A icle h ps://doi.o g/10.1038/s41467-023-38663-7
A p e iously uncha ac e ized Fac o
Associa ed wi h Me abolism and Ene gy
(FAME/C14o 105/CCDC198/1700011H14Rik)
is ela ed o e olu iona y adap a ion, ene gy
balance, and kidney physiology
A lis o au ho s and hei a filia ions appea s a he end o he pape
In his s udy we use compa a i e genomics o unco e a gene wi h uncha -
ac e ized unc ion (1700011H14Rik/C14o 105/CCDC198), which we he eby
name FAME (Fac o Associa ed wi h Me abolism and Ene gy). We obse e ha
FAME shows an unusually high e olu iona y di e gence in bi ds and mammals.
Th ough he compa ison o single nucleo ide polymo phisms, we iden i y
gene flow o FAME om Neande als in o mode n humans. We conduc
knockou expe imen s on animals and obse e al e ed body weigh and
dec eased ene gy expendi u e in Fame knockou animals, co esponding o
genome-wide associa ion s udies linking FAME wi h highe body mass index in
humans. Gene exp ession and subcellula localiza ion analyses e eal ha
FAME is a memb ane-bound p o ein en iched in he kidneys. Al hough he
gene knockou esul s in s uc u ally no mal kidneys, we de ec highe albu-
min in u ine and lowe ed e i in in he blood. Th ough expe imen al alida-
ion, we confi m in e ac ions be ween FAME and e i in and show co-
localiza ion in esicula and plasma memb anes.
Th ough na u al selec ion, majo animal g oups ha e de eloped
unique mechanisms o adap a ions o he en i onmen . The gene ic
landscape co esponds o de elopmen al, mo phological, and phy-
siological adap a ions1. Gene egula o y egions unde go apid e olu-
iona y change o une he p oduc ion o mRNAs encoding he ac ual
e ec o s o adap a ion, he p o eins. The gene p oduc s also unde go
na u al selec ion, which shapes hem acco ding o a ious benefi s
de i ed om hei unc ions2. Impo an ly, no all such p oduc s,
including mainly p o eins, a e essen ial o basic emb yonic de elop-
men and he me e su i al o animals. Nume ous gene knockou
expe imen s in mice ha e highligh ed a coho o p o eins ha a e
unc ionally impo an o some ex en , and ye he animals can li e
pe ec ly wi hou hem unde beneficial ci cums ances3. These non-
essen ial p o eins con ey an adap i e ad an age o hei hos s when
he animals a e exposed o he di e si y o challenging na u al
en i onmen s4.
Fu he mo e, hese seemingly non-essen ial genes migh become
a basis o di e se pa hologies o loss o fi ness5,6. Finally, simila o
essen ial genes, non-essen ial genes migh be a pe ec subs a e o
e olu ion, especially o uning me abolic, s ess- and ene gy- ela ed
ea u es. Being non-essen ial, such genes can e ol e much as e o
p o ide he necessa y e ol abili y unde in ense selec i e p essu e. In
ex eme cases, he e olu ion o p o eins (especially when i comes o a
non-essen ial g oup) migh esul in a comple e change o unc ion7,8
o a pseudogeniza ion, which occu s in genes in ol ed in den al gen-
esis in bi ds, u les, and oo hless mammals9.
The compa a i e genomics app oach10 is pe ec ly designed o
elucida e genomic p o ein-coding and non-coding egions esponsible
Recei ed: 24 Sep embe 2021
Accep ed: 11 May 2023
Check o upda es
e-mail: julian.pe e [email protected];i[email p o ec ed]
Na u e Communica ions | (2023) 14:3092 1
1234567890():,;
1234567890():,;
o di e en animal g oups’di e gence and adap i e adia ion11,12.Fo
ins ance, such analyses b ough o wa d he genomic changes asso-
cia ed wi h “bi dness”o “mammalness”.Manyiden ified egions
appea ed o be in ol ed in he e olu ion o egg p oduc ion, placen al
de elopmen , o geni al shaping11,12.Indeed, hedi e genceo majo
e eb a e g oups such as bi ds, ep iles, and mammals esul ed in
hea y modifica ions o me abolism13,14, ep oduc ion15, and exc e ion16,
oge he wi h associa ed genomic changes and adap ing p o ein
s uc u es. Fo example, he p ocesses o wa e and nu ien e-
abso p ion in bi ds and mammals di e d ama ically a s uc u al,
cellula , and molecula le els, including gene ics. Bi ds and ep iles
p edominan ly exc e e u ic acid ins ead o he u ea used by mammals
and, hus, ely on negligible amoun s o wa e o ni ogen exc e ion17.
Al hough many o he compa a i e s udies pinpoin ed well-
cha ac e ized genes ha can be analyzed in he con ex o unc ional
ne wo ks in ol ed in he di e ging o gan sys ems and physiological
unc ions, he uncha ac e ized genes emained enigma ic in his e o-
lu iona y pa adigm. Al hough he human and mouse genomes con ain
a ound 20.000 p o ein-coding genes, no all o hese a e iden ified,
anno a ed, and cha ac e ized in e ms o hei exp ession and biolo-
gical unc ion18–20. Cha ac e izing such genes unc ionally and in es i-
ga ing hei e olu iona y oles a e essen ial o comple e he holis ic
pic u e o genome ans o ma ions h ough ime.
He e we unco e ed an uncha ac e ized p o ein-coding
1700011H14Rik/C14o 105/CCDC198 gene he eby named FAME (Fac-
o Associa ed wi h Me abolism and Ene gy), ha e ol es a an excep-
ional a e in bi ds and mammals. Specific alleles o FAME flow om
Neande als in o mode n humans, highligh ing i s in ol emen in ou
fi ness. We add essed he exp ession, subcellula localiza ion, mole-
cula s uc u e, unc ional oles, and po en ial disease associa ion o
FAME. Ou esul s es ablish FAME as a as -e ol ing gene modula ing
i on exchange, exc e ion, ene gy expendi u e, and p ocesses po en-
ially associa ed wi h cance p og ession.
Resul s
FAME sequence e ol es a an ex a-high a e du ing he
di e gence o ep iles, bi ds, and mammals
To iden i y p e iously iden ified genes wi h uncha ac e ized unc ion
ha could ensu e di e ging adap a ions in majo amnio e g oups, we
ook ad an age o he compa a i e genomics app oach. E olu iona y
p essu e on p o eins a e o en quan ified by he a io o subs i u ion
a es a non-synonymous and synonymous si es. To elucida e p o eins
co-e ol ing wi h majo e eb a e g oups, we compa ed he a io o
he numbe o non-synonymous subs i u ions pe non-synonymous
si e (dN) o he numbe o synonymous subs i u ions pe synonymous
si e (dS) (dN/dS signa u e) o 27, 16, and 28 pai s o genomes o bi ds,
ep iles and mammals, espec i ely (Supplemen a y Da a 1 and 2). We
s a ed wi h 20 pai s o mammals and bi ds and added 8 mo e pai s o
mammals and 7 mo e pai s o bi ds o inc ease di e si y. We had di -
ficul y finding pai s o ep iles because o ewe a ailable genomes
and ewe b anches on hei e olu iona y ee, bu included se e al
selec ed pai s om di e en clades o ep iles.
We iden ified 312 p o eins, which showed significan ly di e en
dN/dS a ios be ween ep iles and bi ds (FDR < 0.001) (Supplemen a y
Da a 3). Among hem, 129 genes had significan ly highe dN/dS in
ep iles, and 183 p o eins had significan ly highe dN/dS in bi ds.
In e es ingly, when pe o ming bidi ec ional compa isons o iden i y
p o eins wi h he mos flexible sequence in ep iles, only h ee p o-
eins (STOX1, CEP126, and CCDC198) had a mean o iden i y o less
han 60% (Fig. 1a, b and Supplemen a y Da a 4). Two o hem ha e
been p e iously desc ibed. STOX1 is a p o ein in ol ed in ee adical
equilib ium and mi ochond ial unc ion21,whe easCEP126isacen-
osomal p o ein in ol ed in p ima y cilium o ma ion22.The hi d
p o ein, CCDC198/C14o 105 in humans o 1700011H14Rik in
mice (he ea e called FAME, Fac o Associa ed wi h Me abolism and
Ene gy), howe e , has no been cha ac e ized ye . FAME demons a ed
a highe a e age o dN/dS in mammals and bi ds han in ep iles:
0.3912, 0.4235, and 0.2779, espec i ely, which indica es a high e o-
lu iona y a e in mammals and bi ds (Fig. 1b and Supplemen-
a y Da a 4).
Despi e he high a e o e olu iona y changes, his p o ein did no
unde go pseudogeniza ion in any o he s udied clades (Supplemen-
a y Fig. 1a). Nex , we es ed how his gene’s e olu ion coincided wi h
he animals’li es yles. Fo his, we c ea ed he ma ix o li es yles based
on he The a-base da abase (h ps://esapubs.o g/a chi e/ecol/E090/
184/me ada a.h m (“PanTHERIA_1-0_WR93_Aug2008. x ”)) wi h 42
eco ded pa ame e s o species wi h known and published genomes.
Then we es ed co ela ions be ween hese pa ame e s and p o ein
alignmen s, bu also wi h he selec ion o specific egions in he
alignmen s (Fig. 1c, Supplemen a y Fig. 2a). The esul sugges ed ha
specific po ions o FAME co-e ol ed wi h me abolic and exc e ion
ai s (Fig. 1d, Supplemen a y Fig. 2b). This indica ed ha FAME migh
be in ol ed in he con ol o wa e and nu ien exchange. To es his,
we c ea ed ou own ma ix based on he animals’habi a s, including
dese -li ing species and wa e -dwelling mammals such as whales
(Supplemen a y Da a 5).
In e es ingly, scanning o he highes co ela ion o in acellula
loca ion sugges ed he impo ance o he N- e minal egion wi hin he
p o ein. A mo e in-dep h sequence analysis e ealed a possible
N-my is oyla ion si e and se e al phospho yla ion si es (Supplemen-
a y Fig. 3a–d, Supplemen a y Da a 6). This analysis also showed co -
ela ions o he FAME s uc u e wi h he habi a (Supplemen a y
Fig. 3e). Fu he mo e, no homologs in any o he explo ed genomes
we e e iden , whe eas a domain wi h unknown unc ion DUF4619 was
p esen .
To es i e olu iona y changes o FAME also occu ed in humans,
we nex analyzed he e olu iona y modifica ions in FAME since he
spli be ween mode n humans and Neande hals. Al hough some
con ac may ha e occu ed23, Neande hals and mode n humans
e ol ed independen ly be o e he majo ou -o -A ica dispe sal
~70,000 yea s ago24,25. Du ing ~0.5 million yea s, hese wo lineages
accumula ed mu a ions ha eached fixa ion, o nea fixa ion in hei
genome, in bo h g oups. To explo e he ecen e olu ion in FAME we
in es iga ed all single-nucleo ide polymo phisms (SNPs) o which 108
Nige ian Yo ubans ( ep esen ing he mode n human)26 ca y one allele
in a homozygous o m and h ee high-co e age Neande hals27–29
homozygously ca y a di e en allele. In his egion encompassing
FAME and 50 kb ups eam and downs eam (ch 14:57886018-
58010575, hg19), which we compa ed wi h he ances al allele, we
ound 23 such SNPs (Fig. 1e, , Supplemen a y Fig. 1b, c). Fo 20 o hese
SNPs, mode n humans ca y he ances al allele, and o h ee SNPs
Neande hals ca y he ances al allele. Tha mo e alleles a e de i ed
om he Neande hal lineage is compa ible wi h he lowe e ec i e
popula ion size o Neande hals30,and he ac ha weonlyha e h ee
high-co e age Neande hals and 108 Yo ubans bias us o de ec alleles
ha a e de i ed on he Neande hal lineage.
O e all, hese esul s indica e e idence o gene flow om
Neande hals a he locus encompassing FAME. Howe e , he e a e wo
al e na i e scena ios as o why he Neande hal-like alleles in Fig. 1
could be ound among p esen -day people. These alleles we e p esen
in he sha ed ances al popula ion be ween Neande hals and mode n
humans, o hese alleles we e in oduced by gene flow om Nean-
de hals when hese wo g oups me 31. In he geneflow scena io, we
expec o find hese alleles on long Neande hal-like haplo ypes
because meio ic ecombina ion has no had ime o b eak hese DNA
segmen s down o sho e pieces du ing he ime since he gene flow
ook place (~50,000 yea s). To explo e hese wo scena ios, we
calcula ed he linkage disequilib ium be ween he 23 SNPs in Fig. 1 .
We ound ha 14 o hese alleles a e inhe i ed oge he ( 2 > 0.8)
among he indi iduals (n= 2504) in he 1000 Genomes P ojec
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 2
Fig. 1 | FAME sequence changes du ing he e olu iona y di e gence o ep iles,
bi ds, and mammals. a Iden ifica ion o FAME in a sc een o e olu iona y di e -
ging p o eins co esponding o he spli o majo e eb a e g oups. bCompa ison
o dN/dS a ios o unanno a ed p o eins o low p o ein iden i y be ween ep iles.
