Rômulo B aga A eal
Disse a ion p esen ed o ob ain he Ph.D deg ee in Immunology
Ins i u o de Tecnologia Química e Biológica An ónio Xa ie | Uni e sidade No a de Lisboa
Inse he e an image
wi h ounded co ne s
Recip ocal in e ac ions be ween
Helicobac e hepa icus and he
mouse immune sys em
Oei as,
Oc obe , 2016
Rômulo B aga A eal
Disse a ion p esen ed o ob ain he Ph.D deg ee in Immunology
Ins i u o de Tecnologia Química e Biológica An ónio Xa ie | Uni e sidade No a de Lisboa
Oei as, Oc obe , 2016
Recip ocal in e ac ions be ween
Helicobac e hepa icus and he
mouse immune sys em
Resea ch wo k coo dina ed by:
The wo k p esen ed on his hesis was suppo ed by Fundação pa a a
Ciência e a Tecnologia – FCT, g an SFRH/BD/51883/2012
To Juliane and An ônio
4
Table o Con en s
Acknowledgemen s .................................................................................... 7
Summa y .................................................................................................... 9
Sumá io .................................................................................................... 11
Lis o Abb e ia ions ................................................................................. 13
Lis o Figu es and Tables ........................................................................ 14
Chap e 1 : In oduc ion ............................................................................ 17
Recip ocal in e ac ions be ween he hos and he mic obio a ............... 17
1 – Immunological impac o he hos on he mic obio a ................ 17
2 - E ec s o he mic obio a on he hos ........................................ 21
2.1 - Age independen e ec s o he mic obio a on he hos .. 21
2.2 - Age dependen e ec s o he mic obio a on he hos .... 23
Helicobac e hepa icus ......................................................................... 25
Chap e 2 : IL-10 p omo es Helicobac e hepa icus pe sis ence in he gu ,
while An ibodies, T and B cells con ibu e equally o bac e ia elimina ion. 29
P elimina y no es ................................................................................. 30
Abs ac ............................................................................................... 31
In oduc ion .......................................................................................... 32
Resul s ................................................................................................ 34
Impac o he adap i e immuni y on H. hepa icus in he gu ........... 34
Impac o T cells on he esponse o H. hepa icus ......................... 36
Role o B cells and IgA on he esponse o H. hepa icus ............... 40
Discussion ........................................................................................... 43
5
Ma e ials and Me hods ......................................................................... 46
Mice .............................................................................................. 46
Helicobac e hepa icus cul u e and mice coloniza ion ................... 46
Helicobac e hepa icus quan i ica ion ............................................ 47
To al and speci ic Immunoglobulin quan i ica ion by ELISA ........... 48
Fecal Lipocalin-2 quan i ica ion ..................................................... 49
IgA FACS on li e H. hepa icus ...................................................... 49
Da a analysis ................................................................................ 49
Supplemen a y Ma e ial o Chap e 2 ................................................. 51
Chap e 3 : Pe ina al ansmission o Helicobac e hepa icus consolida es
symbiosis h ough induc ion o li e-long immune ole ance media ed by
Foxp3+ egula o y T cells .......................................................................... 57
P elimina y no es ................................................................................. 58
Abs ac ............................................................................................... 59
In oduc ion .......................................................................................... 60
RESULTS ............................................................................................ 62
Mo he o pup ansmission con e s long-las ing ole ance ha
bene i s H. hepa icus ......................................................................... 62
The age bu no he mode o p imo-exposu e o H. hepa icus
condi ions he hos esponse ............................................................. 64
Nei he ma e nal an ibodies no he mic obio a a e equi ed o
pe ina ally induced ole ance o H. hepa icus .................................... 66
Long las ing immune ole ance o H. hepa icus upon mo he o pup
ansmission is T eg media ed ........................................................... 68
Tole ance o H. hepa icus does no a ec he heal h o he hos ... 71
6
Pe ina al ansmission o H. hepa icus shapes he mic obio a o he
hos in immuno-dependen and independen ways ............................ 75
Discussion ........................................................................................... 78
Ma e ials and Me hods ......................................................................... 82
Mice .............................................................................................. 82
Helicobac e hepa icus cul u e and mice coloniza ion ................... 82
Helicobac e hepa icus quan i ica ion ............................................ 83
To al and speci ic Immunoglobulin quan i ica ion by ELISA ........... 84
Induc ion o acu e coli is wi h DSS ................................................ 86
Se ological Analysis ...................................................................... 86
Fecal Lipocalin-2 quan i ica ion ..................................................... 86
D ug T ea men s ........................................................................... 86
Lamina P op ia Lymphocy es Isola ion .......................................... 87
IgA FACS on li e H. hepa icus ...................................................... 87
16S RNA analysis ........................................................................ 88
Da a analysis ................................................................................ 89
Supplemen a y Ma e ial o Chap e 3 ................................................. 91
Chap e 4 : Discussion ........................................................................... 105
Re e ences ............................................................................................. 112
7
Acknowledgemen s
I would like o hank Jocelyne Demengeo , o you dedica ion and
en husiasm wi h he wo k, o being an example o commi men and
de e mina ion, and o you guidance and pa ience. You suppo and
kindness we e c ucial in he di icul si ua ions, bo h pe sonal and wo k
ela ed, and you inc edible abili y o ind solu ions o complex p oblems
was decisi e o he ou come o his hesis.
I am e y g a e ul o all he p esen and pas membe s o he FL lab,
especially Ma ie Louise Be gman, Ana Ca a ina Ma ins, Ma ga ida A aújo,
Vasco Co eia and Inês Cab al, ha we e di ec ly in ol ed in his wo k.
Thank you o he commi men and suppo ! Thanks as well o Vânia Sil a,
o he mos help ul discussions abou wo k, science and he uni e se, o
F ancisca Fon es, o he g ea suppo , o Í is Ca amalho, o you
encou agemen and he mos clea -minded and objec i e opinions, and o
e e ybody else o c ea ing a g ea wo k en i onmen .
Thanks o Ana Regalado, o sha ing many o he sad and happy
momen s o his doc o al wo k. Thank you o you help wi h p o ocols,
expe imen s and exis en ial c isis. You kindness and wise ad ice helped
me ge h ough e e y hing.
I am e y g a e ul o my hesis commi ee, Michael Pa khouse and
Luis Teixei a, o help ul c i icism and g ea ad ice. Thanks o Jo ge
Ca nei o, who inspi ed me o use R and lea n how o do a be e job in da a
analysis. Thanks o Isabel Go do, Ka ina Xa ie and Miguel Soa es, o
help ul discussions in ou “Mouse Mic obio a Mee ings”. Thanks as well o
João Ba is a, Jo ge Sousa, Jessica Thompson, Ana Ri a Oli ei a, Bah iya
Yilmaz and So ia Rebelo o all he help wi h expe imen s and discussions.
Thanks o Manuela Co dei o, o all he help along he way, and o
Élio Sucena, o he good ad ice and willingness o help.
8
I am in g ea deb o Manuel Rebelo, Joana Bom, So ia Leocadio,
Ka en Be man, Ana Lúcia Ribei o, Adé i o Viei a, Lé i Pi es and many
o he membe s o he IGC’s animal house acili y. Thanks o he pa ience
and all he help s uc u ing complex expe imen s along his p ojec .
Thanks o Ma ga ida Pa en e and Lígia Sa ai a o help wi h he
cul u e o Helicobac e hepa icus and an igen p epa a ions.
Thanks o my iends A non Jube g, Tiago Macedo and Rod igo
Oli ei a, o helping me keep in ouch wi h B azil, sha ing many g ea
momen s o es i i y and joy, and also o encou aging me in ha d imes.
Thanks as well o Luciana Mo aes, o he encou agemen and all he
hila ious discussions on he co ido , and o Thiago Ca alho, o good
ad ice and o all he impo an pape s you kep sending me o e he yea s.
Thanks o all my colleagues o he PhD p og am, especially PIBS
2011, o he g ea discussions du ing he classes and he g ea un in he
AMeeGuS mee ings. Thanks o he “bas a dos” Özhan Özkaya, Ja ek
Su kon and Ra ał Gumienny, o all he g ea imes and also o he long
con e sa ions abou he mos andom subjec s. Thanks o you iendship
and encou agemen .
Ob igado a meus pais, Gilde e e José An ônio, e a meu i mão
Rome o, pelo apoio nos momen os di íceis e en usiasmo nos momen os
aleg es.
Thanks o my wi e, Juliane Menezes, o being my pa ne and my
bes iend o he las 8 yea s. Thanks o he g ea suppo and
encou agemen , o helping me on long weekend hou s in he lab, o
sha ing he good and he bad momen s, and o inspi ing me o always gi e
my bes . And hanks o ou son, An ônio, o helping me inish his hesis on
ime :)
15
Figu e 3.1 - Mo he o pup ansmission con e s long-las ing ole ance o H.
hepa icus .................................................................................................. 63
Figu e 3.2 - The age bu no he mode o p imo-exposu e o H. hepa icus
condi ions he hos esponse .................................................................... 65
Figu e 3.3 - Nei he ma e nal an ibodies no he mic obio a a e equi ed o
pe ina ally induced ole ance o H. hepa icus ........................................... 67
Figu e 3.4 - Long las ing immune ole ance o H. hepa icus upon mo he o
pup ansmission is T eg media ed ........................................................... 69
Figu e 3.5 – Tole ance o H. hepa icus does no a ec he heal h o he hos
................................................................................................................. 73
Figu e 3.5 – Tole ance o H. hepa icus does no a ec he heal h o he hos
................................................................................................................. 74
Figu e 3.6 - Pe ina al ansmission o H. hepa icus shapes he mic obio a o
he hos in immuno-dependen and independen ways ............................. 76
Table S3.1 – IgM and IgG analysis by ELISA on ecal ex ac s ................ 91
Figu e S3.1 – ecal IgA om Adcol mice binds li e H. hepa icus .............. 92
Figu e S3.2 – IgA coa ed bac e ia in he eces o SPF, Nbcol and Adcol
mice ......................................................................................................... 93
Figu e S3.3 – Ve y low amoun o H. hepa icus om eces is able o
colonize SPF WT mice ............................................................................. 94
16
Figu e S3.4 – H. hepa icus ecal load 10 weeks pos -coloniza ion (Figu e
3.2 B - D) .................................................................................................. 95
Figu e S3.5 – Complemen a y o Figu e 3.4 A and B ............................... 96
Figu e S3.6 – Complemen a y o Figu e 3.4 C ......................................... 97
Figu e S3.7 – T egs a e deple ed in MLN, PP and La ge In es ine Lamina
P op ia upon DT ea men in DEREG mice ............................................. 98
Figu e S3.10 – An i-H. hepa icus mucosal IgA is T-cell dependen ......... 101
Figu e S3.11 – an i-IL10R ea men is able o b eak ole ance o H.
hepa icus ................................................................................................ 102
Figu e S3.12 – Complemen a y o Figu e 3.6 ......................................... 103
Figu e S3.13 – Complemen a y o Figu e 3.6 ......................................... 104
Figu e 4.1 - Recip ocal in e ac ions be ween H. hepa icus and he hos
immune sys em on di e en de elopmen al s ages ................................ 110
Chap e 1
17
Chap e 1 : In oduc ion
Helicobac e hepa icus is a gu bac e ium commonly ound in animal
acili ies and in he wild. This bac e ium can cause pa hology in
immunocomp omised animals, howe e Wild Type (WT) s ains a e no
a ec ed, and can be pe sis en ly colonized wi h his mic obe, e en om he
i s days o li e, wi hou signs o pa hology o dec ease in b eeding
e iciency. The goal o his doc o al wo k was o iden i y he immunological
mechanisms ha main ain such s able ela ionship be ween WT mice and
H. hepa icus, and how each o ganism a ec s he o he . In o de o
app oach his p oblem, we explo ed di e en componen s o he mucosal
immune sys em, and hei ela ionship wi h he in es inal mic obio a. The
ollowing chap e is an o e iew o he li e a u e ela ed o mic obio a-
immuni y in e ac ions ele an o his wo k.
Recip ocal in e ac ions be ween he hos and he
mic obio a
1 – Immunological impac o he hos on he mic obio a
The amazing di e si y o bac e ia in he mammalian gu poses a e y
pa icula challenge o he hos , ha o disc imina ing be ween bene icial
and dele e ious mic obes, as some o he la e could e en be pa hogenic.
Du ing co-e olu ion o he hos and he mic obio a many mechanisms a ose
o con ol he bac e ia in he gu (and o he su aces o he body), which
gua an ee he p o ec ion o he hos and he s abili y o he bac e ial
communi y (Hoope e al., 2012).
In he gu , bac e ia a e s a i ied and isola ed om he hos issue by
edundan mechanisms. The epi helial cell laye is he ul ima e ba ie ,
abo e which he e is he mucus laye , p esen in he small and la ge
18
in es ine (Johansson e al., 2008; Vaishna a e al., 2011). Mucus p o eins
a e sec e ed by in es inal goble cells, and sel -assemble o o m a igh ly
packed inne laye in he colon, wi h a hicke and loose ex e nal laye
abo e i . Only a loose laye is p esen in he small in es ine, bu in bo h
places a 50µm egion in he mucus, jus abo e he epi helium, is ound
almos de oid o bac e ia, in con as o he bac e ia- ich egion abo e i .
This inne laye is ich in an imic obial pep ides and IgA, which p e en s
bac e ial con ac wi h he epi helium (Vaishna a e al., 2011).
An imic obial pep ides (AMPs) a e e ec o molecules p oduced and
sec e ed a he epi helial su ace. They o m a b oad class o molecules,
some cons i u i ely exp essed, like α-de ensins and lysozyme, and o he s
induced by mic obial sensing, like c yp din- ela ed sequences (CRS)-
pep ides and RegIIIγ (Mukhe jee and Hoope , 2015). Exp ession and
sec e ion o RegIIIγ by epi helial cells is induced by mic obial p oduc s ia
Toll-Like Recep o s (TLR), and impai men o TLR signaling leads o
educed exp ession o RegIIIγ, which in u n ab oga es he bac e ia- ee
zone abo e he epi helium (Vaishna a e al., 2011). AMPs can be b oadly
exp essed, o p oduced by specialized cell ypes, like Pane h cells, which
a e mos ly ound in he c yp s o he small in es ine, and elease g anules
con aining AMPs like lysozyme and α-de ensins. Deg anula ion o Pane h
cells is a highly con olled p ocess, and occu s mos ly h ough sensing o
In e e on-γ (IFN-γ) (Fa in e al., 2014).
