- GCTTGCTCAGCTCCGATTAGC -3150
C GS 5- GCTACGGCTACCTGGAGGA -35- CATCGCTGCCCTTATTAGCTGG -3127
C ZEP 5- AAGAGGCAGGTTGGCTTAGTGC -35- GGTGTCTGTCAACGTGTGTAGC -3127
C TUB 5- GTTGCATCGTTAGCGTGGACG -35- GCAGCAGCCAATGTTCAGACT -3170
C ERF 5- AGCCAGGCTCGCTGCAACTTCC -35- GGA AGT TGC AGC GAG CCT GGC T -3108
C ATG8 5- TCCCGATATCGACAAGAAG -35- TGCGGATGACGTACACAAAT -375
www. on ie sin.o g Augus 2013 | Volume 4 | A icle 291 |3
Rome o-Campe o e al. Conse ed ligh signaling in plan s
Conse ed Domain Sea ch Se ice (h p://www.ncbi.nlm.nih.
go /S uc u e/cdd/w psb.cgi) (Ma chle -Baue and B yan ,
2004).
DATA COMPILATION AND PROCESSING
This s udy is based on an ensemble o mo e han one Te aBy e
ansc ip omic da a om Chlamydomonas,Physcomi ella, and
A abidopsis ob ained unde ela ed physiological and geno ype
condi ions (Table 3). These da a comp ise RNA-seq expe i-
men s om he public da abase, he Sequence Read A chi e
(SRA, h p://www.ncbi.nlm.nih.go /T aces/s a/) (Wheele e al.,
2005) and mic oa ay da a om he A ay Exp ess A chi e
(A ayExp ess, h p://www.ebi.ac.uk/a ayexp ess/) (Rus ici
e al., 2013). Fo Chlamydomonas 50 RNA-seq da a se s ep e-
sen ing eigh di e en geno ypes unde di e se physiological
condi ions (González-Balles e e al., 2010; Mille e al., 2010;
Cas ui a e al., 2011; K opa e al., 2011; Boyle e al., 2012;
Fische e al., 2012; U zica e al., 2012)we eanalyzed.Fo
Physcomi ella 13 RNA-seq da a se s ep esen ing wo di e -
en geno ypes (Zemach e al., 2010; Xiao e al., 2011; Chen
e al., 2012) we e analyzed. Finally, in o de o use compa a-
ble condi ions A abidopsis mic oa ay da a om expe imen s
unde simila condi ions o hose om Chlamydomonas and
Physcomi ella (Gu ié ez e al., 2007; Long e al., 2010; Pa e son
e al., 2010; Iye -Pascuzzi e al., 2011; Cheng e al., 2013)we e
analyzed. The expe imen al condi ions analyzed in his s udy
a e di e se enough o cap u e he ue co-exp ession among
genes. These condi ions include nu ien de iciency (ni ogen,
i on, coppe , and sul u dep i a ion), oxida i e s ess, ligh
s imuli, DNA damage and di e en de elopmen al s ages
(Table 3).
An es ima ion o gene exp ession in he ansc ip omes gen-
e a ed in he di e en condi ions unde s udy was ob ained
ollowing he me hodology desc ibed in T apnell e al. (2012).
This app oach uses a e e ence genome o each species. The
Chlamydomonas e e ence genome co esponds o he elease
5.3 which is assembled in o 17 ch omosomes and 37 addi ional
unmapped sca olds. The Chlamydomonas genomic in o ma ion
is based on he Augus us upda e u11.6. Fo Physcomi ella we
used he e e ence genome elease 1.6 which is assembled in o
2106 sca olds ha ha e no been mapped ye o he 27 ch o-
mosomes ha cons i u e i s genome. The Physcomi ella genomic
in o ma ion is based on he Cosmoss upda e 1.6. Finally, he
A abidopsis genomic in o ma ion is based on he TAIR 10
esou ce. This anno a ion and genome in o ma ion was down-
loaded om Phy ozome (h p://www.phy ozome.ne ), a web-
based pla o m o g een plan compa a i e genomics (Goods ein
e al., 2012).
The wo k low ollowed in he RNA-seq da a p ocessing is
ske ched in Figu e 1 and de ailed in Figu e S1. The i s s ep
consis ed on he alignmen o he sho ead sequences s o ed
in as q iles o he co esponding e e ence genome using he
so wa e package Topha (T apnell e al., 2009) op oduceBAM
iles (bina y alignmen maps). In he second s ep hese iles
oge he wi h he gene anno a ion in o ma ion a ailable we e
used o assemble he whole ansc ip omes o Chlamydomonas
and Physcomi ella unde he condi ions s udied. The assembled
Table 3 | Desc ip ion o he expe imen s and da ase s employed in
his wo k.
Expe imen Accession Da a
base
numbe
2137 WT cells we e cul i a ed
pho ohe e o ophically unde Fe- eple e
(20 mM), Fe-de icien (1 mM) and Fe-limi ed
(0.25 mM) condi ions
SRP010563 SRA
2137 WT cells we e exposed o hyd ogen
pe oxide o 0, 0.5, and 1 h
SRP010084 SRA
4A+WT cells and so 1 mu an cells we e
g own in 12 h ligh /da k cycle o se e al days.
Samples we e aken a ZT6
SRP009273 SRA
2137 WT cells and c 1 mu an cells we e
cul i a ed in TAP o minimal medium unde
Cu-su icien and Cu-de icien condi ions
SRP005483 SRA
CW15 cells we e cul i a ed in N- eple ed,
N-dep i ed condi ions
SRP003630 SRA
D66WTcellsanda s11 mu an cells we e
cul i a ed unde con inuous ligh in S- eple ed
and S-dep i ed condi ions
SRP002284 SRA
Da k g own WT and double pubs/hy2 mu an
p o onema we e i adia ed wi h ed ligh o 1 h
SRP011279 SRA
WT p o onemal, caulonemal, and chlo onemal
issues we e collec ed a 3, 14, 24, 30 days o
de elopmen
SRP009201 SRA
Samples we e collec ed in con ol issues and
issues ea ed wi h he DNA-DSB inducing
agen bleomycin
SRP004443 SRA
Col-0 WT and pye mu an seedlings we e
g own in Fe- eple ed and Fe-dep i ed media
GSE21582 GEO
Col-0 plan s we e g own hyd oponically,
ans e ed o a ni ogen ee medium o 26 h
and inally supplied wi h 1 mM ni a e o 1 mM
ammonium
GSE29589 GEO
Col-0 plan s we e hyd oponically in nu ien
solu ions wi h a ious concen a ions o ni a e
and suc ose
E-MEXP-828 A ay
exp ess
Col-0 seedlings we e cul i a ed in he da k o
educe endogenous H2O2 hen we e ea ed
wi h 5mM H2O2
GSE40574 GEO
Fi e days old Col-0 seedlings we e ans e ed
o sul u de icien media. Samples we e
collec ed a 0, 3,12, 24, 18, and 72 h
GSE30098 GEO
Samples om Col-0, CO o e exp esso
35S:CO and co-2 mu an we e collec ed in
long-day condi ions (16 h ligh /8 h da k) a ZT4
E-MTAB-1078 A ay
exp ess
The columns ep esen he species name, accession numbe s and da a bases
ac onyms o he di e en expe imen al da ase s. A sho desc ip i e pa ag aph
o he expe imen al design (as s a ed by he au ho s in he da abases) is also
p o ided.