Mean ± SEM and n(genome pai s): STOX1 bi ds 0.5297 ± 0.0120 n= 14 mammals
0.3733 ± 0.0095 n=26 ep iles0.3369±0.0071n=7.CEP126 bi ds 0.5982 ± 0.0126
n= 14 mammals 0.5026 ± 0.0159 n= 23 ep iles 0.4581 ± 0.0116 n=14.FAME bi ds
0.4235 ± 0.0150 n= 22 mammals 0.3912 ± 0.0176 n= 28 ep iles 0.2779 ± 0.0144
n= 14. Desc ip i e s a is ics can be accessed in Supplemen a y Da a 13. cCophe-
ne ic co ela ion be ween dend og ams ob ained om amino acid sequence
alignmen s and dend og ams based on PanTHERIA sco es o di e en ecological
ac o s. The longes p o ein sequences we e ob ained o 68 mammalian species
using biomaR (Ensembl). dco ela ion be ween 2-me alignmen egions o eco-
logic (PanTHERIA) and phylogene ic (TimeT ee) dend og ams. The species coun
wi h bo h ecologic da a and o hologue sequence a ailable is indica ed in he op
igh co ne . Regions wi h ends ies a e ma ked wi h a ows. These egions a e
likely connec ed wi h ecological ac o s. O he examples a e shown in Supple-
men a y Fig. 2. No ably, he e a e di e en shapes o ends and posi ions o he
ies. e, Single nucleo ide polymo phisms (SNPs) o which Neande hals (n=3)
and Yo ubans (n= 108) homozygously ca y di e en alleles. Genomic coo dina es
a e in hg19. The ances al alleles we e aken om Ensembl90 and he Neande hal
alleles om p e iously published genomes27,28.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 3
(Supplemen a y Fig. 1b). This haplo ype, agged by s149643449-G,
has a leng h o ~87 kb (ch 14:57958614-58046101) and includes he
p omo e egion and he fi s wo exons o FAME (Supplemen a y
Fig. 1c), as well as he fi s ou exons o he neighbo ing gene SLC35F4.
We in es iga ed i a haplo ype his leng h could ha e su i ed since
he ime o he common ances o as p e iously desc ibed32, i.e., using
he equa ion 1-GammaCDF (m, shape = 2, a e = 1/L), whe e m is he
measu ed haplo ype leng h and L he expec ed leng h gi en by he
equa ion L = 1/( × ). He e is he ecombina ion a e pe gene a ion
pe bp and is he leng h o he human and Neande hal b anches since
di e gence. Fu he mo e, we used he local ecombina ion a e
(1.47 cM pe Mb)33, and p e iously published es ima es o b anch
leng hs and gene a ion ime32. Unde his assump ion, he p obabili y
o a haplo ype o his leng h su i ing since he common ances o o
mode n humans and Neande hals is low (p=3.7e–06). We hus con-
clude ha his haplo ype has been in oduced in he gene pool o
p esen -day people by gene flow om Neande hals. In he 1000
Genomes da a se 26, hese haplo ypes a e ound a low equencies in
Asia, eaching a maximum allele equency o 1.0% among Han Chinese
(n= 208) and in admixed Ame icans, whe e i eaches an allele e-
quency o 0.8% in people o Mexican ances y (n=64).
FAME is a memb ane-associa ed p o ein en iched in he kidney,
panc eas, li e , and allopian ube. Using Geno ype-Tissue
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 4
Exp ession (GTEx) da a, we disco e ed ha he exp ession o FAME
was pa icula ly high in he kidney and o a smalle ex en in he
panc eas, li e , and allopian ube (Fig. 2a and Supplemen a y Fig. 4a).
The analysis o publicly a ailable single-cell ansc ip omics da a o he
mouse kidney34,35 u he confi med he specific exp ession in kidney
epi helial cell ypes. This includes he loop o Henle and collec ing duc
cells, p oximal ubules, and mino exp ession in in e cala ed A cells
(Fig. 2b and Supplemen a y Fig. 4b).
By u ilizing publicly a ailable mass spec ome y da a, we
ound e idence o he p esence o FAME a he p o ein le el in di -
e en issues and species. Fo ins ance, FAME p o ein is de ec ed in
P o eomicsDB [h ps://www.p o eomicsdb.o g], Phosphomouse
[h ps://phosphomouse.hms.ha a d.edu]andPep ideA las[h ps://
db.sys emsbiology.ne /sbeams/cgi/Pep ideA las/Sea ch] public mass
spec ome y da abases36–39. S ong expe imen al e idence o FAME
p o einp oduc ionexis sinbo h hehuman
40 and mouse kidney37.
Fu he mo e, FAME p o ein was de ec ed in cul u ed mu ine collec -
ing duc cells41, alida ing he p esence o FAME p o ein in a cell ype
shown o p oduce i s mRNA in i o (Fig. 2b).
The e o e, we nex ocused on he kidney and alida ed he p e-
sence o FAME p o ein in he p oximal ubules by immunohis-
ochemis y. This is suppo ed by he ac ha we did no de ec FAME
in samples om knockou animals (Fig. 2c and Supplemen a y Fig. 5).
Impo an ly, we ensu ed ha ou an ibody is unc ional and specific
ia de ec ing FAME as a pa o FAME-EGFP usion in cul u ed cells ha
do no p oduce FAME endogenously (Supplemen a y Figs. 5 and 6).
Howe e , al hough we alida ed he unc ionali y o he an ibody, we
mus also acknowledge i s limi a ions connec ed o po en ial low
sensi i i y, which esul s in inabili y o de ec FAME in wes e n blo
wi hou o e exp essing FAME, which we discussed in de ail in he
me hod sec ion.
Wi h he help o molecula cloning and o e exp ession in
HEK293T cells, we ound ha FAME localizes o plasma memb anes as
well as o small cy oplasmic esicles (Fig. 2d, e, and Supplemen a y
Fig. 4c). To u he alida e he p edic ed my is oyla ion si e (Sup-
plemen a y Fig. 3c), we ea ed HEK293T cells o e exp essing
FAME-EGFP wi h IMP-1088 (an inhibi o o he human
N-my is oyl ans e ases NMT1 and NMT2) and DDD85646 (an inhibi o
o T. b ucei N-my is oyl ans e ase (TbNMT)), as well as,
2-B omohexadecanoic acid as a nega i e con ol (a non-selec i e
inhibi o o lipid me abolism) (Fig. 2d, –i). These esul s show ha
once HEK293T cells a e ea ed wi h my is oyla ion-specific inhibi o s,
he localiza ion o FAME shi s om he plasma memb ane owa d he
nucleus (Fig. 2 –i). DMSO ea men o he non-selec i e inhibi ion o
lipid me abolism did no al e he localisa ion o FAME. These esul s
suppo he exis ence o a my is oyla ion si e in FAME. In addi ion,
mu a ing he amino- e minal glycine esidue (si e o my is oyla ion) o
alaninealso esul edin henuclea localisa iono hep o ein(Fig.2e).
Li e-cell imaging expe imen s e ealed as a ficking o FAME in he
memb anes and exocy osis- ela ed o exosome anspo om ans-
ec ed o non- ans ec ed cells, as well as memb ane sha ing (Sup-
plemen a y Fig. 4c–e and Supplemen a y Mo ie 1).
O e all, hese da a show a high exp ession and esicula na u e o
FAME in he mouse kidney, sugges ing a link o cellula /memb ane
anspo .
Binding pa ne s o FAME sugges a ole in i on me abolism and cell
cycle-associa ion. To elucida e he molecula binding pa ne s o
FAME, we pe o med a yeas wo-hyb id sc een. Fo his, we used wo
di e en lib a ies (mouse kidney emb yo om E18.5 and mouse b ain
emb yo mix o E10.5 and E12.5) o co e mo e possible in e ac ion
pa ne s (Fig. 3a). Bo h sc eens iden ified Fe i in Hea y Chain 1
(FTH1), Fo min Binding P o ein 1 Like (FNBP1L), as well as Tousled Like
Kinase 1 (TLK1) as op hi s (Fig. 3b). F h1 encodes he hea y subuni o
e i in, he majo in acellula i on s o age p o ein in p oka yo es and
euka yo es.A main unc ion o e i inis he s o age o i on ina soluble
non oxic s a e and u he i on up ake in capsule cells o he de el-
oping kidney42. FNBP1L, on he o he hand, is equi ed o coo dina e
memb ane ubula ion wi h he eo ganiza ion o he ac in cy oskele-
on du ing endocy osis43,44. TLK1 has se e al di e se subs a es and is
ac i e when phospho yla ed. Ac i a ion by phospho yla ion is cell
cycle-dependen wi h i s peak ac i i y in S-phase. O e exp ession o
TLK1 p o ein causes se e e g ow h de ec s and cell cycle a es in he
G2/M phase wi h apop osis45. Ou yeas - wo-hyb id sc een also
de ec ed FAME in e ac ions wi h ansc ip ion ac o s and p o eins
wi h his one H4-specific ace yl ans e ase ac i i y, including CREB/
ATF BZIP T ansc ip ion Fac o (CREBZF) and Lysine Ace yl ans e ase
7 (MYST2). Bo h CREBZF and MYST2 a e associa ed wi h cell cycle
p og ession and eplica ion. CREBZF a es s he g ow h o os eo-
sa coma cells by displacing MDM2 and s abilizing p5346, whe eas
MYST2 has c ucial unc ions in ansc ip ion, eplica ion, and DNA
epai 47.
Howe e , since FAME was no loca ed in he nucleus (Fig. 2d, e),
he pu a i e Y2H in e ac ion pa ne s in he nucleus (Fig. 3b) mus be
conside ed wi h cau ion. Ne e heless, we confi med he in e ac ion
wi h FTH1 using mChe y-labelled FTH1 exp essed in HEK293T cells co-
ans ec ed wi h GFP- agged FAME (Fig. 3c).
To ob ain a be e pic u e o he in e ac ome o FAME we pe -
o med a p oximi y-dependen bio in iden ifica ion (Bio-ID) expe i-
men oge he wi h classical immunop ecipi a ion ollowed by mass
Fig. 2 | FAME is highly exp essed in kidneys and localises o he cell memb anes
and esicles. a Analysis o FAME exp ession in a ious human issues based on
Geno ype-Tissue Exp ession da a. FAME exp ession is pa icula ly high in he kid-
ney, panc eas, li e , and allopian ube. Mean ± SEM and n(GTEx samples): kidney
(8.071 ± 0.1468 n= 32) panc eas (6.575 ± 0.0392 n= 171) li e (6.447 ± 0.06853
n= 119) allopian ube (4.702 ± 1.230 n= 5) bladde (1.414 ± 0.3387 n= 11) ce ix
u e i (0.9330 ± 0.5028 n= 11.) bDe ailed exp ession analysis o Fame using Tabula
Mu is, a single-cell a las o he mouse. The da a demons a e high exp ession in
kidney epi helial cell ypes, he loop o Henle and collec ing duc cells, bu also in
he p oximal ubules. Mean ± SEM and n(single mouse cells): loop o Henle
(1.546 ± 0.03942 n= 471) collec ing duc (1.403 ± 0.04278 n= 443) p oximal ubule
(0.6419 ± 0.02091 n= 1198) in e cala ed A-cells (0.07076 ± 0.03823 n=45).
cImmunofluo escence o he adul wild ype and knockou mouse kidney s ained
o FAME and imaged oge he wi h au o fluo escence. Rep esen a i e image om
3 di e en animals is shown. See Supplemen a y Fig. 5 o addi ional s ainings.
dValida ion o he FAME N-my is oyla ion si e. Visualiza ion o o e exp essed
fluo escen ly agged FAME-EGFP in HEK293T cells upon ea men wi h he
N-my is oyla ion inhibi o s DDD85646 and IMP-1088 and he palmi oyla ion inhi-
bi o 2-b omohexadecanoic acid (2-BP) as con ol. Da a om 4 independen
expe imen s is shown. eO e exp ession o he usion p o ein in HEK293T cells
shows he localisa ion o FAME in he plasma memb ane and in acellula esicles
(whi e a ows). –iQuan ifica ion o localisa ion changes o o e exp essed FAME-
GFP upon N-my is oyla ion inhibi ion in cellula compa men s. Violin plo s o he
pe cen age o FAME-EGFP localised in he plasma memb ane upon ea men wi h
he indica ed inhibi o s. Mean ± SEM and n: DMSO (53.78 ± 9.491 n=4)2-BP
(73.71 ± 6.262 n= 4) DDD85646 (35.62 ± 7.446 n= 4) IMP-1088 (0.00 ± 0.00 n=4),
p- alue DMSO s IMP-1088 = 0.0013, p- alue 2-BP s DDD85646 = 0.0078, p- alue
DDD85646 s IMP-1088 = 0.0030. gViolin plo s o nuclea FAME localiza ion upon
ea men . Mean ± SEM and n: DMSO (0.00 ± 0.00 n= 4) 2-BP (1.622 ± 1.029 n=4)
DDD85646 (13.10 ± 13.10 n= 4) IMP-1088 (75.36 ± 2.151 n=4),p- alue DMSO s IMP-
1088 = 0.0001, p- alue 2-BP s IMP-1088 = 0.0001. hViolin plo s o cy oplasmic
Fame localiza ion upon ea men . Mean ± SEM and n:DMSO(0.00±0.00n=4)
2-BP (4.882 ± 3.806 n= 4) DDD85646 (0.00 ± 0.00 n= 4) IMP-1088 (16.38 ± 1.882
n=4),p- alue DMSO s IMP-1088 = 0.0001, p- alue 2-BP s IMP-1088 = 0.0351,
p- alue DDD85646 s IMP-1088 = 0.0001. iViolin plo s o memb anous and
cy oplasmic/nuclea Fame localisa ion upon ea men . Mean ± SEM and n: DMSO
(48.09 ± 8.612 n= 4) 2-BP (19.05 ± 5.971 n= 4) DDD85646 (51.34 ± 12.16 n=4)IMP-
1088 (8.255 ± 2.894 n=4),p- alue DMSO s IMP-1088 = 0.0046, p- alue DDD85646
s IMP-1088 = 0.0137. Sou ce da a a e p o ided as a Sou ce Da a file.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 5
spec ome y (Fig. 3d and Supplemen a y Da a 7, 8). The FAME-IP
esul s a e isualized in Fig. 3d oge he wi h o e lapping hi s om he
BioID expe imen . STRING analysis o hese o e lapping hi s e ealed a
s ong associa ion o FAME wi h he ca aly ic complex, in acellula
p o ein anspo , mi ochond ial inne memb ane, espi a o y elec-
on anspo , and p o ein expo (Fig. 3e). These da a a e suppo ed
by gene co ela ion da a om publicly a ailable single-cell
ansc ip omics da a o a ious issues (Supplemen a y Fig. 7). F om
hese posi i e co ela ions, we could show he co-localiza ion o genes
specific o he mic o ubule, mi ochond ia, and PCP-pa hway asso-
cia ion o he FAME p o ein (Fig. 3 –h).
