scieee Open visual document viewer

Reciprocal interactions between Helicobacter hepaticus and the mouse immune system

Braga Areal, Romulo

Abstract

Vertebrates are host for a very large number of bacteria, notably in the intestinal lumen. This complex microbiota encompasses microorganisms that can cause pathology in immunocompromised individuals, but not in healthy hosts who remain silent carriers. The reciprocal interactions between the host and such microbes must involve components of active immune tolerance maintaining at check protective immune responses of the ridding type. We addressed this hypothesis by studying mouse-Helicobacter hepaticus interactions. H. hepaticus is a gut bacteria commonly found in mouse facilities and in the wild. Mice can be persistently colonized with this microbe, even from the first days of life, without developing signs of pathology or decrease in breeding efficiency. However, immunocompromised animals can develop colitis when colonized with H. hepaticus. In this work, we sought to identify the immunological mechanisms triggered upon colonization that ensure a stable relationship between healthy mice and H. hepaticus.(...)

Full text

Rômulo B aga A eal Disse a ion p esen ed o ob ain he Ph.D deg ee in Immunology Ins i u o de Tecnologia Química e Biológica An ónio Xa ie | Uni e sidade No a de Lisboa Inse he e an image wi h ounded co ne s Recip ocal in e ac ions be ween Helicobac e hepa icus and he mouse immune sys em Oei as, Oc obe , 2016 Rômulo B aga A eal Disse a ion p esen ed o ob ain he Ph.D deg ee in Immunology Ins i u o de Tecnologia Química e Biológica An ónio Xa ie | Uni e sidade No a de Lisboa Oei as, Oc obe , 2016 Recip ocal in e ac ions be ween Helicobac e hepa icus and he mouse immune sys em Resea ch wo k coo dina ed by: The wo k p esen ed on his hesis was suppo ed by Fundação pa a a Ciência e a Tecnologia – FCT, g an SFRH/BD/51883/2012 To Juliane and An ônio 4 Table o Con en s Acknowledgemen s .................................................................................... 7 Summa y .................................................................................................... 9 Sumá io .................................................................................................... 11 Lis o Abb e ia ions ................................................................................. 13 Lis o Figu es and Tables ........................................................................ 14 Chap e 1 : In oduc ion ............................................................................ 17 Recip ocal in e ac ions be ween he hos and he mic obio a ............... 17 1 – Immunological impac o he hos on he mic obio a ................ 17 2 - E ec s o he mic obio a on he hos ........................................ 21 2.1 - Age independen e ec s o he mic obio a on he hos .. 21 2.2 - Age dependen e ec s o he mic obio a on he hos .... 23 Helicobac e hepa icus ......................................................................... 25 Chap e 2 : IL-10 p omo es Helicobac e hepa icus pe sis ence in he gu , while An ibodies, T and B cells con ibu e equally o bac e ia elimina ion. 29 P elimina y no es ................................................................................. 30 Abs ac ............................................................................................... 31 In oduc ion .......................................................................................... 32 Resul s ................................................................................................ 34 Impac o he adap i e immuni y on H. hepa icus in he gu ........... 34 Impac o T cells on he esponse o H. hepa icus ......................... 36 Role o B cells and IgA on he esponse o H. hepa icus ............... 40 Discussion ........................................................................................... 43 5 Ma e ials and Me hods ......................................................................... 46 Mice .............................................................................................. 46 Helicobac e hepa icus cul u e and mice coloniza ion ................... 46 Helicobac e hepa icus quan i ica ion ............................................ 47 To al and speci ic Immunoglobulin quan i ica ion by ELISA ........... 48 Fecal Lipocalin-2 quan i ica ion ..................................................... 49 IgA FACS on li e H. hepa icus ...................................................... 49 Da a analysis ................................................................................ 49 Supplemen a y Ma e ial o Chap e 2 ................................................. 51 Chap e 3 : Pe ina al ansmission o Helicobac e hepa icus consolida es symbiosis h ough induc ion o li e-long immune ole ance media ed by Foxp3+ egula o y T cells .......................................................................... 57 P elimina y no es ................................................................................. 58 Abs ac ............................................................................................... 59 In oduc ion .......................................................................................... 60 RESULTS ............................................................................................ 62 Mo he o pup ansmission con e s long-las ing ole ance ha bene i s H. hepa icus ......................................................................... 62 The age bu no he mode o p imo-exposu e o H. hepa icus condi ions he hos esponse ............................................................. 64 Nei he ma e nal an ibodies no he mic obio a a e equi ed o pe ina ally induced ole ance o H. hepa icus .................................... 66 Long las ing immune ole ance o H. hepa icus upon mo he o pup ansmission is T eg media ed ........................................................... 68 Tole ance o H. hepa icus does no a ec he heal h o he hos ... 71 6 Pe ina al ansmission o H. hepa icus shapes he mic obio a o he hos in immuno-dependen and independen ways ............................ 75 Discussion ........................................................................................... 78 Ma e ials and Me hods ......................................................................... 82 Mice .............................................................................................. 82 Helicobac e hepa icus cul u e and mice coloniza ion ................... 82 Helicobac e hepa icus quan i ica ion ............................................ 83 To al and speci ic Immunoglobulin quan i ica ion by ELISA ........... 84 Induc ion o acu e coli is wi h DSS ................................................ 86 Se ological Analysis ...................................................................... 86 Fecal Lipocalin-2 quan i ica ion ..................................................... 86 D ug T ea men s ........................................................................... 86 Lamina P op ia Lymphocy es Isola ion .......................................... 87 IgA FACS on li e H. hepa icus ...................................................... 87 16S RNA analysis ........................................................................ 88 Da a analysis ................................................................................ 89 Supplemen a y Ma e ial o Chap e 3 ................................................. 91 Chap e 4 : Discussion ........................................................................... 105 Re e ences ............................................................................................. 112 7 Acknowledgemen s I would like o hank Jocelyne Demengeo , o you dedica ion and en husiasm wi h he wo k, o being an example o commi men and de e mina ion, and o you guidance and pa ience. You suppo and kindness we e c ucial in he di icul si ua ions, bo h pe sonal and wo k ela ed, and you inc edible abili y o ind solu ions o complex p oblems was decisi e o he ou come o his hesis. I am e y g a e ul o all he p esen and pas membe s o he FL lab, especially Ma ie Louise Be gman, Ana Ca a ina Ma ins, Ma ga ida A aújo, Vasco Co eia and Inês Cab al, ha we e di ec ly in ol ed in his wo k. Thank you o he commi men and suppo ! Thanks as well o Vânia Sil a, o he mos help ul discussions abou wo k, science and he uni e se, o F ancisca Fon es, o he g ea suppo , o Í is Ca amalho, o you encou agemen and he mos clea -minded and objec i e opinions, and o e e ybody else o c ea ing a g ea wo k en i onmen . Thanks o Ana Regalado, o sha ing many o he sad and happy momen s o his doc o al wo k. Thank you o you help wi h p o ocols, expe imen s and exis en ial c isis. You kindness and wise ad ice helped me ge h ough e e y hing. I am e y g a e ul o my hesis commi ee, Michael Pa khouse and Luis Teixei a, o help ul c i icism and g ea ad ice. Thanks o Jo ge Ca nei o, who inspi ed me o use R and lea n how o do a be e job in da a analysis. Thanks o Isabel Go do, Ka ina Xa ie and Miguel Soa es, o help ul discussions in ou “Mouse Mic obio a Mee ings”. Thanks as well o João Ba is a, Jo ge Sousa, Jessica Thompson, Ana Ri a Oli ei a, Bah iya Yilmaz and So ia Rebelo o all he help wi h expe imen s and discussions. Thanks o Manuela Co dei o, o all he help along he way, and o Élio Sucena, o he good ad ice and willingness o help. 8 I am in g ea deb o Manuel Rebelo, Joana Bom, So ia Leocadio, Ka en Be man, Ana Lúcia Ribei o, Adé i o Viei a, Lé i Pi es and many o he membe s o he IGC’s animal house acili y. Thanks o he pa ience and all he help s uc u ing complex expe imen s along his p ojec . Thanks o Ma ga ida Pa en e and Lígia Sa ai a o help wi h he cul u e o Helicobac e hepa icus and an igen p epa a ions. Thanks o my iends A non Jube g, Tiago Macedo and Rod igo Oli ei a, o helping me keep in ouch wi h B azil, sha ing many g ea momen s o es i i y and joy, and also o encou aging me in ha d imes. Thanks as well o Luciana Mo aes, o he encou agemen and all he hila ious discussions on he co ido , and o Thiago Ca alho, o good ad ice and o all he impo an pape s you kep sending me o e he yea s. Thanks o all my colleagues o he PhD p og am, especially PIBS 2011, o he g ea discussions du ing he classes and he g ea un in he AMeeGuS mee ings. Thanks o he “bas a dos” Özhan Özkaya, Ja ek Su kon and Ra ał Gumienny, o all he g ea imes and also o he long con e sa ions abou he mos andom subjec s. Thanks o you iendship and encou agemen . Ob igado a meus pais, Gilde e e José An ônio, e a meu i mão Rome o, pelo apoio nos momen os di íceis e en usiasmo nos momen os aleg es. Thanks o my wi e, Juliane Menezes, o being my pa ne and my bes iend o he las 8 yea s. Thanks o he g ea suppo and encou agemen , o helping me on long weekend hou s in he lab, o sha ing he good and he bad momen s, and o inspi ing me o always gi e my bes . And hanks o ou son, An ônio, o helping me inish his hesis on ime :) 15 Figu e 3.1 - Mo he o pup ansmission con e s long-las ing ole ance o H. hepa icus .................................................................................................. 63 Figu e 3.2 - The age bu no he mode o p imo-exposu e o H. hepa icus condi ions he hos esponse .................................................................... 65 Figu e 3.3 - Nei he ma e nal an ibodies no he mic obio a a e equi ed o pe ina ally induced ole ance o H. hepa icus ........................................... 67 Figu e 3.4 - Long las ing immune ole ance o H. hepa icus upon mo he o pup ansmission is T eg media ed ........................................................... 