Despi e he mechanisms in place o con ine bac e ia abo e he
epi helium, he in es inal issue is no s e ile. Bac e ia ha c oss he
epi helium a e usually phagocy osed and killed by mac ophages in he
Lamina P op ia (Kelsall, 2008). In addi ion, hese bac e ia can be engul ed
by Dend i ic Cells (DCs), which also sample mic obes om he lumen
(Fa ache e al., 2013). DCs ca ying li e bac e ia can p esen hei an igens
o T and B cells in he Mesen e ic Lymph Nodes (MLN), ac i a ed
Chap e 1
19
lymphocy es will sp ead h ough all mucosal su aces (Macphe son and
Uh , 2004). Mic obes wi h highe p opensi y o c oss he in es inal ba ie ,
o li ing in close p oximi y o i , a e mo e likely o ge sampled and u he
con olled by ac i a ed T and B cells and a ge ed by IgA (Mi pu i e al.,
2013).
IgA is he mos common an ibody in mucosal su aces (Man is e al.,
2011). In newbo ns, be o e he Gu Associa ed Lymphoid Tissue (GALT) is
ma u e, IgA in he ma e nal milk p o ides p o ec ion and helps shape he
mic obio a ha colonizes he neona al in es ine (Rogie e al., 2014). A e
he ma u a ion o he GALT, and in esponse o he mic obio a, endogenous
IgA is p oduced in g ea amoun s, binding o bac e ia inside he lumen and
con e ing p o ec ion agains in asion (Bunke e al., 2015; Macphe son
and Uh , 2004; Man is e al., 2011). IgA is sec e ed by plasma cells in he
Lamina P op ia, p edominan ly as dime s, which a e anspo ed h ough
he Polyme ic Immunoglobulin Recep o (pIgR) o he gu lumen (Kae zel,
2014). The e, IgA can bind o an igens and p e en hei nega i e e ec s on
he hos , o example by neu alizing chole a oxin (Lycke e al., 1999). IgA
can also a ec he mo ili y and in asi eness o pa hogens (Fo bes e al.,
2008, 2011), o ins ance by binding o molecules on he bac e ia su ace
used o a ach o he mucus (Pe e son e al., 2007). Indeed, i was ound
ha he appea ance o IgA ha could bind o Segmen ed Filamen ous
Bac e ia (SFB) in he gu co ela ed wi h a dec ease in bac e ial load (Jiang
e al., 2001). Fu he mo e, absence o IgA esul s in expansion o
oppo unis s con ained in he mic obio a (Mi pu i e al., 2013; Suzuki e al.,
2004), which illus a es he ole o his an ibody in he main enance o
homeos asis in he gu .
The di e en ia ion o B lymphocy es in o IgA sec e ing cells (plasma
cells) can occu wi h o wi hou T cell help, as mice wi hou T cells can
p oduce IgA ha bind o bac e ia in he gu (Macphe son, 2000). Mo e
20
po en immune esponses occu hough when bo h T and B cells a e
ac i a ed and help each o he . An igen p esen a ion by B cells inc eases T
cell esponses (Me kenschlage e al., 2016), and T cell help in ge minal
cen e s allows B cells o unde go class-swi ch ecombina ion (CSR) and
soma ic hype mu a ion. This, h ough he p ocess o a ini y ma u a ion, will
imp o e he binding o he sec e ed an ibody o he inducing an igen
(Faga asan e al., 2010). Bac e ia ha induce s ong esponses in he hos
usually igge T cell dependen IgA p oduc ion, as is he case o SFB
(Lécuye e al., 2014).
T cells a e majo playe s in he immune sys em, and make up ano he
laye o e ec o esponse. T cells can kill in ec ed cells, imp o e an ibody
esponses h ough he p omo ion o ge minal cen e eac ions, CSR and
a ini y ma u a ion on B cells, and hey can modi y and egula e he inna e
immune esponse h ough he p oduc ion o cy okines (Khade e al., 2009).
Upon ac i a ion, T cells can di e en ia e in o di e en p o iles, ha will
dic a e how hey espond o u he s imula ion and whe e in he body hey
will mig a e o (B omley e al., 2008). Th2 cells p oduce In e leukin-4 (IL-4)
and p omo e immuni y agains pa asi e in ec ions. Th1 cells p oduce
In e e on-γ (IFN-γ), which ac i a es mac ophages and p omo es esis ance
o many in ec ions (Khade e al., 2009), and can also induce he sec e ion
o AMPs by Pane h Cells (Fa in e al., 2014). IL-17 p oducing T cells (Th17)
ha e been implica ed in he p o ec ion agains many pa hogens and in he
con ol o he mic obio a composi ion, as he cy okines hey p oduce can
ec ui neu ophils o he gu and also induce he p oduc ion o AMPs by
epi helial cells (Khade e al., 2009).
Chap e 1
21
2 - E ec s o he mic obio a on he hos
The gu mic obio a also modi ies and is essen ial o he no mal
de elopmen o many issues in he hos , including he immune sys em.
Mice bo n and aised in he absence o mic obes (ge m ee - GF) exhibi a
se ies o de ec s when compa ed o con en ionally aised animals. GF mice
ha e enla ged ceca, educed in es inal mo ili y, longe illi and sho e
c yp s in he in es ine, educed amoun o AMPs, absence o Isola ed
Lymphoid Follicles (ILF) in he Lamina P op ia, educed numbe o
in aepi helial lymphocy es, and smalle Peye ’s pa ches (PPs) and MLN
(Gensollen e al., 2016). All hese di e ences e idence he impac he
mic obio a has on he ma u a ion o he hos , and pa icula ly o he GALT.
Mos o hese p oblems can be e e ed by coloniza ion o GF mice wi h a
con en ional mic obio a, bu some cellula de ec s canno be co ec ed
once hese mice age pas a c i ical ime window.
2.1 - Age independen e ec s o he mic obio a on he hos
Lymphocy es exp essing αβ T cell ecep o s, CD4+ and CD8+, a e
g ea ly dec eased in numbe s in he Lamina P op ia and In aepi helial
compa men s in he in es ines o GF compa ed o con en ionally aised
mice. This phenomenon can be e e ed i adul GF mice a e colonized wi h
no mal mouse mic obio a, bu no comple ely upon coloniza ion wi h
human o a gu mic obes, showing how he in ica e ela ionship o he
hos immuni y and mic obio a was shaped by co-e olu ion (Chung e al.,
2012).
Lamina P op ia Lymphocy es p oduce less IL-10, IFN-γ, IL-4 and IL-
17 in GF compa ed o con en ional mice, which could be e e ed by adul -
coloniza ion wi h con en ional lo a. Pa icula ly Th17 cells, which a e
impo an o he p oduc ion o IgA in he gu , can be es o ed o no mal
22
le els in he Lamina P op ia o adul GF mice wi h monocoloniza ion wi h
SFB (Gabo iau-Rou hiau e al., 2009).
The homeos asis in he gu is dependen on e ec o mechanisms,
which should be con olled o p e en exace ba ed immune eac ions. CD4+
αβT cells exp essing he ansc ip ion ac o Foxp3 can supp ess immune
eac ions and a e designa ed Regula o y T cells (T eg). T eg a e he majo
sou ce o he immuno egula o y cy okine IL-10 in he gu (Rub so e al.,
2008) and can espond o commensal an igens (La h op e al., 2011). The
equency o Foxp3+ cells inside he CD4+ αβT cell popula ion eaches
some o he highes le els in he colonic Lamina P op ia o con en ionally
aised mice. Fu he mo e, T eg le els a e educed upon an ibio ic ea men
and a e d ama ically dec eased in GF animals (A a ashi e al., 2011).
Coloniza ion o adul GF mice wi h con en ional mic obio a, o wi h a
combina ion o commensals o he genus Clos idium, can es o e T eg
le els in he colonic Lamina P op ia. O he g oups o bac e ia we e also
shown o induce T eg in mice, like Bac e oides agilis (Round and
Mazmanian, 2010), which is a human commensal, and Lac obacillus
mu inus (Tang e al., 2015).
The le els o IgA-p oducing B cells in he Lamina P op ia o GF mice
a e also g ea ly educed (Hap elmeie e al., 2010). This pheno ype can
also be e e ed by coloniza ion o adul GF mice wi h a con en ional
mic obio a (Gensollen e al., 2016), and could also be achie ed by
monocoloniza ion, wi h he numbe o IgA+ plasma cells being main ained
inc eased in he Lamina P op ia e en a e bac e ia elimina ion
(Hap elmeie e al., 2010).
Chap e 1
23
2.2 - Age dependen e ec s o he mic obio a on he hos
S ong immune esponses o in ec ion usually equi e Th1
di e en ia ion and IFN-γ p oduc ion. In neona es howe e , Th1 esponses
a e usually impai ed. Neona al B cells p oduce high amoun s o IL-10 upon
TLR s imula ion (Walke and Golds ein, 2007; Zhang e al., 2007), which
p e en s DC ac i a ion and IL-12 p oduc ion (Sun e al., 2005). Mu ine
neona al T cells p oduce high le els o IL-4 and IL-13 upon ac i a ion,
which a o Th2 pola iza ion (Zaghouani e al., 2009). Th17 de elopmen is
also impai ed in neona es, since IL-6 s imula ion is essen ial o his ype o
pola iza ion and newly o med T cells (Recen Thymic Emig an s - RTEs)
a e less sensi i e o IL-6 han ma u e T cells (Pai a e al., 2013).
Addi ionally, neona al T cells ha e a highe p opensi y o become T egs
han adul T cells, con e ing in high equency o Foxp3+ T egs upon TCR
s imula ion (Wang e al., 2010). All hese p ope ies make neona es e y
suscep ible o in ec ions, bu a he same ime, hey o e he bes
en i onmen o o ge symbio ic ela ionships h ough he de elopmen o
ole ance. The e o e, he coloniza ion wi h he mic obio a in he neona al
s age shapes he immune sys em o he hos in unique ways.
In GF mice, absence o mic obio a causes accumula ion o in a ian
Na u al Kille T cells (iNKT) wi h a p o-in lamma o y pheno ype in he lung
and in es ine, leading o suscep ibili y o ai way hype esponsi eness and
coli is. Coloniza ion wi h a con en ional mic obio a du ing he i s weeks o
li e, bu no a adul age, could p e en iNKT accumula ion and
suscep ibili y o disease (An e al., 2014; Gensollen e al., 2016; Olszak e
al., 2012). Simila ly, dis u bance o he mic obio a by an ibio ic ea men
ea ly in li e causes inc eased suscep ibili y o In lamma o y Bowel Disease
(IBD) in humans (K onman e al., 2012; Shaw e al., 2010).
24
Ano he pheno ype obse ed in GF mice is a high le el o se um IgE
and inc eased suscep ibili y o An igen-Induced O al Anaphylaxis.
Coloniza ion ea ly in li e wi h a complex mic obio a could e e he hype
IgE pheno ype in GF animals, ye his was no he case i coloniza ion was
pe o med in adul s (Cahenzli e al., 2013).
Speci ic Pa hogen F ee (SPF) mice, which ha e a complex
mic obio a bu a e ee o known pa hogens, show accumula ion o Helios-
Foxp3+ T eg (supposedly con e ed ou side o he hymus) in he lungs in
he i s week o li e, a pheno ype ha was no obse ed in GF animals.
T ea men o SPF neona es o wo weeks wi h an i-PD-L1 could p e en
he Helios- T eg accumula ion in he lungs and inc eased suscep ibili y o
ai way in lamma ion (Gollwi ze e al., 2014). This indica es ha he lung
mic obio a induces he gene a ion o T egs ea ly in li e, which con e s a
long-las ing p o ec i e e ec on he lungs. Fu he mo e, neona al mice
ea ed wi h an ibio ics ha e inc eases suscep ibili y o alle gic as hma la e
in li e, which does no happen i ea men was pe o med in adul animals
(Russell e al., 2012). A simila associa ion be ween ea ly li e an ibio ic
ea men and he isk o as hma de elopmen was also epo ed in humans
(Risnes e al., 2011).
Accumula ion o T egs on he neona al skin has been shown o be
essen ial o he gene a ion o immune ole ance o commensal a his si e.
T egs speci ic o commensal an igens we e ound in high equency in he
skin o newbo n-colonized mice, and shown o p e en expe imen ally
induced skin in lamma ion (Scha schmid e al., 2015). In addi ion, mice
ea ed in he neona al pe iod wi h an ibio ics displayed inc eased
suscep ibili y o expe imen al pso iasis in adul hood (Zan i e al., 2015).
This could be pa ially e e ed by co-housing he ea ed animals wi h non-
ea ed con ols, p o iding e idence ha he dis u bance in he mic obio a
caused he inc eased suscep ibili y o disease.
Chap e 2
31
Abs ac
Helicobac e hepa icus is a pa hobion ha li es in close associa ion
wi h he mouse in es inal epi helium. Despi e abundan e idence ha H.
hepa icus induces a s ong adap i e immune esponse in he mice, he
impac o his esponse on he bac e ia li ing in he gu is la gely unknown,
as well as why his bac e ium is no elimina ed by his esponse. We es ed
i he adap i e immuni y impac s H. hepa icus in he in es ine by colonizing
mice lacking di e en componen s o he adap i e immune sys em, and
e i ying he e ec on he bac e ial numbe s in he gu . We ound ha B and
T lymphocy es impac bac e ial load in he gu , wi h a simila con ibu ion.
An ibodies pa icipa e in his e ec , bu do no accoun o he whole
ou come, which indica es ha T and B cells also con ibu e o bac e ia
elimina ion in an an ibody-independen manne . Absence o IL-10 esul s in
an inc eased esponse, which can lead o bac e ia elimina ion. We
conclude ha IL-10 p omo es he pe sis ence o H. hepa icus in he gu ,
while T and B cells con ol bac e ial numbe s. Ou s udy p o ides new
insigh s in o how lymphocy es con ol bac e ia in he mic obio a and
main ain in es inal homeos asis, which could help in he unde s anding and
p e en ion o gu immunopha ologies.
32
In oduc ion
Some o he la ge amoun o bac e ia in he mic obio a li es in close
associa ion wi h he hos . One o hose is Helicobac e hepa icus, which is
b oadly sp ead in he wild and animal acili ies (Wasimuddin e al., 2012),
and was ound o be associa ed wi h he hos epi helium (Chow and
Mazmanian, 2010). I would be expec ed, hence, ha he hos would
p oduce an immune esponse o a oid uncon olled expansion o his
bac e ium, so close o he su ace o he body. I his esponse exis s,
howe e , i is no s ong enough o elimina e his mic obe, since mice a e
posi i e o li e upon coloniza ion (Solnick and Schaue , 2001; Wasimuddin
e al., 2012; Wha y and Fox, 2006).
I is clea ha H. hepa icus induces a T cell esponse in mice,
pa icula ly in he absence o immune egula ion (Cahill e al., 1997;
Kullbe g e al., 1998), ye he in o ma ion on he gu esponse o his
bac e ium emains limi ed, hough i is known o induce a ecal IgA
esponse (Wha y e al., 1998).