FAME con ols he exc e ion o nu ien s and i on. To unde s and
he unc ional ole o FAME in gene al de elopmen , he mo phology
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 6
o o gans, and i s physiology, we gene a ed Fame knockou mice using
an FVB/An gene ic backg ound. CRISPR/Cas9 was used o c ea e hese
knockou mice by inse ing a double STOP codon downs eam o he
ini ia o ATG (see Me hods sec ion). These mice appea ed iable
wi hou majo de elopmen al, mo phological, o beha iou al de ec s.
We could e ec i ely p opaga e he colony in he homozygous
knockou s a e.
In e es ingly, body weigh and mean lean body mass we e sig-
nifican ly al e ed in FVB/An Fame knockou mice (Fig. 4a(i, ii)).
When analysing se um e i in le els, we e ealed a significan
dec ease in e i in in knockou animals compa ed o he con ol
(Fig. 4a(iii)). Fu he mo e, we ound an unusually high amoun o
albumin in he u ine o knockou animals (Fig. 4a(i )). To examine
his pheno ype in mo e de ail, we ca e ully in es iga ed he kidneys
o con ol and knockou animals. Analysis o he kidney olumes o
adul , 12-week old mice and he amoun and size o he fil e ing
glome uli did no show any di e ences (Supplemen a y Fig. 8a).
His ological analyses o Pe iodic acid–Schi (PAS) sec ions showed
no mal his omo phology in bo h wild ype and Fame knockou
mice, wi hou any signs o pa hological al e a ions o glome uli,
essels, o he ubuloin e s i ium (Supplemen a y Fig. 8b). As con-
sequences o kidney mal unc ion, pa icula ly p o einu ia, can be
a ec ed by changes only isible a he ul as uc u al le el, we also
analysed he kidneys using ansmission elec on mic oscopy. The
analysis showed an in ac and no mally de eloped fil a ion ba ie
o he glome uli (Supplemen a y Fig. 8b), wi h egula ly shaped
podocy e oo p ocesses, egula glome ula basal memb ane, and
hin enes a ed endo helium o glome ula capilla ies. Also, he
ubula cells showed a no mal ul as uc u al appea ance wi h a
p ominen b ush bo de in p oximal ubules and high amoun s o
mi ochond ia. No signs o me abolic s ess we e obse ed, includ-
ing no signs o in acellula accumula ions o lipids o glycogen,
inc eased esicles, o high lysosomal ac i i y.
Because adul homozygous knockou animals did no show any
s uc u al pheno ype a he le el o he kidney, we hypo hesized ha
FAME migh con ey specific adap i e highly unable unc ions and is
impo an o he compe i i eness o animals in di e en ecological
niches. To add ess he ole o FAME in ad e se en i onmen al condi-
ions and o challenge he de eloping sys ems o o gans, we es ed he
e ec o a low i on die du ing emb yonic de elopmen o wild ype
and knockou mice (FVB/An backg ound). Fo his, we kep emales on
a low-i on o con ol die o ou weeks be o e ma ing. New-bo n pups
we e hen analysed using mic oCT coupled wi h 3D segmen a ion. All
Fame (FVB/An ) knockou mice on he con ol die showed a size
educ ion o he kidneys, ad enal glands, in e scapula b own adipose
issue, and li e compa ed o he wild ype mice on a con ol die . This
pheno ype was compa able wi h con ol pups being on a low-i on die .
Fame (FVB/An ) knockou mice on a low-i on die showed no u he
changes in o gan size (Fig. 4b– ). These findings sugges ha FAME is
impo an o scaling he inne o gans in esponse o ad e se condi-
ions, including he ene gy s o agesobse edby he educedin e -
scapula b own adipose issue.
To dig deepe in o he unc ion o FAME, pa icula ly in he kid-
ney, we pe o med single-cell RNA sequencing o wild ype and
knockou kidney samples (FVB/An backg ound) (Fig. 5a–candSup-
plemen a y Fig. 9). The da a confi med he p esence o wo con-
secu i e s op codons in he p o ein-coding egion o Fame mRNA in
indi idual cells om he knockou condi ion (Supplemen a y Fig. 10a).
As a main esul , he single-cell ansc ip omics analysis confi med he
p esence o all cell popula ions in knockou kidneys, wi h only mino
composi ional changes (Fig. 5a, b). By analyzing he gene exp ession
wi hin clus e s in mo e de ail, we iden ified only a ew significan di -
e en ially exp essed genes (Fig. 5c and Supplemen a y Fig. 10b–e),
including he p e iously iden ified FAME-binding, i on- anspo ing
F h1 and Slc25a39—a mi ochond ial memb ane anspo e in ol ed in
biosyn hesis and po en ially i on homeos asis48. This sugges s ha he
knockou pheno ype has a molecula na u e wi hou no iceable
de ec s a issue o ganiza ion le els.
Nex , o in es iga e i such me abolism uning oles o FAME
depend on he gene ic backg ound49,50 and addi ional modifica ions o
expe imen al condi ions, we c ea ed and es ed a second mouse
knockou model using a C57BL/6NC l backg ound. Al hough he
exc e ion o albumin in he u ine and se um e i in le els we e no
al e ed in hese mice wi h knocked ou Fame, he body weigh and lean
body mass we e significan ly changed (Supplemen a y Fig. 11). These
wo knockou models on di e en gene ic backg ounds e ealed ha
depending on he exac gene ic backg ound, he body weigh and lean
body mass show di e en significan al e a ions compa ed o he
con ols o he same backg ound. The eason o hese di e ences can
be mul i ace ed and migh include he complex and di e gen con ex
o di e en ly exp essed in e ac ing molecules. Fo ins ance, he con-
ols o di e en backg ounds showed di e ences in he exc e ion o
albumin and se um le els a s eady s a e (compa e Fig. 4aandSup-
plemen a y Fig. 11). Fu he mo e, he di e ences in fine mo emen
and he changed me abolic s a us in bo h animal g oups can cause
di e ences in body weigh and lean body mass. In e es ingly, despi e
he di e ences in weigh changes in he wo knockou models, he
le el o he ene gy balance influencing ho mones gh elin and lep in
we e no significan ly changed in ei he mouse model (Supplemen a y
Fig. 12). Fu he mo e, analysis o mul iple addi ional blood pa ame e s
did no show significan di e ences, excep a dec eased pla ele coun
in knockou emales wi h an FVB/An backg ound (Supplemen a y
Fig. 13) and lowe eosinophil numbe in emales wi h a C57BL/6NC l
backg ound (Supplemen a y Fig. 14).
Knockou o Fame influences me abolic pa ame e s and ac i i y o
he animals. To elucida e he me abolic pheno ype o he knockou
animals, we pe o med me abolic pheno yping. Measu emen s we e
pe o med on 75-day old male mice wi h an FVB/An backg ound, ou
wild ype and ou Fame knockou mice, a e a h ee-day aining
phase in specific me abolic cages. Fo he C57BL/6NC l expe imen al
g oup o simila age, we had eigh wild ype and en knockou males
and se en wild ype and fi e knockou emales, ha unde wen
me abolic pheno yping. Food and wa e in ake, locomo o ac i i y, O
2
Fig. 3 | Binding pa ne s o FAME sugges a ole in i on me abolism. a G aphical
ep esen a ion o he ULTIma e Y2H™sc een pe o med by Hyb igenics. Mouse
FAME bai was cloned in o he pB27 (N-LexA-AKR2-C usion) ec o , and used o
sc eening using mouse kidney emb yo_RP1 and mouse emb yo B ain_RP2 agmen
lib a ies as p ey. The in e ac ion o wo p o eins econs i u es an ac i e an-
sc ip ion ac o and enables yeas g ow h. bTop sco ing in e ac ion pa ne s o
kidney emb yo and emb yo b ain lib a ies a e indica ed. In o al, 118 million
in e ac ions we e es ed. cValida ion o FTH1 as op FAME in e ac ion pa ne om
he ULTIma e Y2H™sc een. FAME-EGFP was o e exp essed oge he wi h FTH1-
mChe y o isualize he hea y subuni o e i in in HEK293T cells. The whi e a ow
poin s owa ds encapsula ed FTH1 by FAME. Rep esen a i e image o 3 indepen-
den expe imen s. dVisualiza ion o FAME in e ac ion pa ne s iden ified by bo h
immunop ecipi a ion (IP)/mass spec ome y and p oximi y-dependen bio in
iden ifica ion analysis (BioID). eSTRING analysis om all o e lapping IP and BioID
hi s. –hValida ion o op FAME in e ac ion pa ne s om he mass spec ome y
analysis. Rep esen a i e image o 3 independen expe imen s. O e exp ession o
FAME-EGFP oge he wi h α-Tubulin-mChe y in HEK293 cells o he isualiza ion
o mic o ubules. Whi e a ows poin a FAME co-localising wi h α-Tubulin.
gO e exp ession o FAME-EGFP oge he wi h MITO-7-mChe y o iden i y mi o-
chond ia. Whi e a ows highligh he memb anous localisa ion o FAME in mi o-
chond ia. hO e exp ession o FAME-EGFP and VANGL1-myc isualized wi h an an i-
VANGL1 an ibody. Whi e a ows show co-localiza ion o bo h p o eins wi hin he
plasma memb ane.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 7
consump ion, and CO
2
p oduc ion o he mice we e moni o ed o
48 h. Be o e and a e he measu emen , body composi ion analysis o
he mice was ca ied ou by EchoMRI (Fig. 6a). As s a ed abo e,
knockou animals wi h FVB/An gene ic backg ounds showed a sig-
nifican ly highe a e age body weigh as compa ed o he wild ypes
(Fig. 4a). In e es ingly, he e ec was e e sed in he C57BL/6NC l
backg ound g oup (Supplemen a y Fig. 11). These di e ences in body
weigh sugges ha Fame dele ion al e s ene gy homeos asis in a way
depending on di e en gene ic backg ounds.
When we in es iga ed ood in ake and no malized i o o al body
weigh , only he ood in ake o he knockou mice wi h FVB/An
backg ound was significan ly lowe du ing he day ime (Fig. 6b).
In addi ion, he ene gy expendi u e o he FVB/An Fame knockou
animals no malized o o al body weigh (Fig. 6b), as well as Z-ac i i y,
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 8
a measu e o explo a o y beha iou , o C57BL/6NC l knockou animals
di e ed significan ly compa ed o wild ype mice o hei co e-
sponding gene ic backg ound (Fig. 6c and Supplemen a y Fig. 15).
O no e, we de ec ed a no iceable endency o changes in fine
ac i i y in he FVB/An backg ound mice: he knockou animals showed
ewe fine mo emen s a nigh , and hei a e age fine mo emen s we e
ewe as compa ed o he wild ypes (Fig. 6b).
Since bo h mouse models exhibi ed sligh ly di e en me abolic
p ofiles, we challenged hem using di e en app oaches o u he
alida e he p e iously obse ed pheno ypes. To exclude he e ec o
ood on ene gy expendi u e and he po en ial impac o he di e ing
day ime ood in ake be ween he geno ypes on a FVB/An backg ound,
we epea ed he expe imen upon as ing. Fo his, we emo ed he
ood om he cage, and s a ed he measu emen a e an 8-hou -long
as ing pe iod wi hou he u he addi ion o ood. Du ing his se up,
he same pa ame e s as in he expe imen s be o e we e moni o ed
o 24 h.
Simila o he expe imen be o e, we obse ed di e ences
be ween he wo g oups o FVB/An mice in ac i i y a he beginning o
he nigh - ime. Bo h fine and Z-ac i i y di e ed significan ly ea ly
du ing he 12-hou da k pe iod (Supplemen a y Fig. 16a–d). In line wi h
his, he ene gy expendi u e o he FVB/An knockou mice was sig-
nifican ly less be ween 7 and 9 PM as compa ed o con ols o he same
backg ound (Supplemen a y Fig. 16e, ). These da a indica e ha he
ood-seeking ac i i y o he FVB/An knockou animals was less p o-
nounced compa ed o wild ypes. These ime poin s ea ly du ing he
da k pe iod o e lap wi h he in ensi e ood-seeking ac i i y o FVB/An
wild ype mice, indica ing ha he significan ly highe ene gy expen-
di u e o he FVB/An wild ype animals is due o he highe locomo o
ac i i y. On he o he hand, i is wo h men ioning ha he ene gy
expendi u e o he FVB/An knockou mice s ayed below he ene gy
expendi u e o FVB/An wild ype mice du ing he whole measu emen .
O e all, FVB/An knockou mice had highe body weigh wi h highe
lean body mass. Fu he mo e, FVB/An knockou mice seemed o be
less hung y a e 8-hou as ing pe iods esul ing in less in ense ood-
seeking beha io . The ene gy expendi u e o he FVB/An knockou
mice was significan ly lowe due o hei dec eased locomo o ac i i y.
Nex , we challenged C57BL/6NC l mice by exposing hem o a fi s
wa m and hen cold en i onmen o s udy e ec s on ene gy expen-
di u e o knockou animals. While e ec s on ene gy expendi u e we e
small, we did find ha depending on he sex o he animals, di e en
measu ed pa ame e s, such as Z-ac i i y, ood in ake and o a low
deg ee ene gy expendi u e, we e al e ed di e en ly be ween emales
(Supplemen a y Fig. 17) and males (Supplemen a y Fig. 18). This sug-
ges s ha FAME has a sex-specific ole.