F on ie s in Plan Science | Plan E olu ion and De elopmen Augus 2013 | Volume 4 | A icle 291 |4
Rome o-Campe o e al. Conse ed ligh signaling in plan s
FIGURE 1 | Schema ic wo k low including da a collec ion and
p ocessing as well as gene co-exp ession ne wo k cons uc ion,
analysis and alida ion. The igu e simpli ies he main s eps ollowed in
he wo k low o he cons uc ion and analysis o he co-exp ession
ne wo ks o Chlamydomonas,Physcomi ella,andA abidopsis.This
wo k low equi es a e e ence genome and he co esponding Gene
On ology anno a ion o each species. The anno a ion was ob ained om
he Phy ozome da abase. Gene exp ession es ima ion measu ed in FPKM
was ob ained by aligning sho eads o he e e ence genome and
assembling ansc ip s using Topha and Cu links. Gene co ela ion and
ne wo k cons uc ion we e pe o med wi h di e en Bioconduc o R
packages. Cy oscape was used o ne wo k isualiza ion. Func ional
pa e ns in he neighbo hood o he genes o in e es we e iden i ied wi h
he web ools ag iGO and GO illa. Finally, Q-PCR was used o expe imen al
alida ion. A de ailed ep esen a ion o his wo k low can be seen in
Figu e S1.
ansc ip omes we e s o ed in GTF iles and esol ed using he
so wa e package Cu links and i s p og am Cu me ge (T apnell,
2010). Finally, gene exp ession le els om he di e en condi-
ions in eg a ed in ou s udy we e es ima ed using Cu di , a
p og am included in he Cu links package ha akes as inpu he
alignmen s iles (BAM iles) and he assembled whole ansc ip-
omes (GTF iles). In o de o a oid biases due o he leng h o
he di e en ansc ip s and numbe o eads gene a ed in each
expe imen , Cu links es ima es gene exp ession using as uni o
measu emen he F agmen s Pe Kb o exon pe Million mapped
eads (FPKM) (Mo aza i e al., 2008). Fo he es o he analysis,
explo a ion, manipula ion and isualiza ion o he da a gene a ed
by Cu links we used he R package cummeRbund (Go e al.,
2011).
The analysis o he a yme ix a h1-121501 mic oa ay da a
ob ained o A abidopsis was pe o med ollowing he me hodol-
ogy desc ibed in Hahne e al. (2008). The R package a y (Gau ie
e al., 2004) om he Bioconduc o p ojec (Gen leman e al.,
2004) was used o quali y con ol, backg ound co ec ion, no -
maliza ion wi h he RMA algo i hm (I iza y e al., 2003), and
es ima ion o gene exp ession le els in he di e en condi ions
unde s udy in his wo k.
RESULTS AND DISCUSSION
CONSTRUCTION OF GENE CO-EXPRESSION NETWORKS FOR
Chlamydomonas,Physcomi ella,ANDA abidopsis
In his analysis, signi ican co-exp ession pa e ns among genes
in he ansc ip omes o Chlamydomonas,Physcomi ella,and
A abidopsis ha e been de e mined analysing he massi e amoun
o gene exp ession da a (see Ma e ials and Me hods sec ion) ha
co e s a wide a ie y o physiological condi ions and geno ypes
(Figu e 1). These co-exp ession pa e ns we e ep esen ed using
h ee di e en gene co-exp ession ne wo ks, one o each species
conside ed in his s udy ep esen ing key s eps in he e olu ion o
pho osyn he ic o ganisms.
Fi s , in o de o emo e noise, only hose genes ha exhibi ed
signi ican changes in a leas one compa ison be ween a condi-
ion and i s co esponding con ol, we e selec ed om he s udied
ansc ip omes. This was pe o med acco ding o he s anda d
app oach used o mic oa ay da a and i s adap a ion o he anal-
ysis o RNA-seq da a (Bulla d e al., 2010). The loga i hm o
he gene exp ession le el measu ed in FPKM was compu ed and,
using he del a me hod, he a iance o he log odds es ima ed.
Di e en ially exp essed genes we e hen selec ed combining his
in o ma ion wi h a old-change c i e ion o wo in he exp ession
le el wi h espec o he co esponding con ol.
Nex , he exp ession p o iles o he di e en ially exp essed
genes we e ex ac ed om he gene exp ession da a gene a ed
acco ding o he wo k low p esen ed in Ma e ials and Me hods
sec ion.Theabsolu e alueo hePea son co ela ion coe icien
be ween gene exp ession p o iles was used as a measu emen o
he le el o co-exp ession be ween he co esponding genes.
Finally, i was necessa y o es ablish a co ela ion h eshold
abo e which i was assumed ha wo genes a e signi ican ly co-
exp essed. Fo he a ional selec ion o a gene co ela ion h esh-
old a c i e ion ha seeks he gene a ion o a scale- ee ne wo k
wi h a high densi y was used. This c i e ion was chosen since mos
biological ne wo ks cha ac e ized so a exhibi his scale- ee
p ope y (Ba abasi and Albe , 1999)andbecauseahigh-densi y
ne wo k acili a es he iden i ica ion o pa e ns in he neighbo -
hood o genes (Aoki e al., 2007). Fo each species, he co ela ion
alue o which he R2o he linea eg ession o he loga i hmic
ans o m o he node deg ee dis ibu ion p esen ed a maximum
while keeping an a e age o ∼20 neighbo s pe gene was de e -
mined. Fo Chlamydomonas einha d ii he co ela ion h eshold
was 0.90, p oducing a R2o 0.9274 and a p- alue o 3.397e-08
o he scale- ee p ope y. Fo Physcomi ella pa ens he co ela-
ion h eshold was 0.94 p oducing a R2o 0.9333 and a p- alue
o 8.242e-08 o he scale- ee p ope y. Fo A abidopsis haliana
www. on ie sin.o g Augus 2013 | Volume 4 | A icle 291 |5

Rome o-Campe o e al. Conse ed ligh signaling in plan s
he co ela ion h eshold was 0.90, p oducing a R2o 0.7827 and
ap- alue o 2.964e-04 o he scale- ee p ope y.
Acco ding o he abo e me hodology h ee co-exp ession
ne wo ks in which edges be ween genes ep esen signi ican
co-exp ession pa e ns in he analysed condi ions we e gene a ed.
The gene co-exp ession ne wo k o Chlamydomonas consis ed o
8443 genes and 138,575 signi ican co-exp ession ela ionships.
Fo Physcomi ella he co esponding ne wo k was cons i u ed by
9080 genes connec ed by 518,209 signi ican co-exp ession ela-
ionships. Finally, he gene co-exp ession ne wo k o A abidopsis
ep esen ed 6204 genes and hei 665,034 co-exp ession ela-
ionships. These ne wo ks we e impo ed in o he so wa e
package Cy oscape (Smoo e al., 2011) o hei isualiza-
ion using he o ganic layou (Figu e 2). The co esponding
Cy oscape iles con aining he speci ica ion o each ne wo k
can be downloaded om he link h p://acke mann.cs.us.
es/web_ne wo k/chlamy_physco_a abidopsis.zip o u he
explo a ion and analysis.