Sec e o y IgA is hough o ac as a ba ie , egula ing he mic obio a
and es ic ing he en ance o in es inal an igens in o he blood (Pabs ,
2012). Some epo s ha e highligh ed he impo ance o IgA on he hos
p o ec ion (Fo bes e al., 2008, 2011; Lycke e al., 1999), and al hough
he e is e idence ha T cell (pa icula ly T egs) a e necessa y o op imal
IgA p oduc ion and homeos asis o he mic obio a (Kawamo o e al., 2014),
o he s ha e claimed ha only pa o he IgA in he gu is T cell-dependen
(Bunke e al., 2015) and ha i only a ge s pa icula g oups o bac e ia in
he gu (Mi pu i e al., 2013).
He e, we sough o unde s and he impac o he immune esponse
on H. hepa icus load in he gu . We ound ha speci ic IgA o H. hepa icus
Chap e 2
33
is T-cell dependen and nega i ely egula ed by IL-10. In he absence o
IgA, speci ic sec e o y IgM is ound in he eces, bu a a much lowe
absolu e concen a ion. B and αβT lymphocy es, oge he wi h IgA, seem o
con ibu e simila ly o H. hepa icus load educ ion, as he la e inc eases
g adually wi h he emo al o each componen sepa a ely. These esul s
e idence how complex and mul ilaye ed he immune esponse o bac e ia
is in he gu .
34
Resul s
Impac o he adap i e immuni y on H. hepa icus in he gu
Mice a e easily colonized wi h H. hepa icus h ough con ac wi h
con amina ed eces, majo ly h ough cop ophagy (Li ings on e al., 1998).
To examine i coloniza ion by his no mal ou e esul s in a speci ic
esponse in he gu , and o es i his esponse a ec s he bac e ia inside
he in es ine, we colonized adul (10 weeks old) B6 WT and Rag2-/- mice by
ga age wi h H. hepa icus-posi i e eces, and e alua ed he bac e ial load in
he eces o hese mice on he cou se o 16 weeks by qPCR. H. hepa icus
coloniza ion occu s in all animals, wi h a peak in bac e ial load be ween 1
and 2 weeks pos -coloniza ion (Fig. 2.1A). Howe e , while he bac e ial
load was conside ably s able in Rag2-/- animals a e his ini ial shi , a
s eady dec ease in bac e ial load was obse ed in WT mice, eaching
le els almos 2 logs lowe han hose in Rag2-/- mice (Fig. 2.1A). This
di e ence was no due o a ia ions in he mic obio a o WT and Rag2-/-
mice, as co-housing o animals o hese wo geno ypes om 4 o 9 weeks
o age be o e coloniza ion p oduced e y simila esul s (Fig. 2.1B). These
da a indica e ha he coloniza ion wi h H. hepa icus induces an adap i e
immune esponse in he mice, and ha his esponse impac s he bac e ia
in he gu .
Chap e 2
35
Figu e 2.1 - Impac o he adap i e immuni y on H. hepa icus in he gu
Adul mice (10 weeks old) WT and Rag2-/-, sepa a ely aised (A) o co-housed o 5
weeks (B), we e colonized wi h H. hepa icus by eces o al ga age. Bac e ial load was
measu ed on eces by qPCR up o 16 weeks pos -coloniza ion, and analyzed as ela i e
abundance = (H. hepa icus 16S / eubac e ia 16S). p < 001, linea eg ession (week 1 -
16). Colo ed do s = indi idual mice, whi e ci cles = mean, e o ba s = SEM, do ed line =
linea eg ession om 1-16 weeks, shade = linea eg ession con idence in e al. N = 10
pe g oup, pooled om wo independen expe imen s. ND = no de ec ed.
36
Impac o T cells on he esponse o H. hepa icus
Because i is known ha H. hepa icus induces a po en T cell
esponse in he gu (Cahill e al., 1997), and ha his esponse is e en
s onge in he absence o IL-10 (Kullbe g e al., 1998), we nex es ed he
impac o he T cell esponse on H. hepa icus in he in es ine using mice
de icien in ei he αβT cells (TCRβ-/-) o IL-10 (IL-10-/-). We obse ed a
highe H. hepa icus load in he absence o T cells, compa ed o WT mice,
bu s ill lowe han he le els in Rag2-/- mice (Fig. 2.2A). Acco dingly, he
esponse in IL-10-/- mice had a la ge e ec on he H. hepa icus load, wi h
le els d opping below he de ec ion limi in mos o he animals a e 11
weeks o coloniza ion (Fig. 2.2A). Taken oge he , hese esul s e idence
ha T cells play a key ole in he elimina ing esponse o H. hepa icus in he
gu .
WT mice displayed high i e s o an i-H. hepa icus IgA on eces
h oughou he coloniza ion (Fig. 2.2B), and his IgA was able o bind o he
su ace o li e H. hepa icus (Fig. S2.6), hence sugges ing ha i can a ec
he bac e ia in he gu . Meanwhile, IL-10-/- mice showed ecal IgA i e s
almos 2 logs highe han WT (Fig. 2.2B), which co ela ed wi h he H.
hepa icus load educ ion (Fig. 2.2D). Con e sely, speci ic IgA was almos
absen in animals lacking T cells, showing ha he induc ion o an i-H.
hepa icus mucosal IgA is T cell dependen (Fig. 2.2B). An inc ease o
abou 1 log in o al ecal IgA p oduc ion was seen in WT and IL-10-/-
animals 1 week a e coloniza ion, bu also in TCRβ-/- wi h a delay (Fig.
2.2C). This was co ela ed wi h he le els o lipocalin-2 (lcn-2), a bioma ke
o in lamma ion in he gu , in IL-10-/- and TCRβ-/- mice, bu no in WT
animals (Fig. 2.2E and F and Fig. S2.5A). Lcn2 le els did no co ela e
wi h he educ ion in H. hepa icus le els in he gu (Fig. S2.5C) o wi h
speci ic IgA le els (Fig. S2.5B), sugges ing ha he in lamma ion igge ed
by H. hepa icus is sepa a ed om he esponse a ge ing his bac e ia.
Chap e 2
37
Figu e 2.2 - Impac o αβT cells and IL-10 on he esponse o H. hepa icus
38
Fig.2.2 - Impac o αβT cells and IL-10 on he esponse o H. hepa icus
A) Adul mice (10 weeks old) TCRβ-/- and IL-10-/- we e colonized wi h H. hepa icus by
eces o al ga age. Bac e ial load was measu ed on eces by qPCR as desc ibed in
Fig.1. WT and Rag2-/- load (same as in Fig.1 A) is shown o compa ison. G oups wi h
he same le e a e no signi ican ly di e en a p = 0.05 (pai wise compa isons o
linea eg essions, p alues co ec ed using single-s ep me hod). Colo ed do s =
indi idual mice, whi e ci cles = mean, e o ba s = SEM, do ed line = linea eg ession
om 1-16 weeks, shade = linea eg ession con idence in e al. N = 10 pe g oup,
pooled om wo independen expe imen s. B and C) An i-H. hepa icus IgA i e (B)
and o al ecal IgA (C) we e e alua ed by ELISA on WT, TCRβ-/- and IL-10-/- mice
shown in A, om 0 – 16 weeks pos -coloniza ion. S a is ical compa ison was
pe o med using A ea Unde he Cu e (AUC), calcula ed pe mice wi h apezoid
me hod and a e aged pe week. G oups wi h he same le e a e no signi ican ly
di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). Colo ed do s = indi idual mice,
whi e ci cles = mean, e o ba s = SEM, do ed line = local polynomial eg ession
i ing (loess), shade = loess con idence in e al. D) Compa ison o speci ic IgA i e s
and bac e ial load in mice shown in A. Colo ed do s = indi idual samples, line = linea
eg ession, shade = linea eg ession con idence in e al, p alue and R2 o he linea
eg ession shown on he g aph. E and F) Fecal Lipocalin-2 le els we e e alua ed by
ELISA in he eces o he mice shown in A, om 0 – 16 weeks pos -coloniza ion (2 –
16 weeks o Rag2-/- mice). E) whi e ci cles = mean, e o ba s = SEM, lines connec
he means. F) Do s ep esen indi idual mice. G oups wi h he same le e a e no
signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). AUC = A ea
Unde he Cu e, calcula ed pe mice wi h apezoid me hod and a e aged pe week.
G and H) An i-H. hepa icus se um Ig i e (G) and o al se um Ig concen a ion (H)
we e measu ed in WT, TCRβ-/- and IL-10-/- mice shown in A, a 16 weeks pos -
coloniza ion. Do s ep esen indi idual mice, g oups wi h he same le e a e no
signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion).
Chap e 2
39
Analysis a 16 weeks pos -coloniza ion showed high i e s o an i-H.
hepa icus IgG and IgA in he se um o WT and IL-10-/- animals, sugges ing
ha his bac e ium c osses he in es inal ba ie , elici ing a sys emic
immune esponse (Fig. 2.2G). Simila ly o he mucosal esponse, speci ic
IgA le els we e highe in IL-10-/- animals compa ed o WT, bu no IgG,
sugges ing ha IL-10 could impac speci ically he IgA p oduc ion. Simila
le els o speci ic IgM we e ound in WT, IL-10-/- and TCRβ-/- mice, bu
speci ic IgG and IgA we e no ound in he la e (Fig. 2.2G). To al
Immunoglobulin le els we e simila be ween he g oups analyzed, wi h a
small inc ease in o al IgA le els in IL-10-/- mice (Fig. 2.2H).
40
Role o B cells and IgA on he esponse o H. hepa icus
Gi en he nega i e co ela ion be ween he IgA esponse and H.
hepa icus load, we es ed i he esponse o H. hepa icus would be a ec ed
by he emo al o an ibodies om he sys em, using mice de oid o B cells
(JhT-/- mice), o by only emo ing IgA, using AID-/- mice (which can’
pe o m class-swi ch ecombina ion, hence only IgM can be p oduced). In
he absence o B cells he H. hepa icus ecal load was highe han in WT
animals, bu lowe han in Rag2-/- (Fig. 2.3A), sugges ing ha B cells
impac he bac e ial load, bu do no accoun o he whole e ec .
In e es ingly, he absence o IgA in AID-/- esul s in an in e media e
pheno ype be ween he B cell de icien and WT (Fig. 2.3A), indica ing ha
IgA a ec s he bac e ial load bu also ha B cells ha e o he e ec s
besides an ibody p oduc ion, since he IgM le els, speci ic and o al, we e
e y low in AID-/- a e coloniza ion (Fig. 2.3B and C). Fecal lcn-2 le els in
JhT-/- and AID-/- (Fig. 2.3D) we e e y simila o he alues ound in WT
mice (Fig. 2.2E), indica ing no e iden inc ease in gu in lamma ion.
To di ec ly es he impac o sec e ed an ibodies on he bac e ial
load, excluding any possibly e ec o IgM in AID-/- mice, we used AID-/-uS-/-
animals, which ha e B cells bu canno sec e e an ibodies. We ound ha
he H. hepa icus ecal le els we e highe in AID-/-uS-/- mice compa ed o
WT, bu lowe han hose in Rag2-/- mice (Fig. 2.4A). To con i m his e ec ,
we analyzed he H. hepa icus mucosal load in he ileum and colon o he
same mice, a e 20 weeks o coloniza ion. No di e ence be ween he
g oups was obse ed in he ileum, whe e H. hepa icus was ound in lowe
equencies (Fig. 2.4B). Howe e , he bac e ial load eached high le els in
he colon o Rag2-/- animals, abou 2 logs highe han in WT mice, wi h
in e media e alues in AID-/-uS-/- (Fig. 2.4B). These da a show ha sec e ed
an ibodies can impac di ec ly he bac e ial load in he gu , bu do no
accoun o he whole e ec .
Chap e 2
47
Helicobac e hepa icus quan i ica ion
The ollowing p ime s we e used in qPCR eac ions: H. hepa icus 16S
wd: GCATTTGAAACTGTTACTCTG, H. hepa icus 16S e :
CTGTTTTCAAGCTCCCCGAAG, 417bp p oduc (Pe nicki-Ocwieja e al.,
2009); Eubac e ia 16S wd: ACTCCTACGGGAGGCAGCAGT, Eubac e ia
16S e : ATTACCGCGGCTGCTGGC, ~180bp p oduc , 18S wd:
CATTCGAACGTCTGCCCTAT, 18S e : CCTGCTGCCTTCCTTGGA,
137bp p oduc (Vaishna a e al., 2011). H. hepa icus (Hh) 16S copy
numbe was es ima ed using plasmid s anda d cu e, o al bac e ia (eubac)
16S copy numbe was es ima ed using a s anda d cu e cons uc ed wi h
E. coli K12 DNA, and hos DNA amoun in ng was es ima ed using a
s anda d cu e cons uc ed wi h in es inal issue DNA. All eac ions
con ained s anda d cu es o absolu e quan i ica ion. Fecal H. hepa icus
amoun is exp essed as log10 o he a io Hh 16S copies/ eubac 16S copy.
Mucosal H. hepa icus amoun is exp essed as log10 o he a io Hh 16S
copies/ ng o hos DNA. DNA om ecal pelle s o ~40mg (a e age 40.2mg
± 10.3, measu ed om 100 samples) and om in es inal issue (3 cm piece
o ileum and colon, a e washing luminal con en wi h PBS) was ex ac ed
using NZYTech Tissue gDNA ex ac ion ki (NZYTech), wi h an ini ial s ep
a 95°C. Fo quan i ica ion, 2ng o ecal DNA and 10ng o mucosal DNA
we e used. P ime s we e used a 0.5µM in he eac ion, con aining 5µL o
iTaq Uni e sal SYBR G een Supe mix (Bio-Rad), 2µL o sample and wa e
o a inal olume o 10µL. qPCR condi ions: 95°C - 3min; 45 cycles o 95°C
- 30s, 60°C - 30s, 72°C - 36s; ollowed by a mel ing cu e o 65 - 95°C wi h
0.5°C inc ease e e y 5s. All eac ions we e p epa ed in 384 well ha d shell
pla es (Bio-Rad), on ice, in less han one hou , o minimize p ime dime
o ma ion, and un immedia ely a e p epa a ion on a CFX384 eal- ime
PCR de ec ion sys em (Bio-Rad).
48
To al and speci ic Immunoglobulin quan i ica ion by ELISA
To quan i y o al and H. hepa icus speci ic ecal an ibodies, ecal
ex ac s we e p epa ed om eshly collec ed o -80°C s o ed eces. Fecal
pelle s o ~50mg we e collec ed om each mice (a e age 56.6mg ± 15.4,
measu ed om 100 samples), and homogenized in 500µL o PBS
con aining a p o ease inhibi o cock ail (P8340, Sigma-Ald ich), o a
solu ion o abou 100mg/mL. Homogena es we e cen i uged a 16,000G
o 10min a oom empe a u e, and supe na an s we e s o ed a -20°C
un il u he use.