These esul s suppo he e olu iona y di e ging and plas ic ole
o FAME in uning he ene gy expendi u e balance in a ious animal
g oups and di e en gene ic backg ounds.
In humans, he analysis o genome-wide associa ion s udies
(GWAS) showed a co ela ion o mu a ions in FAME wi h highe body
mass index and diabe es- ela ed pa hologies as well as macula
degene a ion(Supplemen a yFig.19).These esul sa einlinewi hou
p e ious findings, fi ing ha i on homeos asis and age a e ac o s
ela ed o macula degene a ion51, oge he wi h he ole o i on in
diabe es and body mass indexes52.
To in es iga e his u he , we examined he pheno ypic e ec s
o ecen e olu iona y changes in CCDC198 (FAME) on he mode n
human lineage. O he h ee mu a ions de i ed om he mode n
human lineage ( s143439954, s147526762, s148585073) (Fig. 1 ),
only s147526762 has an ances al allele s ill p esen among Eu -
opeans (allele equency ~0.1%). Gi en ha he as majo i y o
gene ic associa ion s udies ha e been ca ied ou on Eu opeans, we
explo ed whe he s147526762 had any pheno ypic e ec s ela ing
o he pheno ypes discussed abo e (me abolic synd omes, kidney-
ela ed diso de s, and macula degene a ion). We examined possi-
ble associa ions using PhenoScanne 53, and al hough no associa ion
passed co ec ion o mul iple compa isons, he hi wi h he lowes
p- alue was an associa ion wi h high-densi y lipop o ein (p= 0.02,
be a = 0.74, in e se no mally ans o med uni s) om he UK
Household Longi udinal S udy54. Fo his associa ion, he ances al
allele inc eased he HDL le els. We also in es iga ed any associa ion
be ween s147526762 and 1,400 b oad pheno ypes among 400,000
B i ons (using UK BioBank da a and PheWeb (PheWeb, n.d.). The
associa ion wi h he lowes p- alue was agains hype ensi e ch onic
kidney disease, o which he ances al Neande hal-like allele
inc eases he isk (p= 0.04, be a = 6.6, log odds uni s). Al hough
hese associa ions did no pass co ec ion o mul iple compa isons,
we no e ha he en a i e associa ions ma ch he he e sugges ed
ole o CCDC198 (FAME). The low allele equency o he ances al
allele makes pheno ypic analyses challenging. Fu u e, mo e ex en-
si e s udies, pa icula ly among Sou he n Han Chinese people,
whe e 3% ca y he ances al allele26, a e needed o co obo a e
hese pu a i e associa ions.
Co ela ion o FAME wi h cance . Due o he me abolic pheno ypes
obse ed in FAME knockou mice, we became in e es ed in he ole o
FAME in umo s, whe e ene gy expendi u e and me abolism a e
al e ed. Indeed, he exp ession o FAME appea ed s ably main ained
in all umo ypes de i ed om heal hy human FAME+ issues and cell
ypes acco ding o ou analysis o public TCGA and GTEx da ase s
(Fig. 7a, b and Supplemen a y Fig. 20a). The su i al p obabili y o
di e en ypes o cance can be s a ified by low o high FAME
exp ession (Supplemen a y Fig. 20b). To es his in i o, we o e -
exp essed FAME in HEK293T and A549 cells (human adenoca cinoma
om he lung), which led o a dec ease in p oli e a ion (Fig. 7c, d).
The knockou o FAME in HEK293T cells by CRISPR-Cas9 genome
edi ing did no lead o a change in p oli e a ion (da a no shown).
This is likely because Fame is no endogenously exp essed in
HEK293T cells, as confi med by qPCR (Supplemen a y Fig. 20c) and
acco ding o human p o ein a las da a. Con e sely, he knockou o
Fig. 4 | Fame is in ol ed in he exc e ion o p o eins and pa icipa es in he
scaling o inne o gans unde ad e se condi ions such as nu ien deficiency.
a(i)Violin plo s showing he di e ences in weigh be ween male wild ype and Fame
knockou (KO) animals on an FVB/An backg ound. Mean ± SEM and n o each
g oup: WT (27.26 ± 0.3204 n= 4), KO (25.24 ± 0.1775 n=4),p- alue WT s KO =
0.0015. ii Compa ison o mean lean body mass. Mean ± SEM and n:WT
(20.75 ± 0.3303 n= 4) KO (22.50 ± 0.5986 n=4),p- alue WT s KO = 0.0436. (iii)
Compa ison o se um e i in le els. Mean ± SEM and n:WT(3817±548.6n=4)KO
(2238 ± 295.5 n=7),p- alue WT s KO = 0.0206. (i ) Compa ison o u ine albumin
o c ea inine a io. Mean ± SEM and n: WT (0.07496 ± 0.007053 n=11)KO
(0.1983 ± 0.04809 n= 11), p- alue Mann-Whi ney es WT s KO < 0.0001. bMic o-
CT images o P0 pups wi h con ol and low i on die , con aining 178.58 mg i on/kg
o 5.16 mg i on/kg, espec i ely. The kidney ( ed), in e scapula b own adipose
issue (IBAT) (yellow), li e (g een) and ad enal glands (o ange) a e segmen ed
using 3D Visualiza ion so wa e and supe imposed on o he pups. c– Violin plo s
compa ing inne o gan scaling amongs P0 wild ype and knockou pups on di -
e en die s. cKidney olume. Mean ± SEM and n: WT con ol (2.261 ± 0.2301, n=8),
KO con ol (1.401 ± 0.1354, n=8),p- alue WT con ol s KO con ol = 0.0062, WT
low i on (1.120 ± 0.0973, n= 8), KO low i on (1.642 ± 0.2669, n=6).dIBAT olume.
Mean ± SEM and n: WT con ol (8.44 ± 1.299, n= 4), KO con ol (4.955± 0.1169,
n=4),p- alue WT con ol s KO con ol = 0.037, WT low i on (4.210 ± 0.8292,
n= 4), KO low i on (4.897 ± 0.9432, n=3).eLi e olume. Mean ± SEM and n:WT
con ol (29.94 ± 2.959, n= 4), KO con ol (19.90 ± 1.988, n=4),p- alue WT con ol
s KO con ol = 0.0304, WT low i on (17.72 ± 2.049, n= 4), KO low i on
(16.72 ± 2.632, n=3). Ad enal gland olume. Mean ± SEM and n:WTcon ol
(0.095 ± 0.005345, n= 8), KO con ol (0.06125 ± 0.002950, n=8),p- alue WT
con ol s KO con ol < 0.0001, WT low i on (0.06250 ± 0.00491, n= 8), KO low
i on (0.07667 ± 0.004944, n= 6). Sou ce da a a e p o ided as a Sou ce Da a file.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 9
(100 µM), IMP-1088 (100 nM) o DDD85646 (1 µM) 30 min be o e
ans ec ion. The ans ec ion was pe o med wi h 250 ng o RIK-
pEGFP-N1 using Lipo ec amine LTX® and Plus™Reagen (In i ogen).
A e o e nigh incuba ion, he cells we e fixed using 4% PFA o
20 min a oom empe a u e, washed 3 imes wi h PBS and s ained wi h
DAPI.Imagingandcoun ingwaspe o medusingaThunde Sys em
(Leica). Violin cha s we e gene a ed using P ism So wa e 9.0
(G aphpad).
In e ac ion pa ne s
Yeas Two-Hyb id Y2H Sc eening. The ULTIma e Y2H sc eening was
pe o med by Hyb igenics Se ices (Pa is, F ance; www.hyb igenics-
se ices.com) ollowing p e iously desc ibed me hods73,74. The mouse
1700011H14Rik (aa 1-294) bai was PCR-amplified, sequenced, cloned
in he pB27 (N-LexA-AKR2-C usion) ec o , and used o sc eening
using mouse kidney emb yo_RP1 and mouse emb yo B ain_RP2 ag-
men lib a ies as p ey. A o al o 174 and 94 p ey agmen s, espec-
i ely,o heposi i eclones,we eamplified by PCR and sequenced a
hei 50 and 30 junc ions. The esul ing sequences we e used o
iden i y he co esponding in e ac ing p o eins in he GenBank da a-
base (NCBI) using a ully au oma ed p ocedu e.
Bio-ID. The P oximi y-dependen Bio in Iden ifica ion (BioID) expe i-
men s we e pe o med using he PROFACGEN Se ice (www.
p o acgen.com). The De ailed epo , as well as RAW da a, a e a ail-
able unde [h ps://da ad yad.o g/s ash/sha e/oj XiYX S3yzg5SZwd
XHogg geQBDaSgP hRBdU8Yw].
Immunop ecipi a ion (IP) and MS/MS analysis o pep ides.
HEK293T cells we e ans ec ed wi h a plasmid encoding un agged
mouse 1700011H14Rik/FAME. The day a e ans ec ion, cells we e
washed wi h PBS, sc aped in ice-cold PBS, and pelle ed by 200 × g, 4 °C
cen i uga ion. Cells we e lysed in 1 ml o cold lysis bu e (0.5 % NP40,
50 mM T is bu e , pH 7.4; 300 mM NaCl; 1 mM EDTA) supplemen ed
wi h p o ease inhibi o s (Roche, 11836145001) and 0.1 mM di hio-
h ei ol (Sigma, E3876). A e 15 min, he lysa e was clea ed by cen-
i uga ion a 16000 × g o 15 min. 1 µg o mouse monoclonal
1700011H14Rik an ibody o no mal mouse IgG as nega i e con ol
(Me ck, 12-371) was used pe sample and incuba ed o e nigh a 4 °C
on a o a ing wheel. 40 μl o p o ein G-Sepha ose beads slu y (GE
Heal hca e, 17-0618-05) was washed in 1 ml o lysis bu e and 200 × g
cen i uga ion. Equilib a ed beads we e added o he lysa es wi h
an ibodies, and incuba ed a 4 °C on a o a ing wheel o 4 h. The beads
we e washed 6 imes in lysis bu e by cen i uga ion. The las wo
washes we e done in bu e wi hou de e gen .
Following IP washes, bead bound p o ein complexes we e
diges ed di ec ly on he beads by adding o 1 µg ypsin (P omega,
sequencing g ade) in 50 mM NaHCO
3
bu e . Beads we e mixed and
incuba ed a 37 °C wi h mild agi a ion o wo hou s. Beads we e
o exed and emo ed, while he eleased p o ein complexes we e
u he incuba ed a 37 °C o e nigh (16 h) wi hou agi a ion. The
esul ing pep ides we e ex ac ed in LC-MS ials by 2.5% o mic acid
(FA) in 50% ace oni ile (ACN) and 100% ACN wi h he addi ion o
polye hylene glycol (PEG-20.000; final concen a ion 0.001%) and
concen a ed in a SpeedVac concen a o (The moFishe ) o a final
olume o 15 µl.
Six independen eplica es we e analyzed by mass spec ome y
(Supplemen a y Figs. 23 and 24).
LC-MS/MS analyses o pep ide mix u es we e done using an Ul i-
ma e 3000 RSLCnano sys em connec ed o an O bi ap Eli e hyb id
spec ome e (The mo Fishe Scien ific). P io o LC sepa a ion, yp ic
diges s we e online concen a ed and desal ed using a apping col-
umn (100 μm×30mm)filled wi h 3.5-μm X-B idge BEH 130
C18 so ben (Wa e s). A e washing o he apping column wi h 0.1%
FA, he pep ides we e elu ed (flow a e 300 nl/min) om he apping
column on o an analy ical column (Acclaim Pepmap100 C18, 3 µm
pa icles, 75 μm × 500 mm; The mo Fishe Scien ific) by a 100 min
nonlinea g adien p og am (1–56% o mobile phase B; mobile phase A:
0.1% FA in wa e ; mobile phase B: 0.1% FA in 80% ACN). Equilib a ion o
he apping column and analy ical column was done p io o sample
injec ion o sample loop. The analy ical column ou le was di ec ly
connec ed o he Digi al PicoView 550 (New Objec i e) ion sou ce wi h
a PicoTip emi e SilicaTip (New Objec i e, FS360-20-15-N-20-C12).
ABIRD (Ac i e Backg ound Ion Reduc ion De ice) was ins alled.
MS da a we e acqui ed in a da a-dependen s a egy selec ing up
o op 10 p ecu so s based on p ecu so abundance in he su ey scan
(m/z 350-2000). The esolu ion o he su ey scan was 60 000 (m/z
400) wi h a a ge alue o 1 × 106ions, one mic oscan and maximum
injec ion ime o 200 ms. HCD MS/MS spec a we e acqui ed wi h a
a ge alue o 50 000 and esolu ion o 15 000 (m/z 400). The max-
imum injec ion ime o MS/MS was 500 ms. Dynamic exclusion was
enabled o 45 s a e one MS/MS spec a acquisi ion and ea ly
expi a ion was disabled. The isola ion window o MS/MS agmen a-
ion was se o 2 m/z.
Fo da a e alua ion, he MaxQuan so wa e (2.0.1.0)75 wi h
inbuild And omeda sea ch engine was used using de aul se ings
unless o he wise no ed. Sea ch was done agains UniP o KB p o eome
da abase o Homo sapiens (downloaded om [h ps:// p.unip o .o g/
pub/da abases/unip o /cu en _ elease/knowledgebase/ e e ence_p
o eomes/Euka yo a/UP000005640/UP000005640_9606. as a.gz],
e sion om 2021-06-16, 20,600 p o ein sequences), a sepa a e as a
file con aining he mouse C14o 105/FAME Q9CPZ1 (CN105_MOUSE)
sequence and he cRAP con aminan s da abase (112 sequences, e sion
om 2018-11-22, downloaded om [h p://www. hegpm.o g/c ap].
Modifica ions we e se as ollows o he da abase sea ch: oxida ion
(M), deamida ion (N, Q), and ace yla ion (P o ein N- e m) as a iable
modifica ions, wi h ca bamidome hyla ion (C) as a fixed modifica ion.