69 Figu e 3.5 – Tole ance o H. hepa icus does no a ec he heal h o he hos ................................................................................................................. 73 Figu e 3.5 – Tole ance o H. hepa icus does no a ec he heal h o he hos ................................................................................................................. 74 Figu e 3.6 - Pe ina al ansmission o H. hepa icus shapes he mic obio a o he hos in immuno-dependen and independen ways ............................. 76 Table S3.1 – IgM and IgG analysis by ELISA on ecal ex ac s ................ 91 Figu e S3.1 – ecal IgA om Adcol mice binds li e H. hepa icus .............. 92 Figu e S3.2 – IgA coa ed bac e ia in he eces o SPF, Nbcol and Adcol mice ......................................................................................................... 93 Figu e S3.3 – Ve y low amoun o H. hepa icus om eces is able o colonize SPF WT mice ............................................................................. 94 16 Figu e S3.4 – H. hepa icus ecal load 10 weeks pos -coloniza ion (Figu e 3.2 B - D) .................................................................................................. 95 Figu e S3.5 – Complemen a y o Figu e 3.4 A and B ............................... 96 Figu e S3.6 – Complemen a y o Figu e 3.4 C ......................................... 97 Figu e S3.7 – T egs a e deple ed in MLN, PP and La ge In es ine Lamina P op ia upon DT ea men in DEREG mice ............................................. 98 Figu e S3.10 – An i-H. hepa icus mucosal IgA is T-cell dependen ......... 101 Figu e S3.11 – an i-IL10R ea men is able o b eak ole ance o H. hepa icus ................................................................................................ 102 Figu e S3.12 – Complemen a y o Figu e 3.6 ......................................... 103 Figu e S3.13 – Complemen a y o Figu e 3.6 ......................................... 104 Figu e 4.1 - Recip ocal in e ac ions be ween H. hepa icus and he hos immune sys em on di e en de elopmen al s ages ................................ 110 Chap e 1 17 Chap e 1 : In oduc ion Helicobac e hepa icus is a gu bac e ium commonly ound in animal acili ies and in he wild. This bac e ium can cause pa hology in immunocomp omised animals, howe e Wild Type (WT) s ains a e no a ec ed, and can be pe sis en ly colonized wi h his mic obe, e en om he i s days o li e, wi hou signs o pa hology o dec ease in b eeding e iciency. The goal o his doc o al wo k was o iden i y he immunological mechanisms ha main ain such s able ela ionship be ween WT mice and H. hepa icus, and how each o ganism a ec s he o he . In o de o app oach his p oblem, we explo ed di e en componen s o he mucosal immune sys em, and hei ela ionship wi h he in es inal mic obio a. The ollowing chap e is an o e iew o he li e a u e ela ed o mic obio a- immuni y in e ac ions ele an o his wo k. Recip ocal in e ac ions be ween he hos and he mic obio a 1 – Immunological impac o he hos on he mic obio a The amazing di e si y o bac e ia in he mammalian gu poses a e y pa icula challenge o he hos , ha o disc imina ing be ween bene icial and dele e ious mic obes, as some o he la e could e en be pa hogenic. Du ing co-e olu ion o he hos and he mic obio a many mechanisms a ose o con ol he bac e ia in he gu (and o he su aces o he body), which gua an ee he p o ec ion o he hos and he s abili y o he bac e ial communi y (Hoope e al., 2012). In he gu , bac e ia a e s a i ied and isola ed om he hos issue by edundan mechanisms. The epi helial cell laye is he ul ima e ba ie , abo e which he e is he mucus laye , p esen in he small and la ge 18 in es ine (Johansson e al., 2008; Vaishna a e al., 2011). Mucus p o eins a e sec e ed by in es inal goble cells, and sel -assemble o o m a igh ly packed inne laye in he colon, wi h a hicke and loose ex e nal laye abo e i . Only a loose laye is p esen in he small in es ine, bu in bo h places a 50µm egion in he mucus, jus abo e he epi helium, is ound almos de oid o bac e ia, in con as o he bac e ia- ich egion abo e i . This inne laye is ich in an imic obial pep ides and IgA, which p e en s bac e ial con ac wi h he epi helium (Vaishna a e al., 2011). An imic obial pep ides (AMPs) a e e ec o molecules p oduced and sec e ed a he epi helial su ace. They o m a b oad class o molecules, some cons i u i ely exp essed, like α-de ensins and lysozyme, and o he s induced by mic obial sensing, like c yp din- ela ed sequences (CRS)- pep ides and RegIIIγ (Mukhe jee and Hoope , 2015). Exp ession and sec e ion o RegIIIγ by epi helial cells is induced by mic obial p oduc s ia Toll-Like Recep o s (TLR), and impai men o TLR signaling leads o educed exp ession o RegIIIγ, which in u n ab oga es he bac e ia- ee zone abo e he epi helium (Vaishna a e al., 2011). AMPs can be b oadly exp essed, o p oduced by specialized cell ypes, like Pane h cells, which a e mos ly ound in he c yp s o he small in es ine, and elease g anules con aining AMPs like lysozyme and α-de ensins. Deg anula ion o Pane h cells is a highly con olled p ocess, and occu s mos ly h ough sensing o In e e on-γ (IFN-γ) (Fa in e al., 2014). Despi e he mechanisms in place o con ine bac e ia abo e he epi helium, he in es inal issue is no s e ile. Bac e ia ha c oss he epi helium a e usually phagocy osed and killed by mac ophages in he Lamina P op ia (Kelsall, 2008). In addi ion, hese bac e ia can be engul ed by Dend i ic Cells (DCs), which also sample mic obes om he lumen (Fa ache e al., 2013). DCs ca ying li e bac e ia can p esen hei an igens o T and B cells in he Mesen e ic Lymph Nodes (MLN), ac i a ed Chap e 1 19 lymphocy es will sp ead h ough all mucosal su aces (Macphe son and Uh , 2004). Mic obes wi h highe p opensi y o c oss he in es inal ba ie , o li ing in close p oximi y o i , a e mo e likely o ge sampled and u he con olled by ac i a ed T and B cells and a ge ed by IgA (Mi pu i e al., 2013). IgA is he mos common an ibody in mucosal su aces (Man is e al., 2011). In newbo ns, be o e he Gu Associa ed Lymphoid Tissue (GALT) is ma u e, IgA in he ma e nal milk p o ides p o ec ion and helps shape he mic obio a ha colonizes he neona al in es ine (Rogie e al., 2014). A e he ma u a ion o he GALT, and in esponse o he mic obio a, endogenous IgA is p oduced in g ea amoun s, binding o bac e ia inside he lumen and con e ing p o ec ion agains in asion (Bunke e al., 2015; Macphe son and Uh , 2004; Man is e al., 2011). IgA is sec e ed by plasma cells in he Lamina P op ia, p edominan ly as dime s, which a e anspo ed h ough he Polyme ic Immunoglobulin Recep o (pIgR) o he gu lumen (Kae zel, 2014). The e, IgA can bind o an igens and p e en hei nega i e e ec s on he hos , o example by neu alizing chole a oxin (Lycke e al., 1999). IgA can also a ec he mo ili y and in asi eness o pa hogens (Fo bes e al., 2008, 2011), o ins ance by binding o molecules on he bac e ia su ace used o a ach o he mucus (Pe e son e al., 2007). Indeed, i was ound ha he appea ance o IgA ha could bind o Segmen ed Filamen ous Bac e ia (SFB) in he gu co ela ed wi h a dec ease in bac e ial load (Jiang e al., 2001). Fu he mo e, absence o IgA esul s in expansion o oppo unis s con ained in he mic obio a (Mi pu i e al., 2013; Suzuki e al., 2004), which illus a es he ole o his an ibody in he main enance o homeos asis in he gu . The di e en ia ion o B lymphocy es in o IgA sec e ing cells (plasma cells) can occu wi h o wi hou T cell help, as mice wi hou T cells can p oduce IgA ha bind o bac e ia in he gu (Macphe son, 2000). Mo e 20 po en immune esponses occu hough when bo h T and B cells a e ac i a ed and help each o he . An igen p esen a ion by B cells inc eases T cell esponses (Me kenschlage e al., 2016), and T cell help in ge minal cen e s allows B cells o unde go class-swi ch ecombina ion (CSR) and soma ic hype mu a ion. This, h ough he p ocess o a ini y ma u a ion, will imp o e he binding o he sec e ed an ibody o he inducing an igen (Faga asan e al., 2010). Bac e ia ha induce s ong esponses in he hos usually igge T cell dependen IgA p oduc ion, as is he case o SFB (Lécuye e al., 2014). T cells a e majo playe s in he immune sys em, and make up ano he laye o e ec o esponse. T cells can kill in ec ed cells, imp o e an ibody esponses h ough he p omo ion o ge minal cen e eac ions, CSR and a ini y ma u a ion on B cells, and hey can modi y and egula e he inna e immune esponse h ough he p oduc ion o cy okines (Khade e al., 2009). Upon ac i a ion, T cells can di e en ia e in o di e en p o iles, ha will dic a e how hey espond o u he s imula ion and whe e in he body hey will mig a e o (B omley e al., 2008). Th2 cells p oduce In e leukin-4 (IL-4) and p omo e immuni y agains pa asi e in ec ions. Th1 cells p oduce In e e on-γ (IFN-γ), which ac i a es mac ophages and p omo es esis ance o many in ec ions (Khade e al., 2009), and can also induce he sec e ion o AMPs by Pane h Cells (Fa in e al., 2014). IL-17 p oducing T cells (Th17) ha e been implica ed in he p o ec ion agains many pa hogens and in he con ol o he mic obio a composi ion, as he cy okines hey p oduce can ec ui neu ophils o he gu and also induce he p oduc ion o AMPs by epi helial cells (Khade e al., 2009). Chap e 1 21 2 - E ec s o he mic obio a on he hos The gu mic obio a also modi ies and is essen ial o he no mal de elopmen o many issues in he hos , including he immune sys em. Mice bo n and aised in he absence o mic obes (ge m ee - GF) exhibi a se ies o de ec s when compa ed o con en ionally aised animals. GF mice ha e enla ged ceca, educed in es inal mo ili y, longe illi and sho e c yp s in he in es ine, educed amoun o AMPs, absence o Isola ed Lymphoid Follicles (ILF) in he Lamina P op ia, educed numbe o in aepi helial lymphocy es, and smalle Peye ’s pa ches (PPs) and MLN (Gensollen e al., 2016). All hese di e ences e idence he impac he mic obio a has on he ma u a ion o he hos , and pa icula ly o he GALT. Mos o hese p oblems can be e e ed by coloniza ion o GF mice wi h a con en ional mic obio a, bu some cellula de ec s canno be co ec ed once hese mice age pas a c i ical ime window. 