IN THE EVOLUTIONARY HISTORY OF THE CO-Like GENE FAMILY FROM
Chlamydomonas TO A abidopsis BOTH ESSENTIAL AND SECONDARY
GENES CAN BE IDENTIFIED
The loca ion o genes in co-exp ession ne wo ks and he size
o hei nea by neighbo hood can be used o de e mine hei
FIGURE 2 | Gene co-exp ession ne wo ks o Chlamydomonas,
Physcomi ella,andA abidopsis.In he ne wo ks, nodes ep esen
genes and edges be ween nodes show signi ican co-exp ession ela ion
be ween hem. C CO,PpCOLs, and A COLs and hei neighbo hoods
(genes h ee edges apa ) a e highligh ed wi h di e en colo s. In he
Chlamydomonas ne wo k (bo om le ) C CO and i s neighbo hood ( ed
colo ) occupy a cen al posi ion sugges ing i s ole as an essen ial egula o
in he Chlamydomonas ansc ip ome. In he Physcomi ella ne wo k ( op
cen e ) PpCOL1,PpCOL4 and hei neighbo hoods ( ed and blue colo s,
espec i ely) occupy a cen al posi ion, while PpCOL5 (g een colo ) is
loca ed in he pe iphe y o he ne wo k. In he A abidopsis ne wo k (bo om
igh ) A COLs genes (di e en colo s) a e widely sp ead o e he ne wo k
indica ing hei ole in mul iple biological p ocesses. Func ional
conse a ion, specializa ion and di e gence du ing he e olu iona y line o
COLs can be obse ed in hei neighbo hood. Consis en ly, C CO,PpCOLs,
and A COLs genes a e co-exp essed wi h genes in ol ed in ligh esponse
(ZEP, Zeaxan hin epoxidase), s a ch me abolism (SSS, solubale s a ch
syn hase), ni ogen me abolism (GS, cy osolic glu amine syn hase)and
esponse o chemical s imulus (ERF, e hylene esponse ac o )asi is
sugges ed by hei nea by localiza ion in he co esponding ne wo ks.
ele ance in he en i e ansc ip ome o he co esponding
o ganism in he condi ions unde s udy (Aoki e al., 2007). The
h ee gene co-exp ession ne wo ks analysed in his wo k a e
scale- ee ne wo ks. In his ype o ne wo ks mos nodes a e
connec ed wi h ew o he s. Ne e heless, he e exis s a small
se o nodes ha a e connec ed o a la ge numbe . These nodes
a e called hubs (Kleinbe g, 1999)andplayakey olein he
unc ioning and in o ma ion p opaga ion in he co esponding
ne wo ks (Ba abasi and Albe , 1999). The hubs in each ne wo k
we e de e mined using he R package ig aph (Csa di and Nepusz,
2006). Only genes wi h a sco e in he op 5% we e conside ed
hubs. The same c i e ion was used o he h ee ne wo ks.
Scale- ee ne wo ks a e obus agains andom pe u ba ions
since hese a e mos likely o hi a node wi h only a ew neighbo s
and he e o e o dis up only a small po ion o he ne wo k.
Ne e heless, scale- ee ne wo ks a e agile agains pe u ba ions
a ec ing he hub nodes. The e o e, he mu a ion o a hub node
a ec s a signi ican numbe o o he nodes connec ed o i
p oducing a cascade phenomenon ha eaches a la ge pa o he
en i e ne wo k (Wang and Chen, 2003). Employing his c i e ion
we can iden i y cen al and essen ial genes as well as pe iphe al
and seconda y ones in he e olu iona y line om he single
gene C CO in Chlamydomonas o he 17 A COL homologues in
A abidopsis (Figu e 2 and Figu e S2).
In he Chlamydomonas gene co-exp ession ne wo k, C CO
appea s loca ed nea he co e o he ne wo k as a hub gene wi h
mo e han 50 neighbo s (Figu e 2). This sugges s ha C CO is
an essen ial gene in he Chlamydomonas ansc ip ome unde
he condi ions s udied in his wo k. A C CO o e exp ession o
mu a ion would p edic ably p oduce a dis up ion in he unc-
ioning o all hese neighbo ing genes ha would p opaga e
quickly h oughou he ne wo k a ec ing a la ge numbe o
o he genes and he biological p ocesses hey a e in ol ed in.
The e o e, any majo change in he exp ession o C CO could
esul in an ex ensi e change in he Chlamydomonas pheno-
ype. This e ec has been epo ed p e iously (Se ano e al.,
2009)whe esilencingo C CO using an isense RNA was shown
o be de imen al o algal g ow h. Mo eo e , o e exp ession
o C CO was epo ed o p oduce massi e changes in cellu-
la mo phology, chlo ophyll con en , g ow h a e and cell-cycle
egula ion.
Using sequence simila i y p og ams om he Phy ozome web
po al, en genes we e iden i ied in he Physcomi ella genome
exhibi ing high simila i y (>40%) wi h he A abidopsis CO gene
(A 5g15840) o he Chlamydomonas C CO gene (g6302). These
genes ha con ained a leas one B-box and CCT domain,
a e iden i ied in he cu en anno a ion e sion 1.6 o he
Physcomi ella genome d a (Table 2). Th ee o hese genes ha e
been s udied p e iously (Shimizu e al., 2004; Zobell e al.,
2005) and named PpCOL1,PpCOL2,andPpCOL3 espec i ely.
Based on he phylogeny and ollowing he same nomencla-
u e, he es o he genes we e named PpCOL4 o PpCOL10.
Only h ee o hese genes PpCOL1,PpCOL4,andPpCOL5 a e
p esen in he Physcomi ella gene co-exp ession ne wo k gen-
e a ed he e. The es o he genes ei he we e no exp essed in
he samples conside ed in his s udy o did no exhibi signi -
ican co-exp ession le els wi h any o he gene in he ne wo k.
F on ie s in Plan Science | Plan E olu ion and De elopmen Augus 2013 | Volume 4 | A icle 291 |6
Rome o-Campe o e al. Conse ed ligh signaling in plan s
This sugges s ha hese genes play hei main ole in o he
physiological condi ions no s udied in his wo k. PpCOL1 and
PpCOL4 a e ound a he cen e o he ne wo k and al hough
hey canno be ega ded as hubs hey a e connec ed o o he
genes ha a e co-exp essed wi h mo e han 300 genes. Bo h
genes a e placed close o each o he sugges ing ha hey may be
in ol ed in simila o ela ed biological p ocesses. This would
con e edundancy and obus ness o he ne wo k, so ha he
al e a ion in he exp ession pa e n o one o hese wo genes
could be coun e ac ed by he no mal unc ion o he o he . In
his espec , he appa en mul iple gene duplica ion o C CO
ha ga e ise o he en-gene amily o PpCOLs has p oduced
edundan hub genes o e ing obus ness o he ansc ip ome o
Physcomi ella.TheC CO descendan gene in he Physcomi ella
ne wo k, PpCOL5, appea s in he pe iphe y o he gene co-
exp ession ne wo k ac ing as a hub wi h 122 neighbo ing genes.
The e o e, PpCOL5 seems o be a key gene in ol ed in seconda y
biological p ocesses in his Physcomi ella ansc ip ome since he
genes o his clus e a e somehow disconnec ed om he es o
he ne wo k (Figu e 2). This may sugges ha , al hough a majo
modi ica ion o he exp ession o PpCOL5 would no be le hal,
i could massi ely dis up he biological p ocesses in which i is
in ol ed.
Finally, in he A abidopsis gene co-exp ession ne wo k, se en
A COL genes ou o a 17-membe gene amily (Table 2) ha e been
iden i ied. These a e CO,COL1,COL2,COL5,COL7,COL9,and
COL13. The o he A COL genes we e no signi ican ly exp essed
in he condi ions conside ed in his s udy possibly because hey
a e in ol ed in biological p ocesses no s udied he e. These
A COLs appea sp ead all o e he ne wo k, sugges ing ha hey
a e in ol ed in a la ge numbe o biological p ocesses co e ing
an impo an pa o he ansc ip ome. COL1,COL2,andCOL7
a e closely a anged a he co e o he ne wo k ( ed clus e in
Figu e 2). In ac , COL1 and COL2 a e di ec ly connec ed. The
h ee o hem ha e mo e han 150 neighbo s each and could
independen ly be conside ed hubs playing a key ole in he unc-
ion and ansmission o in o ma ion in he co e o he ne wo k.