Enzyme specifici y was yp ic/P wi h wo pe missible misclea ages.
Second pep ides and ma ch be ween uns (MBR) ea u es we e
enabled. Only pep ides and p o eins wi h alse disco e y a e h esh-
old unde 0.01 we e conside ed. Da a a e publicly a ailable in he
PRIDE da abase wi h he iden ifie PXD039259.
The p o einG oups. x file, he esul ing ou pu om MaxQuan ,
was u he p ocessed in R, . 4.1.1. using he Di e en ial En ichmen o
P o eomics Da a (DEP) R package76.In hewo kflow, fi s ly con-
aminan hi s we e fil e ed ou and p o ein in ensi ies we e log2
ans o med. Only p o eins wi h in ensi y > 0 in mo e han 4/6 samples
o a leas one condi ion we e e ained. In ensi ies we e no malized
using LoessF no maliza ion, and missing alues we e impu ed using
minimal alue. Finally, limma es wi h Benjamini-Hochbe g adjus men
o mul iple compa ison was used o es o he di e en ially exp es-
sed p o eins. P o eins we e deno ed as up egula ed when passing he
h eshold o log2 old change > 1 and adjus ed p- alue < 0.05. Co e-
sponding cellula localiza ions o up egula ed p o eins we e isualized
using he Human Cell Map esou ce77 (Supplemen a y Fig. 23c).
Mouse models
The o iginal FVB/An colony was a kind gi om he Uni e si y o
An we p, Belgium. The colony was e eshed om he Jackson
Labo a o y [h ps://www.jax.o g/s ain/004828] se e al imes. All
expe imen s we e pe o med in acco dance wi h he Ins i u ional
E hical Codex, Hunga ian Ac o Animal Ca e and Expe imen a ion
(2013, 40/2013) and he Eu opean Union guidelines (Di ec i e 2010/
63/EU), and wi h he app o al o he Ins i u ional Animal Ca e and Use
Commi ee o he Ins i u e o Expe imen al Medicine. Mice we e
main ained on a 12-hou ligh /da k cycle, and ood and wa e we e
p o ided ad libi um behind a SPF ba ie acco ding o FELASA
ecommenda ion. All mice we e heal hy wi h no ob ious beha io al
pheno ypes. Low i on (C1038) and con ol die (C1000) we e ob ained
om Al omin.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 16
All C57Bl/6NC l animals we eb ed and housed a he Czech Cen e
o Phenogenomics, Ves ec, which is acc edi ed by he Minis y o
Ag icul u e o he Czech Republic. Mice we e housed unde s anda d
condi ions (12:12 - ligh :da k cycle) in he indi idually en ila ed cages
(Tecniplas g een line) and had ee access o s anda d chow (Al omin
1310) and pu ified chlo ina ed wa e . Labo a o y animal acili y en i-
la ion is se o op imal ai quali y (HEPA fi a ion) and quan i y o
animal and wo king s a com o and s able empe a u e (in ange
19-21 °C) and humidi y (45–65%). All animal expe imen s we e
app o ed by he Animal Ca e and Use Commi ee o he Ins i u e o
Molecula Gene ics o he Czech Academy o Sciences, P ague, in
acco dance wi h guidelines and p ac ices es ablished by he Di ec i e
2010/63/EU o he Eu opean Pa liamen on he P o ec ion o Animals
Used o Scien ific Pu poses.
Gene a ion o Fame KO mice.Fo FVB/An ansgenic mice gene a-
ion, we co-injec ed Cas9 p o ein (30 ng/µl), he gRNA (GGAACACA
GGGCCAGTTGA(GGG)) (50 ng/µl), and ssODN dono (CAGTCTCGTGA
ATGAGCTTTCTTCTTCCAGGTTCCGATTCAATGCAAAGAACACAGGG
CCTCACTAGGGTGTCTCTGTTTCTTGGCTTTGTAAAGGTG) (15 ng/µl)
in o FVB/An e ilized eggs. Injec ed emb yos we e ansplan ed in o
he o iduc o B6CBAF1 pseudop egnan emales. The geno yping o
he new-bo n mice was ca ied ou by a PCR-based s a egy, whe e we
could de ec he co ec modifica ion by using specific p ime s o he
modified sequence.
Gene a ion o he Ccdc198/Fame knockou model.TheCcdc198/
Fame KO mouse (C57BL/6NC l- Ccdc198 em1(IMPC)Ccpcz) was gene -
a ed on a C57BL/6NCRL backg ound (Cha les Ri e Labo a o ies) by
dele ion o a c i ical exon, specifically exon 3 o he Ccdc198/Fame gene
(ENSMUSG00000021850) by using he CRISPR/Cas9 sys em. The
guide RNAs (gRNAs) o highes sco e and specifici y we e designed
using CRISPOR. The ollowing guide RNAs we e selec ed o gene a e
he exon dele ion: gRNAs, 5′- AAGGACCTGAATCTAGCACT-3′and 5′-
CATTTCCAGTACAGACTAGT-3′. The gRNAs we e assembled in o a
ibonucleop o ein (RNP) complex wi h Cas9 p o ein (In eg a ed DNA
Technologies, 1081058, 1072532), elec opo a ed in o 1-cell zygo es,
and ans e ed in o pseudop egnan os e emales (C l:CD1(ICR)).
Pu a i e ounde s we e analyzed by PCR and sequencing. A ounde
ha bo ing a 661 bp dele ion o e lapping he en i e exon 3 o he
Ccdc198/Fame gene was chosen o subsequen b eeding. Geno yping
was pe o med by PCR wi h he o wa d p ime 5’- GCTGAACTGT
GGAGCAGGTA-3′and e e se p ime 5′-CAATCCACCCCCAATACC
CC-3′.
Tissue con as ing and X- ay compu ed mic o omog aphy mea-
su emen s. To inc ease he con as o so issues o X- ay com-
pu ed mic o omog aphy (mic oCT), he samples we e s ained wi h
1% iodine. A e emb yo dissec ion in ice-cold PBS, he samples we e
fixed in 4% o maldehyde in PBS solu ion o 24 h a 4 °C wi h slow
o a ion. Subsequen ly, samples we e dehyd a ed in inc emen ally
inc easing e hanol concen a ions (30%, 50%, 70%), 1 day in each
concen a ion. Samples we e ans e ed in o 1% iodine in 90%
me hanol o issue con as ing. The iodine-me hanol solu ion was
changed a e 3 days. P0 pups we e s ained o 7 days. The con-
as ing p ocedu e was ollowed by ehyd a ion o he samples by
incuba ion in e hanol se ies (90%, 70%, 50%, and 30%). Then, he
ehyd a ed emb yos we e embedded in 1% aga ose gel (Sigma-
Ald ich, A5304) and placed in polyp opylene conical ubes o a oid
mo ion a i ac s du ing mic oCT scanning. The mic oCT measu e-
men s we e conduc ed using he sys em GE phoenix | ome|x L 240
(GE Sensing and Inspec ion Technologies) wi h a 180 kV/15 W max-
imum powe nano ocus X- ay ube and fla panel dynamic 41 | 100:
4000 × 4000 px, wi h pixel size 100 × 100 μm. The exposu e ime
was 900 ms and 2000 p ojec ions we e aken o e 360°. Th ee
p ojec ions in e e y posi ion we e a e aged o educ ion o he
noise in he da a. The u ilized accele a ion ol age and cu en we e
60 kV and 200 µA. X- ay spec um was fil e ed by 0.2 mm o alumi-
num pla e. The oxel size o he econs uc ed da a was 12 µm o P0
pups, 5.8 µm o he whole kidneys, and 1.3 µm o sec ions o he
kidneys. The omog aphic econs uc ions we e pe o med using GE
phoenix da os|x 2.0 3D compu ed omog aphy so wa e (GE Sensing
and Inspec ion Technologies). Fo 3D isualiza ion, he segmen a-
ion was done by an ope a o using a combina ion o so wa e A izo
(The moFishe Scien ific) and VG S udio MAX (Volume G aphics).
U ine and blood analyses. U ine was collec ed o each mouse a he
same ime in he mo ning. To collec u ine, he mouse was held o e a
Pe i dish. The u ine was ans e ed in o a collec ion ube and s o ed
a 4 °C o di ec ly used o u he analysis.
Blood collec ion was pe o med om he ail ein o he mice.
Subsequen ly, he se um was isola ed by cen i uga ion o 20 min a
2500 pm. The se um was hen ans e ed in o a clean ube and used
o immedia e analysis. The ollowing ki s we e used acco ding o he
manu ac u e ’s ins uc ion. Mouse C ea inine Assay Ki (C ys alchem,
80350), Mouse Albumin ELISA Ki (C ys alchem, 80630), Mouse Fe -
i in ELISA Ki (C ys alchem, 80636), Sodium Assay Ki (C ys alchem,
80179), Po assium Assay Ki (C ys alchem, 80169).
T ansmission elec on mic oscopy. Kidney issue was cu in small
pieces and fixed in 3% glu a aldehyde in PBS. Samples we e washed
in 0.1 M Soe ensen’s phospha e bu e (Me ck), pos -fixed in 1%
OsO
4
(Ro h, Ka ls uhe, Ge many) in 25 mM suc ose bu e (Me ck)
and dehyd a ed by ascending e hanol se ies (30, 50, 70, 90 and
100%) o 10 min each. The las s ep was epea ed 3 imes. Dehy-
d a ed specimens we e incuba ed in p opylene oxide (Se a) o
30 min, in a mix u e o Epon esin (Se a) and p opylene oxide (1:1)
o 1 h, and finally in pu e Epon o 1 h. Samples we e embedded in
pu e Epon. Epon polyme iza ion was pe o med a 90 °C o 2 h.
Ul a hin sec ions (70–100 nm) we e cu by ul amic o ome
(Reiche Ul acu S, Leica) wi h a diamond kni e (Leica) and picked
up on Cu/Rh g ids (HR23 Max a o m, Plano). The con as was
enhanced by s aining wi h 0.5% u anyl ace a e and 1% lead ci a e
(bo h EMS). Samples we e examined using a Zeiss Leo 906 ans-
mission elec on mic oscope (Ca l Zeiss) ope a ing a an accele a-
ion ol age o 60 kV.
Single-cell p epa a ion om adul kidneys. Con ol and mu an li -
e ma e mice (male and emale) we e used o single-cell an-
sc ip omic and mo phological analysis o he adul kidney. Mice we e
anes he ized wi h isoflu ane o e dose and ansca dially pe used wi h
PBS. Kidneys we e dissec ed. One kidney pe mouse was fixed in 4%
PFA a 4 °C o e nigh o be used o mo phological analysis. The sec-
ond kidney was chopped in small pieces and diges ed wi h 2 mg/ml
Collagenase P o 10 min a 37 °C, an equal olume o 0.10% ypsin/
EDTA was added, and issue was diges ed o an addi ional 10 min a
37 °C. Following enzyma ic diges ion, issue was i u a ed using a
wide-bo e pipe e ip, and clumps we e mechanically dissocia ed using
a100µm mesh and a sy inge plunge .
Cell suspensions we e washed wice wi h PBS/10% FBS and
esuspended a a concen a ion o 1,000 cells/µl o p ocessing wi h a
10x con olle (10x Genomics).
Lib a y p epa a ion and sequencing. Lib a y p epa a ion was pe -
o med using a 10x con olle (10x Genomics) wi h he Single Cell 3’ 3
chemis y. Sequencing was pe o med using a HiSeq 3000 (Illumina)
a he Biomedical Scien ific Facili y (BSF), Vienna, Aus ia.
Single-cell RNA sequencing o he fi e samples (KO emale, KO
male, KO mix, WT emale, WT mix) esul ed in 103,554,203 eads
(86.30% and 67.90% o hem we e confiden ly mapped o he genome
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 17
and he ansc ip ome, espec i ely) o KO emale; 58,088,304 eads
(87.30% and 69.10%) o KO male; 73,512,818 (90.30% and 75.00%);
75,266,219 eads (86.40% and 65.40%) o WT emale; and 58,636,386
eads (92.50% and 77.90%) o WT mix. The inse size o each
sequencing was 350 bp.
To check whe he DE genes be ween wild ype and knockou a e
no sex-specific, we compa ed hem wi h he lis o he co esponding
DE genes be ween emale and male p oximal ubule (PT) samples
om78. The genes whose adjus ed p- alues a e less han 0.01 we e
excluded om he compa a i e analysis. Bo h lis s ha e a li le in e -
sec ion; mo eo e , in he case o hese ew in e sec ed genes, he mos
significan DE genes be ween wild ype and KO we e no e en in he op
40 sex-specific genes. The excep ions a e Inm (male-specific) and
Spp1 ( emale-specific) genes. The mos in iguing findings a e ha he
FAME-binding i on- anspo ing F h1 and po en ially i on homeos asis
associa ed Slc25a39 gene seem o be gende neu al. These Da a a e
now ou lined in Supplemen a y Da a 10.
Single-cell RNAseq analysis.Rawfiles we e p ocessed, mapped, and
coun ed o he Cell Range mm10-2020-A genome and i s co e-
sponding anno a ion by Cell Range e sion 4.0.0. The ou pu coun
ma ices o eachsamplewe e u he p ocessedwi h heSeu a
package pipeline ( .3.2.2.9001)79. Each da ase was fil e ed o emo e
genes exp essed in less han h ee cells and o emo e cells ha had
ewe han 1000 mRNA coun s pe cell and mo e han 50 % o mi o-
chond ial coun s (accoun ing o he high me abolic a e obse ed in
he kidney)35. Pu a i e double cells we e p edic ed by Sc uble be o e
he fil a ion and log-no maliza ion s eps80.Fo u he compa a i e
analysis, fi e da ase s we e in eg a ed in o one join da ase . To
imp o e downs eam dimensionali y educ ion and clus e ing, he
mi ochond ial gene con en was eg essed ou by using he ScaleDa a
unc ion om he Seu a package. The fi s 40 p incipal componen s
and 30 nea es neighbo s we e used o g aph-based clus e ing and
u he isualiza ion by UMAP. Each clus e was assigned a cell ype
based on he ma ke genes epo ed in p e ious s udies35,78,81–83 and
Supplemen a y Fig. 9. To es ima e he di e ence in geno ype com-
posi ional con en , he exac Fishe es was applied. Iden ifica ion o
di e en ially exp essed genes in wild ype and mu an geno ypes in
each clus e was done by he FindMa ke s unc ion ha implemen ed
Wilcoxon ank-sum es and used a cu o o minimum log FC di e -
ence (0.25). Mo e de ails can be ound online h ps://gi hub.com/
ipo e ennaya/RIK_pape .