Soluble H. hepa icus an igens (SHelAg) we e p epa ed as p e iously
desc ibed (Kullbe g e al., 1998). A e cul u ed o 5 days in blood-aga
pla es, bac e ia we e ha es ed in PBS solu ion, washed and lysed in a
F ench P ess. The solu ion was cen i uged a 8,000G o 30 min a 4°C,
he supe na an was il e ed s e ile wi h a 0.22µm po e size il e and
p o ein con en was de e mined using BCA p o ein assay. The p epa a ion
was s o ed a -80°C.
ELISA was pe o med using high binding 384 well ELISA pla es
(Ul aC uz). Fo o al Ig quan i ica ion, pla es we e coa ed wi h Goa an i-
Mouse IgM, IgG o IgA polyclonal an ibodies (Sou he n Bio ech), and o
an i-H. hepa icus Ig quan i ica ion, coa ing was done using 10µg/mL o
SHelAg. Pla es we e coa ed o e nigh a 4°C, washed in PBS 0.05%
Tween20 and blocked wi h 2% BSA solu ion in PBS. Fecal ex ac s we e
added undilu ed (speci ic Ig) o 10 old dilu ed ( o al Ig) o pla es and dilu ed
7 imes, 3 old each ime. Fo speci ic ecal IgA quan i ica ion, a e e ence
sample pooled om 5 adul colonized B6 was used in all assays. Fo
speci ic se um IgM, IgG and IgA, a e e ence se um sample o colonized IL-
10-/- dilu ed 1:210 was used in all assays. A e o e nigh incuba ion a 4°C,
pla es we e washed in PBS 0.05% Tween20 and incuba ed wi h Goa an i-
Chap e 2
49
Mouse IgM, IgG o IgA conjuga ed wi h HRP. Reac ions we e e ealed wi h
TMB (BD) and s opped wi h 0.1M H2SO4.
Fecal Lipocalin-2 quan i ica ion
Quan i ica ion o ecal Lipocalin-2 was pe o med on ecal ex ac s,
ob ained as desc ibed abo e, using he ki manu ac u e ins uc ions
(Mouse Lipocalin-2/NGAL DuoSe ELISA, ca alog numbe : DY1857, R&D).
IgA FACS on li e H. hepa icus
H. hepa icus was cul u ed as desc ibed abo e, and 106 CFU we e
used pe assay. Bac e ia was washed once in PBS, pelle ed (12,000G,
5min), esuspended in ecal ex ac (p epa ed as desc ibed o ELISA
assay) om naï e o 16 weeks colonized Adul B6 mice, and incuba ed on
ice o 30min. Bac e ia we e hen washed in PBS and incuba ed o 15min
on ice wi h Goa an i-Mouse IgA (Sou he n Bio ech), labeled using
Alexa647 Labeling Ki (The mo Fishe Scien i ic). The bac e ia was washed
again and esuspended in a PBS solu ion con aining 5µM o SYTO 9
(Molecula P obes). E en s we e acqui ed on a CyAn ADP Analyze
(Beckman Coul e ) and analyzed on FlowJo So wa e (T ee S a ). Analysis
was pe o med ga ing on li e bac e ia, which we e SYTO 9 B igh , as
con i med by coun e s aining wi h 45µM o p opidium iodide (Molecula
P obes), and excluding e en s wi h high pulse wid h.
Da a analysis
Da a and s a is ical analysis we e pe o med using R so wa e e sion
3.2.5 (R Co e Team, 2014). Mul iple compa isons we e done using K uskal-
Wallis and Mann–Whi ney–Wilcoxon es wi h he Benjamini and Hochbe g
p alue co ec ion. Mul iple compa isons o linea eg essions we e
pe o med using linea model and he unc ion glh (Gene al linea
hypo heses and mul iple compa isons), using single-s ep p ocedu e o p
50
alue co ec ion, in package mul comp (Ho ho n e al., 2008). G aphs we e
made in R so wa e using he package ggplo 2 (Wickham, 2009).
Chap e 2
51
Supplemen a y Ma e ial o Chap e 2
Figu e S2.1 - To al 16S le els in ecal DNA a e H. hepa icus coloniza ion
(complemen a y o Figu es 2.1A, 2.2A and 2.3A).
To al 16S (quan i ied using p ime s ha ecognize a conse ed egion in all
bac e ia 16S) in DNA ex ac ed om eces o mice o he indica ed geno ype om
0 – 16 weeks pos -coloniza ion wi h H. hepa icus. To al 16S alues we e used o
no malize he numbe o H. hepa icus 16S p esen ed as ela i e abundance in
igu es 2.1A, 2.2A and 2.3A. Do s = indi idual mice, whi e ci cles = mean, e o
ba s = SEM, do ed line = o e all mean, shade = o e all s anda d de ia ion. N = 10
o WT, Rag2-/-, TCRβ-/- and IL-10-/-, N = 9 o JhT-/- and AID-/-, pooled om wo
independen expe imen s.
52
Geno ype
In e cep
slope
Signi icance
codes*
(p=0.05)
es ima e SE es ima e SE
Rag2-/-
-2.764
0.166
-0.026
0.017
a
TCRβ-/-
-3.550
0.166
0.002
0.017
b
JhT-/-
-3.351
0.171
-0.017
0.017
b
AID-/-
-3.618
0.171
-0.035
0.017
c
WT
-3.355
0.118
-0.097
0.012
d
IL-10-/-
-3.786
0.170
-0.183
0.019
e
Mul iple R-squa ed: 0.53 ; Adjus ed R-squa ed: 0.52
*g oups wi h he same le e a e no di e en a he signi icance le el
Table S2.1 - Linea eg ession coe icien s (Fig 2.2A and Fig 2.3A)
Figu e S2.2 - Linea eg ession esiduals plo (Fig 2.2A and Fig 2.3A)
Chap e 2
53
Geno ype
In e cep
slope
Signi icance
codes*
(p=0.05)
es ima e SE es ima e SE
Rag2-/-
-2.948
0.211
-0.041
0.030
a
AID-/-uS-/-
-3.492
0.156
-0.067
0.018
b
WT
-3.823
0.110
-0.085
0.013
c
Mul iple R-squa ed: 0.52 ; Adjus ed R-squa ed: 0.51
*g oups wi h he same le e a e no di e en a he signi icance le el
Table S2.2 - Linea eg ession coe icien s (Fig 2.4A)
Figu e S2.3 - Linea eg ession esiduals plo (Fig 2.4A)
54
Figu e S2.4 – Rep esen a i e indi idual plo s (Fig 2.2A and Fig 2.3A)
Indi idual plo s o H. hepa icus ecal load om 1 – 16 weeks o coloniza ion in 3
ep esen a i e mice om each geno ype in igu es 2.2A and 2.3A. Do ed line = linea
eg ession, shade = linea eg ession con idence in e al.
Chap e 2
55
Figu e S2.5 – Lipocalin-2 co ela ion o IgA and load (complemen a y o Fig. 2.2)
Indi idual samples om mice o he indica ed geno ypes om 0-16 weeks (A and B) and
om 1-16 weeks (C). Blue line = linea eg ession, shade = linea eg ession con idence
in e al, p alue and R2 o he linea eg ession indica ed on he g aphs.
56
Figu e S2.6 – IgA om colonized mice binds o he su ace o H. hepa icus
FACS analysis o li e H. hepa icus ( om cul u e), s ained wi h SYTO9 (nucleic acid
s aining, memb ane pe meable) (A) o SYTO9 + an i-mouse IgA (B), o p e-incuba ed
wi h ecal ex ac ( .e.) om naï e (C) o 16 weeks colonized Adul B6 WT mice (D)
be o e s aining wi h SYTO9 + an i-mouse IgA. E en s shown we e ga ed on SYTO9
b igh (li e) e en s wi h low pulse wid h.
Chap e 3
63
Figu e 3.1 - Mo he o pup ansmission con e s long-las ing ole ance o H.
hepa icus
A) Adul B6 mice (10 weeks old) we e colonized wi h H. hepa icus by ga age wi h
posi i e eces. Newbo n coloniza ion was achie ed na u ally by mo he o pup
ansmission, which happens in he i s days o li e. B) H. hepa icus mucosal load in he
ileum and colon o Adcol and Nbcol mice was assessed by Q-PCR using H. hepa icus
16S speci ic p ime s, no malized o hos DNA (measu ed using 18S speci ic p ime s).
G oup – N.( ime o coloniza ion): Adcol – 4.(13w), 5.(26w); Nbcol – 6.(13w), 4.(17w),
2.(18w). * p < 0.05 (Wilcoxon es ). C – D) An i-H. hepa icus and o al ecal IgA we e
analyzed by ELISA in he eces o Adcol (C) and Nbcol (D) mice a 4 and 16 weeks pos -
coloniza ion. Do s ep esen measu emen s and lines connec dilu ions o he same
sample. Adcol N = 10 in bo h poin s, Nbcol N = 6 a 4w and N = 5 a 16w. E) An i-H.
hepa icus ecal IgA i e s in Adcol and Nbcol mice a indica ed ages we e es ima ed by
ELISA. Whi e symbol = mean. E o ba = SEM. Adcol: N = 10 om 10 - 26w o age.
Nbcol - N.(age): 6.(4w), 11.(5w), 24.(6w), 16.(7w), 10.(9w), 10.(10w), 10.(12w), 3.(13w),
5.(16w), 10.(22w), 10.(34w)
64
esponse, and ha his esponse is inhibi ed in animals colonized ea ly in
li e.
The age bu no he mode o p imo-exposu e o H. hepa icus
condi ions he hos esponse
Low dose and ch onic exposu e o o eign an igens has been
p oposed o p omo e Immune ole ance, by inducing T cell ane gy,
exhaus ion o di e en ia ion in o T eg. I is concei able ha pups o H.
hepa icus colonized mo he s a e con inuously inges ing low numbe o H.
hepa icus o ganisms, while ou p o ocol o gas ic ga age would deli e
suddenly a la ge numbe o H. hepa icus in adul s. To add ess his
disc epancy we i s colonized adul mice wi h i a ed amoun s o H.
hepa icus-posi i e ecal p epa a ions. The inoculum used in igu e 1
con ained abou 106 CFU (es ima ed by Q-PCR and cul u e) and se ial
dilu ions e ealed ha as long as he inoculum con ained an es ima ed 100
CFU (10,000x dilu ion), SPF mice could be colonized wi h H. hepa icus
(Fig. S3.3), indica ing absence o coloniza ion esis ance. Mo e impo an
o his s udy, adminis a ion o an es ima ed 100CFU by o al ga age o
adul mice led o eadily de ec able H. hepa icus speci ic IgA in he eces
wi h i e s in he ange o 101-102 a 4 weeks pos -coloniza ion (Fig. 3.2A),
simila o hose ob ained wi h undilu ed inoculum (Fig. 3.1E). Then, we
pe o med gas ic ga age in newbo n SPF animals using inoculum
es ima ed a 2x105 CFU (20ul o an undilu ed ecal p epa a ion). To u he
gain insigh on he ime window when immune ole ance a he han
esponse ollows exposu e o H. hepa icus, pups we e inocula ed a
di e en ages, om 1 o 4 weeks o age (Fig. 3.2B). Success ul
coloniza ion was con i med by qPCR 10 weeks pos -inocula ion (Fig. S3.4).
S ikingly, in a-gas ic ga age ep oduced mo he ansmission as pups
inocula ed be o e 3 weeks o age did no de elop high le els o ecal H.
hepa icus-speci ic IgA (Fig. 3.2C and D). In con as , pas his age,
Chap e 3
65
inocula ion led o eadily de ec able immune esponses as indica ed by H.
hepa icus speci ic IgA i e app oxima ing, albei lowe han, hose ob ained
in Adcol animals (Fig. 3.2C and 3.1E ). The g oup o mice inocula ed a 3
weeks o age was he e ogeneous, wi h some animals un esponsi e and
o he s esponsi e (Fig. 3.2C). We conclude ha i espec i e o he mode o
Figu e 3.2 - The age bu no he mode o p imo-exposu e o H. hepa icus condi ions
he hos esponse
A) Adul (9w old) B6 we e ga aged wi h a eced p epa a ion om H. hepa icus posi i e
animals, dilu ed 10,000x in PBS. Mice we e con i medly posi i e o H. hepa icus 7 days
a e ga age. 4 weeks a e coloniza ion, eces we e analyzed o an i-H. hepa icus and
To al IgA by ELISA. N = 4. B - D) Mice a 1-4 weeks o age we e colonized wi h H.
hepa icus by eces o al ga age. 10 weeks a e coloniza ion, eces we e analyzed o
an i-H. hepa icus and To al IgA by ELISA. N = 8, 13, 9 and 8 espec i ely. G oups wi h
he same le e a e no signi ican ly di e en a p = 0.05
66
ansmission and he inoculum load, mice in ec ed ea ly in li e de elop long
las ing immune ole ance o H. hepa icus , and ha he ansi ion om non-
esponde o esponde s a e occu s a ound weaning age, possibly lagging
o se e al weeks be o e ull compe ence.
Nei he ma e nal an ibodies no he mic obio a a e equi ed o
pe ina ally induced ole ance o H. hepa icus
Weaning is associa ed wi h he end o ma e nal an ibody supply and
a die change leading o majo al e a ions in he mic obiome composi ion.
We nex add essed whe he hese changes we e ela ed o he
physiological swi ch we e idenced abo e. To p oduce immune-compe en
animals bo n o an ibody-de icien dams, young adul Rag2-/- emales we e
colonized wi h H. hepa icus by in a-gas ic ga age, and ma ed wi h WT
males. Con ols we e bo n o WT mo he s also colonized as adul s. The
p ogenies we e moni o ed when adul s, om 6 o 18 weeks o age.
Analysis o eces ex ac con i med animals we e H. hepa icus posi i e and
showed ha while hey displayed no mal o al IgA concen a ion, none
p oduced H. hepa icus speci ic IgA (Fig. 3.3A), demons a ing ha
ma e nal an ibodies a e dispensable o he induc ion o long las ing
ole ance o H. hepa icus in newbo ns. To es he con ibu ion o he
mic obio a o he hos esponsi eness o H. hepa icus, adul WT ge m- ee
mice we e mono-colonized wi h cul u ed H. hepa icus, con i med posi i e,
and ei he le o age, o se in b eeding o p oduce p ogenies mono-
colonized a bi h. Analysis a 9 weeks pos coloniza ion e ealed ha he
mic obio a is dispensable o obus an i-H. hepa icus speci ic IgA
p oduc ion in animals ha had been monocolonized when adul s, and o
long las ing ole ance induc ion and main enance in animals ha had been
mono-colonized pe ina ally (Fig. 3.3B - C). We conclude ha induc ion o
immune ole ance upon p imo-in ec ion wi h H. hepa icus is a newbo n
in insic ea u e. In u n, his inding sugges s ha he main enance o such
Chap e 3
67
immune ole ance in o adul age is an in insic p ope y o he immune
sys em.