2.1 - Age independen e ec s o he mic obio a on he hos Lymphocy es exp essing αβ T cell ecep o s, CD4+ and CD8+, a e g ea ly dec eased in numbe s in he Lamina P op ia and In aepi helial compa men s in he in es ines o GF compa ed o con en ionally aised mice. This phenomenon can be e e ed i adul GF mice a e colonized wi h no mal mouse mic obio a, bu no comple ely upon coloniza ion wi h human o a gu mic obes, showing how he in ica e ela ionship o he hos immuni y and mic obio a was shaped by co-e olu ion (Chung e al., 2012). Lamina P op ia Lymphocy es p oduce less IL-10, IFN-γ, IL-4 and IL- 17 in GF compa ed o con en ional mice, which could be e e ed by adul - coloniza ion wi h con en ional lo a. Pa icula ly Th17 cells, which a e impo an o he p oduc ion o IgA in he gu , can be es o ed o no mal 22 le els in he Lamina P op ia o adul GF mice wi h monocoloniza ion wi h SFB (Gabo iau-Rou hiau e al., 2009). The homeos asis in he gu is dependen on e ec o mechanisms, which should be con olled o p e en exace ba ed immune eac ions. CD4+ αβT cells exp essing he ansc ip ion ac o Foxp3 can supp ess immune eac ions and a e designa ed Regula o y T cells (T eg). T eg a e he majo sou ce o he immuno egula o y cy okine IL-10 in he gu (Rub so e al., 2008) and can espond o commensal an igens (La h op e al., 2011). The equency o Foxp3+ cells inside he CD4+ αβT cell popula ion eaches some o he highes le els in he colonic Lamina P op ia o con en ionally aised mice. Fu he mo e, T eg le els a e educed upon an ibio ic ea men and a e d ama ically dec eased in GF animals (A a ashi e al., 2011). Coloniza ion o adul GF mice wi h con en ional mic obio a, o wi h a combina ion o commensals o he genus Clos idium, can es o e T eg le els in he colonic Lamina P op ia. O he g oups o bac e ia we e also shown o induce T eg in mice, like Bac e oides agilis (Round and Mazmanian, 2010), which is a human commensal, and Lac obacillus mu inus (Tang e al., 2015). The le els o IgA-p oducing B cells in he Lamina P op ia o GF mice a e also g ea ly educed (Hap elmeie e al., 2010). This pheno ype can also be e e ed by coloniza ion o adul GF mice wi h a con en ional mic obio a (Gensollen e al., 2016), and could also be achie ed by monocoloniza ion, wi h he numbe o IgA+ plasma cells being main ained inc eased in he Lamina P op ia e en a e bac e ia elimina ion (Hap elmeie e al., 2010). Chap e 1 23 2.2 - Age dependen e ec s o he mic obio a on he hos S ong immune esponses o in ec ion usually equi e Th1 di e en ia ion and IFN-γ p oduc ion. In neona es howe e , Th1 esponses a e usually impai ed. Neona al B cells p oduce high amoun s o IL-10 upon TLR s imula ion (Walke and Golds ein, 2007; Zhang e al., 2007), which p e en s DC ac i a ion and IL-12 p oduc ion (Sun e al., 2005). Mu ine neona al T cells p oduce high le els o IL-4 and IL-13 upon ac i a ion, which a o Th2 pola iza ion (Zaghouani e al., 2009). Th17 de elopmen is also impai ed in neona es, since IL-6 s imula ion is essen ial o his ype o pola iza ion and newly o med T cells (Recen Thymic Emig an s - RTEs) a e less sensi i e o IL-6 han ma u e T cells (Pai a e al., 2013). Addi ionally, neona al T cells ha e a highe p opensi y o become T egs han adul T cells, con e ing in high equency o Foxp3+ T egs upon TCR s imula ion (Wang e al., 2010). All hese p ope ies make neona es e y suscep ible o in ec ions, bu a he same ime, hey o e he bes en i onmen o o ge symbio ic ela ionships h ough he de elopmen o ole ance. The e o e, he coloniza ion wi h he mic obio a in he neona al s age shapes he immune sys em o he hos in unique ways. In GF mice, absence o mic obio a causes accumula ion o in a ian Na u al Kille T cells (iNKT) wi h a p o-in lamma o y pheno ype in he lung and in es ine, leading o suscep ibili y o ai way hype esponsi eness and coli is. Coloniza ion wi h a con en ional mic obio a du ing he i s weeks o li e, bu no a adul age, could p e en iNKT accumula ion and suscep ibili y o disease (An e al., 2014; Gensollen e al., 2016; Olszak e al., 2012). Simila ly, dis u bance o he mic obio a by an ibio ic ea men ea ly in li e causes inc eased suscep ibili y o In lamma o y Bowel Disease (IBD) in humans (K onman e al., 2012; Shaw e al., 2010). 24 Ano he pheno ype obse ed in GF mice is a high le el o se um IgE and inc eased suscep ibili y o An igen-Induced O al Anaphylaxis. Coloniza ion ea ly in li e wi h a complex mic obio a could e e he hype IgE pheno ype in GF animals, ye his was no he case i coloniza ion was pe o med in adul s (Cahenzli e al., 2013). Speci ic Pa hogen F ee (SPF) mice, which ha e a complex mic obio a bu a e ee o known pa hogens, show accumula ion o Helios- Foxp3+ T eg (supposedly con e ed ou side o he hymus) in he lungs in he i s week o li e, a pheno ype ha was no obse ed in GF animals. T ea men o SPF neona es o wo weeks wi h an i-PD-L1 could p e en he Helios- T eg accumula ion in he lungs and inc eased suscep ibili y o ai way in lamma ion (Gollwi ze e al., 2014). This indica es ha he lung mic obio a induces he gene a ion o T egs ea ly in li e, which con e s a long-las ing p o ec i e e ec on he lungs. Fu he mo e, neona al mice ea ed wi h an ibio ics ha e inc eases suscep ibili y o alle gic as hma la e in li e, which does no happen i ea men was pe o med in adul animals (Russell e al., 2012). A simila associa ion be ween ea ly li e an ibio ic ea men and he isk o as hma de elopmen was also epo ed in humans (Risnes e al., 2011). Accumula ion o T egs on he neona al skin has been shown o be essen ial o he gene a ion o immune ole ance o commensal a his si e. T egs speci ic o commensal an igens we e ound in high equency in he skin o newbo n-colonized mice, and shown o p e en expe imen ally induced skin in lamma ion (Scha schmid e al., 2015). In addi ion, mice ea ed in he neona al pe iod wi h an ibio ics displayed inc eased suscep ibili y o expe imen al pso iasis in adul hood (Zan i e al., 2015). This could be pa ially e e ed by co-housing he ea ed animals wi h non- ea ed con ols, p o iding e idence ha he dis u bance in he mic obio a caused he inc eased suscep ibili y o disease. Chap e 2 31 Abs ac Helicobac e hepa icus is a pa hobion ha li es in close associa ion wi h he mouse in es inal epi helium. Despi e abundan e idence ha H. hepa icus induces a s ong adap i e immune esponse in he mice, he impac o his esponse on he bac e ia li ing in he gu is la gely unknown, as well as why his bac e ium is no elimina ed by his esponse. We es ed i he adap i e immuni y impac s H. hepa icus in he in es ine by colonizing mice lacking di e en componen s o he adap i e immune sys em, and e i ying he e ec on he bac e ial numbe s in he gu . We ound ha B and T lymphocy es impac bac e ial load in he gu , wi h a simila con ibu ion. An ibodies pa icipa e in his e ec , bu do no accoun o he whole ou come, which indica es ha T and B cells also con ibu e o bac e ia elimina ion in an an ibody-independen manne . Absence o IL-10 esul s in an inc eased esponse, which can lead o bac e ia elimina ion. We conclude ha IL-10 p omo es he pe sis ence o H. hepa icus in he gu , while T and B cells con ol bac e ial numbe s. Ou s udy p o ides new insigh s in o how lymphocy es con ol bac e ia in he mic obio a and main ain in es inal homeos asis, which could help in he unde s anding and p e en ion o gu immunopha ologies. 32 In oduc ion Some o he la ge amoun o bac e ia in he mic obio a li es in close associa ion wi h he hos . One o hose is Helicobac e hepa icus, which is b oadly sp ead in he wild and animal acili ies (Wasimuddin e al., 2012), and was ound o be associa ed wi h he hos epi helium (Chow and Mazmanian, 2010). I would be expec ed, hence, ha he hos would p oduce an immune esponse o a oid uncon olled expansion o his bac e ium, so close o he su ace o he body. I his esponse exis s, howe e , i is no s ong enough o elimina e his mic obe, since mice a e posi i e o li e upon coloniza ion (Solnick and Schaue , 2001; Wasimuddin e al., 2012; Wha y and Fox, 2006). I is clea ha H. hepa icus induces a T cell esponse in mice, pa icula ly in he absence o immune egula ion (Cahill e al., 1997; Kullbe g e al., 1998), ye he in o ma ion on he gu esponse o his bac e ium emains limi ed, hough i is known o induce a ecal IgA esponse (Wha y e al., 1998). Sec e o y IgA is hough o ac as a ba ie , egula ing he mic obio a and es ic ing he en ance o in es inal an igens in o he blood (Pabs , 2012). Some epo s ha e highligh ed he impo ance o IgA on he hos p o ec ion (Fo bes e al., 2008, 2011; Lycke e al., 1999), and al hough he e is e idence ha T cell (pa icula ly T egs) a e necessa y o op imal IgA p oduc ion and homeos asis o he mic obio a (Kawamo o e al., 2014), o he s ha e claimed ha only pa o he IgA in he gu is T cell-dependen (Bunke e al., 2015) and ha i only a ge s pa icula g oups o bac e ia in he gu (Mi pu i e al., 2013). He e, we sough o unde s and he impac o he immune esponse on H. hepa icus load in he gu . We ound ha speci ic IgA o H. hepa icus Chap e 2 33 is T-cell dependen and nega i ely egula ed by IL-10. In he absence o IgA, speci ic sec e o y IgM is ound in he eces, bu a a much lowe absolu e concen a ion. B and αβT lymphocy es, oge he wi h IgA, seem o con ibu e simila ly o H. hepa icus load educ ion, as he la e inc eases g adually wi h he emo al o each componen sepa a ely. These esul s e idence how complex and mul ilaye ed he immune esponse o bac e ia is in he gu . 34 Resul s Impac o he adap i e immuni y on H. hepa icus in he gu Mice a e easily colonized wi h H. hepa icus h ough con ac wi h con amina ed eces, majo ly h ough cop ophagy (Li ings on e al., 1998). To examine i coloniza ion by his no mal ou e esul s in a speci ic esponse in he gu , and o es i his esponse a ec s he bac e ia inside he in es ine, we colonized adul (10 weeks old) B6 WT and Rag2-/- mice by ga age wi h H. hepa icus-posi i e eces, and e alua ed he bac e ial load in he eces o hese mice on he cou se o 16 weeks by qPCR. H. hepa icus coloniza ion occu s in all animals, wi h a peak in bac e ial load be ween 1 and 2 weeks pos -coloniza ion (Fig. 2.1A). Howe e , while he bac e ial load was conside ably s able in Rag2-/- animals a e his ini ial shi , a s eady dec ease in bac e ial load was obse ed in WT mice, eaching le els almos 2 logs lowe han hose in Rag2-/- mice (Fig. 2.1A). This di e ence was no due o a ia ions in he mic obio a o WT and Rag2-/- mice, as co-housing o animals o hese wo geno ypes om 4 o 9 weeks o age be o e coloniza ion p oduced e y simila esul s (Fig. 2.1B). These da a indica e ha he coloniza ion wi h H. hepa icus induces an adap i e immune esponse in he mice, and ha his esponse impac s he bac e ia in he gu . Chap e 2 35 Figu e 2.1 - Impac o he adap i e immuni y on H. hepa icus in he gu Adul mice (10 weeks old) WT and Rag2-/-, sepa a ely aised (A) o co-housed o 5 weeks (B), we e colonized wi h H. hepa icus by eces o al ga age. Bac e ial load was measu ed on eces by qPCR up o 16 weeks pos -coloniza ion, and analyzed as ela i e abundance = (H. hepa icus 16S / eubac e ia 16S). p < 001, linea eg ession (week 1 - 16). Colo ed do s = indi idual mice, whi e ci cles = mean, e o ba s = SEM, do ed line = linea eg ession om 1-16 weeks, shade = linea eg ession con idence in e al. N = 10 pe g oup, pooled om wo independen expe imen s. ND = no de ec ed. 36 Impac o T cells on he esponse o H. hepa icus Because i is known ha H. hepa icus induces a po en T cell esponse in he gu (Cahill e al., 1997), and ha his esponse is e en s onge in he absence o IL-10 (Kullbe g e al., 1998), we nex es ed he impac o he T cell esponse on H. hepa icus in he in es ine using mice de icien in ei he αβT cells (TCRβ-/-) o IL-10 (IL-10-/-). We obse ed a highe H. hepa icus load in he absence o T cells, compa ed o WT mice, bu s ill lowe han he le els in Rag2-/- mice (Fig. 2.2A). Acco dingly, he esponse in IL-10-/- mice had a la ge e ec on he H. hepa icus load, wi h le els d opping below he de ec ion limi in mos o he animals a e 11 weeks o coloniza ion (Fig. 2.2A). Taken oge he , hese esul s e idence ha T cells play a key ole in he elimina ing esponse o H. hepa icus in he gu . WT mice displayed high i e s o an i-H. hepa icus IgA on eces h oughou he coloniza ion (Fig. 2.2B), and his IgA was able o bind o he su ace o li e H. hepa icus (Fig. S2.6), hence sugges ing ha i can a ec he bac e ia in he gu . Meanwhile, IL-10-/- mice showed ecal IgA i e s almos 2 logs highe han WT (Fig. 2.2B), which co ela ed wi h he H. hepa icus load educ ion (Fig. 2.2D). Con e sely, speci ic IgA was almos absen in animals lacking T cells, showing ha he induc ion o an i-H. hepa icus mucosal IgA is T cell dependen (Fig. 2.2B). An inc ease o abou 1 log in o al ecal IgA p oduc ion was seen in WT and IL-10-/- animals 1 week a e coloniza ion, bu also in TCRβ-/- wi h a delay (Fig. 2.2C). This was co ela ed wi h he le els o lipocalin-2 (lcn-2), a bioma ke o in lamma ion in he gu , in IL-10-/- and TCRβ-/- mice, bu no in WT animals (Fig. 2.2E and F and Fig. S2.5A). Lcn2 le els did no co ela e wi h he educ ion in H. hepa icus le els in he gu (Fig. S2.5C) o wi h speci ic IgA le els (Fig. S2.5B), sugges ing ha he in lamma ion igge ed by H. hepa icus is sepa a ed om he esponse a ge ing his bac e ia. Chap e 2 37 Figu e 2.2 - Impac o αβT cells and IL-10 on he esponse o H. hepa icus 38 Fig.2.2 - Impac o αβT cells and IL-10 on he esponse o H. hepa icus A) Adul mice (10 weeks old) TCRβ-/- and IL-10-/- we e colonized wi h H. hepa icus by eces o al ga age. Bac e ial load was measu ed on eces by qPCR as desc ibed in Fig.1. WT and Rag2-/- load (same as in Fig.1 A) is shown o compa ison. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (pai wise compa isons o linea eg essions, p alues co ec ed using single-s ep me hod). Colo ed do s = indi idual mice, whi e ci cles = mean, e o ba s = SEM, do ed line = linea eg ession om 1-16 weeks, shade = linea eg ession con idence in e al. N = 10 pe g oup, pooled om wo independen expe imen s. B and C) An i-H. hepa icus IgA i e (B) and o al ecal IgA (C) we e e alua ed by ELISA on WT, TCRβ-/- and IL-10-/- mice shown in A, om 0 – 16 weeks pos -coloniza ion. S a is ical compa ison was pe o med using A ea Unde he Cu e (AUC), calcula ed pe mice wi h apezoid me hod and a e aged pe week. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). Colo ed do s = indi idual mice, whi e ci cles = mean, e o ba s = SEM, do ed line = local polynomial eg ession i ing (loess), shade = loess con idence in e al. D) Compa ison o speci ic IgA i e s and bac e ial load in mice shown in A. Colo ed do s = indi idual samples, line = linea eg ession, shade = linea eg ession con idence in e al, p alue and R2 o he linea eg ession shown on he g aph. E and F) Fecal Lipocalin-2 le els we e e alua ed by ELISA in he eces o he mice shown in A, om 0 – 16 weeks pos -coloniza ion (2 – 16 weeks o Rag2-/- mice). E) whi e ci cles = mean, e o ba s = SEM, lines connec he means. F) Do s ep esen indi idual mice. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). AUC = A ea Unde he Cu e, calcula ed pe mice wi h apezoid me hod and a e aged pe week. G and H) An i-H. hepa icus se um Ig i e (G) and o al se um Ig concen a ion (H) we e measu ed in WT, TCRβ-/- and IL-10-/- mice shown in A, a 16 weeks pos - coloniza ion. Do s ep esen indi idual mice, g oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). Chap e 2 39 Analysis a 16 weeks pos -coloniza ion showed high i e s o an i-H. hepa icus IgG and IgA in he se um o WT and IL-10-/- animals, sugges ing ha his bac e ium c osses he in es inal ba ie , elici ing a sys emic immune esponse (Fig. 2.2G). Simila ly o he mucosal esponse, speci ic IgA le els we e highe in IL-10-/- animals compa ed o WT, bu no IgG, sugges ing ha IL-10 could impac speci ically he IgA p oduc ion. Simila le els o speci ic IgM we e ound in WT, IL-10-/- and TCRβ-/- mice, bu speci ic IgG and IgA we e no ound in he la e (Fig. 2.2G). To al Immunoglobulin le els we e simila be ween he g oups analyzed, wi h a small inc ease in o al IgA le els in IL-10-/- mice (Fig. 2.2H). 40 Role o B cells and IgA on he esponse o H. hepa icus Gi en he nega i e co ela ion be ween he IgA esponse and H. hepa icus load, we es ed i he esponse o H. hepa icus would be a ec ed by he emo al o an ibodies om he sys em, using mice de oid o B cells (JhT-/- mice), o by only emo ing IgA, using AID-/- mice (which can’ pe o m class-swi ch ecombina ion, hence only IgM can be p oduced). In he absence o B cells he H. hepa icus ecal load was highe han in WT animals, bu lowe han in Rag2-/- (Fig. 2.3A), sugges ing ha B cells impac he bac e ial load, bu do no accoun o he whole e ec . In e es ingly, he absence o IgA in AID-/- esul s in an in e media e pheno ype be ween he B cell de icien and WT (Fig. 2.3A), indica ing ha IgA a ec s he bac e ial load bu also ha B cells ha e o he e ec s besides an ibody p oduc ion, since he IgM le els, speci ic and o al, we e e y low in AID-/- a e coloniza ion (Fig. 2.3B and C). Fecal lcn-2 le els in JhT-/- and AID-/- (Fig. 2.3D) we e e y simila o he alues ound in WT mice (Fig. 2.2E), indica ing no e iden inc ease in gu in lamma ion. To di ec ly es he impac o sec e ed an ibodies on he bac e ial load, excluding any possibly e ec o IgM in AID-/- mice, we used AID-/-uS-/- animals, which ha e B cells bu canno sec e e an ibodies. We ound ha he H. hepa icus ecal le els we e highe in AID-/-uS-/- mice compa ed o WT, bu lowe han hose in Rag2-/- mice (Fig. 2.4A). To con i m his e ec , we analyzed he H. hepa icus mucosal load in he ileum and colon o he same mice, a e 20 weeks o coloniza ion. No di e ence be ween he g oups was obse ed in he ileum, whe e H. hepa icus was ound in lowe equencies (Fig. 2.4B). Howe e , he bac e ial load eached high le els in he colon o Rag2-/- animals, abou 2 logs highe han in WT mice, wi h in e media e alues in AID-/-uS-/- (Fig. 2.4B). These da a show ha sec e ed an ibodies can impac di ec ly he bac e ial load in he gu , bu do no accoun o he whole e ec . Chap e 2 47 Helicobac e hepa icus quan i ica ion The ollowing p ime s we e used in qPCR eac ions: H. hepa icus 16S wd: GCATTTGAAACTGTTACTCTG, H. hepa icus 16S e : CTGTTTTCAAGCTCCCCGAAG, 417bp p oduc (Pe nicki-Ocwieja e al., 2009); Eubac e ia 16S wd: ACTCCTACGGGAGGCAGCAGT, Eubac e ia 16S e : ATTACCGCGGCTGCTGGC, ~180bp p oduc , 18S wd: CATTCGAACGTCTGCCCTAT, 18S e : CCTGCTGCCTTCCTTGGA, 137bp p oduc (Vaishna a e al., 2011). H. hepa icus (Hh) 16S copy numbe was es ima ed using plasmid s anda d cu e, o al bac e ia (eubac) 16S copy numbe was es ima ed using a s anda d cu e cons uc ed wi h E. coli K12 DNA, and hos DNA amoun in ng was es ima ed using a s anda d cu e cons uc ed wi h in es inal issue DNA. All eac ions con ained s anda d cu es o absolu e quan i ica ion. Fecal H. hepa icus amoun is exp essed as log10 o he a io Hh 16S copies/ eubac 16S copy. Mucosal H. hepa icus amoun is exp essed as log10 o he a io Hh 16S copies/ ng o hos DNA. DNA om ecal pelle s o ~40mg (a e age 40.2mg ± 10.3, measu ed om 100 samples) and om in es inal issue (3 cm piece o ileum and colon, a e washing luminal con en wi h PBS) was ex ac ed using NZYTech Tissue gDNA ex ac ion ki (NZYTech), wi h an ini ial s ep a 95°C. Fo quan i ica ion, 2ng o ecal DNA and 10ng o mucosal DNA we e used. P ime s we e used a 0.5µM in he eac ion, con aining 5µL o iTaq Uni e sal SYBR G een Supe mix (Bio-Rad), 2µL o sample and wa e o a inal olume o 10µL. qPCR condi ions: 95°C - 3min; 45 cycles o 95°C - 30s, 60°C - 30s, 72°C - 36s; ollowed by a mel ing cu e o 65 - 95°C wi h 0.5°C inc ease e e y 5s. All eac ions we e p epa ed in 384 well ha d shell pla es (Bio-Rad), on ice, in less han one hou , o minimize p ime dime o ma ion, and un immedia ely a e p epa a ion on a CFX384 eal- ime PCR de ec ion sys em (Bio-Rad). 48 To al and speci ic Immunoglobulin quan i ica ion by ELISA To quan i y o al and H. hepa icus speci ic ecal an ibodies, ecal ex ac s we e p epa ed om eshly collec ed o -80°C s o ed eces. Fecal pelle s o ~50mg we e collec ed om each mice (a e age 56.6mg ± 15.4, measu ed om 100 samples), and homogenized in 500µL o PBS con aining a p o ease inhibi o cock ail (P8340, Sigma-Ald ich), o a solu ion o abou 100mg/mL. Homogena es we e cen i uged a 16,000G o 10min a oom empe a u e, and supe na an s we e s o ed a -20°C un il u he use. Soluble H. hepa icus an igens (SHelAg) we e p epa ed as p e iously desc ibed (Kullbe g e al., 1998). A e cul u ed o 5 days in blood-aga pla es, bac e ia we e ha es ed in PBS solu ion, washed and lysed in a F ench P ess. The solu ion was cen i uged a 8,000G o 30 min a 4°C, he supe na an was il e ed s e ile wi h a 0.22µm po e size il e and p o ein con en was de e mined using BCA p o ein assay. The p epa a ion was s o ed a -80°C. ELISA was pe o med using high binding 384 well ELISA pla es (Ul aC uz). Fo o al Ig quan i ica ion, pla es we e coa ed wi h Goa an i- Mouse IgM, IgG o IgA polyclonal an ibodies (Sou he n Bio ech), and o an i-H. hepa icus Ig quan i ica ion, coa ing was done using 10µg/mL o SHelAg. Pla es we e coa ed o e nigh a 4°C, washed in PBS 0.05% Tween20 and blocked wi h 2% BSA solu ion in PBS. Fecal ex ac s we e added undilu ed (speci ic Ig) o 10 old dilu ed ( o al Ig) o pla es and dilu ed 7 imes, 3 old each ime. Fo speci ic ecal IgA quan i ica ion, a e e ence sample pooled om 5 adul colonized B6 was used in all assays. Fo speci ic se um IgM, IgG and IgA, a e e ence se um sample o colonized IL- 10-/- dilu ed 1:210 was used in all assays. A e o e nigh incuba ion a 4°C, pla es we e washed in PBS 0.05% Tween20 and incuba ed wi h Goa an i- Chap e 2 49 Mouse IgM, IgG o IgA conjuga ed wi h HRP. Reac ions we e e ealed wi h TMB (BD) and s opped wi h 0.1M H2SO4. Fecal Lipocalin-2 quan i ica ion Quan i ica ion o ecal Lipocalin-2 was pe o med on ecal ex ac s, ob ained as desc ibed abo e, using he ki manu ac u e ins uc ions (Mouse Lipocalin-2/NGAL DuoSe ELISA, ca alog numbe : DY1857, R&D). IgA FACS on li e H. hepa icus H. hepa icus was cul u ed as desc ibed abo e, and 106 CFU we e used pe assay. Bac e ia was washed once in PBS, pelle ed (12,000G, 5min), esuspended in ecal ex ac (p epa ed as desc ibed o ELISA assay) om naï e o 16 weeks colonized Adul B6 mice, and incuba ed on ice o 30min. Bac e ia we e hen washed in PBS and incuba ed o 15min on ice wi h Goa an i-Mouse IgA (Sou he n Bio ech), labeled using Alexa647 Labeling Ki (The mo Fishe Scien i ic). The bac e ia was washed again and esuspended in a PBS solu ion con aining 5µM o SYTO 9 (Molecula P obes). E en s we e acqui ed on a CyAn ADP Analyze (Beckman Coul e ) and analyzed on FlowJo So wa e (T ee S a ). Analysis was pe o med ga ing on li e bac e ia, which we e SYTO 9 B igh , as con i med by coun e s aining wi h 45µM o p opidium iodide (Molecula P obes), and excluding e en s wi h high pulse wid h. Da a analysis Da a and s a is ical analysis we e pe o med using R so wa e e sion 3.2.5 (R Co e Team, 2014). Mul iple compa isons we e done using K uskal- Wallis and Mann–Whi ney–Wilcoxon es wi h he Benjamini and Hochbe g p alue co ec ion. Mul iple compa isons o linea eg essions we e pe o med using linea model and he unc ion glh (Gene al linea hypo heses and mul iple compa isons), using single-s ep p ocedu e o p 50 alue co ec ion, in package mul comp (Ho ho n e al., 2008). G aphs we e made in R so wa e using he package ggplo 2 (Wickham, 2009). Chap e 2 51 Supplemen a y Ma e ial o Chap e 2 Figu e S2.1 - To al 16S le els in ecal DNA a e H. hepa icus coloniza ion (complemen a y o Figu es 2.1A, 2.2A and 2.3A). To al 16S (quan i ied using p ime s ha ecognize a conse ed egion in all bac e ia 16S) in DNA ex ac ed om eces o mice o he indica ed geno ype om 0 – 16 weeks pos -coloniza ion wi h H. hepa icus. To al 16S alues we e used o no malize he numbe o H. hepa icus 16S p esen ed as ela i e abundance in igu es 2.1A, 2.2A and 2.3A. Do s = indi idual mice, whi e ci cles = mean, e o ba s = SEM, do ed line = o e all mean, shade = o e all s anda d de ia ion. N = 10 o WT, Rag2-/-, TCRβ-/- and IL-10-/-, N = 9 o JhT-/- and AID-/-, pooled om wo independen expe imen s. 52 Geno ype In e cep slope Signi icance codes* (p=0.05) es ima e SE es ima e SE Rag2-/- -2.764 0.166 -0.026 0.017 a TCRβ-/- -3.550 0.166 0.002 0.017 b JhT-/- -3.351 0.171 -0.017 0.017 b AID-/- -3.618 0.171 -0.035 0.017 c WT -3.355 0.118 -0.097 0.012 d IL-10-/- -3.786 0.170 -0.183 0.019 e Mul iple R-squa ed: 0.53 ; Adjus ed R-squa ed: 0.52 *g oups wi h he same le e a e no di e en a he signi icance le el Table S2.1 - Linea eg ession coe icien s (Fig 2.2A and Fig 2.3A) Figu e S2.2 - Linea eg ession esiduals plo (Fig 2.2A and Fig 2.3A) Chap e 2 53 Geno ype In e cep slope Signi icance codes* (p=0.05) es ima e SE es ima e SE Rag2-/- -2.948 0.211 -0.041 0.030 a AID-/-uS-/- -3.492 0.156 -0.067 0.018 b WT -3.823 0.110 -0.085 0.013 c Mul iple R-squa ed: 0.52 ; Adjus ed R-squa ed: 0.51 *g oups wi h he same le e a e no di e en a he signi icance le el Table S2.2 - Linea eg ession coe icien s (Fig 2.4A) Figu e S2.3 - Linea eg ession esiduals plo (Fig 2.4A) 54 Figu e S2.4 – Rep esen a i e indi idual plo s (Fig 2.2A and Fig 2.3A) Indi idual plo s o H. hepa icus ecal load om 1 – 16 weeks o coloniza ion in 3 ep esen a i e mice om each geno ype in igu es 2.2A and 2.3A. Do ed line = linea eg ession, shade = linea eg ession con idence in e al. Chap e 2 55 Figu e S2.5 – Lipocalin-2 co ela ion o IgA and load (complemen a y o Fig. 2.2) Indi idual samples om mice o he indica ed geno ypes om 0-16 weeks (A and B) and om 1-16 weeks (C). Blue line = linea eg ession, shade = linea eg ession con idence in e al, p alue and R2 o he linea eg ession indica ed on he g aphs. 56 Figu e S2.6 – IgA om colonized mice binds o he su ace o H. hepa icus FACS analysis o li e H. hepa icus ( om cul u e), s ained wi h SYTO9 (nucleic acid s aining, memb ane pe meable) (A) o SYTO9 + an i-mouse IgA (B), o p e-incuba ed wi h ecal ex ac ( .e.) om naï e (C) o 16 weeks colonized Adul B6 WT mice (D) be o e s aining wi h SYTO9 + an i-mouse IgA. E en s shown we e ga ed on SYTO9 b igh (li e) e en s wi h low pulse wid h. Chap e 3 63 Figu e 3.1 - Mo he o pup ansmission con e s long-las ing ole ance o H. hepa icus A) Adul B6 mice (10 weeks old) we e colonized wi h H. hepa icus by ga age wi h posi i e eces. Newbo n coloniza ion was achie ed na u ally by mo he o pup ansmission, which happens in he i s days o li e. B) H. hepa icus mucosal load in he ileum and colon o Adcol and Nbcol mice was assessed by Q-PCR using H. hepa icus 16S speci ic p ime s, no malized o hos DNA (measu ed using 18S speci ic p ime s). G oup – N.