Me abolic cage expe imen s (FVB/An ). To examine he e ec o
he absence o 1700011H14Rik/Fame gene on he me abolism o
adul mice, me abolic pheno yping was ca ied ou by using he
PhenoMas e Sys em (TSE Sys ems). Mice we e placed indi idually
in o me abolic aining cages o habi ua e o he new en i onmen
o 3 days. A e ha , he body composi ion, including o al body
weigh , o al and ee wa e con en , a and lean body mass o he
animals we e de e mined by an EchoMRI whole-body magne ic
esonance analyze (Zinsse Analy ic). Du ing pheno yping, he
wa e and ood in ake (g), he locomo o ac i i y (coun s/hou ), and
he calo ime ic pa ame e s, like O
2
consump ion (VO
2
), CO
2
p o-
duc ion (VCO
2
) o he animals we e con inuously moni o ed o 24
o 48 h. The ene gy expendi u e (kcal/h) was calcula ed acco ding
o he Wei equa ion84. The es ing ene gy expendi u e was es i-
ma ed om he ene gy expendi u e da a in specific ime poin s
when a mouse indi idually mo ed less han 1% o i s maximum
ambula o y alue o he las 30 min and a e less han 0.1 g o he
las 1 h85. The espi a o y exchange a io is he a io o CO
2
p o-
duced and O
2
used (VCO
2
/VO
2
). A he end o he me abolic mea-
su emen , he body composi ion analysis was epea ed. All RAW
Da a om hese measu emen s can be ound in Supplemen a y
Da a 11.
Me abolic cage expe imen s (C57BL/6NC l).APhenoMas e (TSE
Sys ems) sys em was used o he indi ec calo ime y. The so wa e
used in he PhenoMas e PC was TSE PhenoMas e .7.1.2. Be o e he
s a o he indi ec calo ime y measu emen s, a comple e calib a ion
p o ocol o he gas analyze s was pe o med acco ding o he man-
u ac u e ’s ecommenda ions using no mal ai -comp essed, CO
2
1%
and N2 100%. The mice we e indi idually housed in a mul iplex sys em
wi h 8 cages plus a e e ence cage. The sampling equency o measu e
he CO
2
and O
2
gas measu emen s we e e e y 15 min. All measu e-
men s we e ini ia ed in he mo ning be ween 9:00 and 11:00.
We p o ided e e y cage ad libi um access o wa e and ood, a
s anda d chow die (Al omin, 1314). Wooden chips bedding olume
was limi ed o app oxima ely 125 ml du ing indi ec calo ime y mea-
su emen s o p ope ly de ec he locomo o ac i i y o he mice by an
in a ed beam b eak ame su ounding he cage in he
ho izon al plane.
The en i onmen al condi ions inside he clima ic chambe we e
55% ela i e humidi y and a ligh cycle o 12 h o ligh (6:00 o 18:00)
and 12 h o da kness (18: o 6:00) synch onized wi h he animal acili y
whe e he mice we e p e iously housed. Fo he indi ec calo ime y
measu emen , he empe a u e was se up as ollows: a 23 °C o 48 h,
and a e ha , we kep he mice in he moneu ali y (30 °C) o
app oxima ely 24 h, in o al 36 h.
Fo indi ec calo ime y using a cold challenge, he empe a u e
was se up as ollows: We s a ed he indi ec calo ime y measu e-
men using 23 °C o 7 h. A 17:00 he clima e chambe was wa ming up
he en i onmen o 30 °C o 7 h. A 00:00 he empe a u e s a ed o
dec ease g adually o each 4 °C. A app ox. 8:00, we kep 4 °C o 4 h,
and a 12:00 he empe a u e was inc eased back o 23 °C and
emained a 23 °C o app ox. 22 h when he calo ime y finished, a e
a o al o 48 h. This allowed us o e alua e whe he he cold challenge
p oduced a me abolic ca y o e e ec .
The indi ec calo ime y eco ded he CO
2
p oduc ion and O
2
consump ion. F om hese alues, he Ene gy Expendi u e (EE) and
Respi a o y exchange a io (RER) was calcula ed. Mo eo e , mea-
su emen s o locomo o ac i i y and ood and wa e in ake we e
eco ded e e y 15 min. When he indi ec calo ime y p o ocol ended,
he expe imen was s opped, and he mice we e weighed and placed
in o hei o iginal cages. All RAW Da a om hese measu emen s can
be ound in Supplemen a y Da a 12.
Exp ession analysis— umo da a
The Cance Genome A las (TCGA) gene exp ession da a we e down-
loaded om he Genomic Da a Commons (GDC) po al in Decembe
2018 [h ps://po al.gdc.cance .go /]. Replica es and samples flagged
by he Pan-Cance A las ini ia i e (PanCanA las; gdc.cance .go /abou -
da a/publica ions/pancana las) we e emo ed, yielding 9,510 umo s
and 713 ma ched no mal issue samples om 31 di e en issue si es.
Gene exp ession alues ep esen uppe quan ile no malized HTSeq-
acqui ed F agmen s Pe Kilobase pe Million eads mapped (FPKM)
p ocessed by he TCGA IlluminaHiSeq_RNASeqV2 pla o m. Pa hologic
umo s age da a o kidney umo s we e ob ained om he PanCa-
nA las p ojec si e.
Gene a ion o FAME KO cell lines
CRISPR-Cas9 based gene edi ing was used o c ea e FAME KO lines in
A549 cells. Single Guide RNAs (sgRNAs) we e designed using
CRISPOR86 and cloned in o len iCRISPR 2 (Addgene #52961) flowing
he Zheng lab p o ocol87 (sgRNA: AAGTCCACACGGCCAGCCGA).
Plasmids we e alida ed by sequencing. Len i i al pa icles we e p o-
duced in HEK293T cells by co- ans ec ion o 2.4 µg o psPAX2
(Addgene #12260), 1.8 µg MD2.G (Addgene #12259) and 3.6 µglen i-
CRISPR 2-sgRNA cons uc using polye hyleneimine (PEI, 25 K, Poly-
sciences) a a 1:3 DNA:PEI (1 µg/µl) a io. Supe na an s we e ha es ed
48 h pos -in ec ion. Fo knocking ou FAME,1×10
5cells we e seeded
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 18
in o 6-well pla es, i us-pa icle con aining supe na an was added,
and p o amine sul a e (Me ck) a 8 µg/mL was added. Cells we e
ansduced by spin ec ion a 800 x g o 60 min. Selec ion o in ec ed
cells was s a ed 24 h pos - ansduc ion using 2 µg/mL pu omycin
(Cayman Chemical). Single-cell clones we e ob ained by limi ing dilu-
ion. Genomic DNA was ex ac ed using he Mona ch gDNA Pu ifica-
ion Ki (New England Biolabs) acco ding o manu ac u e ins uc ions.
FAME KO was alida ed by sequencing o he FAME locus wi h he
sequencing p ime s (Mic osyn h): sgRNA KO locus, wd 5’GCCAT-
GAAGGAAATGACTGCT 3’, s5’TCAAAACCACAAAGTCTGGTGC 3’.
The alida ion o hese knockou s can be ound in Supplemen-
a y Fig. 22.
P oli e a ion analysis o FAME KO cell lines. Fo p oli e a ion assays,
5×10
4A549 o HEK293T cells we e seeded in o 12-well pla es. The nex
day, cells we e ans ec ed wi h 1 µg o pEGFP-N1 as con ol o pEGFP-
N1-FAME using Lipo ec amine 3000 (In i ogen) and placed in o an
Incucy e S3 Li e-Cell Analysis Ins umen (Sa o ius). Images o ans-
mi ed ligh and g een fluo escence we e aken e e y 2 h. A e ~95 h,
he image acquisi ion was s opped. G een a ea confluence was ana-
lyzed using he Incucy e Base Analysis So wa e(Sa o ius) and P ism 9
(G aphpad).
KO alida ion. RNA isola ion was pe o med using he Nucleospin
RNA II ki (Mache ey-Nagel). The concen a ion o RNA was measu ed
using a NanoD op ND-1000 sys em (The mo Fishe Scien ific). RNA
quali y and in eg i y we e assessed by he TapeS a ion 2200 sys em
(Agilen Technologies). Fo qRT–PCR exp ession analysis, he RNA was
e e se ansc ibed using he Ve so cDNA Syn hesis Ki (The mo Fishe
Scien ific) acco ding o he manu ac u e ’s ins uc ions. Quan i a i e
exp ession analysis was pe o med using he Quan S udio 5 Real-Time
PCR ins umen and p edesigned TaqMan gene exp ession assays
(The mo Fishe Scien ific): C14ORF105 (Taqman p obe
Hs00216847_m1). GAPDH exp ession was used as an in e nal con ol.
Rela i e quan ifica ion was pe o med acco ding o he ΔΔCT
me hod88.
S a is ics and ep oducibili y
S a is ical analysis was pe o med using app op ia e so wa e
(G aphpad P ism 9). Desc ip i e s a is ics a e displayed as mean ±
s anda d e o o he mean (SEM). All da a ollowing Gaussian dis-
ibu ion we e analyzed by unpai ed - es s ( wo- ailed). p- alues
smalle han 0.05 we e conside ed s a is ically significan (*p<0.05,
**p< 0.01, ***p< 0.001). All p- alues wi hou addi ional indica ion s em
om - es s. Nonpa ame ic da a we e anlyzed by Mann-Whi ney es
and specifically indica ed in he figu e legends.
Repo ing summa y
Fu he in o ma ion on esea ch design is a ailable in he Na u e
Po olio Repo ing Summa y linked o his a icle.
Da a a ailabili y
Two knockou mice s ains we e gene a ed o his manusc ip . Mice on
aC57BL/6NC l backg ound will be a ailable h ough he In e na ional
Mouse Pheno yping Conso ium [h ps://www.mousepheno ype.o g/
da a/sea ch? e m=CCDC198& ype=gene]whe easFVB/An a e depos-
i ed o he Jackson Labo a o y (JAX S ock No. 038293). All he in o -
ma ion necessa y o ep oduce he single cell analysis is p esen ed in
he Me hods Sec ion. All o he ele an da a suppo ing he key findings
o his s udy a e a ailable wi hin he a icle and i s Supplemen a y
In o ma ion files o om he co esponding au ho upon eques . SNP
da a o ances al alleles (108 Nige ian Yo ubans, YRI) was aken om
he 1000 Genomes P ojec deposi ed in Ensembl [h ps://www.
ensembl.o g/in o/genome/ a ia ion/species/popula ions.h ml]. The
Neande hal genomes we e published p e iously27:[h p:// p.e a.mpg.
de/neande al/Chagy skaya/VCF/]28, Eu opean Nucleo ide A chi e
(ENA) PRJEB21157 [h ps://bioin .e a.mpg.de/jb owse]29,2014ENA
ERP002097 [h p://cdna.e a.mpg.de/neande al/al ai/]. The RAW mass
spec ome y can be accessed h ough PRIDE wi h he iden ifie
PXD039259. RAW Single cell sequencing files can be downloaded om
GEO wi h he accession numbe GSE206860. RAW Yea -Two-Hyb id
da a can be accessed h ough [h ps://da ad yad.o g/s ash/sha e/
oj XiYX S3yzg5SZwd XHogg geQBDaSgP hRBdU8Yw]. P o ein and
CDS sequences om di e en amnio a o ganisms we e ob ained om
NCBI da abase (Supplemen a y Fig. 3). The Cance Genome A las P o-
g am (TCGA, Decembe 2018, [h ps://po al.gdc.cance .go /]and
Geno ype-Tissue Exp ession (GTEx) p ojec da ase s ( elease V6p)
[h ps://www.g expo al.o g/home/]we eused ocollec da a o
Fig. 7a, b and Supplemen a y Fig. 4a. Tabula mu is [h ps:// abula-mu is.
ds.czbiohub.o g/] was used o ob ain da a o Fig. 2aandSupplemen-
a y Fig. 4b and downloaded om [h ps://figsha e.com/p ojec s/
Tabula_Mu is_T ansc ip omic_cha ac e iza ion_o _20_o gans_and_ issu
es_ om_Mus_musculus_a _single_cell_ esolu ion/27733]. GWAS89 was
used o gene a e da a om Supplemen a y Fig. 19. Sou ce da a a e
p o ided wi h his pape .
Code a ailabili y
All cus om-made sc ip s used in he analysis a e a ailable a : [h ps://
gi hub.com/ipo e ennaya/RIK_pape ].
Re e ences
1. Jones, F. C. e al. The genomic basis o adap i e e olu ion in
h eespine s icklebacks. Na u e 484,55–61 (2012).
2. Bus aman e, C. D. e al. Na u al selec ion on p o ein-coding genes
in he human genome. Na u e 437, 1153–1157 (2005).
3. Wang, T. e al. Iden ifica ion and cha ac e iza ion o essen ial genes
in he human genome. Science 350,1096–1101 (2015).
4. Lieben, L. E olu ion: Redefining gene essen iali y. Na . Re . Gene
17, 66 (2016).
5. Manuylo , N. L., Manuylo a, E., A doshina, V. & Te osian, S. Se -
din1/L c10 is dispensable o mouse de elopmen . Genesis 46,
441–446 (2008).