Figu e 3.3 - Nei he ma e nal an ibodies no he mic obio a a e equi ed o
pe ina ally induced ole ance o H. hepa icus
A) Adul WT and Rag2-/- emales we e colonized wi h H. hepa icus and b ed o WT
males. Pups om hese b eedings we e analyzed a 6, 12 and 18 weeks o age o an i-
H. hepa icus and To al IgA by ELISA. N=10, 10 and 5 o WT mo he a he indica ed
ages, and N=12 o Rag2-/- mo he a all he ime poin s. B - C) Adul ge m- ee mice
we e colonized wi h pu e H. hepa icus cul u e and analyzed 9 weeks la e .
Monocolonized mice we e b ed o p oduce Newbo n-colonized pups, which we e
analyzed a 9 weeks o age. An i-H. hepa icus and To al IgA we e assessed by ELISA.
Adul : n = 9; Newbo n: n = 15. * p < 0.05 (Wilcoxon es ).
68
Long las ing immune ole ance o H. hepa icus upon mo he o pup
ansmission is T eg media ed
The esul s abo e, indica ing ha he e y long las ing immune
ole ance o he pe sis en pa hobion H. hepa icus upon pe ina al exposu e
is a hos in insic p ope y, e oked ei he immunological igno ance o
obus ly con olled immuni y. Bo h he immunosupp essi e cy okine IL-10
and T eg cells a e igge ed upon adul exposu e o H. hepa icus (Be g e
al., 1996; Kullbe g e al., 2002; Rub so e al., 2008), ye as shown he e,
hey do no p e en an immune esponse o his bac e ia. We easoned
hese pa hways may be mo e obus ly ec ui ed du ing pe ina al li e, and
es ed he ole o hese componen s by loss o unc ion app oaches. IL10-/-
newbo n-colonized mice we e analyzed om 4 o 15 weeks o age. An i-H.
hepa icus IgA was e iden in eces o Nbcol IL-10-/- mice al eady a 5 weeks
o age, wi h a con inuous inc ease a e ha (Fig. 3.4A). To al ecal IgA was
also inc eased In Nbcol IL-10-/- mice wi h age (Fig. S3.5A). Analysis o
ecal H. hepa icus load in hose mice showed a con inuous dec ease in H.
hepa icus numbe s wi h age (Fig. S3.5B), and al hough hey had dia hea
h ough he cou se o he analysis, hei weigh inc eased con inuously
(Fig. S3.5C). These esul s indica e ha IL-10 is equi ed o he induc ion
and/o main enance o immune ole ance o H. hepa icus. In ac , we ound
ha 10 weeks old Nbcol WT mice ha ecei ed 4 weekly 1mg doses o
an i-IL-10R an ibody s a ed p oducing low le els o an i-H. hepa icus IgA
10 weeks a e he beginning o ea men , unlike un ea ed li e ma e
con ols (Fig. S3.11), co obo a ing he idea ha IL-10 is in ol ed in he
main enance o his ole ance. Addi ionally, hese indings exclude nega i e
selec ion as a mechanism o explaining he lack o esponse in pe ina ally
colonized mice, indica ing ha ac i e ole ance a he han igno ance
media es his e ec .
Chap e 3
69
Figu e 3.4 - Long las ing immune ole ance o H. hepa icus upon mo he o pup
ansmission is T eg media ed
A) An i-H hepa icus ecal IgA was analyzed by ELISA om 4 o 15 weeks o age in IL10-/-
newbo n colonized mice. N=14. Linea model: y~log(x), line = eg ession, shade =
con idence in e al; eg ession coe icien : p < 0.01; R2 = 0.63; F s a is ic: p < 0.01. B)
Adul WT mice, newbo n colonized wi h H. hepa icus, we e injec ed one ime i.p. wi h
PBS o 500μg o an i-CD25 (PC61 clone). An i. H. hepa icus ecal IgA was assessed a 0,
4 and 8 weeks pos - ea men (12, 16 and 20 weeks o age). PBS: n=5; an i-CD25: n=6.
Line = linea eg ession, shade = con idence in e al; g oup compa ison: p < 0.01;
mul iple R2 = 0.58; F s a is ic: p < 0.01. Rep esen a i e o wo independen expe imen s.
C) B6 WT and DEREG (Foxp3-DTR) mice colonized a bi h ecei ed 1μg o Diph he ia
Toxin (DT) i.p. a 6 weeks o age, and ecal IgA i e s we e measu ed by ELISA on he
indica ed ages. N(weeks): WT+DT = 6(6), 19(9-10); DEREG+DT = 9(6), 24(9-10), pooled
om 2 independen expe imen s. Line = linea eg ession, shade = con idence in e al;
g oup compa ison: p < 0.01; mul iple R2 = 0.49; F s a is ic: p < 0.01. D) F equency o
TCRβ+ CD4+ Foxp3+ cells in he la ge in es ine lamina p op ia o adul WT mice ei he
SPF, o colonized wi h H. hepa icus when adul o a bi h. n=6 pe g oup. G oups wi h
he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es ).
70
To add ess he ole o CD4 egula o y T cells in he main enance o
immune ole ance o H. hepa icus, we i s adminis a ed, in a single
injec ion, he deple ing an i-CD25 an ibody (PC61) o young adul mice ha
had been colonized a bi h. This p ocedu e deple es mo e han 50% o
T egs in he in es ine and lymphoid issues (Wang e al., 2015; Zelenay and
Demengeo , 2006). An i-H. hepa icus speci ic IgA could be de ec ed in he
eces o he ea ed mice a 4 and 8 weeks pos -injec ion, bu no in
un ea ed con ols (Fig. 3.4B). These esul s indica e ha immune
esponses in animals ha had been colonized a bi h a e main ained a
check by a CD25 exp essing cellula subse . As CD25 is exp essed by a
la ge subse o T eg bu also by ecen ly ac i a ed T cells and some B cells,
we nex analyzed animals gene ically enginee ed o exp ess he diph he ia
oxin (DT) ecep o speci ically in Foxp3+ cells (Foxp3-DTR / DEREG).
Newbo n-colonized WT and DEREG mice we e ea ed wi h one injec ion o
1µg DT a 6 weeks o age. This ea men leads o a ansien bu
subs an ial dec ease in Foxp3+ cell numbe s in he mucosal compa men
al eady a 2 days pos -injec ion (Fig. S3.7), and caused a apid appea ance
o an i-H. hepa icus IgA in eces o DEREG mice om 1 o 4 weeks pos
ea men , bu no in WT li e ma e con ols (Fig. 3.4C). To al ecal IgA was
ansien ly inc eased in DEREG mice 1 week a e ea men (Fig. S3.6A),
and H. hepa icus load was sligh ly bu signi ican ly dec eased in he
mucosa o he ileum and colon o DEREG mice 9 weeks a e he single
ea men (Fig. S3.6B). Toge he hese da a indica e ha p imo-exposu e
du ing pe ina al li e leads o a e y obus ole ogenic immune esponse,
ensu ed by he ec ui men o Foxp3+ T eg ha supp ess, in an IL-10
dependen manne , o he wise ully compe en e ec o s cells. Indeed,
Foxp3+ cell equency was signi ican ly inc eased in he colonic Lamina
P op ia o Nbcol mice, compa ed o SPF and Adcol mice, all analyzed a
adul age (Fig. 3.4D). Finally, we es ed i TLR2 was in ol ed in he H.
hepa icus induced ole ance, as i has been shown o be in ol ed in
Chap e 3
71
mic obial induced T egs in he gu (Round e al., 2011). TLR2-/- mice
Newbo n-colonized wi h H. hepa icus did no moun a de ec able an i-H.
hepa icus IgA esponse when adul s, indica ing H. hepa icus p omo es T eg
in a TLR2 independen manne (Fig. S3.8). Taken oge he , hese esul s
es ablish ha H. hepa icus immune e asion elies on he induc ion o T eg,
a mechanism obus ly a o ed by he newbo n physiological s a e and sel -
pe pe ua ed along hos ma u a ion, beyond ep oduc i e age.
Tole ance o H. hepa icus does no a ec he heal h o he hos
Because H. hepa icus was ound in highe equency in he colon o
Nbcol mice (Fig. 3.1B), which does no seem o moun a esponse o his
bac e ia, we checked i he e was indica ion o H. hepa icus ansloca ion o
hos issues, analyzing he numbe o H. hepa icus 16S copies eco e ed in
he Mesen e ic Lymph nodes (MLN) and gallbladde DNA ex ac s om
Adcol and Nbcol mice. This analysis indica ed ha H. hepa icus seems o
ansloca e a a simila equency o he MLN o Adcol and Nbcol mice, bu
H. hepa icus DNA was ound mo e equen ly in he gallbladde o Nbcol
mice (Fig. 3.5A). Addi ional analysis e ealed high i e s o an i-H.
hepa icus IgM, IgG and IgA in he se um o Adcol mice, wi h inc eased
le els o o al IgM and IgG (Fig. 3.5B and C). In con as , Nbcol mice had
le els o speci ic IgM simila o hose o naï e mice (SPF), which sugges
hese we e no induced bu a he na u al IgM (Fig. 3.5B). An i-H. hepa icus
IgA was no de ec ed in he se um o Nbcol mice, as wells as in naï e mice,
in acco dance o wha was ound o IgA in he gu (Fig. 3.1E). An i-H.
hepa icus IgG was ound in he se um o Nbcol mice, albei a le els mo e
han 10 old lowe han hose o Adcol mice. Collec i ely, hese esul s
sugges ha pe ina al coloniza ion wi h H. hepa icus induces no only
mucosal bu also sys emic ole ance. Ne e heless, despi e inc eased H.
hepa icus accumula ion, Nbcol mice did no p esen a se ological s a e
indica i e o pa hology, wi h no mal le els o AST and ALT (Fig. 3.5D),
72
simila o Adcol and SPF mice, wi h he same being ue o o he
se ological pa ame e s (Fig. S3.9A). Likewise, ecal alues o Lipocalin-2,
which a e inc eased in he ace o gu pa hology, we e no mal in Nbcol
mice, simila ly o SPF and Adcol mice (Fig. 3.5E). Also, induc ion o coli is
using DSS showed no di e ence be ween hese g oups in suscep ibili y o
gu in lamma ion (Fig. 3.5F and Fig. S3.9B). Taken oge he , hese s udies
allow us o conclude ha ole ance o H. hepa icus does no a ec
nega i ely he hos .
Chap e 3
79
Nbcol mice, bu hese mice had no e iden signs o li e o o he pa hology
(Fig. 3.5D and Fig. S3.9A). These da a sugges ha he ole ance o H.
hepa icus happens also in a sys emic le el, p e en ing exace ba ed T-cell
eac ions inside he body.
The capaci y o he mice o become ole an o H. hepa icus
dec eases wi h age, as coloniza ion om 3 weeks onwa ds esul s in
speci ic IgA p oduc ion in adul hood (Fig. 3.2C and D). This could be
explained by epo s ha neona al T cells a e mo e p one o become T egs,
a ea u e ha dec eases a e 2 weeks o age (Wang e al., 2010).
Fu he mo e, Recen Thymic Emig an s (RTEs), which a e he p e e en ial
p ecu so s o T egs di e en ia ed in he pe iphe y (Pai a e al., 2013), a e
inc eased in he lymphoid o gans o neona es and dec ease p og essi ely
wi h age (Hale e al., 2006). The e o e, H. hepa icus seems o explo e an
in insic p opensi y o neona al mice o become ole an , inducing ea ly high
le els o T egs ha will la e supp ess esponses o hese bac e ia.
Likewise, i was ound ha lung mic obio a induce T egs in he i s 2 weeks
o age in mice, wi h implica ions o alle gen ole ance (Gollwi ze e al.,
2014), ha T egs speci ic o mic obial an igens can be induced in he skin
by bac e ial coloniza ion in 7 days old mice (Scha schmid e al., 2015), and
ha Helicobac e pylo i coloniza ion in newbo ns esul s in absence o
gas ic in lamma ion la e in li e (A nold e al., 2011).
Despi e he pa icula p opensi ies o ole ance gene a ion in he
neona e sys em, no all pe ina al gu bac e ia coloniza ion esul s in
ole ance. Fo example, mice de elop a mucosal IgA esponse o SFB e en
when colonized pe ina ally wi h i (Jiang e al., 2001), and newbo n mice
de elop s ong in lamma o y esponses when in ec ed wi h Ye sinia
en e ocoli ica (Sie ke e al., 2014). A g ea p opo ion o bac e ia a e ound
coa ed wi h IgA in he gu o adul mice, in T-cell dependen and
independen manne s (Bunke e al., 2015), which sugges s ha he
80
gene a ion o an igen-speci ic T egs and supp ession o IgA esponses in
he gu a e pa icula ea u es o a selec g oup o mic obes. Ne e heless,
he ole o T egs on he IgA gene a ion in he gu emains con o e sial.
Some epo s indica e ha T egs p omo e he gene a ion o In es inal IgA
(Cong e al., 2009; Kawamo o e al., 2014; Tsuji e al., 2009), while o he s
a gue ha T egs p e en ge minal cen e o ma ion (Chung e al., 2011;
Lin e man e al., 2011). As some s udies ha e iden i ied T-cell dependen
and independen IgA esponses in he gu , wi h p oposed di e ences in he
ole o he IgA gene a ed in each, he T eg ole as p omo e o supp esso
o gu IgA could as well be di e en ia ed by he ype o IgA gene a ed. As
T-cell dependen IgA would equi e di e en ia ed, an igen-speci ic T cells,
mos likely Th17 (Hi o a e al., 2013), T egs could ac as supp esso s o
an igen-speci ic IgA by supp essing he speci ic T-cell esponse. In ou
model, an i-H. hepa icus ecal IgA esponses we e T cell dependen (Fig.
S3.10), which suppo s he idea ha T egs could p e en hese esponses
ups eam o ge minal cen e eac ions.
We ound ha he na u al me hod o coloniza ion by H. hepa icus in
he mice, om mo he o newbo ns, esul s in he gene a ion o T egs, ha
supp ess he immune esponses o his bac e ia. This esul s in an absence
o speci ic IgA, and also allows his bac e ia o each highe le els in he
in es inal mucosa, hence ensu ing highe p obabili y o dissemina ion and
su i al o his mic obe. This mechanism would explain he high incidence
o H. hepa icus in ec ion in animal acili ies and in he wild, whe e he
Helicobac e genus is highly p e alen (Wasimuddin e al., 2012). A pa allel
model was also p oposed o H. pylo i, which was un il ecen ly highly
p e alen in human popula ions (Blase e al., 2008). H. pylo i in ec ion
would be ha mless, o e en bene icial, when occu ing e y ea ly in he
de elopmen , bu ha m ul when happening a la e s ages, o he mos
Chap e 3
81
p oblems associa ed wi h his in ec ion come om he uncon olled immune
esponse o he bac e ia (A nold e al., 2011).