( ime o coloniza ion): Adcol – 4.(13w), 5.(26w); Nbcol – 6.(13w), 4.(17w), 2.(18w). * p < 0.05 (Wilcoxon es ). C – D) An i-H. hepa icus and o al ecal IgA we e analyzed by ELISA in he eces o Adcol (C) and Nbcol (D) mice a 4 and 16 weeks pos - coloniza ion. Do s ep esen measu emen s and lines connec dilu ions o he same sample. Adcol N = 10 in bo h poin s, Nbcol N = 6 a 4w and N = 5 a 16w. E) An i-H. hepa icus ecal IgA i e s in Adcol and Nbcol mice a indica ed ages we e es ima ed by ELISA. Whi e symbol = mean. E o ba = SEM. Adcol: N = 10 om 10 - 26w o age. Nbcol - N.(age): 6.(4w), 11.(5w), 24.(6w), 16.(7w), 10.(9w), 10.(10w), 10.(12w), 3.(13w), 5.(16w), 10.(22w), 10.(34w) 64 esponse, and ha his esponse is inhibi ed in animals colonized ea ly in li e. The age bu no he mode o p imo-exposu e o H. hepa icus condi ions he hos esponse Low dose and ch onic exposu e o o eign an igens has been p oposed o p omo e Immune ole ance, by inducing T cell ane gy, exhaus ion o di e en ia ion in o T eg. I is concei able ha pups o H. hepa icus colonized mo he s a e con inuously inges ing low numbe o H. hepa icus o ganisms, while ou p o ocol o gas ic ga age would deli e suddenly a la ge numbe o H. hepa icus in adul s. To add ess his disc epancy we i s colonized adul mice wi h i a ed amoun s o H. hepa icus-posi i e ecal p epa a ions. The inoculum used in igu e 1 con ained abou 106 CFU (es ima ed by Q-PCR and cul u e) and se ial dilu ions e ealed ha as long as he inoculum con ained an es ima ed 100 CFU (10,000x dilu ion), SPF mice could be colonized wi h H. hepa icus (Fig. S3.3), indica ing absence o coloniza ion esis ance. Mo e impo an o his s udy, adminis a ion o an es ima ed 100CFU by o al ga age o adul mice led o eadily de ec able H. hepa icus speci ic IgA in he eces wi h i e s in he ange o 101-102 a 4 weeks pos -coloniza ion (Fig. 3.2A), simila o hose ob ained wi h undilu ed inoculum (Fig. 3.1E). Then, we pe o med gas ic ga age in newbo n SPF animals using inoculum es ima ed a 2x105 CFU (20ul o an undilu ed ecal p epa a ion). To u he gain insigh on he ime window when immune ole ance a he han esponse ollows exposu e o H. hepa icus, pups we e inocula ed a di e en ages, om 1 o 4 weeks o age (Fig. 3.2B). Success ul coloniza ion was con i med by qPCR 10 weeks pos -inocula ion (Fig. S3.4). S ikingly, in a-gas ic ga age ep oduced mo he ansmission as pups inocula ed be o e 3 weeks o age did no de elop high le els o ecal H. hepa icus-speci ic IgA (Fig. 3.2C and D). In con as , pas his age, Chap e 3 65 inocula ion led o eadily de ec able immune esponses as indica ed by H. hepa icus speci ic IgA i e app oxima ing, albei lowe han, hose ob ained in Adcol animals (Fig. 3.2C and 3.1E ). The g oup o mice inocula ed a 3 weeks o age was he e ogeneous, wi h some animals un esponsi e and o he s esponsi e (Fig. 3.2C). We conclude ha i espec i e o he mode o Figu e 3.2 - The age bu no he mode o p imo-exposu e o H. hepa icus condi ions he hos esponse A) Adul (9w old) B6 we e ga aged wi h a eced p epa a ion om H. hepa icus posi i e animals, dilu ed 10,000x in PBS. Mice we e con i medly posi i e o H. hepa icus 7 days a e ga age. 4 weeks a e coloniza ion, eces we e analyzed o an i-H. hepa icus and To al IgA by ELISA. N = 4. B - D) Mice a 1-4 weeks o age we e colonized wi h H. hepa icus by eces o al ga age. 10 weeks a e coloniza ion, eces we e analyzed o an i-H. hepa icus and To al IgA by ELISA. N = 8, 13, 9 and 8 espec i ely. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 66 ansmission and he inoculum load, mice in ec ed ea ly in li e de elop long las ing immune ole ance o H. hepa icus , and ha he ansi ion om non- esponde o esponde s a e occu s a ound weaning age, possibly lagging o se e al weeks be o e ull compe ence. Nei he ma e nal an ibodies no he mic obio a a e equi ed o pe ina ally induced ole ance o H. hepa icus Weaning is associa ed wi h he end o ma e nal an ibody supply and a die change leading o majo al e a ions in he mic obiome composi ion. We nex add essed whe he hese changes we e ela ed o he physiological swi ch we e idenced abo e. To p oduce immune-compe en animals bo n o an ibody-de icien dams, young adul Rag2-/- emales we e colonized wi h H. hepa icus by in a-gas ic ga age, and ma ed wi h WT males. Con ols we e bo n o WT mo he s also colonized as adul s. The p ogenies we e moni o ed when adul s, om 6 o 18 weeks o age. Analysis o eces ex ac con i med animals we e H. hepa icus posi i e and showed ha while hey displayed no mal o al IgA concen a ion, none p oduced H. hepa icus speci ic IgA (Fig. 3.3A), demons a ing ha ma e nal an ibodies a e dispensable o he induc ion o long las ing ole ance o H. hepa icus in newbo ns. To es he con ibu ion o he mic obio a o he hos esponsi eness o H. hepa icus, adul WT ge m- ee mice we e mono-colonized wi h cul u ed H. hepa icus, con i med posi i e, and ei he le o age, o se in b eeding o p oduce p ogenies mono- colonized a bi h. Analysis a 9 weeks pos coloniza ion e ealed ha he mic obio a is dispensable o obus an i-H. hepa icus speci ic IgA p oduc ion in animals ha had been monocolonized when adul s, and o long las ing ole ance induc ion and main enance in animals ha had been mono-colonized pe ina ally (Fig. 3.3B - C). We conclude ha induc ion o immune ole ance upon p imo-in ec ion wi h H. hepa icus is a newbo n in insic ea u e. In u n, his inding sugges s ha he main enance o such Chap e 3 67 immune ole ance in o adul age is an in insic p ope y o he immune sys em. Figu e 3.3 - Nei he ma e nal an ibodies no he mic obio a a e equi ed o pe ina ally induced ole ance o H. hepa icus A) Adul WT and Rag2-/- emales we e colonized wi h H. hepa icus and b ed o WT males. Pups om hese b eedings we e analyzed a 6, 12 and 18 weeks o age o an i- H. hepa icus and To al IgA by ELISA. N=10, 10 and 5 o WT mo he a he indica ed ages, and N=12 o Rag2-/- mo he a all he ime poin s. B - C) Adul ge m- ee mice we e colonized wi h pu e H. hepa icus cul u e and analyzed 9 weeks la e . Monocolonized mice we e b ed o p oduce Newbo n-colonized pups, which we e analyzed a 9 weeks o age. An i-H. hepa icus and To al IgA we e assessed by ELISA. Adul : n = 9; Newbo n: n = 15. * p < 0.05 (Wilcoxon es ). 68 Long las ing immune ole ance o H. hepa icus upon mo he o pup ansmission is T eg media ed The esul s abo e, indica ing ha he e y long las ing immune ole ance o he pe sis en pa hobion H. hepa icus upon pe ina al exposu e is a hos in insic p ope y, e oked ei he immunological igno ance o obus ly con olled immuni y. Bo h he immunosupp essi e cy okine IL-10 and T eg cells a e igge ed upon adul exposu e o H. hepa icus (Be g e al., 1996; Kullbe g e al., 2002; Rub so e al., 2008), ye as shown he e, hey do no p e en an immune esponse o his bac e ia. We easoned hese pa hways may be mo e obus ly ec ui ed du ing pe ina al li e, and es ed he ole o hese componen s by loss o unc ion app oaches. IL10-/- newbo n-colonized mice we e analyzed om 4 o 15 weeks o age. An i-H. hepa icus IgA was e iden in eces o Nbcol IL-10-/- mice al eady a 5 weeks o age, wi h a con inuous inc ease a e ha (Fig. 3.4A). To al ecal IgA was also inc eased In Nbcol IL-10-/- mice wi h age (Fig. S3.5A). Analysis o ecal H. hepa icus load in hose mice showed a con inuous dec ease in H. hepa icus numbe s wi h age (Fig. S3.5B), and al hough hey had dia hea h ough he cou se o he analysis, hei weigh inc eased con inuously (Fig. S3.5C). These esul s indica e ha IL-10 is equi ed o he induc ion and/o main enance o immune ole ance o H. hepa icus. In ac , we ound ha 10 weeks old Nbcol WT mice ha ecei ed 4 weekly 1mg doses o an i-IL-10R an ibody s a ed p oducing low le els o an i-H. hepa icus IgA 10 weeks a e he beginning o ea men , unlike un ea ed li e ma e con ols (Fig. S3.11), co obo a ing he idea ha IL-10 is in ol ed in he main enance o his ole ance. Addi ionally, hese indings exclude nega i e selec ion as a mechanism o explaining he lack o esponse in pe ina ally colonized mice, indica ing ha ac i e ole ance a he han igno ance media es his e ec . Chap e 3 69 Figu e 3.4 - Long las ing immune ole ance o H. hepa icus upon mo he o pup ansmission is T eg media ed A) An i-H hepa icus ecal IgA was analyzed by ELISA om 4 o 15 weeks o age in IL10-/- newbo n colonized mice. N=14. Linea model: y~log(x), line = eg ession, shade = con idence in e al; eg ession coe icien : p < 0.01; R2 = 0.63; F s a is ic: p < 0.01. B) Adul WT mice, newbo n colonized wi h H. hepa icus, we e injec ed one ime i.p. wi h PBS o 500μg o an i-CD25 (PC61 clone). An i. H. hepa icus ecal IgA was assessed a 0, 4 and 8 weeks pos - ea men (12, 16 and 20 weeks o age). PBS: n=5; an i-CD25: n=6. Line = linea eg ession, shade = con idence in e al; g oup compa ison: p < 0.01; mul iple R2 = 0.58; F s a is ic: p < 0.01. Rep esen a i e o wo independen expe imen s. C) B6 WT and DEREG (Foxp3-DTR) mice colonized a bi h ecei ed 1μg o Diph he ia Toxin (DT) i.p. a 6 weeks o age, and ecal IgA i e s we e measu ed by ELISA on he indica ed ages. N(weeks): WT+DT = 6(6), 19(9-10); DEREG+DT = 9(6), 24(9-10), pooled om 2 independen expe imen s. Line = linea eg ession, shade = con idence in e al; g oup compa ison: p < 0.01; mul iple R2 = 0.49; F s a is ic: p < 0.01. D) F equency o TCRβ+ CD4+ Foxp3+ cells in he la ge in es ine lamina p op ia o adul WT mice ei he SPF, o colonized wi h H. hepa icus when adul o a bi h. n=6 pe g oup. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es ). 