6. B ody, M. J. & Lee, Y. The Role o Leucine-Rich Repea Con aining
P o ein 10 (LRRC10) in Dila ed Ca diomyopa hy. F on Physiol. 7,
337 (2016).
7. S asse , B. e al. E olu iona y o igin and di e sifica ion o epi-
de mal ba ie p o eins in amnio es. Mol. Biol. E ol. 31,
3194–3205 (2014).
8. Kawasaki,K.,La on ,A.G.&Si e,J.Y.Thee olu iono milkcasein
genes om oo h genes be o e he o igin o mammals. Mol. Biol.
E ol. 28,2053–2061 (2011).
9. Me edi h,R.W.,Ga esy,J.&Sp inge ,M.S.Molecula decayo
enamel ma ix p o ein genes in u les and o he eden ulous
amnio es. BMC E ol. Biol. 13,20(2013).
10. Elleg en, H. Compa a i e genomics and he s udy o e olu ion by
na u al selec ion. Mol. Ecol. 17,4586–4596 (2008).
11. Zhang, G. e al. Compa a i e genomics e eals insigh s in o a ian
genome e olu ion and adap a ion. Science 346,1311–1320
(2014).
12. Ja is, E. D. e al. Whole-genome analyses esol e ea ly b anches in
he eeo li eo mode nbi ds.Science 346,1320–1331
(2014).
13. Seebache , F. The e olu ion o me abolic egula ion in animals.
Comp. Biochem. Physiol. B Biochem. Mol. Biol. 224,195–203 (2018).
14. Hed ick, M. S. & Hillman, S. S. Wha d o e he e olu ion o endo-
he my? J. Exp. Biol. 219,300–301 (2016).
15. Robe s, R. M., G een, J. A. & Schulz, L. C. The e olu ion o he
placen a. Rep oduc ion 152,R179–R189 (2016).
16. Vize, P. D. & Smi h, H. W. A Home ic iew o kidney e olu ion: A
ep in o H.W. Smi h’s classic essay wi h a new in oduc ion.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 19
E olu ion o he kidney. 1943. Ana . Rec. A Disco. Mol. Cell E ol. Biol.
277,344–354 (2004).
17. Poulson, T. L., McNabb, F. M. & Folk, R. L. U ic acid: he main
ni ogenous exc e o y p oduc o bi ds. Science 170,98–99 (1970).
18. Galpe in, M. Y. & Koonin, E. V. F om comple e genome sequence o
‘comple e’unde s anding? T ends Bio echnol. 28,398–406 (2010).
19. Galpe in, M. Y. & Koonin, E. V. ‘Conse ed hypo he ical’p o eins:
p io i iza ion o a ge s o expe imen al s udy. Nucleic Acids Res
32,5452–5463 (2004).
20. Pawlowski, K. Uncha ac e ized/hypo he ical p o eins in biomedical
‘omics’expe imen s: is no el y being swep unde he ca pe ? B ie .
Func . Genom. P o eomic 7,283–290 (2008).
21. Do ido , L. e al. Ni oso- edox balance and mi ochond ial home-
os asis a e egula ed by STOX1, a p e-eclampsia-associa ed gene.
An ioxid. Redox Signal 21,819–834 (2014).
22. Bona i a, R. e al. Cep126 is equi ed o pe icen iola sa elli e
localisa ion o he cen osome and o p ima y cilium o ma ion.
Biol. Cell 106,254–267 (2014).
23. Chen, L., Wol , A. B., Fu, W., Li, L. & Akey, J. M. Iden i ying and
In e p e ing Appa en Neande hal Ances y in A ican Indi iduals.
Cell 180,677–687.e616 (2020).
24. Pos h, C. e al. Pleis ocene Mi ochond ial Genomes Sugges a
Single Majo Dispe sal o Non-A icans and a La e Glacial Popula ion
Tu no e in Eu ope. Cu . Biol. 26,827–833 (2016).
25. Ri o, T. e al. A dispe sal o Homo sapiens om sou he n o eas e n
A ica immedia ely p eceded he ou -o -A ica mig a ion. Sci. Rep.
9,4728(2019).
26. Genomes P ojec , C. e al. A global e e ence o human gene ic
a ia ion. Na u e 526,68–74 (2015).
27. Ma essoni, F. e al. A high-co e age Neande al genome om
Chagy skaya Ca e. P oc. Na l Acad. Sci. USA 117,
15132–15136 (2020).
28. P u e , K. e al. A high-co e age Neande al genome om Vindija
Ca e in C oa ia. Science 358,655–658 (2017).
29. P u e , K. e al. The comple e genome sequence o a Neande hal
om he Al ai Moun ains. Na u e 505,43–49 (2014).
30. Ma essoni, F. & P u e , K. Be e suppo o a small e ec i e
popula ion size o Neande als and a long sha ed his o y o Nean-
de als and Deniso ans. P oc.Na lAcad.Sci.USA114,
E10256–E10257 (2017).
31. G een, R. E. e al. A d a sequence o he Neande al genome.
Science 328,710–722 (2010).
32. Hue a-Sanchez, E. e al. Al i ude adap a ion in Tibe ans caused by
in og ession o Deniso an-like DNA. Na u e 512,194–197 (2014).
33. Kong, A. e al. Fine-scale ecombina ion a e di e ences be ween
sexes, popula ions and indi iduals. Na u e 467,1099–1103 (2010).
34. Tabula Mu is, C. e al. Single-cell ansc ip omics o 20 mouse
o gans c ea es a Tabula Mu is. Na u e 562,367–372 (2018).
35. Pa k, J. e al. Single-cell ansc ip omics o he mouse kidney
e eals po en ial cellula a ge s o kidney disease. Science 360,
758–763 (2018).
36. Deu sch,E.W.ThePep ideA lasP ojec .Me hods Mol. Biol. 604,
285–296 (2010).
37. Hu lin, E. L. e al. A issue-specific a las o mouse p o ein phos-
pho yla ion and exp ession. Cell 143, 1174–1189 (2010).
38. Schmid , T. e al. P o eomicsDB. Nucleic Acids Res 46,
D1271–D1281 (2018).
39. Wang, D. e al. A deep p o eome and ansc ip ome abundance
a las o 29 heal hy human issues. Mol. Sys . Biol. 15, e8503 (2019).
40. Li, S. e al. Digging Mo e Missing P o eins Using an En ichmen
App oach wi h P o eoMine . J. P o eome Res 16, 4330–4339 (2017).
41. Rinschen, M. M. e al. Quan i a i e phosphop o eomic analysis
e eals asop essin V2- ecep o -dependen signaling pa hways in
enal collec ing duc cells. P oc. Na l Acad. Sci. USA 107,
3882–3887 (2010).
42. MacKenzie, E. L., Iwasaki, K. & Tsuji, Y. In acellula i on anspo
and s o age: om molecula mechanisms o heal h implica ions.
An ioxid. Redox Signal 10, 997–1030 (2008).
43. Ho, H. Y. e al. Toca-1 media es Cdc42-dependen ac in nuclea ion
by ac i a ing he N-WASP-WIP complex. Cell 118,203–216 (2004).
44. Kakimo o, T., Ka oh, H. & Negishi, M. Regula ion o neu onal mo -
phology by Toca-1, an F-BAR/EFC p o ein ha induces plasma
memb ane in agina ion. J. Biol. Chem. 281, 29042–29053 (2006).
45. Lee, J., Kim, M. S., Pa k, S. H. & Jang, Y. K. Tousled-like kinase 1 is a
nega i e egula o o co e ansc ip ion ac o s in mu ine emb yo-
nic s em cells. Sci. Rep. 8, 334 (2018).
46. Zhang, R., Thamm, D. H. & Mis a, V. The e ec o Zhang ei/CREBZF
on cell g ow h, di e en ia ion, apop osis, mig a ion, and he
un olded p o ein esponse in se e al canine os eosa coma cell
lines. BMC Ve . Res 11,22(2015).
47. Pa do, M. e al. Mys 2/Ka 7 his one ace yl ans e ase in e ac ion
p o eomics e eals umou -supp esso Niam as a no el binding
pa ne in emb yonic s em cells. Sci. Rep. 7, 8157 (2017).
48. Nilsson, R. e al. Disco e y o genes essen ial o heme biosyn hesis
h ough la ge-scale gene exp ession analysis. Cell Me ab. 10,
119–130 (2009).
49. Tschop, M. H. e al. A guide o analysis o mouse ene gy me abo-
lism. Na . Me hods 9,57–63 (2011).
50. Wes , D. B., Booze , C. N., Moody, D. L. & A kinson, R. L. Die a y
obesi y in nine inb ed mouse s ains. Am. J. Physiol. 262,
R1025–R1032 (1992).
51. Dunaie , J. L. I on induced oxida i e damage as a po en ial ac o in
age- ela ed macula degene a ion: he Cogan Lec u e. In es
Oph halmol. Vis. Sci. 47, 4660–4664 (2006).
52. Sypes, E. E. e al. Highe Body Mass Index Is Associa ed wi h I on
Deficiency in Child en 1 o 3 Yea s o Age. J. Pedia . 207,198–204
e191 (2019).
53. Kama , M. A. e al. PhenoScanne V2: an expanded ool o
sea ching human geno ype-pheno ype associa ions. Bioin o ma ics
35,4851–4853 (2019).
54. P ins, B. P. e al. Genome-wide analysis o heal h- ela ed bioma ke s
in he UK Household Longi udinal S udy e eals no el associa ions.
Sci. Rep. 7, 11008 (2017).
55. Gopal, S. K. e al. YBX1/YB-1 induces pa ial EMT and umou -
igenici y h ough sec e ion o angiogenic ac o s in o he ex a-
cellula mic oen i onmen . Onco a ge 6,13718–13730 (2015).
56. Tang, J. e al. Knockdown o TPT1-AS1 inhibi s cell p oli e a ion, cell
cycle G1/S ansi ion, and epi helial-mesenchymal ansi ion in
gas ic cance . Bosn. J. Basic Med. Sci. 21,39–46 (2021).
57. Ye, Z. e al. ODC1 p omo es p oli e a ion and mobili y ia he AKT/
GSK3be a/be a-ca enin pa hway and modula ion o acido ic
mic oen i onmen in human hepa ocellula ca cinoma. Onco Ta -
ge s The . 12,4081–4092 (2019).
58. Meng, Q. e al. Ab oga ion o glu a hione pe oxidase-1 d i es EMT
and chemo esis ance in panc ea ic cance by ac i a ing ROS-
media ed Ak /GSK3be a/Snail signaling. Oncogene 37,
5843–5857 (2018).
59. Xu, C. e al. SPP1, analyzed by bioin o ma ics me hods, p omo es
he me as asis in colo ec al cance by ac i a ing EMT pa hway.
Biomed. Pha maco he . 91, 1167–1177 (2017).
60. Solda o , R. e al. Spa io empo al s uc u e o cell a e decisions in
mu ine neu al c es . Science 364, eaas9536 (2019).
61. Guan, C., Ye, C., Yang, X. & Gao, J. A e iew o cu en la ge-scale
mouse knockou e o s. Genesis 48,73–85 (2010).
62. Wenge ,M.J.,DellaValle,D.M.,Mu ay-Kolb,L.E.&Haas,J.D.
E ec o i on deficiency on simul aneous measu es o beha io ,
b ain ac i i y, and ene gy expendi u e in he pe o mance o a
cogni i e ask. Nu . Neu osci. 22,196–206 (2019).
63. Blankenhaus, B. e al. Fe i in egula es o ganismal ene gy balance
and he mogenesis. Mol. Me ab. 24,64–79 (2019).
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 20
64. Bogdan, A. R., Miyazawa, M., Hashimo o, K. & Tsuji, Y. Regula o s o
I on Homeos asis: New Playe s in Me abolism, Cell Dea h, and
Disease. T ends Biochem Sci. 41,274–286 (2016).
65. Wasse man, D. H., O’Dohe y, R. M. & Zinke , B. A. Role o he
endoc ine panc eas in con ol o uel me abolism by he li e du -
ing exe cise. In J. Obes. Rela . Me ab. Diso d. 19,S22–S30
(1995).
66. Bha acha ya, D., Azambuja, A. P. & Simoes-Cos a, M. Me abolic
Rep og amming P omo es Neu al C es Mig a ion ia Yap/Tead
Signaling. De . Cell 53,199–211.e196 (2020).
67. Manz,D.H.,Blanche e,N.L.,Paul,B.T.,To i,F.M.&To i,S.V.I on
and cance : ecen insigh s. Ann. N. Y Acad. Sci. 1368,
149–161 (2016).
68. Yuan, M. e al. N-my is oyla ion: om cell biology o ansla ional
medicine. Ac a Pha m. Sin. 41,1005–1015 (2020).
69. Lin, C. Y. e al. Memb ane p o ein- egula ed ne wo ks ac oss human
cance s. Na . Commun. 10, 3131 (2019).
70. Edga ,R.C.MUSCLE:mul iplesequencealignmen wi hhigh
accu acy and high h oughpu . Nucleic Acids Res 32,
1792–1797 (2004).
71. Ca i he s, L. J. e al. A No el App oach o High-Quali y Pos mo em
Tissue P ocu emen : The GTEx P ojec . Biop ese Biobank 13,
311–319 (2015).
72. Bu le , A., Ho man, P., Smibe , P., Papalexi, E. & Sa ija, R. In e-
g a ing single-cell ansc ip omic da a ac oss di e en condi ions,
echnologies, and species. Na . Bio echnol. 36,411–420
(2018).
73. Fo ms eche , E. e al. P o ein in e ac ion mapping: a D osophila
case s udy. Genome Res. 15,376–384 (2005).
74. Rain, J. C. e al. The p o ein-p o ein in e ac ion map o Helicobac e
pylo i. Na u e 409,211–215 (2001).