In he unde s anding o how he mucosal immune sys em wo ks, one
should ake in o accoun how his sys em e ol ed and was shaped by he
mic obial wo ld in e ac ing wi h i . As s udies wi h wild mice sugges ,
Helicobac e spp. a e pa o he indigenous lo a o he mice, which
p obably co-e ol ed wi h his o ganism. As i happens, due o p oblems
wi h immunode icien mice hese bac e ia we e pu ged om he mic obio a
o expe imen al animal acili ies, which could ha e a g ea e ec in o all
e alua ions o he mechanisms exis ing in he gu o con ol and bene i
om bac e ia. Indeed, i was ound ha ee-li ing mice ha e a hicke ,
be e de eloped mucus laye in he colon, wi h a be e sepa a ion o
bac e ia om he epi helium (Jakobsson e al., 2015). Fu he mo e, we
obse ed ha pe ina al coloniza ion wi h H. hepa icus shapes he
mic obio a o he mice in a pa icula way, which could e en be mo e
a o able o he hos . Fo example, we ound ha , in WT mice, H. hepa icus
pe ina al coloniza ion p omo es a d ama ic dec ease in he equency o he
amily E ysipelo ichaceae (Fig. 3.6B), which was ound in highe
equencies in mice wi h a poo me abolic p o ile in he in es ine (Fleissne
e al., 2010; Tu nbaugh e al., 2009). Addi ionally, we ound ha pe ina ally
colonized mice had inc eased le els o T egs in he la ge in es ine Lamina
P op ia (Fig. 3.4D), which also poin s o a bene i o he hos . The e o e,
pe ina al coloniza ion wi h H. hepa icus gua an ees an ea ly educa ion o
he immune sys em h ough gene a ion o T egs and ensu es a li e-long
symbiosis be ween his wo species. In his ligh , a mo e comp ehensi e
analysis o he indigenous mic obio a o mice and humans may help o
iden i y o he g oups o bac e ia wi h simila p ope ies and he capaci y o
main ain and imp o e he obus ness o homeos asis in he gu .
82
Ma e ials and Me hods
Mice
Wild ype (WT), Rag2-/-, IL10-/-, TLR2-/-, TCRβ-/- and DEREG (Lahl e
al., 2007) mice we e all in C57BL/6 backg ound, b ead in ou speci ic
pa hogen ee (SPF) acili y, which excludes Helicobac e hepa icus. All
expe imen s in ol ing H. hepa icus coloniza ion we e pe o med in a
dedica ed oom. Ge m ee (GF) C57BL/6 mice we e aised in he IGC
gno obiology acili y in axenic isola o s (La Calhene/ORM). Adul s GF mice
we e ans e ed o s e ile ISOcages (Tecniplas ) o use in expe imen s,
and hei mic obiological s a us was con i med mul iple imes along he
s udy.
Helicobac e hepa icus cul u e and mice coloniza ion
Helicobac e hepa icus e e ence s ain (CIP 104102) was ob ained
om he Biological esou ces cen e o he Pas eu Ins i u e. G ow h was
pe o med in 10% ho se blood-aga (HBA, Oxoid) pla es, supplemen ed
wi h 12.5 mg/L ancomycin, 0.3 mg/L polymyxin B, 6.3 mg/L ime hop im
and 5.0 mg/L ampho e icin B, a 37°C, unde mic oae ophilic condi ions
(6% O2, 7% CO2, 3.5% H2 and 83.5% N2) gene a ed by an Anoxoma
sys em (MART Mic obiology). Bac e ia we e ha es ed a e 5 days o
cul u ed in PBS solu ion and numbe s we e es ima ed by OD quan i ica ion.
Mice we e colonized by o al ga age wi h 100µL o bac e ia suspension a
109 CFU/mL in PBS, using an animal eeding needle wi h silicone ip, size
20G x 1.5’’ (Cadence Science). Coloniza ion was con i med by PCR on
ecal DNA using H. hepa icus 16S speci ic p ime s: wd:
GCATTTGAAACTGTTACTCTG, e : CTGTTTTCAAGCTCCCCGAAG,
417bp p oduc (Pe nicki-Ocwieja e al., 2009). Fecal DNA was p epa ed
ei he wi h NZY ech issue gDNA ki (NZY ech), wi h a p e-s ep o 95°C,
Chap e 3
83
using 5ng o eac ions, o by a simple boiling me hod, as desc ibed
elsewhe e (T ue e al., 2000). B ie ly, o one ecal pelle was added 700ul
o a 25mM NaOH, 0.2mM EDTA solu ion wi h pH=12, and ollowed he
p ocedu e: 95°C, 3min, o ex, 95°C, 7min, o ex, cen i uga ion 16,000G
2min, ake 50µl o supe na an and add o 50µl o 40mM T is HCl solu ion,
wi h pH=5. 2µl o his inal sample was used in PCR eac ions. PCR was
pe o med in 25µl, wi h he inal concen a ions: 1.25mM MgCl2, 0.2mM
dNTP, 0.4µM o each p ime , 1.5U o GOTaq and 2µl o empla e
(P omega). Reac ions we e pe o med on a MyCycle (BioRad) wi h he
ollowing condi ions: 95°C 5min, ollowed by 36 cycles o 95°C - 30s, 60°C -
45s, 72°C - 1min, wi h a inal ex ension o 72°C - 10min. P oduc s we e
isualized on a 2% aga ose gel (Lonza).
To ep oduce coloniza ion h ough cop ophagy, mice we e colonized
using a p epa a ion o H. hepa icus posi i e eces, om mice p e iously
colonized wi h cul u ed H. hepa icus. Fecal pelle s we e homogenized in
PBS a a a io o 1 pelle o 400µL (~ 100mg/mL) and il e ed in 100µm
mesh. Each adul mouse ecei ed 100µL o his ecal p epa a ion by o al
ga age. 1, 2 and 3 weeks old mice we e colonized wi h 20ul o ecal
suspension using a 24G x 25mm long eeding needle (Fine Science Tools),
ben ~30° o acili a e inse ion in o he o al ca i y (Bu chbach e al., 2007).
Adul GF we e colonized wi h cul u ed H. hepa icus by o al ga age, and
con i med posi i e using PCR on ecal DNA. Monocolonized mice we e
b ed in ISOcages o p oduce pups newbo n-monocolonized wi h H.
hepa icus, which we e kep in ISOcages a e weaning un il 9 weeks o age.
Helicobac e hepa icus quan i ica ion
The ollowing p ime s we e used in qPCR eac ions: H. hepa icus 16S
wd: GCATTTGAAACTGTTACTCTG, H. hepa icus 16S e :
CTGTTTTCAAGCTCCCCGAAG, 417bp p oduc (Pe nicki-Ocwieja e al.,
84
2009); 18S wd: CATTCGAACGTCTGCCCTAT, 18S e :
CCTGCTGCCTTCCTTGGA, 137bp p oduc (Vaishna a e al., 2011). H.
hepa icus (Hh) 16S copy numbe was es ima ed using plasmid s anda d
cu e, and hos DNA amoun in ng was es ima ed using a s anda d cu e
cons uc ed wi h in es inal issue DNA, measu ed using Qubi dsDNA
Assay (Molecula P obes). All eac ions con ained s anda d cu es o
absolu e quan i ica ion. H. hepa icus amoun is exp essed as log10 o he
a io Hh 16S copies/ ng o hos DNA, unless o he wise s a ed. In es inal
mucosa, MLN and gallbladde DNA was ex ac ed using NZYTech Tissue
gDNA ex ac ion ki (NZYTech), wi h an ini ial s ep a 95°C. Fo
quan i ica ion, 10ng o DNA was used. P ime s we e used a 0.5µM in he
eac ion, con aining 5µL o iTaq Uni e sal SYBR G een Supe mix (Bio-
Rad), 2µL o sample and wa e o a inal olume o 10µL. qPCR condi ions:
95°C - 3min; 45 cycles o 95°C - 30s, 60°C - 30s, 72°C - 36s; ollowed by a
mel ing cu e o 65 - 95°C wi h 0.5°C inc ease e e y 5s. All eac ions we e
p epa ed in 384 well ha d shell pla es (Bio-Rad), on ice, in less han one
hou , o minimize p ime dime o ma ion, and un immedia ely a e
p epa a ion on a CFX384 eal- ime PCR de ec ion sys em (Bio-Rad).
To al and speci ic Immunoglobulin quan i ica ion by ELISA
To quan i y o al and H. hepa icus speci ic ecal an ibodies, ecal
ex ac s we e p epa ed om eshly collec ed o -80°C s o ed eces. Fecal
pelle s o ~50mg we e collec ed om each mice (a e age 56.6mg ± 15.4,
measu ed om 100 samples), and homogenized in 500µL o PBS
con aining a p o ease inhibi o cock ail (P8340, Sigma-Ald ich), o a
solu ion o abou 100mg/mL. Homogena es we e cen i uged a 16,000G
o 10min a oom empe a u e, and supe na an s we e s o ed a -20°C
un il u he use.
Chap e 3
85
Soluble H. hepa icus an igens (SHelAg) we e p epa ed as p e iously
desc ibed (Kullbe g e al., 1998). A e cul u ed o 5 days in blood-aga
pla es, bac e ia we e ha es ed in PBS solu ion, washed and lysed in a
F ench P ess. The solu ion was cen i uged a 8,000G o 30 min a 4°C,
he supe na an was il e ed s e ile wi h a 0.22µm po e size il e and
p o ein con en was de e mined using BCA p o ein assay. The p epa a ion
was s o ed a -80°C.
ELISA was pe o med using high binding 384 well ELISA pla es
(Ul aC uz). Fo o al Ig quan i ica ion, pla es we e coa ed wi h Goa an i-
Mouse IgM, IgG o IgA polyclonal an ibodies (Sou he n Bio ech), and o
an i-H. hepa icus Ig quan i ica ion, coa ing was done using 10µg/mL o
SHelAg. Pla es we e coa ed o e nigh a 4°C, washed in PBS 0.05%
Tween20 and blocked wi h 2% BSA solu ion in PBS. Fecal ex ac s we e
added undilu ed (speci ic Ig) o 10 old dilu ed ( o al Ig) o pla es and dilu ed
7 imes, 3 old each ime. Se um samples we e assayed s a ing om a
dilu ion o 1:200. Fo speci ic ecal IgA quan i ica ion, a e e ence sample
pooled om 5 adul colonized B6 was used in all assays. Fo speci ic
se um IgM, IgG and IgA, a e e ence se um sample o colonized IL-10-/-
dilu ed 1:210 was used in all assays. A e o e nigh incuba ion a 4°C,
pla es we e washed in PBS 0.05% Tween20 and incuba ed wi h Goa an i-
Mouse IgM, IgG o IgA conjuga ed wi h HRP. Reac ions we e e ealed wi h
TMB (BD) and s opped wi h 0.1M H2SO4, and ead a 450nm in a Mul iskan
GO Mic opla e Spec opho ome e (The mo Scien i ic). Ti e s we e
calcula ed as he dilu ion a 10% o he maximum signal (no malized o a
e e ence in all samples), using in e pola ion om a 4-pa ame e logis ic
eg ession i ing.
86
Induc ion o acu e coli is wi h DSS
Mice we e ea ed wi h Dex an Sul a e Sodium (DSS) (36,000-50,000
Da, MP Biomedicals), dilu ed in d inking wa e , o 7 days. DSS solu ion
was changed o a new one e e y 2 days. Weigh was sco ed o 18 days.
Se ological Analysis
Mice we e eu hanized wi h CO2 and blood was collec ed om he
in ahepa ic ena ca a in o hepa ine-coa ed collec ion ubes. Assays we e
pe o med on plasma, on he same day o ex ac ion. Se ological analyses
we e pe o med on a Siemens Ad ia 1200 Chemis y Analyze by
DNA ech, Po ugal, on he ollowing pa ame e s: To al, Di ec and Indi ec
Bili ubin, Alanine ansaminase (ALT), Aspa a e ansaminase (AST),
Alcaline Phospha ase, Lac ic Dehyd ogenase (LDH), To al P o ein and
Albumin.
Fecal Lipocalin-2 quan i ica ion
Quan i ica ion o ecal Lipocalin-2 was pe o med on ecal ex ac s,
ob ained as desc ibed abo e, using he ki manu ac u e ins uc ions
(Mouse Lipocalin-2/NGAL DuoSe ELISA, ca alog numbe : DY1857, R&D).
D ug T ea men s
Mice we e ea ed wi h an i-CD25 (PC61 clone, IGC’s An ibody
Facili y) wi h one injec ion o a 500µg dose in ape i oneally (i.p.); wi h an i-
IL-10R (1B1.2 clone, IGC’s An ibody Facili y) wi h 4 injec ions, weekly, o
1mg i.p.; and wi h Diph he ia Toxin om Co ynebac e ium diph he iae
(Sigma) wi h one injec ion o a 1µg dose i.p..
Chap e 3
87
Lamina P op ia Lymphocy es Isola ion
Lymphocy e isola ion om Lamina P op ia o he la ge in es ine was
pe o med by ex ac ing he in es ines, cu ing in 6 cm pieces, opening
longi udinally and washing igo ously in PBS in a pe i dish. Pieces we e
hen cu in o 1cm agmen s, collec ed in 20ml o PBS wi h 4% Fe al Bo ine
Se um (FBS, Gibco) and EDTA (Gibco) was added o a inal concen a ion
o 5mM. A e 15min o shaking a 2000 pm, 37°C in an o bi al shake , and
a inal o ex o 5s, pieces we e collec ed in s eel mesh and his EDTA
p ocedu e was epea ed one mo e ime. Pieces we e hen collec ed in o a
2ml eppendo ube wi h 1ml HBSS 4% FBS and minced wi h scisso s.
F agmen s we e hen collec ed in o a 20ml solu ion o HBSS wi h 4% FBS
and 1mg/mL Colagenase Tye VIII and 0.1mg/mL DNAse I (Sigma) and
diges ed o 30min a 2000 pm, 37°C in an o bi al shake . The solu ion was
il e ed wi h a 70µm cell s aine (BD), cen i uged a 450G, 5min a 4°C,
esuspended in 8mL o a 40% Pe coll (Sigma) solu ion in HBSS (Pe coll
p e iously co ec ed o 310mOsm/kg, pH 7) and laye ed on o 4mL o a 80%
Pe coll solu ion. A e cen i uga ion a 620G, 20min, 20°C, wi h no b ake o
accele a ion, cells we e collec ed om he in e ace o he wo Pe coll
laye s and washed once be o e use o FACS s aining. Cells we e p e-
incuba ed wi h Fc-block (an i-CD16/CD32, IGC-AbSe ice), and hen
incuba ed wi h an i-mouse TCRβ (H57-597, eBioscience), CD4 (GK1.5,
eBioscience), CD8 (53-6.7, eBioscience), CD25 (PC61, IGC-AbSe ice),
Foxp3 (FJK-16S, eBioscience). E en s we e acqui ed on an LSRFo essa
X-20 cell analyze (BD) and analyzed on FlowJo So wa e (T ee S a ).