70 To add ess he ole o CD4 egula o y T cells in he main enance o immune ole ance o H. hepa icus, we i s adminis a ed, in a single injec ion, he deple ing an i-CD25 an ibody (PC61) o young adul mice ha had been colonized a bi h. This p ocedu e deple es mo e han 50% o T egs in he in es ine and lymphoid issues (Wang e al., 2015; Zelenay and Demengeo , 2006). An i-H. hepa icus speci ic IgA could be de ec ed in he eces o he ea ed mice a 4 and 8 weeks pos -injec ion, bu no in un ea ed con ols (Fig. 3.4B). These esul s indica e ha immune esponses in animals ha had been colonized a bi h a e main ained a check by a CD25 exp essing cellula subse . As CD25 is exp essed by a la ge subse o T eg bu also by ecen ly ac i a ed T cells and some B cells, we nex analyzed animals gene ically enginee ed o exp ess he diph he ia oxin (DT) ecep o speci ically in Foxp3+ cells (Foxp3-DTR / DEREG). Newbo n-colonized WT and DEREG mice we e ea ed wi h one injec ion o 1µg DT a 6 weeks o age. This ea men leads o a ansien bu subs an ial dec ease in Foxp3+ cell numbe s in he mucosal compa men al eady a 2 days pos -injec ion (Fig. S3.7), and caused a apid appea ance o an i-H. hepa icus IgA in eces o DEREG mice om 1 o 4 weeks pos ea men , bu no in WT li e ma e con ols (Fig. 3.4C). To al ecal IgA was ansien ly inc eased in DEREG mice 1 week a e ea men (Fig. S3.6A), and H. hepa icus load was sligh ly bu signi ican ly dec eased in he mucosa o he ileum and colon o DEREG mice 9 weeks a e he single ea men (Fig. S3.6B). Toge he hese da a indica e ha p imo-exposu e du ing pe ina al li e leads o a e y obus ole ogenic immune esponse, ensu ed by he ec ui men o Foxp3+ T eg ha supp ess, in an IL-10 dependen manne , o he wise ully compe en e ec o s cells. Indeed, Foxp3+ cell equency was signi ican ly inc eased in he colonic Lamina P op ia o Nbcol mice, compa ed o SPF and Adcol mice, all analyzed a adul age (Fig. 3.4D). Finally, we es ed i TLR2 was in ol ed in he H. hepa icus induced ole ance, as i has been shown o be in ol ed in Chap e 3 71 mic obial induced T egs in he gu (Round e al., 2011). TLR2-/- mice Newbo n-colonized wi h H. hepa icus did no moun a de ec able an i-H. hepa icus IgA esponse when adul s, indica ing H. hepa icus p omo es T eg in a TLR2 independen manne (Fig. S3.8). Taken oge he , hese esul s es ablish ha H. hepa icus immune e asion elies on he induc ion o T eg, a mechanism obus ly a o ed by he newbo n physiological s a e and sel - pe pe ua ed along hos ma u a ion, beyond ep oduc i e age. Tole ance o H. hepa icus does no a ec he heal h o he hos Because H. hepa icus was ound in highe equency in he colon o Nbcol mice (Fig. 3.1B), which does no seem o moun a esponse o his bac e ia, we checked i he e was indica ion o H. hepa icus ansloca ion o hos issues, analyzing he numbe o H. hepa icus 16S copies eco e ed in he Mesen e ic Lymph nodes (MLN) and gallbladde DNA ex ac s om Adcol and Nbcol mice. This analysis indica ed ha H. hepa icus seems o ansloca e a a simila equency o he MLN o Adcol and Nbcol mice, bu H. hepa icus DNA was ound mo e equen ly in he gallbladde o Nbcol mice (Fig. 3.5A). Addi ional analysis e ealed high i e s o an i-H. hepa icus IgM, IgG and IgA in he se um o Adcol mice, wi h inc eased le els o o al IgM and IgG (Fig. 3.5B and C). In con as , Nbcol mice had le els o speci ic IgM simila o hose o naï e mice (SPF), which sugges hese we e no induced bu a he na u al IgM (Fig. 3.5B). An i-H. hepa icus IgA was no de ec ed in he se um o Nbcol mice, as wells as in naï e mice, in acco dance o wha was ound o IgA in he gu (Fig. 3.1E). An i-H. hepa icus IgG was ound in he se um o Nbcol mice, albei a le els mo e han 10 old lowe han hose o Adcol mice. Collec i ely, hese esul s sugges ha pe ina al coloniza ion wi h H. hepa icus induces no only mucosal bu also sys emic ole ance. Ne e heless, despi e inc eased H. hepa icus accumula ion, Nbcol mice did no p esen a se ological s a e indica i e o pa hology, wi h no mal le els o AST and ALT (Fig. 3.5D), 72 simila o Adcol and SPF mice, wi h he same being ue o o he se ological pa ame e s (Fig. S3.9A). Likewise, ecal alues o Lipocalin-2, which a e inc eased in he ace o gu pa hology, we e no mal in Nbcol mice, simila ly o SPF and Adcol mice (Fig. 3.5E). Also, induc ion o coli is using DSS showed no di e ence be ween hese g oups in suscep ibili y o gu in lamma ion (Fig. 3.5F and Fig. S3.9B). Taken oge he , hese s udies allow us o conclude ha ole ance o H. hepa icus does no a ec nega i ely he hos . Chap e 3 79 Nbcol mice, bu hese mice had no e iden signs o li e o o he pa hology (Fig. 3.5D and Fig. S3.9A). These da a sugges ha he ole ance o H. hepa icus happens also in a sys emic le el, p e en ing exace ba ed T-cell eac ions inside he body. The capaci y o he mice o become ole an o H. hepa icus dec eases wi h age, as coloniza ion om 3 weeks onwa ds esul s in speci ic IgA p oduc ion in adul hood (Fig. 3.2C and D). This could be explained by epo s ha neona al T cells a e mo e p one o become T egs, a ea u e ha dec eases a e 2 weeks o age (Wang e al., 2010). Fu he mo e, Recen Thymic Emig an s (RTEs), which a e he p e e en ial p ecu so s o T egs di e en ia ed in he pe iphe y (Pai a e al., 2013), a e inc eased in he lymphoid o gans o neona es and dec ease p og essi ely wi h age (Hale e al., 2006). The e o e, H. hepa icus seems o explo e an in insic p opensi y o neona al mice o become ole an , inducing ea ly high le els o T egs ha will la e supp ess esponses o hese bac e ia. Likewise, i was ound ha lung mic obio a induce T egs in he i s 2 weeks o age in mice, wi h implica ions o alle gen ole ance (Gollwi ze e al., 2014), ha T egs speci ic o mic obial an igens can be induced in he skin by bac e ial coloniza ion in 7 days old mice (Scha schmid e al., 2015), and ha Helicobac e pylo i coloniza ion in newbo ns esul s in absence o gas ic in lamma ion la e in li e (A nold e al., 2011). Despi e he pa icula p opensi ies o ole ance gene a ion in he neona e sys em, no all pe ina al gu bac e ia coloniza ion esul s in ole ance. Fo example, mice de elop a mucosal IgA esponse o SFB e en when colonized pe ina ally wi h i (Jiang e al., 2001), and newbo n mice de elop s ong in lamma o y esponses when in ec ed wi h Ye sinia en e ocoli ica (Sie ke e al., 2014). A g ea p opo ion o bac e ia a e ound coa ed wi h IgA in he gu o adul mice, in T-cell dependen and independen manne s (Bunke e al., 2015), which sugges s ha he 80 gene a ion o an igen-speci ic T egs and supp ession o IgA esponses in he gu a e pa icula ea u es o a selec g oup o mic obes. Ne e heless, he ole o T egs on he IgA gene a ion in he gu emains con o e sial. Some epo s indica e ha T egs p omo e he gene a ion o In es inal IgA (Cong e al., 2009; Kawamo o e al., 2014; Tsuji e al., 2009), while o he s a gue ha T egs p e en ge minal cen e o ma ion (Chung e al., 2011; Lin e man e al., 2011). As some s udies ha e iden i ied T-cell dependen and independen IgA esponses in he gu , wi h p oposed di e ences in he ole o he IgA gene a ed in each, he T eg ole as p omo e o supp esso o gu IgA could as well be di e en ia ed by he ype o IgA gene a ed. As T-cell dependen IgA would equi e di e en ia ed, an igen-speci ic T cells, mos likely Th17 (Hi o a e al., 2013), T egs could ac as supp esso s o an igen-speci ic IgA by supp essing he speci ic T-cell esponse. In ou model, an i-H. hepa icus ecal IgA esponses we e T cell dependen (Fig. S3.10), which suppo s he idea ha T egs could p e en hese esponses ups eam o ge minal cen e eac ions. We ound ha he na u al me hod o coloniza ion by H. hepa icus in he mice, om mo he o newbo ns, esul s in he gene a ion o T egs, ha supp ess he immune esponses o his bac e ia. This esul s in an absence o speci ic IgA, and also allows his bac e ia o each highe le els in he in es inal mucosa, hence ensu ing highe p obabili y o dissemina ion and su i al o his mic obe. This mechanism would explain he high incidence o H. hepa icus in ec ion in animal acili ies and in he wild, whe e he Helicobac e genus is highly p e alen (Wasimuddin e al., 2012). A pa allel model was also p oposed o H. pylo i, which was un il ecen ly highly p e alen in human popula ions (Blase e al., 2008). H. pylo i in ec ion would be ha mless, o e en bene icial, when occu ing e y ea ly in he de elopmen , bu ha m ul when happening a la e s ages, o he mos Chap e 3 81 p oblems associa ed wi h his in ec ion come om he uncon olled immune esponse o he bac e ia (A nold e al., 2011). In he unde s anding o how he mucosal immune sys em wo ks, one should ake in o accoun how his sys em e ol ed and was shaped by he mic obial wo ld in e ac ing wi h i . As s udies wi h wild mice sugges , Helicobac e spp. a e pa o he indigenous lo a o he mice, which p obably co-e ol ed wi h his o ganism. As i happens, due o p oblems wi h immunode icien mice hese bac e ia we e pu ged om he mic obio a o expe imen al animal acili ies, which could ha e a g ea e ec in o all e alua ions o he mechanisms exis ing in he gu o con ol and bene i om bac e ia. Indeed, i was ound ha ee-li ing mice ha e a hicke , be e de eloped mucus laye in he colon, wi h a be e sepa a ion o bac e ia om he epi helium (Jakobsson e al., 2015). Fu he mo e, we obse ed ha pe ina al coloniza ion wi h H. hepa icus shapes he mic obio a o he mice in a pa icula way, which could e en be mo e a o able o he hos . Fo example, we ound ha , in WT mice, H. hepa icus pe ina al coloniza ion p omo es a d ama ic dec ease in he equency o he amily E ysipelo ichaceae (Fig. 3.6B), which was ound in highe equencies in mice wi h a poo me abolic p o ile in he in es ine (Fleissne e al., 2010; Tu nbaugh e al., 2009). Addi ionally, we ound ha pe ina ally colonized mice had inc eased le els o T egs in he la ge in es ine Lamina P op ia (Fig. 3.4D), which also poin s o a bene i o he hos . The e o e, pe ina al coloniza ion wi h H. hepa icus gua an ees an ea ly educa ion o he immune sys em h ough gene a ion o T egs and ensu es a li e-long symbiosis be ween his wo species. In his ligh , a mo e comp ehensi e analysis o he indigenous mic obio a o mice and humans may help o iden i y o he g oups o bac e ia wi h simila p ope ies and he capaci y o main ain and imp o e he obus ness o homeos asis in he gu . 82 Ma e ials and Me hods Mice Wild ype (WT), Rag2-/-, IL10-/-, TLR2-/-, TCRβ-/- and DEREG (Lahl e al., 2007) mice we e all in C57BL/6 backg ound, b ead in ou speci ic pa hogen ee (SPF) acili y, which excludes Helicobac e hepa icus. All expe imen s in ol ing H. hepa icus coloniza ion we e pe o med in a dedica ed oom. Ge m ee (GF) C57BL/6 mice we e aised in he IGC gno obiology acili y in axenic isola o s (La Calhene/ORM). Adul s GF mice we e ans e ed o s e ile ISOcages (Tecniplas ) o use in expe imen s, and hei mic obiological s a us was con i med mul iple imes along he s udy. Helicobac e hepa icus cul u e and mice coloniza ion Helicobac e hepa icus e e ence s ain (CIP 104102) was ob ained om he Biological esou ces cen e o he Pas eu Ins i u e. G ow h was pe o med in 10% ho se blood-aga (HBA, Oxoid) pla es, supplemen ed wi h 12.5 mg/L ancomycin, 0.3 mg/L polymyxin B, 6.3 mg/L ime hop im and 5.0 mg/L ampho e icin B, a 37°C, unde mic oae ophilic condi ions (6% O2, 7% CO2, 3.5% H2 and 83.5% N2) gene a ed by an Anoxoma sys em (MART Mic obiology). Bac e ia we e ha es ed a e 5 days o cul u ed in PBS solu ion and numbe s we e es ima ed by OD quan i ica ion. Mice we e colonized by o al ga age wi h 100µL o bac e ia suspension a 109 CFU/mL in PBS, using an animal eeding needle wi h silicone ip, size 20G x 1.5’’ (Cadence Science). Coloniza ion was con i med by PCR on ecal DNA using H. hepa icus 16S speci ic p ime s: wd: GCATTTGAAACTGTTACTCTG, e : CTGTTTTCAAGCTCCCCGAAG, 417bp p oduc (Pe nicki-Ocwieja e al., 2009). Fecal DNA was p epa ed ei he wi h NZY ech issue gDNA ki (NZY ech), wi h a p e-s ep o 95°C, Chap e 3 83 using 5ng o eac ions, o by a simple boiling me hod, as desc ibed elsewhe e (T ue e al., 2000). B ie ly, o one ecal pelle was added 700ul o a 25mM NaOH, 0.2mM EDTA solu ion wi h pH=12, and ollowed he p ocedu e: 95°C, 3min, o ex, 95°C, 7min, o ex, cen i uga ion 16,000G 2min, ake 50µl o supe na an and add o 50µl o 40mM T is HCl solu ion, wi h pH=5. 