Since hese genes a e loca ed nea each o he hey a e p obably
in ol ed in ela ed biological p ocesses. A majo dis up ion in
he exp ession pa e n o one o hese h ee genes could be eas-
ily compensa ed by he co ec unc ioning o he o he wo. In
ac , single mu a ions in ei he COL1 o COL2 show no signi i-
can e ec in he plan (Ledge e al., 2001). The e o e, i could be
p edic ed ha , in o de o obse e any app eciable change in he
pheno ype a mul iple mu an should be gene a ed. This seems o
indica e ha he new e en s o gene duplica ion ha ook place
be ween Physcomi ella and A abidopsis ha e inc eased he num-
be o edundan hub genes and, as a consequence, he obus ness
agains ex e nal pe u ba ions o i s ansc ip ome. The es o
he A COLs in ou ne wo k a e dis ibu ed owa d he pe iphe y
and p esen ewe neighbo ing genes. I could be in e ed hen
ha hese genes a e no essen ial hubs and could be in ol ed in
seconda y p ocesses. Fo example, a mu a ion in CO limi s i s
e ec s o he capaci y o he plan o lowe in esponse o pho-
ope iod (Rédei, 1962) and i s o e exp ession esul s mainly in
an ea ly lowe ing pheno ype (Pu e ill e al., 1995). Seconda y
pheno ypic e ec s no obse ed in he mu an could a ise due o
CO o e exp ession assuming he unc ion o o he A COLs.In
a simila si ua ion, COL5 and COL9 a e loca ed nea by CO and
hei o e exp ession ha e been epo ed o p oduce a mild ea ly
lowe ing and la e lowe ing pheno ypes, espec i ely (Cheng and
Wang, 2005; Hassidim e al., 2009). Fo COL13 i s si ua ion in he
ne wo k is analogous bu he e ec o i s mu a ion o o e exp es-
sion has no been s udied. A simila lowe ing pheno ype could
be p edic ed o his gene when o e exp essed.
THE GENE NEIGHBORHOODS OF C CO,PpCOLs,ANDA COLs REVEAL
CONSERVATION OF CO-EXPRESSED BIOLOGICAL PROCESSES ACROSS
THE PLANT EVOLUTIONARY LINEAGE
In o de o s udy he di e en biological p ocesses associa ed o
he genes ha cons i u e he e olu iona y line om he single
copy C CO in Chlamydomonas o he 17 A COLs in A abidopsis
(Figu e S2), hei neighbo hood in he co esponding ne wo ks
was cha ac e ized. Fo his eason, genes a a dis ance o a leas
h ee, ha is, hose genes ha can be eached using pa hs wi h
h ee edges om he genes o in e es , we e selec ed. Nex , GO
(The Gene On ology Conso ium, 2000) e m en ichmen o e
he anno a ion o hese genes using he web-based so wa e ools
GO illa (Eden e al., 2009)andAg iGO(Du e al., 2010)was
pe o med, aking heen i egenomeasbackg ound.In hecase
o A abidopsis we we e able o use di ec ly he GO anno a ion
in o ma ion a ailable a he esou ce TAIR .10. Ne e heless, o
Physcomi ella and Chlamydomonas such in o ma ion is no a ail-
able due o he lack o p e ious expe imen al s udies. Ins ead,
o hese species, GO anno a ion in e ed om he in o ma ion
in Phy ozome and P am (Pun a e al., 2012)abou hep o ein
amilies o which each gene-encoded p o ein belongs was used.
Fi s , o he GO en ichmen in each one o he h ee ne -
wo ks, he union o he neighbo hood o he co esponding
COL genes unde s udy, was conside ed. Mo e speci ically, o
Chlamydomonas,Physcomi ella,andA abidopsis he se o genes
used o pe o m GO en ichmen we e he neighbo s a a dis ance
o h ee o C CO,anyo hePpCOLs and any o he A COLs,
espec i ely. A a i s glance, a high o e lapping be ween he
signi ican ly en iched GO e ms in he p e ious h ee se s o
neighbo ing genes could be obse ed. This indica es ha he di -
e en biological p ocesses in which C CO,somePpCOLs and
A COLs a e in ol ed a e la gely conse ed ac oss he species e o-
lu ion. Addi ionally, new biological p ocesses appea ed in he
en ichmen o he co esponding se s o genes in Physcomi ella
and A abidopsis ha bo h species sha e in common (Table 3).
This p o ides e idences o newly acqui ed in luence o e di e -
en p ocesses in Physcomi ella ha a e a e wa ds conse ed and
expanded in A abidopsis.
One o he mos signi ican ly en iched GO e ms in he
egions unde s udy in he h ee ne wo ks om Chlamydomonas
o A abidopsis is Response o ligh s imulus. Genes loca ed in
he neighbo hood o C CO,PpCOLs,andA COLs signi ican ly
include genes in ol ed in pho ope cep ion such as C yp och omes
(CRY)(C e06.g295200,Pp1s488_10V6,A 4g08920), in edox p o-
cesses egula ed by ligh such as Zeaxan hin epoxidase (ZEP)
(C e02.g095750,Pp1s321_9V6,A 5g67030)andCy och ome P450
(CYP)(C e07.g325000,Pp1s281_82V6,A 5g05690)andin he
p o ec ion agains high ligh in ensi y such as Ligh Ha es ing
www. on ie sin.o g Augus 2013 | Volume 4 | A icle 291 |7
Rome o-Campe o e al. Conse ed ligh signaling in plan s
Complexes (LHC)(C e17.g740950,Pp1s628_3V6,A 4g10340)o
he pho osys em II. This esponse o ligh has been p e iously
epo ed o C CO (Se ano e al., 2009), PpCOL1 (Zobell e al.,
2005)andCO (Val e de e al., 2004). The e o e, his in e species
ne wo k analysis could success ully p edic gene unc ion using
he signi ican ly en iched GO e ms obse ed in he co espond-
ing modules a ound he genes o in e es .
The nex conse ed GO e ms a e in ol ed in me abolism
such as S a ch me abolic p ocess; Lipid me abolic p ocess and
Ni ogen compound me abolic p ocess. Consis en ly, in he
egions o he h ee ne wo ks, genes in ol ed in s a ch
biosyn hesis such as S a ch Syn hases (SSS)(C e16.g665800,
Pp1s234_74V6,A 4g18240), in s a ch hyd olysis such as Be a-
amylases (BAM)(C e01.g044100,Pp1s317_42V6,A 2g32290), in
a y acid syn hesis such as Long Chain Acyl-CoA syn hases (LACS)
(Pp1s113_124V6,A 2g47240)and3-ke oacyl-CoA syn hase (KCS)
(C e07.g320550, Pp1s268_29V6, A 4g34250), in a y acid mod-
i ica ion such as Fa y Acid Desa u ases (FAD)(C e13.g590500,
Pp1s98_209V6,A 3g15850), Glu amine Syn he ase (GS)(g13061,
Pp1s19_281V6,A 5g37600)andNi a e T anspo e (NTR)
(g18260,Pp1s283_88V6,A 4g18480) can be ound. Recen ly, he
in luence o C CO and CO o e he me abolism o s a ch and
ca bohyd a es has been desc ibed (Se ano e al., 2009;O iz
e al., unpublished esul s). The e ec o hese genes o e he
me abolism o lipids and ni ogen compounds sugges ed in his
wo k emains o be explo ed expe imen ally. This e lec s he
possible applica ion o his ype o analysis, employing he e o-
lu iona y line o gene co-exp ession ne wo ks, o gene unc ion
p edic ion. This way, when a gene wi h an unknown unc ion
is consis en ly co-exp essed ac oss i s e olu iona y lineage wi h
he same well-cha ac e ized genes, a pu a i e unc ion could be
assigned o i .