IgA FACS on li e H. hepa icus
H. hepa icus was cul u ed as desc ibed abo e, and 106 CFU we e
used pe assay. Bac e ia we e washed once in PBS, pelle ed (12,000G,
5min), esuspended in ecal ex ac (p epa ed as desc ibed o ELISA
88
assay) om SPF, Adcol o Nbcol mice and incuba ed on ice o 30min.
Bac e ia we e hen washed in PBS and incuba ed o 15min on ice wi h
Goa an i-Mouse IgA (Sou he n Bio ech), labeled using Alexa647 Labeling
Ki (The mo Fishe Scien i ic). Bac e ia we e washed again and
esuspended in a PBS solu ion con aining 5µM o SYTO 9 (Molecula
P obes). E en s we e acqui ed on a CyAn ADP Analyze (Beckman
Coul e ) and analyzed on FlowJo So wa e (T ee S a ). Analysis was
pe o med ga ing on li e bac e ia, which we e SYTO 9 B igh , as con i med
by coun e s aining wi h 45µM o p opidium iodide (Molecula P obes), and
excluding e en s wi h high pulse wid h.
16S RNA analysis
48 samples we e analyzed, om WT and Rag2-/- animals, ei he SPF,
Adcol o Nbcol, 4 Males and 4 Females pe g oup. SPF and Nbcol mice
we e 8-12 weeks old; Adcol mice we e colonized a 10 weeks o age and
analyzed a 10 weeks pos -coloniza ion. DNA om ecal pelle s was
ex ac ed using NZYTech Tissue gDNA ex ac ion ki (NZYTech), wi h a
p e-s ep o 95°C, and used o 16S RNA gene sequencing as p e iously
desc ibed (Wal e s e al., 2016). Sample p ocessing and sequencing we e
pe o med by he IGC Genomics Uni . The 515 -806 bac e ial/a chaeal
p ime pai was used, which a ge s he 16S RNA gene a iable egion 4
(V4), wi h he ollowing sequences: 515 - GTGYCAGCMGCCGCGGTAA;
806 – GGACTACNVGGGTWTCTAAT; ba codes we e added in he 5’ end
o he 515 p ime , and Illumina adap e s we e p esen in bo h p ime s.
Sample p ocessing and PCRs we e pe o med as desc ibed in he Ea h
Mic obiome P ojec (EMP; h p://www.ea hmic obiome.o g/emp-s anda d-
p o ocols/16s/, 16S RNA Ampli ica ion P o ocol e sion 6_15). Pai -end
sequencing was pe o med on an Illumina MiSeq Bench op Sequence ,
ollowing manu ac u e 's ins uc ions. Reads we e p ocessed and analyzed
using Mo hu So wa e e sion 1.36.1 (Schloss e al., 2009), ollowing he
Chap e 3
95
Figu e S3.4 – H. hepa icus ecal load 10 weeks pos -coloniza ion (Figu e 3.2 B - D)
Mice a 1-4 weeks o age we e colonized wi h H. hepa icus by eces o al ga age. 10
weeks a e coloniza ion, eces we e analyzed o an i-H. hepa icus and To al IgA by
ELISA. N = 8, 5, 6 and 8 espec i ely. Linea model: y~exp(-x), line = eg ession, shade =
con idence in e al; eg ession coe icien : p < 0.01; R2 = 0.30; F s a is ic: p < 0.01
96
Figu e S3.5 – Complemen a y o Figu e 3.4 A and B
A - C) To al ecal IgA, H. hepa icus ecal load and weigh o he mice shown in igu e
3.4A. A) Linea model: y~log(x), eg ession coe icien : p < 0.01; R2 = 0.52; F s a is ic: p <
0.01; B) Linea model: y~exp(-x), eg ession coe icien : p < 0.01; R2 = 0.21; F s a is ic: p
< 0.01; C) Linea model: y~log(x), eg ession coe icien : p < 0.01; R2 = 0.62; F s a is ic: p
< 0.01. D) To al ecal IgA measu ed on he mice om igu e 3.4B; Linea eg ession,
g oup compa ison: p = 0.57; mul iple R2 = 0.31; F s a is ic: p < 0.05. Line = eg ession,
shade = con idence in e al.
Chap e 3
97
Figu e S3.6 – Complemen a y o Figu e 3.4 C
A) To al IgA measu ed on he eces o he mice p esen ed in Figu e 3.4C. Line = local
polinomial eg ession, shade = con idence in e al. B) H. hepa icus load in he mucosa o
he ileum and colon, no malized o hos 18S, in pa o he mice shown in Figu e 3.4C, 9
weeks a e DT ea men . N pe g oup: WT+DT = 14; DEREG+DT = 15. Poin s =
indi idual mice, ba = median. * p < 0.05 (Wilcoxon es ).
98
Figu e S3.7 – T egs a e deple ed in MLN, PP and La ge In es ine Lamina P op ia
upon DT ea men in DEREG mice
Newbo n colonized li e ma e WT and DEREG mice we e ea ed wi h 1μg o DT i.p. a 7
weeks o age. Analysis o equency and o al numbe s o TCRβ+ CD4+ Foxp3+ cells was
pe o med 2 days la e on MLN, PP and La ge In es ine Lamina P op ia. A)
Rep esen a i e FACS plo s o he Foxp3+ cells equency in he TCRβ+ CD4+ popula ion,
a he indica ed o gans. B) Numbe o TCRβ+ CD4+ cells. C) Numbe o TCRβ+ CD4+
Foxp3+ cells. D) Pe cen age o TCRβ+ CD4+ Foxp3+ cells. N = 3 pe g oup, * p < 0.05 (
es ), ns = no signi ican . MLN = Mesen e ic Lymph Nodes; PP = Peye ’s Pa ches; LPL =
La ge In es ine Lamina P op ia; DT = Diph he ia Toxin.
Chap e 3
99
Figu e S3.8 – Newbo n ole ance o H. hepa icus is TLR2 independen
Young Adul TLR-/- males and emales we e colonized wi h H. hepa icus by eces ga age
and b ed o p oduce Newbo n-colonized pups. To al and an i-H. hepa icus IgA we e
analyzed by ELISA on he eces o Newbo n-colonized TLR2-/- mice a 5, 7 and 9 weeks
o age. N = 6 a all poin s.
100
Figu e S3.9 – Complemen a y o Figu e 3.5 D and F
A) Se ologic analysis on SPF, Adcol and Nbcol mice. SPF: n = 6, 11 weeks old. Adcol: n
= 6, 12 weeks colonized, coloniza ion a 10 weeks o age. Nbcol: n = 6, 11 weeks
old/colonized. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05
(Wilcoxon es wi h BH co ec ion). B) Lipocalin-2 concen a ion was measu ed by ELISA
on he eces o SPF, Adcol and Nbcol mice a days 0, 5, 11 and 18 a e ea men wi h
3% DSS in d inking wa e o 7 days. SPF: n = 10, 12 weeks old. Adcol: n = 10, 14 weeks
old, 4 weeks colonized. Nbcol: n = 10, 12 weeks old/colonized. ns = non-signi ican
(linea mixed e ec s analysis).
Chap e 3
101
Figu e S3.10 – An i-H. hepa icus mucosal IgA is T-cell dependen
Adu (10 weeks old) WT and TCRβ-/- mice we e colonized wi h H. hepa icus by eces
ga age and analyzed 4 weeks pos -coloniza ion o o al and an i-H. hepa icus IgA by
ELISA. N= 10 in each g oup.
102
Figu e S3.11 – an i-IL10R ea men is able o b eak ole ance o H. hepa icus
10 weeks old Nbcol mice ecei ed 4 weekly 1mg doses o an i-IL-10R an ibody (clone
1B1.2) o PBS. To al and an i-H. hepa icus IgA we e analyzed on eces on 0, 4 and 10
weeks pos - ea men . An i-IL10R: n=5; PBS: n=4. Lines = linea eg ession, shades =
con idence in e al, G oup compa ison: p < 0.01, Mul iple R2 = 0.55; F s a is ic: p < 0.01.
Chap e 3
103
Figu e S3.12 – Complemen a y o Figu e 3.6
16S RNA a iable egion 4 (V4) analysis on ecal DNA om WT and Rag2-/- animals,
ei he SPF, Adcol o Nbcol, 4 Males and 4 Females pe g oup. SPF and Nbcol mice we e
8-12 weeks old; Adcol mice we e colonized a 10 weeks o age and analyzed a 10
weeks pos -coloniza ion. Rela i e abundance o di e en axa be ween he g oups
analyzed. Lowes classi ica ion le el achie ed in he analysis shown abo e he g aph.
S a is ical analysis was pe o med using Wilcoxon es , wi h Benjamini and Hochbe g
co ec ion. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05.
104
Figu e S3.13 – Complemen a y o Figu e 3.6
16S RNA a iable egion 4 (V4) analysis on ecal DNA om WT and Rag2-/- animals,
ei he SPF, Adcol o Nbcol, 4 Males and 4 Females pe g oup. SPF and Nbcol mice we e
8-12 weeks old; Adcol mice we e colonized a 10 weeks o age and analyzed a 10
weeks pos -coloniza ion. A) Plo s o ela i e abundance o he indica ed axa on
indi idual mice o he indica ed g oups. Taxa wi h ela i e abundance abo e 0.1% a e
shown. B) Species ichness, es ima ed wi h Chao index. C) Species di e si y, es ima ed
wi h Shannon index. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05
(Wilcoxon es wi h BH co ec ion).
Chap e 4
111
Conclusion
Ou s udies o he ecip ocal in e ac ions be ween H. hepa icus and
he mouse immune sys em p o ide no el insigh s in o how he hos
adap i e immuni y con ols he mic obio a and how i is a ec ed by i .
Fu he mo e, hey highligh he impo ance o e ising he lis o bac e ia
excluded om he mic obio a on animal s udies, o some o hose, like H.
hepa icus, a e an impo an componen o his sys em ha p obably
e ol ed wi h his hos o compose a balanced s uc u e. The e o e, mo e
in es iga ions on na u al popula ions a e necessa y o sea ch o o he key
componen s o he mic obio a o mice and humans, which could help o
unde s and how he gu associa ed immune sys em e ol ed and p o ide
new ools o es o e homeos asis in pa hological condi ions.
112
Re e ences
Adkins, B., Lecle c, C., and Ma shall-Cla ke, S. (2004). Neona al
adap i e immuni y comes o age. Na . Re . Immunol. 4, 553–564.
An, D., Oh, S.F., Olszak, T., Ne es, J.F., A ci, F.Y., E u k-Hasdemi ,
D., Lu, X., Zeissig, S., Blumbe g, R.S., and Kaspe , D.L. (2014).
Sphingolipids om a symbio ic mic obe egula e homeos asis o hos
in es inal na u al kille T cells. Cell 156, 123–133.
And ade, E.B., Al es, J., Madu ei a, P., Oli ei a, L., Ribei o, A.,
Co dei o-da-Sil a, A., Co eia-Ne es, M., T ieu-Cuo , P., and Fe ei a, P.
(2013). TLR2-induced IL-10 p oduc ion impai s neu ophil ec ui men o
in ec ed issues du ing neona al bac e ial sepsis. J. Immunol. 191, 4759–
4768.
Annacke , O., Pimen a-A aujo, R., Bu len-De anoux, O., Ba bosa,
T.C., Cumano, A., and Bandei a, A. (2001). CD25+ CD4+ T Cells Regula e
he Expansion o Pe iphe al CD4 T Cells Th ough he P oduc ion o IL-10.
J. Immunol. 166, 3008–3018.
A nold, I.C., Lee, J.Y., Amie a, M.R., Roe s, A., Fla ell, R.A.,
Spa wasse , T., and Mülle , A. (2011). Tole ance Ra he Than Immuni y
P o ec s F om Helicobac e pylo i–Induced Gas ic P eneoplasia.
Gas oen e ology 140, 199–209.e8.
A a ashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwaha a, T.,
Momose, Y., Cheng, G., Yamasaki, S., Sai o, T., Ohba, Y., e al. (2011).
Induc ion o Colonic Regula o y T Cells by Indigenous Clos idium Species.
Science (80-. ). 331, 337–341.
Be g, D.J., Da idson, N., Kühn, R., Mülle , W., Menon, S., Holland,
Re e ences
113
G., Thompson-Snipes, L., Leach, M.W., and Rennick, D. (1996).
En e ocoli is and colon cance in in e leukin-10-de icien mice a e
associa ed wi h abe an cy okine p oduc ion and CD4(+) TH1-like
esponses. J. Clin. In es . 98, 1010–1020.
Biswas, A., Liu, Y.-J., Hao, L., Mizoguchi, A., Salzman, N.H., Be ins,
C.L., and Kobayashi, K.S. (2010). Induc ion and escue o Nod2-dependen
Th1-d i en g anuloma ous in lamma ion o he ileum. P oc. Na l. Acad. Sci.
107, 14739–14744.
Blase , M.J., Chen, Y., and Reibman, J. (2008). Does Helicobac e
pylo i p o ec agains as hma and alle gy? Gu 57, 561–567.
B omley, S.K., Mempel, T.R., and Lus e , A.D. (2008). O ches a ing
he o ches a o s: chemokines in con ol o T cell a ic. Na . Immunol. 9,
970–980.
Bunke , J.J., Flynn, T.M., Ko al, J.C., Shaw, D.G., Meisel, M.,
McDonald, B.D., Ishizuka, I.E., Den , A.L., Wilson, P.C., Jab i, B., e al.
(2015). Inna e and Adap i e Humo al Responses Coa Dis inc Commensal
Bac e ia wi h Immunoglobulin A. Immuni y 43, 541–553.
Bu chbach, M.E.R., Edwa ds, J.D., Schussle , K.R., and Bu ghes,
A.H.M. (2007). A no el me hod o o al deli e y o d ug compounds o he
neona al SMNΔ7 mouse model o spinal muscula a ophy. J. Neu osci.
Me hods 161, 285–290.
Cahenzli, J., Kölle , Y., Wyss, M., Geuking, M.B., and McCoy, K.D.
(2013). In es inal mic obial di e si y du ing ea ly-li e coloniza ion shapes
long- e m IgE le els. Cell Hos Mic obe 14, 559–570.
Cahill, R.J., Fol z, C.J., Fox, J.G., Dangle , C.A., Pow ie, F., and
Schaue , D.B. (1997). In lamma o y bowel disease: an immuni y-media ed
114
condi ion igge ed by bac e ial in ec ion wi h Helicobac e hepa icus. In ec .
Immun. 65, 3126–3131.
Chao, A. (1984). Nonpa ame ic es ima ion o he numbe o classes
in a popula ion. Scand. J. S a .
Chow, J., and Mazmanian, S.K. (2010). A Pa hobion o he
Mic obio a Balances Hos Coloniza ion and In es inal In lamma ion. Cell
Hos Mic obe 7, 265–276.