75. Cox, J. & Mann, M. MaxQuan enables high pep ide iden ifica ion
a es, indi idualized p.p.b.- ange mass accu acies and p o eome-
wide p o ein quan ifica ion. Na . Bio echnol. 26,1367–1372
(2008).
76. Zhang, X. e al. P o eome-wide iden ifica ion o ubiqui in in e ac-
ions using UbIA-MS. Na . P o oc. 13,530–550 (2018).
77. Go, C. D. e al. A p oximi y-dependen bio inyla ion map o a human
cell. Na u e 595,120–124 (2021).
78. Ransick, A. e al. Single-Cell P ofiling Re eals Sex, Lineage, and
Regional Di e si y in he Mouse Kidney. De . Cell 51,399–413
e397 (2019).
79. S ua , T. e al. Comp ehensi e In eg a ion o Single-Cell Da a. Cell
177, 1888–1902.e1821 (2019).
80. Wolock, S. L., Lopez, R. & Klein, A. M. Sc uble : Compu a ional
Iden ifica ion o Cell Double s in Single-Cell T ansc ip omic Da a.
Cell Sys . 8,281–291.e289 (2019).
81. Wilson, P. C. e al. The single-cell ansc ip omic landscape o ea ly
human diabe ic neph opa hy. P oc. Na l Acad. Sci. USA 116,
19619–19625 (2019).
82. Chung, J. J. e al. Single-Cell T ansc ip ome P ofiling o he Kidney
Glome ulus Iden ifies Key Cell Types and Reac ions o Inju y. J. Am.
Soc. Neph ol. 31,2341–2354 (2020).
83. Sch oede , A. W. e al. NOVEL HUMAN KIDNEY CELL SUBSETS
IDENTIFIED BY MUX-SEQ. T ansplan a ion 104,S85
(2020).
84. Wei , J. B. New me hods o calcula ing me abolic a e wi h special
e e ence o p o ein me abolism. J. Physiol. 109,1–9 (1949).
85. E en, P. C., Mokh a ian, A. & Pele, A. P ac ical aspec s o indi ec
calo ime yinlabo a o yanimals.Neu osci. Biobeha Re . 18,
435–447 (1994).
86. Conco de , J. P. & Haeussle , M. CRISPOR: in ui i e guide selec ion
o CRISPR/Cas9 genome edi ing expe imen s and sc eens. Nucleic
Acids Res 46,W242–W245 (2018).
87. Shalem, O. e al. Genome-scale CRISPR-Cas9 knockou sc eening
in human cells. Science 343,84–87 (2014).
88. Li ak,K.J.&Schmi gen,T.D.Analysiso ela i egeneexp ession
da a using eal- ime quan i a i e PCR and he 2(-Del a Del a C(T))
Me hod. Me hods 25,402
–408 (2001).
89. Beck, T., Rowlands, T., Sho e , T. & B ookes, A. J. GWAS Cen al: an
expanding esou ce o finding and isualising geno ype and phe-
no ype da a om genome-wide associa ion s udies. Nucleic Acids
Res 51,D986–D993 (2023).
90. Howe, K. L. e al. Ensembl 2021. Nucleic Acids Res 49,
D884–D891 (2021).
Acknowledgemen s
We would like o hank Vendula No osado a (Ins i u e o Molecula
Gene ics o he Czech Academy o Sciences) and Roldan Medina De
Guia (Ins i u e o Molecula Gene ics o he Czech Academy o Sciences)
o eedback on he s a is ics as well as clinical chemis y. M.T., M.K.,
T.Z., and J.K. acknowledge CzechNanoLab Resea ch In as uc u e
suppo edbyMEYSCR(LM2018110).M.T.acknowledges heB noCi y
Municipali y as a B no Ph.D. Talen Schola ship Holde and Ma ina
Roeselo a Memo ial Fellowship. R.S. was suppo ed by he Czech
Academy o Sciences RVO 68378050 and by LM2018126, Czech Cen e
o Phenogenomics, p o ided by he Minis y o Educa ion, You h and
Spo s o he Czech Republic. CIISB, Ins uc -CZ Cen e o Ins uc -ERIC
EU conso ium, unded by MEYS CR in as uc u e p ojec LM2023042
and Eu opean Regional De elopmen Fund-P ojec „UP CIISB“(No.
CZ.02.1.01/0.0/0.0/18_046/0015974), is g a e ully acknowledged o
he financial suppo o he measu emen s a he CEITEC P o eomics
Co e Facili y. Compu a ional esou ces o he IP LC-MS/MS da a p o-
cessing we e p o ided by he e-INFRA CZ p ojec (ID:90140), suppo ed
by he Minis y o Educa ion, You h and Spo s o he Czech Republic.
I.A. was suppo ed by Be il Halls en Resea ch Founda ion, Medical
Uni e si y o Vienna and Gus a sson’s Founda ion P ize 2021, T.B. was
suppo ed by a g an om he Aus ian Science Fund M2688-B28, J.K.
was suppo ed by he G an Agency o Masa yk Uni e si y (MUNI/H/
1615/2018). I.P. was suppo ed by he Eu opean Union’s Ho izon 2020
Resea ch and Inno a ion P og am unde Ma ie Sklodowska-Cu ie (g an
ag eemen No. 860635, ITN NEUc es ), P.B. was suppo ed by he
Ge man Resea ch Founda ion (DFG, P ojec IDs 322900939,
454024652, 432698239 & 445703531), Eu opean Resea ch Council
(ERC Consolida o G an No 101001791), and he Fede al Minis y o
Educa ion and Resea ch (BMBF, STOP-FSGS-01GM2202C). The wo k o
J.K. was suppo ed by Czech Science Founda ion (22-02794 S). Pa s o
Figs. 1,3,6and Supplemen a y Figs 6, 11 –18 we e c ea ed wi h BioR-
ende .com. OG and RD we e suppo ed by Minis y o Science and
Highe Educa ion o he Russian Fede a ion g an 075-15-2021-1344 and
Japan Socie y o he P omo ion o Science (JSPS) KAKENHI
JP23H02226.
Au ho con ibu ions
J.Pe., L.E., A.A., I.P., R.M., T.B., M.T., R.D., A.S.S., E.E.A., D.P.R., H.Z., M.K.,
M.E.K., J.K ., T.R., K.G., S.K., D.P., Z.Z., R.S.G., A.G., M.E.B., M.iK., H.A., and
D.L. acqui ed all biological da a and pe o med he ele an analysis.
R.K. and C.K. p o ided human samples and ga e eedback on expe i-
men al aspec s. J.Pe., I.A., T.Z., F.E., Z.M., G.S., T.K., V.B., T.H., K.F., J.Ka.,
P.B., C.F., J.R., P.K., J.P.R., R.S. and O.G. ga e eedback on expe imen al
aspec s, supe ised expe imen al app oaches, and implemen ed he
da a in e p e a ion. J.Pe., L.E. and I.A. made all figu es con aining da a
and esul ing analysis. J.Pe. and I.A. designed he s udy, o ganized he
expe imen al wo k, and w o e he manusc ip . All au ho s p o ided
eedback on figu es, manusc ip composi ion, and s uc u e.
Funding
Open access unding p o ided by Ka olinska Ins i u e.
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 21
Compe ing in e es s
The au ho s decla e no compe ing in e es s.
Addi ional in o ma ion
Supplemen a y in o ma ion The online e sion con ains
supplemen a y ma e ial a ailable a
h ps://doi.o g/10.1038/s41467-023-38663-7.
Co espondence and eques s o ma e ials should be add essed o
Julian Pe e sen o Igo Adameyko.
Pee e iew in o ma ion Na u e Communica ions hanks E ich Ja is
and he o he , anonymous, e iewe (s) o hei con ibu ion o he pee
e iew o his wo k. A pee e iew file is a ailable.
Rep in s and pe missions in o ma ion is a ailable a
h p://www.na u e.com/ ep in s
Publishe ’s no e Sp inge Na u e emains neu al wi h ega d o ju -
isdic ional claims in published maps and ins i u ional a filia ions.
Open Access This a icle is licensed unde a C ea i e Commons
A ibu ion 4.0 In e na ional License, which pe mi s use, sha ing,
adap a ion, dis ibu ion and ep oduc ion in any medium o o ma , as
long as you gi e app op ia e c edi o he o iginal au ho (s) and he
sou ce, p o ide a link o he C ea i e Commons license, and indica e i
changes we e made. The images o o he hi d pa y ma e ial in his
a icle a e included in he a icle’s C ea i e Commons license, unless
indica ed o he wise in a c edi line o he ma e ial. I ma e ial is no
included in he a icle’s C ea i e Commons license and you in ended
use is no pe mi ed by s a u o y egula ion o exceeds he pe mi ed
use, you will need o ob ain pe mission di ec ly om he copy igh
holde . To iew a copy o his license, isi h p://c ea i ecommons.o g/
licenses/by/4.0/.
© The Au ho (s) 2023, co ec ed publica ion 2023
Julian Pe e sen
1,25
,LukasEnglmaie
2,3,25
,A emV.A emo
4
, I ina Po e ennaya
4
,RubaMahmoud
1
,
Thibaul Boude lique
4
, Ma ke a Tesa o a
5
, Ruslan De ia iia o
6,7
,Ane Szil ásy-Szabó
8
,E genyE.Akku a o
9,10
,
Da id Pajuelo Regue a
11
, Hugo Zebe g
12,13
, Ma ke a Kaucka
14
, Ma ia Eleni Kas i i
4,13
,JanK i anek
15
,
Tomasz Radaszkiewicz
16
, K is ína Gömö yo á
16
, Sa ah Knau h
1
, Da id Po esil
17
, Zbynek Zd ahal
17
,RanjaniS iGanji
17
,
Anna G abowski
4
, Mi iam E. Buhl
18
, Tomas Zikmund
5
, Michaela Ka ko a
5,15
,HåkanAxelson
19
,Da idLindg en
19
,
Ra ael K amann
20
, Ch is oph Kuppe
20
, Fe enc E délyi
21
, Zol án Má é
21
, Gábo Szabó
21
, Till Koehne
1
, Tibo Ha kany
22
,
Kaj F ied
13
, Joze Kaise
5
, Pe e Boo
18
,CsabaFeke e
8
, Jan Rozman
11,23
,Pe Kaspa ek
11
, Jan P ochazka
11
,
Radisla Sedlacek
11
,Vi ezsla B yja
16
,OlegGuse
6,24
& Igo Adameyko
4,13
1
Depa men o O hodon ics, Uni e si y Leipzig Medical Cen e , Leipzig, Ge many.
2
CeMM Resea ch Cen e o Molecula Medicine o he Aus ian Academy
o Sciences, 1090 Vienna, Aus ia.
3
Ludwig Bol zmann Ins i u e o Ra e and Undiagnosed Diseases, 1090 Vienna, Aus ia.
4
Depa men o Neu oimmunology,
Cen e o B ain Resea ch, Medical Uni e si y Vienna, Vienna, Aus ia.
5
Cen al Eu opean Ins i u e o Technology, B no Uni e si y o Technology, B no, Czech
Republic.
6
Regula o y Genomics Resea ch Cen e , Ins i u e o Fundamen al Medicine and Biology, Kazan Fede al Uni e si y, Kazan, Russia.
7
Endoc inology
Resea ch Cen e , Moscow, Russia.
8
Labo a o yo In eg a i e Neu oendoc inology, Ins i u e o Expe imen al Medicine, 1083 Budapes ,Hunga y.
9
Depa men
o Applied Physics, Royal Ins i u e o Technology, Science o Li e Labo a o y, 171 65, S ockholm, Sweden.
10
Uni e si y o Ox o d, MRC Wea he all Ins i u e o
Molecula Medicine, Radcli e Depa men o Medicine, Ox o d OX3 9DS, UK.
11
Ins i u e o Molecula Gene ics o he Czech Academy o Science, Czech
Cen e o Phenogenomics, Ves ec, Czech Republic.
12
Depa men o Neu oscience, Ka olinska Ins i u e , S ockholm, Sweden.
13
Depa men o Physiology
and Pha macology, Ka olinska Ins i u e , S ockholm, Sweden.
14
Max Planck Ins i u e o E olu iona y Biology, Plön 24306, Ge many.
15
Depa men o
His ology and Emb yology, Facul y o Medicine, Masa yk Uni e si y, B no, Czech Republic.
16
Ins i u e o Expe imen al Biology, Facul y o Science, Masa yk
Uni e si y, B no, Czech Republic.
17
Cen al Eu opean Ins i u e o Technology, Masa yk Uni e si y, B no, Czech Republic.
18
Ins i u e o Pa hology & Elec on
Mic oscopy Facili y, RWTH Aachen Uni e si y Hospi al, Aachen, Ge many.
19
T ansla ional Cance Resea ch, Depa men o Labo a o y Medicine, Lund
Uni e si y, Medicon Village, Scheele ägen 2, Lund, Sweden.
20
Ins i u e o Expe imen al Medicine and Sys ems Biology, RWTH Aachen Uni e si y,
Aachen, Ge many.
21
Medical Gene Technology Uni , Ins i u e o Expe imen al Medicine, Budapes , Hunga y.
22
Depa men o Molecula Neu osciences,
Cen e o B ain Resea ch, Medical Uni e si y Vienna, Vienna, Aus ia.
23
Luxembou g Cen e o Sys ems Biomedicine, Uni e si y o Luxembou g, 6, a enue
du Swing, 4367 Bel aux, Luxembou g.
24
In ac able Disease Resea ch Cen e , G adua e School o Medicine, Jun endo Uni e si y, Tokyo, Japan.
25
These
au ho s con ibu ed equally: Julian Pe e sen, Lukas Englmaie . e-mail: julian.pe e [email protected];igo [email protected]
A icle h ps://doi.o g/10.1038/s41467-023-38663-7
Na u e Communica ions | (2023) 14:3092 22