Finally, se e al GO e ms de ined as Response o chemi-
cal s imulus and De elopmen al p ocess, we e iden i ied ha
signi ican ly and speci ically appea ed en iched bo h in he
Physcomi ella and A abidopsis ne wo ks. Al hough hese GO
e m did no appea signi ican ly ep esen ed in he neigh-
bo hood o C CO in he Chlamydomonas ne wo k we we e
s ill able o iden i y se e al algal genes ha showed a sim-
ila anno a ion, including E hylene Response Fac o s (ERF)
(g15714,Pps265_50V6,A 1g53910)andAuxin T anspo e s (AUX)
(C e16.g680200,Pp1s167_10V6,A 5g43700). O he GO e m
such as Response o jasmona e only p esen ed conse ed genes
in Physcomi ella and A abidopsis ne wo ks such as Jasmona e
Insensi i e (JIN)(Pp1s11_350V6,A 1g32640)andJasmona e
Responsi e (JR)(Pp1s200_12V6,A 3g16470) genes. In ac , i has
been sugges ed ha Chlamydomonas can espond o some ho -
monal s imuli and ha his e ec has s e ched and become
mo e complex as plan s de eloped in ica e s uc u es and unc-
ions, eaching he complexi y o he cu en plan ho mone
esponses (Riaño-Pachon e al., 2008). These could be iden i-
ied as he p ecu so s o genes associa ed o ho mone signal-
ing and expe imen s could be designed o demons a e hei
unc ion. The e o e, ano he applica ion o his c oss species
ne wo k analysis could be o p edic he e olu ion o phys-
iological p ocesses and hei impo ance in he di e si ica-
ion o key egula o y esponses (such as ho mone esponses)
be ween di e en species. I his is he case, when applied
o a species ansc ip ome, implying he s udy o egula o y
modules o many key ac o s in a na u al popula ion con-
ex , his analysis could be a e y use ul ool o unde s and
specia ion.
GENE SPECIALIZATION AND THE ESTABLISHMENT OF CONNECTIONS
BETWEEN DIFFERENT BIOLOGICAL PROCESSES IS REFLECTED IN THE
EVOLUTIONARY HISTORY FROM C CO TO A COLs
P e iously i was shown ha , in he mul i-gene amilies o
Physcomi ella and A abidopsis, di e en genes appea a dis an
posi ions in he ne wo k showing dis inc le els o impo ance
in he o ganiza ion and in o ma ion ansmission o he co e-
sponding ne wo ks. In o de o de e mine i his in luences he
biological unc ions o genes, GO e m en ichmen in he neigh-
bo hood o each indi idual gene o in e es in his wo k, was
pe o med.
In he Chlamydomonas genome a single C CO copy in ol ed
in co e biological p ocesses can be iden i ied: esponse o
ligh s imulus, s a ch me abolic p ocess, lipid me abolic p o-
cess and ni ogen compound me abolic p ocess. A ending
o ou analysis C CO could also be ma ginally in ol ed in
p e-de elopmen al p ocesses and esponse o chemical s imuli
(Table 4 and Figu e 3).
In he Physcomi ella ne wo k h ee COL genes we e iden i-
ied: PpCOL1,PpCOL4,andPpCOL5. GO e m en ichmen in
each o he neighbo hood o hese genes show ha each one has
di e ged o specialize in a pa icula biological p ocess. PpCOL1
exhibi s a high le el o co-exp ession wi h LHC, SSS and a y
acid dena u izes. This sugges s a specializa ion o his gene in
esponse o ligh and ca bon me abolism, consolida ing a con-
nec ion ha was al eady es ablished in Chlamydomonas.On he
o he hand, in he neighbo hood o PpCOL4 and PpCOL5, genes
associa ed wi h ni ogen me abolism, aging, de elopmen and
esponse o chemical s imuli can be ound. This sugges s ha
hese p ocesses, ha we e seconda y o C CO in Chlamydomonas,
became ela ed o new COL genes and possibly mo e ele an
du ing he e olu ion o plan s in o species like Physcomi ella.
Duplica ion and di e si ica ion om C CO p oduced genes such
as PpCOL4 and PpCOL5 ha co e ed he new challenges ela ed
o main aining a mul icellula o ganism in o de o coo dina e,
among o he s, i s de elopmen al p ocesses. O special in e es
among he genes highly co-exp essed wi h hese wo genes is he
Physcomy h ella PEBP, Phospha idyl-E anolamine Binding P o ein
(Pp1s32_140V6). This gene shows a high sequence simila i y wi h
he FT gene, he mobile lo igen ho mone ha cons i u es he
main a ge o CO in A abidopsis. The e o e, ano he possible
applica ion o ou app oach would be o iden i y ue unc ional
o hologous genes by de e mining whe he o no hei neighbo -
ing genes o known unc ions in he co esponding ne wo ks a e
e olu iona ily conse ed.
In he A abidopsis ne wo k, a conside able inc ease in he com-
plexi y and di e si ica ion o he unc ion o he se en A COL
genes included in his s udy is appa en . A g oup o genes com-
p ising COL1,COL2,COL5,andCOL7 a e co-exp essed wi h
genes whose unc ion is simila o he co e p ocesses associa ed
wi h C CO, such as esponse o ligh , s a ch, lipid and ni ogen
F on ie s in Plan Science | Plan E olu ion and De elopmen Augus 2013 | Volume 4 | A icle 291 |8
Rome o-Campe o e al. Conse ed ligh signaling in plan s
Table 4 | GO e ms signi ican ly en iched in C CO,PpCOLs, and A COLs neighbo hood in he gene co-exp ession ne wo ks.