Chung, H., Pamp, S.J., Hill, J.A., Su ana, N.K., Edelman, S.M., T oy,
E.B., Reading, N.C., Villablanca, E.J., Wang, S., Mo a, J.R., e al. (2012).
Gu Immune Ma u a ion Depends on Coloniza ion wi h a Hos -Speci ic
Mic obio a. Cell 149, 1578–1593.
Chung, Y., Tanaka, S., Chu, F., Nu ie a, R.I., Ma inez, G.J., Rawal,
S., Wang, Y.-H., Lim, H., Reynolds, J.M., Zhou, X.-H., e al. (2011).
Follicula egula o y T cells exp essing Foxp3 and Bcl-6 supp ess ge minal
cen e eac ions. Na . Med. 17, 983–988.
Cong, Y., Feng, T., Fujihashi, K., Schoeb, T.R., and Elson, C.O.
(2009). A dominan , coo dina ed T egula o y cell-IgA esponse o he
in es inal mic obio a. P oc. Na l. Acad. Sci. U. S. A. 106, 19256–19261.
Faga asan, S., Kawamo o, S., Kanagawa, O., and Suzuki, K. (2010).
Adap i e immune egula ion in he gu : T cell-dependen and T cell-
independen IgA syn hesis. Annu. Re . Immunol. 28, 243–273.
Fa ache, J., Zigmond, E., Shakha , G., and Jung, S. (2013).
Con ibu ions o dend i ic cells and mac ophages o in es inal homeos asis
and immune de ense. Immunol. Cell Biol. 91, 232–239.
Fa in, H.F., Ka haus, W.R., Kujala, P., Rakhshandeh oo, M.,
Re e ences
115
Schwank, G., V ies, R.G.J., Kalkho en, E., Nieuwenhuis, E.E.S., and
Cle e s, H. (2014). Pane h cell ex usion and elease o an imic obial
p oduc s is di ec ly con olled by immune cell-de i ed IFN-γ. J. Exp. Med.
211, 1393–1405.
Fleissne , C.K., Huebel, N., Abd El-Ba y, M.M., Loh, G., Klaus, S.,
and Blau , M. (2010). Absence o in es inal mic obio a does no p o ec
mice om die -induced obesi y. B J Nu 104, 919–929.
Fo bes, S.J., Eschmann, M., and Man is, N.J. (2008). Inhibi ion o
Salmonella en e ica se o a yphimu ium mo ili y and en y in o epi helial
cells by a p o ec i e an ilipopolysaccha ide monoclonal immunoglobulin a
an ibody. In ec . Immun. 76, 4137–4144.
Fo bes, S.J., Bumpus, T., McCa hy, E.A., Co hesy, B., and Man is,
N.J. (2011). T ansien Supp ession o Shigella lexne i Type 3 Sec e ion by
a P o ec i e O-An igen-Speci ic Monoclonal IgA. MBio 2, e00042–11 –
e00042–11.
Fox, J.G., Dewhi s , F.E., Tully, J.G., Pas e , B.J., Yan, L., Taylo ,
N.S., Collins, M.J., Go elick, P.L., and Wa d, J.M. (1994). Helicobac e
hepa icus sp. no ., a mic oae ophilic bac e ium isola ed om li e s and
in es inal mucosal sc apings om mice. J. Clin. Mic obiol. 32, 1238–1245.
F i z, J.H., Rojas, O.L., Sima d, N., McCa hy, D.D., Hap elmeie , S.,
Rubino, S., Robe son, S.J., La ijani, M., Gosselin, J., I ano , I.I., e al.
(2012). Acquisi ion o a mul i unc ional IgA+ plasma cell pheno ype in he
gu . Na u e 481, 199–203.
Gabo iau-Rou hiau, V., Rako obe, S., Lécuye , E., Mulde , I., Lan, A.,
B idonneau, C., Roche , V., Pisi, A., De Paepe, M., B andi, G., e al. (2009).
The Key Role o Segmen ed Filamen ous Bac e ia in he Coo dina ed
Ma u a ion o Gu Helpe T Cell Responses. Immuni y 31, 677–689.
116
Gensollen, T., Iye , S.S., Kaspe , D.L., and Blumbe g, R.S. (2016).
How coloniza ion by mic obio a in ea ly li e shapes he immune sys em.
Science (80-. ). 352, 539–544.
Gollwi ze , E.S., Saglani, S., T ompe e, A., Yada a, K., She bu n, R.,
McCoy, K.D., Nicod, L.P., Lloyd, C.M., and Ma sland, B.J. (2014). Lung
mic obio a p omo es ole ance o alle gens in neona es ia PD-L1. Na .
Med. 20, 642–647.
Hale, J.S., Bou salian, T.E., Tu k, G.L., and Fink, P.J. (2006). Thymic
ou pu in aged mice. P oc. Na l. Acad. Sci. U. S. A. 103, 8447–8452.
Hap elmeie , S., Lawson, M. a E., Slack, E., Ki undi, J.K., S oel, M.,
Heikenwalde , M., Cahenzli, J., Velyko edko, Y., Balme , M.L., End , K., e
al. (2010). Re e sible mic obial coloniza ion o ge m- ee mice e eals he
dynamics o IgA immune esponses. Science 328, 1705–1709.
Hi o a, K., Tu ne , J.-E., Villa, M., Dua e, J.H., Demengeo , J.,
S einme z, O.M., and S ockinge , B. (2013). Plas ici y o TH17 cells in
Peye ’s pa ches is esponsible o he induc ion o T cell–dependen IgA
esponses. Na . Immunol. 14, 372–379.
Hoope , L. V, and Macphe son, A.J. (2010). Immune adap a ions ha
main ain homeos asis wi h he in es inal mic obio a. Na . Re . Immunol. 10,
159–169.
Hoope , L. V., Li man, D.R., and Macphe son, a. J. (2012).
In e ac ions Be ween he Mic obio a and he Immune Sys em. Science (80-.
). 336, 1268–1273.
Ho ho n, T., B e z, F., and Wes all, P. (2008). Simul aneous
in e ence in gene al pa ame ic models. Biome ical J.
Re e ences
117
Jakobsson, H.E., Rod íguez-Piñei o, A.M., Schü e, A., E mund, A.,
Boysen, P., Bema k, M., Somme , F., Bäckhed, F., Hansson, G.C., and
Johansson, M.E. (2015). The composi ion o he gu mic obio a shapes he
colon mucus ba ie . EMBO Rep. 16, 164–177.
Jiang, H.-Q., Bos, N. a., and Ceb a, J.J. (2001). Timing, Localiza ion,
and Pe sis ence o Coloniza ion by Segmen ed Filamen ous Bac e ia in he
Neona al Mouse Gu Depend on Immune S a us o Mo he s and Pups.
In ec . Immun. 69, 3611–3617.
Johansson, M.E. V, Phillipson, M., Pe e sson, J., Velcich, A., Holm,
L., and Hansson, G.C. (2008). The inne o he wo Muc2 mucin-dependen
mucus laye s in colon is de oid o bac e ia. P oc. Na l. Acad. Sci. U. S. A.
105, 15064–15069.
Kae zel, C.S. (2014). Coope a i i y among sec e o y IgA, he
polyme ic immunoglobulin ecep o , and he gu mic obio a p omo es hos -
mic obial mu ualism. Immunol. Le . 162, 10–21.
Kawamo o, S., Ma uya, M., Ka o, L.M., Suda, W., A a ashi, K., Doi,
Y., Tsu sui, Y., Qin, H., Honda, K., Okada, T., e al. (2014). Foxp3+ T Cells
Regula e Immunoglobulin A Selec ion and Facili a e Di e si ica ion o
Bac e ial Species Responsible o Immune Homeos asis. Immuni y 41,
152–165.
Kelsall, B. (2008). Recen p og ess in unde s anding he pheno ype
and unc ion o in es inal dend i ic cells and mac ophages. Mucosal
Immunol. 1, 460–469.
Khade , S.A., Ga en, S.L., and Kolls, J.K. (2009). Th17 cells a he
c oss oads o inna e and adap i e immuni y agains in ec ious diseases a
he mucosa. Mucosal Immunol. 2, 403–411.
118
Kozich, J.J., Wes co , S.L., Bax e , N.T., Highlande , S.K., and
Schloss, P.D. (2013). De elopmen o a Dual-Index Sequencing S a egy
and Cu a ion Pipeline o Analyzing Amplicon Sequence Da a on he MiSeq
Illumina Sequencing Pla o m. Appl. En i on. Mic obiol. 79, 5112–5120.
K onman, M.P., Zaou is, T.E., Haynes, K., Feng, R., and Co in, S.E.
(2012). An ibio ic exposu e and IBD de elopmen among child en: a
popula ion-based coho s udy. Pedia ics 130, e794–e803.
Kullbe g, M.C., Wa d, J.M., Go elick, P.L., Caspa , P., Hieny, S.,
Chee e , A., Janko ic, D., and She , A. (1998). Helicobac e hepa icus
igge s coli is in speci ic-pa hogen- ee in e leukin-10 (IL-10)-de icien mice
h ough an IL-12- and gamma in e e on-dependen mechanism. In ec .
Immun. 66, 5157–5166.
Kullbe g, M.C., Janko ic, D., Go elick, P.L., Caspa , P., Le e io, J.J.,
Chee e , A.W., and She , A. (2002). Bac e ia- igge ed CD4 + T Regula o y
Cells Supp ess Helicobac e hepa icus –induced Coli is. J. Exp. Med. 196,
505–515.
Kullbe g, M.C., Ande sen, J.F., Go elick, P.L., Caspa , P., Sue baum,
S., Fox, J.G., Chee e , A.W., Janko ic, D., and She , A. (2003). Induc ion
o coli is by a CD4+ T cell clone speci ic o a bac e ial epi ope. P oc. Na l.
Acad. Sci. U. S. A. 100, 15830–15835.
Lahl, K., Loddenkempe , C., D ouin, C., F eye , J., A nason, J., Ebe l,
G., Hamann, A., Wagne , H., Huehn, J., and Spa wasse , T. (2007).
Selec i e deple ion o Foxp3+ egula o y T cells induces a scu y-like
disease. J. Exp. Med. 204, 57–63.
La h op, S.K., Bloom, S.M., Rao, S.M., Nu sch, K., Lio, C.-W.,
San ac uz, N., Pe e son, D. a, S appenbeck, T.S., and Hsieh, C.-S. (2011).
Pe iphe al educa ion o he immune sys em by colonic commensal
Re e ences
119
mic obio a. Na u e 478, 250–254.
Lécuye , E., Rako obe, S., Lengliné-Ga nie , H., Leb e on, C., Pica d,
M., Jus e, C., F i zen, R., Ebe l, G., McCoy, K.D., Macphe son, A.J., e al.
(2014). Segmen ed ilamen ous bac e ium uses seconda y and e ia y
lymphoid issues o induce gu IgA and speci ic T helpe 17 cell esponses.
Immuni y 40, 608–620.
Lino, A.C., Moh , E., and Demengeo , J. (2013). Na u ally sec e ed
immunoglobulins limi B1 and MZ B-cell numbe s h ough a mic obio a-
independen mechanism. Blood 122, 209–218.
Lin e man, M. a, Pie son, W., Lee, S.K., Kallies, A., Kawamo o, S.,
Rayne , T.F., S i as a a, M., Di eka , D.P., Bea on, L., Hogan, J.J., e al.
(2011). Foxp3+ ollicula egula o y T cells con ol he ge minal cen e
esponse. Na . Med. 17, 975–982.
Li ings on, R.S., Riley, L.K., Besch-Willi o d, C.L., Hook, R.R., and
F anklin, C.L. (1998). T ansmission o Helicobac e hepa icus in ec ion o
sen inel mice by con amina ed bedding. Lab. Anim. Sci. 48, 291–293.
Lycke, N., E landsson, L., Ekman, L., Schön, K., and Leande son, T.
(1999). Lack o J chain inhibi s he anspo o gu IgA and ab oga es he
de elopmen o in es inal an i oxic p o ec ion. J. Immunol. 163, 913–919.
Macphe son, a. J. (2000). A P imi i e T Cell-Independen Mechanism
o In es inal Mucosal IgA Responses o Commensal Bac e ia. Science (80-.
). 288, 2222–2226.
Macphe son, A.J., and Uh , T. (2004). Induc ion o p o ec i e IgA by
in es inal dend i ic cells ca ying commensal bac e ia. Science 303, 1662–
1665.
120
Macphe son, A.J., Geuking, M.B., and McCoy, K.D. (2012).
Homeland secu i y: IgA immuni y a he on ie s o he body. T ends
Immunol. 33, 160–167.
Maloy, K.J., Salaun, L., Cahill, R., Dougan, G., Saunde s, N.J., and
Pow ie, F. (2002). CD4+CD25+ TR Cells Supp ess Inna e Immune
Pa hology Th ough Cy okine-dependen Mechanisms. J. Exp. Med. 197,
111–119.
Man is, N.J., Rol, N., and Co hésy, B. (2011). Sec e o y IgA’s
complex oles in immuni y and mucosal homeos asis in he gu . Mucosal
Immunol. 4, 603–611.
Mazmanian, S.K., Round, J.L., and Kaspe , D.L. (2008). A mic obial
symbiosis ac o p e en s in es inal in lamma o y disease. Na u e 453,
620–625.
Me kenschlage , J., Ploquin, M.J., Eksmond, U., Anda gachew, R.,
Tho bo n, G., Filby, A., Peppe , M., E a old, B., and Kassio is, G. (2016).
S epwise B-cell-dependen expansion o T helpe clono ypes di e si ies he
T-cell esponse. Na . Commun. 7, 10281.
Mi pu i, J., Rae z, M., S u ge, C.R., Wilhelm, C.L., Benson, A.,
Sa ani, R.C., Hoope , L. V., and Ya o insky, F. (2013). P o eobac e ia-
speci ic IgA egula es ma u a ion o he in es inal mic obio a. Gu Mic obes
5, 37–41.
Mo ison, P.J., Bending, D., Fouse , L. a, W igh , J.F., S ockinge , B.,
Cooke, a, and Kullbe g, M.C. (2013). Th17-cell plas ici y in Helicobac e
hepa icus-induced in es inal in lamma ion. Mucosal Immunol. 00.
Mukhe jee, S., and Hoope , L. V. (2015). An imic obial de ense o he
in es ine. Immuni y 42, 28–39.
Re e ences
127
inac i a ion, no deple ion, o CD4+CD25+ T egula o y cells”. J. Immunol.
177, 2036–2037; au ho eply 2037–2038.
Zhang, X., De iaud, E., Jiao, X., B aun, D., Lecle c, C., and Lo-Man,
R. (2007). Type I in e e ons p o ec neona es om acu e in lamma ion
h ough in e leukin 10-p oducing B cells. J. Exp. Med. 204, 1107–1118.