Chlamydomonas einha d ii Physcomi ella pa ens A abidopsis haliana
Gene GO e m*Rep esen a i e
genes**
Gene GO e m*Rep esen a i e
genes**
Gene GO e m*Rep esen a i e
genes**
C CO (g6302)
Response o
ligh s imulus
GO:0009416
(2.73 ×10−5)
C e06.g295200
C e07.g325000
C e17.g740950
(24)
PpCOL1 (Pp1s371_27V6)
Response o ligh
s imulus
GO:0009416
(2.61 ×10−3)
Pp1s281_82V6
Pp1s628_3V6
(13)
COL1 (A 5g15850), COL2 (A 3g02380)
COL5 (A 5g57660), COL7 (A 1g73870)
Response o ligh s imulus
GO:0009416
(3.26 ×10−6)
A 4g08920
A 5g05690
A 1g44575
(24)
Response o cold
GO:0009409
(6.73 ×10−6)
A 1g12860
A 5g57560
A 5g20630
(17)
S a ch me abolic
p ocess
GO:0005982
(2.98 ×10−5)
C e16.g665800
C e01.g044100
(7)
Ca bohyd a e
me abolic
p ocess
GO:0005975
(1.2×10−3)
Pp1s234_74V6
Pp1s317_42V6
(12)
S a ch me abolic p ocess
GO:0005982
(1.94 ×10−3)
A 4g18240
A 5g24300
A 2g32290
(7)
Lipid me abolic
p ocess
GO:0006629
(4.83 ×10−3)
C e13.g590500
g14829
C e06.g256750
(20)
Fa y acid
biosyn he ic
p ocess
GO:0006633
(3.74 ×10−2)
Pp1s268_29V6
Pp1s7_269V6
Pp1s98_209V6
(5)
Lipid me abolic p ocess
GO:0006629
(1.45 ×10−2)
A 2g47240
A 4g34250
A 3g15850
(20)
Ni ogen
compound
me abolic
p ocess
GO:0006807
(5.63 ×10−3)
g13061
C e03.g207250
g18260
(72)
PpCOL4 (Pp1s36_238V6)
Ni ogen
compound
me abolic
p ocess
GO:0006807
(4.7×10−3)
Pp1s283_88V6
Pp1s128_117V6
(44)
Ni ogen compound
me abolic p ocess
GO:0006807
(3.34 ×10−5)
A 5g37600
A 5g35630
A 4g18480
A 3g09650
(18)
Aging
GO:0007568
(1.82 ×10−2)
Pp1s1_163V6
(6)
Response o auxin
s imulus
GO:0009733
(7.46 ×10−4)
A 1g29440
A 4g38850
A 1g08810
(13)
De elopmen al
p ocess
GO:0032502
(4.52 ×10−4)
C e06.g271100
C e06.g251700
C e06.g299300
(53)
PpCOL5 (Pp1s26_5V6)
De elopmen al
p ocess
GO:0032502
(1.19 ×10−4)
Pp1s10_24V6
Pp1s232_84V6
Pp1s38_120V6
(16)
Response o Gibbe ellin
s imulus
(0.029)
A 2g37640
A 1g74670
A 1g71030
(13)
CO (A 5g15840)
Response o Jasmodic
acid s imulus
GO:0009753
(6.73 ×10−5)
A 1g32640
A 3g16470
A 1g19640
(9)
Response o empe a u e
s imulus
GO:0009266
(1.86 ×10−3)
A 2g45660
A 3g27660
(8)
Response o ca bohyd a e
s imulus GO:0009743
(2.15 ×10−2)
A 3g50060
A 5g67300
(6)
Response o
chemical
s imulus
GO:0042221
(2.9×10−2)
g15714
C e16.g680200
C e02.g095750
(11)
Response o
chemical s imulus
GO:0042221
(6.81 ×10−3)
Pp1s167_70V6
Pp1s265_50V6
Pp1s175_16V6
(23)
De ense esponse
GO:0006952
(6.39 ×10−4)
A 4g31800
A 1g42560
(14)
COL9 (A 3g07650)
Ci cadian hy hm
GO:0007623
(4.56 ×10−5)
A 2g46830
A 5g61380
(5)
Response o cold
GO:0009409
(3.65 ×10−3)
A 2g21660
A 3g08730
(5)
(Con inued)
www. on ie sin.o g Augus 2013 | Volume 4 | A icle 291 |9
Rome o-Campe o e al. Conse ed ligh signaling in plan s
Gu ié ez,R.A.,Lejay,L.V.,Dean,
A., Chia omon e, F., Shasha, D.
E., and Co uzzi, G. M. (2007).
Quali a i e ne wo k models and
genome-wide exp ession da a
de ine ca bon/ni ogen- esponsi e
molecula machines in A abidopsis.
Genome Biol. 8, R7.
Hahne, F., Hube , W., Gen leman,
R., and Falcon, S. (2008).
Bioconduc o Case S udies.
New Yo k, NY: Sp inge . doi:
10.1007/978-0-387-77240-0
Hassidim,M.,Ha i ,Y.,Yaki ,E.,K on,
I., and G een, R. M. (2009). O e -
exp ession o CONSTANS-LIKE 5
can induce lowe ing in sho -
day g own A abidopsis.Plan a 230,
481–491. doi: 10.1007/s00425-009-
0958-7
Heinz, S., Benne , C., Spann, N.,
Be olino, E., Lin, Y. C., Laslo,
P., e al. (2010). Simple combi-
na ions o lineage-de e mining
ansc ip ion ac o s p ime cis-
egula o y elemen s equi ed o
mac ophage and B cell iden i-
ies. Mol. Cell 38, 576–589. doi:
10.1016/j.molcel.2010.05.004
Imaizumi, T. (2010). A abidopsis ci -
cadian clock and pho ope iodism:
ime o hink abou loca ion. Cu .
Opin. Plan Biol. 13, 83–89. doi:
10.1016/j.pbi.2009.09.007
I iza y, R. A., Hobbs, B., Collin, F.,
Beaze -Ba clay, Y. D., An onellis,
K. J., Sche , U., e al. (2003).
Explo a ion, no maliza ion, and
summa ies o high densi y oligonu-
cleo ide a ay p obe le el da a.
Bios a is ics 4, 249–264. doi:
10.1093/bios a is ics/4.2.249
Iye -Pascuzzi, A. S., Jackson, T., Cui, H.,
Pe icka,J.J.,Busch,W.,Tsukagoshi,
H., e al. (2011). Cell iden i y
egula o s link de elopmen and
s ess esponses in he A abidopsis
oo . De . Cell 21, 770–782. doi:
10.1016/j.de cel.2011.09.009
Jackson, S. D. (2009). Plan
esponses o pho ope iod.
New Phy ol. 181, 517–531. doi:
10.1111/j.1469-8137.2008.02681.x
Jang, S., Ma chal, V., Panig ahi, K.
C.,Wenkel,S.,Soppe,W.,Deng,
X. W., e al. (2008). A abidopsis
COP1 shapes he empo al pa -
e n o CO accumula ion con-
e ing a pho ope iodic lowe ing
esponse. EMBO J. 27, 1277–1288.
doi: 10.1038/emboj.2008.68
Jones,D.T.,Taylo ,W.R.,and
Tho n on, J. M. (1992). The
apid gene a ion o mu a ion da a
ma ices om p o ein sequences.
Compu . Appl. Biosci. 8, 275–282.
Khanna, R., K onmille , B., Maszle,
D. R., Coupland, G., Holm, M.,
Mizuno, T., e al. (2009). The
A abidopsis B-box zinc inge am-
ily. Plan Cell 21, 3416–3420. doi:
10.1105/ pc.109.069088
Kim, W. Y., Fujiwa a, S., Suh, S. S., Kim,
J., Kim, Y., Han, L., e al. (2007).
ZEITLUPE is a ci cadian pho o e-
cep o s abilized by GIGANTEA in
blue ligh . Na u e 449, 356–360. doi:
10.1038/na u e06132
Kimu a, M., and Oh a, T. (1974). On
some p inciples go e ning molec-
ula e olu ion. P oc. Na l. Acad.
Sci. U.S.A. 71, 2848–2852. doi:
10.1073/pnas.71.7.2848
Kleinbe g, J. (1999). Au ho i a i e
sou ces in a hype linked en i on-
men . J. ACM 46, 604–632. doi:
10.1145/324133.324140
K opa , J., Hong-He mesdo , A.,
Case o, D., En , P., Cas ui a, M.,
Pelleg ini, M., e al. (2011). A
e ised mine al nu ien supple-
men inc eases biomass and g ow h
a e in Chlamydomonas ein-
ha d ii.Plan J. 66, 770–780. doi:
10.1111/j.1365-313X.2011.04537.x
Lajoie, M., Be and, D., and El-
Mab ouk, N. (2010). In e ing he
e olu iona y his o y o gene clus e s
om phylogene ic and gene o de
da a. Mol. Biol. E ol. 27, 761–772.
doi: 10.1093/molbe /msp271
Láza o, A., Val e de, F., Piñei o, M., and
Ja illo, J. A. (2012). The a abidopsis
E3 Ubiqui in ligase HOS1 nega i ely
egula es CONSTANS abundance in
he pho ope iodic con ol o lowe -
ing. Plan Cell 24, 982–999.
Ledge , S., S aye , C., Ash on, F.,
Kay, S. A., and Pu e ill, J. (2001).
Analysis o he unc ion o wo
ci cadian- egula ed CONSTANS-
LIKE genes. Plan J. 26, 15–22. doi:
10.1046/j.1365-313x.2001.01003.x
Li,L.,Huang,Y.,Xia,X.,andSun,Z.
(2006). P e e en ial duplica ion in
hespa sepa o ayeas p o ein
in e ac ion ne wo k. Mol. Biol. E ol.
23, 2467–2473. doi: 10.1093/mol-
be /msl121
Long,T.A.,Tsukagoshi,H.,Busch,W.,
Lahne ,B.,Sal ,D.E.,andBen ey,P.
N. (2010). The bHLH ansc ip ion
ac o POPEYE egula es esponse
o i on de iciency in A abidopsis
oo s. Plan Cell 22, 2219–2236. doi:
10.1105/ pc.110.074096
Man ield, I. W., De lin, P., Jen, C. H.,
Wes head,D.R.,andGilma in,
P. M. (2007). Conse a ion,
con e gence, and di e gence
o ligh - esponsi e, ci cadian-
egula ed, and issue-speci ic
exp ession pa e ns du ing e olu-
ion o he A abidopsis GATA gene
amily. Plan Physiol. 143, 941–958.
doi: 10.1104/pp.106.090761
Ma chle -Baue , A., and B yan , S. H.
(2004). CD-Sea ch: p o ein domain
anno a ions on he ly. Nucleic
Acids Res. 1, W327–W331. doi:
10.1093/na /gkh454
Me zke , M. L. (2010). Sequencing
echnologies – he nex gene a ion.
Na . Re . Gene . 11, 31–46. doi:
10.1038/n g2626
Mille , R., Wu, G., Deshpande,
R.,Viele ,A.,Ga ne ,K.,
Li, X., e al. (2010). Changes
in ansc ip abundance in
Chlamydomonas einha d ii ol-
lowing ni ogen dep i a ion p edic
di e sion o me abolism. Plan
Physiol. 154, 1737–1752. doi:
10.1104/pp.110.165159
Mo aza i, A., Williams, B., McCue,
K., Schae , L., and Wold, B. (2008).
Mapping and quan i ying mam-
malian ansc ip omes by RNA-
seq. Na . Me hods 5, 621–628. doi:
10.1038/nme h.1226
Mülle , G. B. (2007). E o–de o:
ex ending he e olu iona y syn he-
sis. Na . Re . Gene . 8, 943–949. doi:
10.1038/n g2219
Nas all,J.,Sun,L.,Ro h,J.R.,and
Ande sson, D. I. (2012). Real- ime
e olu ion o new genes by inno-
a ion, ampli ica ion, and di e -
gence. Science 338, 384–387. doi:
10.1126/science.1226521
Ohno, S. (1970). E olu ion by Gene
Duplica ion.NewYo k,NY:
Sp inge .
Oldham, M. C., Ho a h, S.,
and Geschwind, D. H. (2006).
Conse a ion and e olu ion o gene
coexp ession ne wo ks in human
and chimpanzee b ains. P oc. Na l.
Acad.Sci.U.S.A. 103, 17973–17978.
doi: 10.1073/pnas.0605938103
Pa e son, K., Cakmak, T., Coope ,
A., Lage , I., Rasmusson, A. G.,
and Escoba , M. A. (2010). Dis inc
signalling pa hways and ansc ip-
ome esponse signa u es di e -
en ia e ammonium- and ni a e-
supplied plan s. Plan Cell En i on.
33, 1486–1501.
Pun a, M., Coggil, P. C., Ebe ha d ,
R. Y., Mis y, J., Ta e, J., Bou nsell,
C., e al. (2012). The P am p o-
ein amilies da abase. Nucleic
Acids Res. 40, D290–D301. doi:
10.1093/na /gk 1065
Pu e ill, J., Robson, R., Lee, K., Simon,
R., and Coupland, G. (1995). The
CONSTANS gene o A abidopsis
p omo es lowe ing and encodes
a p o ein showing simila i ies o
zinc inge ansc ip ion ac o s.
Cell 80, 885–900. doi: 10.1016/0092-
8674(95)90288-0
Rédei, G. P. (1962). Supe i al mu an s
o A abidopsis.Gene ics 47, 443–460.
Riaño-Pachon, D. M., Co ea, L.
G. G., T ejos-Espinosa, R.,
and Muelle -Roebe , B. (2008).
G een ansc ip ion ac o s: a
Chlamydomonas o e iew. Gene ics
179, 31–39.
Robson, F., Cos a, M. M., Hepwo h, S.
R., Vizi , I., Piñei o, M., Ree es, P.
H., e al. (2001). Func ional impo -
ance o conse ed domains in he
lowe ing- ime gene CONSTANS
demons a ed by analysis o mu an
alleles and ansgenic plan s. Plan J.
28, 619–631.
Rome o, J. M., and Val e de, F. (2009).
E olu iona ily conse ed pho ope-
iod mechanisms in plan s. Plan
Signal. Beha . 4, 642–644. doi:
10.4161/psb.4.7.8975
Ruij e , J. M., Ramake s, C., Hoogaa s,
W.,Bakke ,O.,VanDenHo ,
M. J. B., Ka len, Y., e al. (2009).
Ampli ica ion e iciency: linking
baseline and bias in he analysis
o quan i a i e PCR da a. Nucleic
Acids Res. 37, 45. doi: 10.1093/na /
gkp045
Rus ici, G., Kolesniko , N., B andizi,
M.,Bu de ,T.,Dylag,M.,Emam,I.,
e al. (2013). A ayexp ess upda e –
ends in da abase g ow h and links
o da a analysis ools. Nucleic Acids
Res. 41, D987–D990.
Sai ou, N., and Nei, M. (1987). The
neighbo -joining me hod: a new
me hod o econs uc ing phylo-
gene ic ees. Mol. Biol. E ol.4,
406–425.
Samach, A., Onouchi, H., Gold, S.
E.,Di a,G.S.,Schwa z-Somme ,
Z., Yano sky, M. F., e al. (2000).
Dis inc oles o CONSTANS
a ge genes in ep oduc i e
de elopmen o A abidopsis.
Science 288, 1613–1616. doi:
10.1126/science.288.5471.1613
Schliesky, S., Gowik, U., Webe , A.
P. M., and B äu igam, A. (2012).
RNA-seq assembly – a e we he e
ye ? F on . Plan Sci. 3:220. doi:
10.3389/ pls.2012.00220
Se ano, G., He e a-Palau, R.,
Rome o,J.M.,Se ano,A.,
Coupland, G., and Val e de,
F. (2009). Chlamydomonas
CONSTANS and he e olu ion
o plan pho ope iodic signalling.
Cu . Biol. 19, 359–368. doi:
10.1016/j.cub.2009.01.044
Shimizu, M., Ichikawa, K., and Aoki,
S. (2004). Pho ope iod- egula ed
exp ession o he PpCOL1 gene
encoding a homolog o CO/COL
p o eins in he moss Physcomi ella
pa ens.Biochem. Biophys. Res.
Commun. 324, 1296–1301. doi:
10.1016/j.bb c.2004.09.194
Simon, R., Igeno, I. M., and Coupland,
G. (1996). Ac i a ion o lo-
al me is em iden i y genes in
A abidopsis.Na u e 384, 59–62. doi:
10.1038/384059a0
F on ie s in Plan Science | Plan E olu ion and De elopmen Augus 2013 | Volume 4 | A icle 291 |16

Rome o-Campe o e al. Conse ed ligh signaling in plan s
Smoo , M., Ono, K., Ruscheinski,
J., Peng-Liang, W., and Ideke , T.
(2011). Cy oscape 2.8: new ea-
u es o da a in eg a ion and ne -
wo k isualiza ion. Bioin o ma ics
27, 431–432. doi: 10.1093/bioin o -
ma ics/b q675
Sueoka,N.,Chiang,K.S.,andKa es,
R. J. (1967). Deoxy ibonucleic
acid eplica ion in meiosis
o Chlamydomonas einha di.
J. Mol. Biol. 25, 47–66. doi:
10.1016/0022-2836(67)90278-1
Tamu a, K., Pe e son, D., Pe e son, N.,
S eche , G., Nei, M., and Kuma ,
S. (2011). MEGA5: molecula
e olu iona y gene ics analy-
sis using maximum likelihood,
e olu iona y dis ance, and max-
imum pa simony me hods. Mol.
Biol. E ol. 28, 2731–2739. doi:
10.1093/molbe /ms 121
The Gene On ology Conso ium.
(2000). Gene on ology: ool o he
uni ica ion o biology. Na . Gene .
25, 25–29.
Tiwa i,S.B.,She,Y.,Chang,H.-C.,
Hou, Y., Ha is, A., Ma, S. F.,
e al. (2010). The lowe ing ime
egula o CONSTANS is ec ui ed
o he FLOWERING LOCUS T
p omo e ia a unique cis-elemen .
New Phy ol. 187, 57–66. doi:
10.1111/j.1469-8137.2010.03251.x
Tohge, T., and Fe nie, A. R. (2012).
Co-exp ession and co- esponses:
wi hin and beyond ansc ip-
ion. F on . Plan Sci. 3:248. doi:
10.3389/ pls.2012.00248
T apnell, C. (2010). T ansc ip assem-
blyandquan i ica ionbyRNA-
seq e eals unanno a ed ansc ip s
and iso o m swi ching du ing cell
di e en ia ion. Na . Bio echnol. 28,
511–515. doi: 10.1038/nb .1621
T apnell, C., Pa che , L., and Salzbe g,
S. (2009). TopHa : disco e ing
splice junc ios wi h RNA-seq.
Bioin o ma ics 25, 1105–1111. doi:
10.1093/bioin o ma ics/b p120
T apnell, C., Robe s, A., Go , L.,
Pe ea, G., Kim, D., Kelley, D. R.,
e al. (2012). Di e en ial gene
and ansc ip exp ession anal-
ysis o RNA-seq expe imen s
wi h TopHa and Cu links.
Na . P o oc. 7, 562–578. doi:
10.1038/np o .2012.016
U zica,E.I.,Adle ,L.N.,Page,M.
D.,Lins e ,C.L.,A bing,M.A.,
Case o, D., e al. (2012). Impac o
oxida i e s ess on asco ba e biosyn-
hesis in Chlamydomonas ia egu-
la ion o he VTC2 gene encoding
aGDP-L-galac ose phospho ylase.
J. Biol. Chem. 287, 14234–14245.
doi: 10.1074/jbc.M112.341982
Usadel, B., Obayashi, T., Mu wil,
M., Gio gi, F. M., Bassel,
G. W., Tanimo o, M., e al.
(2009). Co-exp ession ools o
plan biology: oppo uni ies
o hypo hesis gene a ion and
ca ea s. Plan Cell En i on. 32,
1633–1651. doi: 10.1111/j.1365-
3040.2009.02040.x
Val e de, F. (2011). CONSTANS and
he e olu iona y o igin o pho-
ope iodic iming o lowe ing.
J. Exp. Bo . 62, 2453–2463. doi:
10.1093/jxb/e q449
Val e de, F., Mou ado , A., Soppe, W.,
Ra ensc o , D., Samach, A., and
Coupland, G. (2004). Pho o ecep o
egula ion o CONSTANS p o ein
in pho ope iodic lowe ing. Science
303, 1003–1006. doi: 10.1126/sci-
ence.1091761
Wahl, V., Ponnu, J., Schle e h, A.,
A i aul ,S.,Langenecke ,T.,
F anke, A., e al. (2013). Regula ion
o Flowe ing by T ehalose-6-
Phospha e Signaling in A abidopsis
haliana.Science 339, 704–707. doi:
10.1126/science.1230406
Wang, X. F., and Chen, G. (2003).
Complex ne wo ks: small-wo ld,
scale- ee, and beyond. IEEE
Ci cui s Sys . Mag. 3, 6–20. doi:
10.1109/MCAS.2003.1228503
Wenkel, S., Tu ck, F., Le Gou ie ec,
J., Samach, A., and Coupland,
G. (2006). CONSTANS and he
CCAATboxbindingcomplexsha e
a unc ionally impo an domain
and in e ac o egula e lowe -
ing o A abidopsis.Plan Cell 8,
2971–2984.
Wheele , D. L., Ba e , T., Benson,
D.A.,B yan ,S.H.,Canese,K.,
Chu ch, D. M., e al. (2005).
Da abase esou ces o he na ional
cen e o bio echnology in o -
ma ion. Nucleic Acids Res. 33,
D39–D45.
Xiao,L.,Wang,H.,Wan,P.,
Kuang, T., and He, Y. (2011).
Genome-wide ansc ip ome
analysis o game ophy e de el-
opmen in Physcomi ella pa ens.
BMC Plan Biol. 15:177. doi:
10.1186/1471-2229-11-177
Yu,J.W.,Rubio,V.,Lee,N.Y.,Bai,
S., Lee, S. Y., Kim, S. S., e al.
(2008). COP1 and ELF3 con ol
ci cadian unc ion and pho ope i-
odic lowe ing by egula ing GI s a-
bili y. Mol. Cell 32, 617–630. doi:
10.1016/j.molcel.2008.09.026
Zemach,A.,McDaniel,I.E.,Sil a,
P., and Zilbe man, D. (2010).
Genome-wide e olu iona y analysis
o euka yo ic DNA me hyla-
ion. Science 14, 916–919. doi:
10.1126/science.1186366
Zhang, J. (2003). E olu ion by gene
duplica ion: an upda e. T ends
Ecol. E ol. 6, 292–298. doi:
10.1016/S0169-5347(03)00033-8
Zobell, O., Coupland, G., and Reiss, B.
(2005). The amily o CONSTANS-
Like genes in Physcomi ella
pa ens.Plan Biol. 7, 266–275. doi:
10.1055/s-2005-865621
Con lic o In e es S a emen : The
au ho s decla e ha he esea ch
was conduc ed in he absence o any
comme cial o inancial ela ionships
ha could be cons ued as a po en ial
con lic o in e es .
Recei ed: 29 Ap il 2013; accep ed: 13 July
2013; published online: 05 Augus 2013.
Ci a ion: Rome o-Campe o FJ, Lucas-
Reina E, Said FE, Rome o JM and
Val e de F (2013) A con ibu ion o he
s udy o plan de elopmen e olu ion
based on gene co-exp ession ne wo ks.
F on . Plan Sci. 4:291. doi: 10.3389/ pls.
2013.00291
This a icle was submi ed o F on ie s
in Plan E olu ion and De elopmen , a
special y o F on ie s in Plan Science.
Copy igh © 2013 Rome o-Campe o,
Lucas-Reina, Said, Rome o and
Val e de.Thisisanopen-access
a icle dis ibu ed unde he e ms o
he C ea i e Commons A ibu ion
License (CC BY). The use, dis ibu-
ion o ep oduc ion in o he o ums
is pe mi ed, p o ided he o iginal
au ho (s) o licenso a e c edi ed and
ha he o iginal publica ion in his
jou nal is ci ed, in acco dance wi h
accep ed academic p ac ice. No use,
dis ibu ion o ep oduc ion is pe mi -
ed which does no comply wi h hese
e ms.
www. on ie sin.o g Augus 2013 | Volume 4 | A icle 291 |17