2µl o his inal sample was used in PCR eac ions. PCR was pe o med in 25µl, wi h he inal concen a ions: 1.25mM MgCl2, 0.2mM dNTP, 0.4µM o each p ime , 1.5U o GOTaq and 2µl o empla e (P omega). Reac ions we e pe o med on a MyCycle (BioRad) wi h he ollowing condi ions: 95°C 5min, ollowed by 36 cycles o 95°C - 30s, 60°C - 45s, 72°C - 1min, wi h a inal ex ension o 72°C - 10min. P oduc s we e isualized on a 2% aga ose gel (Lonza). To ep oduce coloniza ion h ough cop ophagy, mice we e colonized using a p epa a ion o H. hepa icus posi i e eces, om mice p e iously colonized wi h cul u ed H. hepa icus. Fecal pelle s we e homogenized in PBS a a a io o 1 pelle o 400µL (~ 100mg/mL) and il e ed in 100µm mesh. Each adul mouse ecei ed 100µL o his ecal p epa a ion by o al ga age. 1, 2 and 3 weeks old mice we e colonized wi h 20ul o ecal suspension using a 24G x 25mm long eeding needle (Fine Science Tools), ben ~30° o acili a e inse ion in o he o al ca i y (Bu chbach e al., 2007). Adul GF we e colonized wi h cul u ed H. hepa icus by o al ga age, and con i med posi i e using PCR on ecal DNA. Monocolonized mice we e b ed in ISOcages o p oduce pups newbo n-monocolonized wi h H. hepa icus, which we e kep in ISOcages a e weaning un il 9 weeks o age. Helicobac e hepa icus quan i ica ion The ollowing p ime s we e used in qPCR eac ions: H. hepa icus 16S wd: GCATTTGAAACTGTTACTCTG, H. hepa icus 16S e : CTGTTTTCAAGCTCCCCGAAG, 417bp p oduc (Pe nicki-Ocwieja e al., 84 2009); 18S wd: CATTCGAACGTCTGCCCTAT, 18S e : CCTGCTGCCTTCCTTGGA, 137bp p oduc (Vaishna a e al., 2011). H. hepa icus (Hh) 16S copy numbe was es ima ed using plasmid s anda d cu e, and hos DNA amoun in ng was es ima ed using a s anda d cu e cons uc ed wi h in es inal issue DNA, measu ed using Qubi dsDNA Assay (Molecula P obes). All eac ions con ained s anda d cu es o absolu e quan i ica ion. H. hepa icus amoun is exp essed as log10 o he a io Hh 16S copies/ ng o hos DNA, unless o he wise s a ed. In es inal mucosa, MLN and gallbladde DNA was ex ac ed using NZYTech Tissue gDNA ex ac ion ki (NZYTech), wi h an ini ial s ep a 95°C. Fo quan i ica ion, 10ng o DNA was used. P ime s we e used a 0.5µM in he eac ion, con aining 5µL o iTaq Uni e sal SYBR G een Supe mix (Bio- Rad), 2µL o sample and wa e o a inal olume o 10µL. qPCR condi ions: 95°C - 3min; 45 cycles o 95°C - 30s, 60°C - 30s, 72°C - 36s; ollowed by a mel ing cu e o 65 - 95°C wi h 0.5°C inc ease e e y 5s. All eac ions we e p epa ed in 384 well ha d shell pla es (Bio-Rad), on ice, in less han one hou , o minimize p ime dime o ma ion, and un immedia ely a e p epa a ion on a CFX384 eal- ime PCR de ec ion sys em (Bio-Rad). To al and speci ic Immunoglobulin quan i ica ion by ELISA To quan i y o al and H. hepa icus speci ic ecal an ibodies, ecal ex ac s we e p epa ed om eshly collec ed o -80°C s o ed eces. Fecal pelle s o ~50mg we e collec ed om each mice (a e age 56.6mg ± 15.4, measu ed om 100 samples), and homogenized in 500µL o PBS con aining a p o ease inhibi o cock ail (P8340, Sigma-Ald ich), o a solu ion o abou 100mg/mL. Homogena es we e cen i uged a 16,000G o 10min a oom empe a u e, and supe na an s we e s o ed a -20°C un il u he use. Chap e 3 85 Soluble H. hepa icus an igens (SHelAg) we e p epa ed as p e iously desc ibed (Kullbe g e al., 1998). A e cul u ed o 5 days in blood-aga pla es, bac e ia we e ha es ed in PBS solu ion, washed and lysed in a F ench P ess. The solu ion was cen i uged a 8,000G o 30 min a 4°C, he supe na an was il e ed s e ile wi h a 0.22µm po e size il e and p o ein con en was de e mined using BCA p o ein assay. The p epa a ion was s o ed a -80°C. ELISA was pe o med using high binding 384 well ELISA pla es (Ul aC uz). Fo o al Ig quan i ica ion, pla es we e coa ed wi h Goa an i- Mouse IgM, IgG o IgA polyclonal an ibodies (Sou he n Bio ech), and o an i-H. hepa icus Ig quan i ica ion, coa ing was done using 10µg/mL o SHelAg. Pla es we e coa ed o e nigh a 4°C, washed in PBS 0.05% Tween20 and blocked wi h 2% BSA solu ion in PBS. Fecal ex ac s we e added undilu ed (speci ic Ig) o 10 old dilu ed ( o al Ig) o pla es and dilu ed 7 imes, 3 old each ime. Se um samples we e assayed s a ing om a dilu ion o 1:200. Fo speci ic ecal IgA quan i ica ion, a e e ence sample pooled om 5 adul colonized B6 was used in all assays. Fo speci ic se um IgM, IgG and IgA, a e e ence se um sample o colonized IL-10-/- dilu ed 1:210 was used in all assays. A e o e nigh incuba ion a 4°C, pla es we e washed in PBS 0.05% Tween20 and incuba ed wi h Goa an i- Mouse IgM, IgG o IgA conjuga ed wi h HRP. Reac ions we e e ealed wi h TMB (BD) and s opped wi h 0.1M H2SO4, and ead a 450nm in a Mul iskan GO Mic opla e Spec opho ome e (The mo Scien i ic). Ti e s we e calcula ed as he dilu ion a 10% o he maximum signal (no malized o a e e ence in all samples), using in e pola ion om a 4-pa ame e logis ic eg ession i ing. 86 Induc ion o acu e coli is wi h DSS Mice we e ea ed wi h Dex an Sul a e Sodium (DSS) (36,000-50,000 Da, MP Biomedicals), dilu ed in d inking wa e , o 7 days. DSS solu ion was changed o a new one e e y 2 days. Weigh was sco ed o 18 days. Se ological Analysis Mice we e eu hanized wi h CO2 and blood was collec ed om he in ahepa ic ena ca a in o hepa ine-coa ed collec ion ubes. Assays we e pe o med on plasma, on he same day o ex ac ion. Se ological analyses we e pe o med on a Siemens Ad ia 1200 Chemis y Analyze by DNA ech, Po ugal, on he ollowing pa ame e s: To al, Di ec and Indi ec Bili ubin, Alanine ansaminase (ALT), Aspa a e ansaminase (AST), Alcaline Phospha ase, Lac ic Dehyd ogenase (LDH), To al P o ein and Albumin. Fecal Lipocalin-2 quan i ica ion Quan i ica ion o ecal Lipocalin-2 was pe o med on ecal ex ac s, ob ained as desc ibed abo e, using he ki manu ac u e ins uc ions (Mouse Lipocalin-2/NGAL DuoSe ELISA, ca alog numbe : DY1857, R&D). D ug T ea men s Mice we e ea ed wi h an i-CD25 (PC61 clone, IGC’s An ibody Facili y) wi h one injec ion o a 500µg dose in ape i oneally (i.p.); wi h an i- IL-10R (1B1.2 clone, IGC’s An ibody Facili y) wi h 4 injec ions, weekly, o 1mg i.p.; and wi h Diph he ia Toxin om Co ynebac e ium diph he iae (Sigma) wi h one injec ion o a 1µg dose i.p.. Chap e 3 87 Lamina P op ia Lymphocy es Isola ion Lymphocy e isola ion om Lamina P op ia o he la ge in es ine was pe o med by ex ac ing he in es ines, cu ing in 6 cm pieces, opening longi udinally and washing igo ously in PBS in a pe i dish. Pieces we e hen cu in o 1cm agmen s, collec ed in 20ml o PBS wi h 4% Fe al Bo ine Se um (FBS, Gibco) and EDTA (Gibco) was added o a inal concen a ion o 5mM. A e 15min o shaking a 2000 pm, 37°C in an o bi al shake , and a inal o ex o 5s, pieces we e collec ed in s eel mesh and his EDTA p ocedu e was epea ed one mo e ime. Pieces we e hen collec ed in o a 2ml eppendo ube wi h 1ml HBSS 4% FBS and minced wi h scisso s. F agmen s we e hen collec ed in o a 20ml solu ion o HBSS wi h 4% FBS and 1mg/mL Colagenase Tye VIII and 0.1mg/mL DNAse I (Sigma) and diges ed o 30min a 2000 pm, 37°C in an o bi al shake . The solu ion was il e ed wi h a 70µm cell s aine (BD), cen i uged a 450G, 5min a 4°C, esuspended in 8mL o a 40% Pe coll (Sigma) solu ion in HBSS (Pe coll p e iously co ec ed o 310mOsm/kg, pH 7) and laye ed on o 4mL o a 80% Pe coll solu ion. A e cen i uga ion a 620G, 20min, 20°C, wi h no b ake o accele a ion, cells we e collec ed om he in e ace o he wo Pe coll laye s and washed once be o e use o FACS s aining. Cells we e p e- incuba ed wi h Fc-block (an i-CD16/CD32, IGC-AbSe ice), and hen incuba ed wi h an i-mouse TCRβ (H57-597, eBioscience), CD4 (GK1.5, eBioscience), CD8 (53-6.7, eBioscience), CD25 (PC61, IGC-AbSe ice), Foxp3 (FJK-16S, eBioscience). E en s we e acqui ed on an LSRFo essa X-20 cell analyze (BD) and analyzed on FlowJo So wa e (T ee S a ). IgA FACS on li e H. hepa icus H. hepa icus was cul u ed as desc ibed abo e, and 106 CFU we e used pe assay. Bac e ia we e washed once in PBS, pelle ed (12,000G, 5min), esuspended in ecal ex ac (p epa ed as desc ibed o ELISA 88 assay) om SPF, Adcol o Nbcol mice and incuba ed on ice o 30min. Bac e ia we e hen washed in PBS and incuba ed o 15min on ice wi h Goa an i-Mouse IgA (Sou he n Bio ech), labeled using Alexa647 Labeling Ki (The mo Fishe Scien i ic). Bac e ia we e washed again and esuspended in a PBS solu ion con aining 5µM o SYTO 9 (Molecula P obes). E en s we e acqui ed on a CyAn ADP Analyze (Beckman Coul e ) and analyzed on FlowJo So wa e (T ee S a ). Analysis was pe o med ga ing on li e bac e ia, which we e SYTO 9 B igh , as con i med by coun e s aining wi h 45µM o p opidium iodide (Molecula P obes), and excluding e en s wi h high pulse wid h. 16S RNA analysis 48 samples we e analyzed, om WT and Rag2-/- animals, ei he SPF, Adcol o Nbcol, 4 Males and 4 Females pe g oup. SPF and Nbcol mice we e 8-12 weeks old; Adcol mice we e colonized a 10 weeks o age and analyzed a 10 weeks pos -coloniza ion. DNA om ecal pelle s was ex ac ed using NZYTech Tissue gDNA ex ac ion ki (NZYTech), wi h a p e-s ep o 95°C, and used o 16S RNA gene sequencing as p e iously desc ibed (Wal e s e al., 2016). Sample p ocessing and sequencing we e pe o med by he IGC Genomics Uni . The 515 -806 bac e ial/a chaeal p ime pai was used, which a ge s he 16S RNA gene a iable egion 4 (V4), wi h he ollowing sequences: 515 - GTGYCAGCMGCCGCGGTAA; 806 – GGACTACNVGGGTWTCTAAT; ba codes we e added in he 5’ end o he 515 p ime , and Illumina adap e s we e p esen in bo h p ime s. Sample p ocessing and PCRs we e pe o med as desc ibed in he Ea h Mic obiome P ojec (EMP; h p://www.ea hmic obiome.o g/emp-s anda d- p o ocols/16s/, 16S RNA Ampli ica ion P o ocol e sion 6_15). Pai -end sequencing was pe o med on an Illumina MiSeq Bench op Sequence , ollowing manu ac u e 's ins uc ions. Reads we e p ocessed and analyzed using Mo hu So wa e e sion 1.36.1 (Schloss e al., 2009), ollowing he Chap e 3 95 Figu e S3.4 – H. hepa icus ecal load 10 weeks pos -coloniza ion (Figu e 3.2 B - D) Mice a 1-4 weeks o age we e colonized wi h H. hepa icus by eces o al ga age. 10 weeks a e coloniza ion, eces we e analyzed o an i-H. hepa icus and To al IgA by ELISA. N = 8, 5, 6 and 8 espec i ely. Linea model: y~exp(-x), line = eg ession, shade = con idence in e al; eg ession coe icien : p < 0.01; R2 = 0.30; F s a is ic: p < 0.01 96 Figu e S3.5 – Complemen a y o Figu e 3.4 A and B A - C) To al ecal IgA, H. hepa icus ecal load and weigh o he mice shown in igu e 3.4A. A) Linea model: y~log(x), eg ession coe icien : p < 0.01; R2 = 0.52; F s a is ic: p < 0.01; B) Linea model: y~exp(-x), eg ession coe icien : p < 0.01; R2 = 0.21; F s a is ic: p < 0.01; C) Linea model: y~log(x), eg ession coe icien : p < 0.01; R2 = 0.62; F s a is ic: p < 0.01. D) To al ecal IgA measu ed on he mice om igu e 3.4B; Linea eg ession, g oup compa ison: p = 0.57; mul iple R2 = 0.31; F s a is ic: p < 0.05. Line = eg ession, shade = con idence in e al. Chap e 3 97 Figu e S3.6 – Complemen a y o Figu e 3.4 C A) To al IgA measu ed on he eces o he mice p esen ed in Figu e 3.4C. Line = local polinomial eg ession, shade = con idence in e al. B) H. hepa icus load in he mucosa o he ileum and colon, no malized o hos 18S, in pa o he mice shown in Figu e 3.4C, 9 weeks a e DT ea men . N pe g oup: WT+DT = 14; DEREG+DT = 15. Poin s = indi idual mice, ba = median. * p < 0.05 (Wilcoxon es ). 98 Figu e S3.7 – T egs a e deple ed in MLN, PP and La ge In es ine Lamina P op ia upon DT ea men in DEREG mice Newbo n colonized li e ma e WT and DEREG mice we e ea ed wi h 1μg o DT i.p. a 7 weeks o age. Analysis o equency and o al numbe s o TCRβ+ CD4+ Foxp3+ cells was pe o med 2 days la e on MLN, PP and La ge In es ine Lamina P op ia. A) Rep esen a i e FACS plo s o he Foxp3+ cells equency in he TCRβ+ CD4+ popula ion, a he indica ed o gans. B) Numbe o TCRβ+ CD4+ cells. C) Numbe o TCRβ+ CD4+ Foxp3+ cells. D) Pe cen age o TCRβ+ CD4+ Foxp3+ cells. N = 3 pe g oup, * p < 0.05 ( es ), ns = no signi ican . MLN = Mesen e ic Lymph Nodes; PP = Peye ’s Pa ches; LPL = La ge In es ine Lamina P op ia; DT = Diph he ia Toxin. Chap e 3 99 Figu e S3.8 – Newbo n ole ance o H. hepa icus is TLR2 independen Young Adul TLR-/- males and emales we e colonized wi h H. hepa icus by eces ga age and b ed o p oduce Newbo n-colonized pups. To al and an i-H. hepa icus IgA we e analyzed by ELISA on he eces o Newbo n-colonized TLR2-/- mice a 5, 7 and 9 weeks o age. N = 6 a all poin s. 100 Figu e S3.9 – Complemen a y o Figu e 3.5 D and F A) Se ologic analysis on SPF, Adcol and Nbcol mice. SPF: n = 6, 11 weeks old. Adcol: n = 6, 12 weeks colonized, coloniza ion a 10 weeks o age. Nbcol: n = 6, 11 weeks old/colonized. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). B) Lipocalin-2 concen a ion was measu ed by ELISA on he eces o SPF, Adcol and Nbcol mice a days 0, 5, 11 and 18 a e ea men wi h 3% DSS in d inking wa e o 7 days. SPF: n = 10, 12 weeks old. Adcol: n = 10, 14 weeks old, 4 weeks colonized. Nbcol: n = 10, 12 weeks old/colonized. ns = non-signi ican (linea mixed e ec s analysis). Chap e 3 101 Figu e S3.10 – An i-H. hepa icus mucosal IgA is T-cell dependen Adu (10 weeks old) WT and TCRβ-/- mice we e colonized wi h H. hepa icus by eces ga age and analyzed 4 weeks pos -coloniza ion o o al and an i-H. hepa icus IgA by ELISA. N= 10 in each g oup. 102 Figu e S3.11 – an i-IL10R ea men is able o b eak ole ance o H. hepa icus 10 weeks old Nbcol mice ecei ed 4 weekly 1mg doses o an i-IL-10R an ibody (clone 1B1.2) o PBS. To al and an i-H. hepa icus IgA we e analyzed on eces on 0, 4 and 10 weeks pos - ea men . An i-IL10R: n=5; PBS: n=4. Lines = linea eg ession, shades = con idence in e al, G oup compa ison: p < 0.01, Mul iple R2 = 0.55; F s a is ic: p < 0.01. Chap e 3 103 Figu e S3.12 – Complemen a y o Figu e 3.6 16S RNA a iable egion 4 (V4) analysis on ecal DNA om WT and Rag2-/- animals, ei he SPF, Adcol o Nbcol, 4 Males and 4 Females pe g oup. SPF and Nbcol mice we e 8-12 weeks old; Adcol mice we e colonized a 10 weeks o age and analyzed a 10 weeks pos -coloniza ion. Rela i e abundance o di e en axa be ween he g oups analyzed. Lowes classi ica ion le el achie ed in he analysis shown abo e he g aph. S a is ical analysis was pe o med using Wilcoxon es , wi h Benjamini and Hochbe g co ec ion. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05. 104 Figu e S3.13 – Complemen a y o Figu e 3.6 16S RNA a iable egion 4 (V4) analysis on ecal DNA om WT and Rag2-/- animals, ei he SPF, Adcol o Nbcol, 4 Males and 4 Females pe g oup. SPF and Nbcol mice we e 8-12 weeks old; Adcol mice we e colonized a 10 weeks o age and analyzed a 10 weeks pos -coloniza ion. A) Plo s o ela i e abundance o he indica ed axa on indi idual mice o he indica ed g oups. Taxa wi h ela i e abundance abo e 0.1% a e shown. B) Species ichness, es ima ed wi h Chao index. C) Species di e si y, es ima ed wi h Shannon index. G oups wi h he same le e a e no signi ican ly di e en a p = 0.05 (Wilcoxon es wi h BH co ec ion). Chap e 4 111 Conclusion Ou s udies o he ecip ocal in e ac ions be ween H. hepa icus and he mouse immune sys em p o ide no el insigh s in o how he hos adap i e immuni y con ols he mic obio a and how i is a ec ed by i . Fu he mo e, hey highligh he impo ance o e ising he lis o bac e ia excluded om he mic obio a on animal s udies, o some o hose, like H. hepa icus, a e an impo an componen o his sys em ha p obably e ol ed wi h his hos o compose a balanced s uc u e. The e o e, mo e in es iga ions on na u al popula ions a e necessa y o sea ch o o he key componen s o he mic obio a o mice and humans, which could help o unde s and how he gu associa ed immune sys em e ol ed and p o ide new ools o es o e homeos asis in pa hological condi ions. 112 Re e ences Adkins, B., Lecle c, C., and Ma shall-Cla ke, S. (2004). Neona al adap i e immuni y comes o age. Na . Re . Immunol. 4, 553–564. An, D., Oh, S.F., Olszak, T., Ne es, J.F., A ci, F.Y., E u k-Hasdemi , D., Lu, X., Zeissig, S., Blumbe g, R.S., and Kaspe , D.L. (2014). Sphingolipids om a symbio ic mic obe egula e homeos asis o hos in es inal na u al kille T cells. Cell 156, 123–133. And ade, E.B., Al es, J., Madu ei a, P., Oli ei a, L., Ribei o, A., Co dei o-da-Sil a, A., Co eia-Ne es, M., T ieu-Cuo , P., and Fe ei a, P. (2013). TLR2-induced IL-10 p oduc ion impai s neu ophil ec ui men o in ec ed issues du ing neona al bac e ial sepsis. J. Immunol. 191, 4759– 4768. Annacke , O., Pimen a-A aujo, R., Bu len-De anoux, O., Ba bosa, T.C., Cumano, A., and Bandei a, A. (2001). CD25+ CD4+ T Cells Regula e he Expansion o Pe iphe al CD4 T Cells Th ough he P oduc ion o IL-10. J. Immunol. 166, 3008–3018. A nold, I.C., Lee, J.Y., Amie a, M.R., Roe s, A., Fla ell, R.A., Spa wasse , T., and Mülle , A. (2011). Tole ance Ra he Than Immuni y P o ec s F om Helicobac e pylo i–Induced Gas ic P eneoplasia. Gas oen e ology 140, 199–209.e8. A a ashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwaha a, T., Momose, Y., Cheng, G., Yamasaki, S., Sai o, T., Ohba, Y., e al. (2011). Induc ion o Colonic Regula o y T Cells by Indigenous Clos idium Species. Science (80-. ). 331, 337–341. Be g, D.J., Da idson, N., Kühn, R., Mülle , W., Menon, S., Holland, Re e ences 113 G., Thompson-Snipes, L., Leach, M.W., and Rennick, D. (1996). En e ocoli is and colon cance in in e leukin-10-de icien mice a e associa ed wi h abe an cy okine p oduc ion and CD4(+) TH1-like esponses. J. Clin. In es . 98, 1010–1020. Biswas, A., Liu, Y.-J., Hao, L., Mizoguchi, A., Salzman, N.H., Be ins, C.L., and Kobayashi, K.S. (2010). Induc ion and escue o Nod2-dependen Th1-d i en g anuloma ous in lamma ion o he ileum. P oc. Na l. Acad. Sci. 107, 14739–14744. Blase , M.J., Chen, Y., and Reibman, J. (2008). Does Helicobac e pylo i p o ec agains as hma and alle gy? Gu 57, 561–567. B omley, S.K., Mempel, T.R., and Lus e , A.D. (2008). O ches a ing he o ches a o s: chemokines in con ol o T cell a ic. Na . Immunol. 9, 970–980. Bunke , J.J., Flynn, T.M., Ko al, J.C., Shaw, D.G., Meisel, M., McDonald, B.D., Ishizuka, I.E., Den , A.L., Wilson, P.C., Jab i, B., e al. (2015). Inna e and Adap i e Humo al Responses Coa Dis inc Commensal Bac e ia wi h Immunoglobulin A. Immuni y 43, 541–553. Bu chbach, M.E.R., Edwa ds, J.D., Schussle , K.R., and Bu ghes, A.H.M. (2007). A no el me hod o o al deli e y o d ug compounds o he neona al SMNΔ7 mouse model o spinal muscula a ophy. J. Neu osci. Me hods 161, 285–290. Cahenzli, J., Kölle , Y., Wyss, M., Geuking, M.B., and McCoy, K.D. (2013). In es inal mic obial di e si y du ing ea ly-li e coloniza ion shapes long- e m IgE le els. Cell Hos Mic obe 14, 559–570. Cahill, R.J., Fol z, C.J., Fox, J.G., Dangle , C.A., Pow ie, F., and Schaue , D.B. (1997). In lamma o y bowel disease: an immuni y-media ed 114 condi ion igge ed by bac e ial in ec ion wi h Helicobac e hepa icus. In ec . Immun. 65, 3126–3131. Chao, A. (1984). Nonpa ame ic es ima ion o he numbe o classes in a popula ion. Scand. J. S a . Chow, J., and Mazmanian, S.K. (2010). A Pa hobion o he Mic obio a Balances Hos Coloniza ion and In es inal In lamma ion. Cell Hos Mic obe 7, 265–276. Chung, H., Pamp, S.J., Hill, J.A., Su ana, N.K., Edelman, S.M., T oy, E.B., Reading, N.C., Villablanca, E.J., Wang, S., Mo a, J.R., e al. (2012). Gu Immune Ma u a ion Depends on Coloniza ion wi h a Hos -Speci ic Mic obio a. Cell 149, 1578–1593. Chung, Y., Tanaka, S., Chu, F., Nu ie a, R.I., Ma inez, G.J., Rawal, S., Wang, Y.-H., Lim, H., Reynolds, J.M., Zhou, X.-H., e al. (2011). Follicula egula o y T cells exp essing Foxp3 and Bcl-6 supp ess ge minal cen e eac ions. Na . Med. 17, 983–988. Cong, Y., Feng, T., Fujihashi, K., Schoeb, T.R., and Elson, C.O. (2009). A dominan , coo dina ed T egula o y cell-IgA esponse o he in es inal mic obio a. P oc. Na l. Acad. Sci. U. S. A. 106, 19256–19261. Faga asan, S., Kawamo o, S., Kanagawa, O., and Suzuki, K. (2010). Adap i e immune egula ion in he gu : T cell-dependen and T cell- independen IgA syn hesis. Annu. Re . Immunol. 28, 243–273. Fa ache, J., Zigmond, E., Shakha , G., and Jung, S. (2013). Con ibu ions o dend i ic cells and mac ophages o in es inal homeos asis and immune de ense. Immunol. Cell Biol. 91, 232–239. Fa in, H.F., Ka haus, W.R., Kujala, P., Rakhshandeh oo, M., Re e ences 115 Schwank, G., V ies, R.G.J., Kalkho en, E., Nieuwenhuis, E.E.S., and Cle e s, H. (2014). Pane h cell ex usion and elease o an imic obial p oduc s is di ec ly con olled by immune cell-de i ed IFN-γ. J. Exp. Med. 211, 1393–1405. Fleissne , C.K., Huebel, N., Abd El-Ba y, M.M., Loh, G., Klaus, S., and Blau , M. (2010). Absence o in es inal mic obio a does no p o ec mice om die -induced obesi y. B J Nu 104, 919–929. Fo bes, S.J., Eschmann, M., and Man is, N.J. (2008). Inhibi ion o Salmonella en e ica se o a yphimu ium mo ili y and en y in o epi helial cells by a p o ec i e an ilipopolysaccha ide monoclonal immunoglobulin a an ibody. In ec . Immun. 76, 4137–4144. Fo bes, S.J., Bumpus, T., McCa hy, E.A., Co hesy, B., and Man is, N.J. (2011). T ansien Supp ession o Shigella lexne i Type 3 Sec e ion by a P o ec i e O-An igen-Speci ic Monoclonal IgA. MBio 2, e00042–11 – e00042–11. Fox, J.G., Dewhi s , F.E., Tully, J.G., Pas e , B.J., Yan, L., Taylo , N.S., Collins, M.J., Go elick, P.L., and Wa d, J.M. (1994). Helicobac e hepa icus sp. no ., a mic oae ophilic bac e ium isola ed om li e s and in es inal mucosal sc apings om mice. J. Clin. Mic obiol. 32, 1238–1245. F i z, J.H., Rojas, O.L., Sima d, N., McCa hy, D.D., Hap elmeie , S., Rubino, S., Robe son, S.J., La ijani, M., Gosselin, J., I ano , I.I., e al. (2012). Acquisi ion o a mul i unc ional IgA+ plasma cell pheno ype in he gu . Na u e 481, 199–203. Gabo iau-Rou hiau, V., Rako obe, S., Lécuye , E., Mulde , I., Lan, A., B idonneau, C., Roche , V., Pisi, A., De Paepe, M., B andi, G., e al. (2009). The Key Role o Segmen ed Filamen ous Bac e ia in he Coo dina ed Ma u a ion o Gu Helpe T Cell Responses. Immuni y 31, 677–689. 116 Gensollen, T., Iye , S.S., Kaspe , D.L., and Blumbe g, R.S. (2016). How coloniza ion by mic obio a in ea ly li e shapes he immune sys em. Science (80-. ). 352, 539–544. Gollwi ze , E.S., Saglani, S., T ompe e, A., Yada a, K., She bu n, R., McCoy, K.D., Nicod, L.P., Lloyd, C.M., and Ma sland, B.J. (2014). Lung mic obio a p omo es ole ance o alle gens in neona es ia PD-L1. Na . Med. 20, 642–647. Hale, J.S., Bou salian, T.E., Tu k, G.L., and Fink, P.J. (2006). Thymic ou pu in aged mice. P oc. Na l. Acad. Sci. U. S. A. 103, 8447–8452. Hap elmeie , S., Lawson, M. a E., Slack, E., Ki undi, J.K., S oel, M., Heikenwalde , M., Cahenzli, J., Velyko edko, Y., Balme , M.L., End , K., e al. (2010). Re e sible mic obial coloniza ion o ge m- ee mice e eals he dynamics o IgA immune esponses. Science 328, 1705–1709. Hi o a, K., Tu ne , J.-E., Villa, M., Dua e, J.H., Demengeo , J., S einme z, O.M., and S ockinge , B. (2013). Plas ici y o TH17 cells in Peye ’s pa ches is esponsible o he induc ion o T cell–dependen IgA esponses. Na . Immunol. 14, 372–379. Hoope , L. V, and Macphe son, A.J. (2010). Immune adap a ions ha main ain homeos asis wi h he in es inal mic obio a. Na . Re . Immunol. 10, 159–169. Hoope , L. V., Li man, D.R., and Macphe son, a. J. (2012). In e ac ions Be ween he Mic obio a and he Immune Sys em. Science (80-. ). 336, 1268–1273. Ho ho n, T., B e z, F., and Wes all, P. (2008). Simul aneous in e ence in gene al pa ame ic models. Biome ical J. Re e ences 117 Jakobsson, H.E., Rod íguez-Piñei o, A.M., Schü e, A., E mund, A., Boysen, P., Bema k, M., Somme , F., Bäckhed, F., Hansson, G.C., and Johansson, M.E. (2015). The composi ion o he gu mic obio a shapes he colon mucus ba ie . EMBO Rep. 16, 164–177. Jiang, H.-Q., Bos, N. a., and Ceb a, J.J. (2001). Timing, Localiza ion, and Pe sis ence o Coloniza ion by Segmen ed Filamen ous Bac e ia in he Neona al Mouse Gu Depend on Immune S a us o Mo he s and Pups. In ec . Immun. 69, 3611–3617. Johansson, M.E. V, Phillipson, M., Pe e sson, J., Velcich, A., Holm, L., and Hansson, G.C. (2008). The inne o he wo Muc2 mucin-dependen mucus laye s in colon is de oid o bac e ia. P oc. Na l. Acad. Sci. U. S. A. 105, 15064–15069. Kae zel, C.S. (2014). Coope a i i y among sec e o y IgA, he polyme ic immunoglobulin ecep o , and he gu mic obio a p omo es hos - mic obial mu ualism. Immunol. Le . 162, 10–21. Kawamo o, S., Ma uya, M., Ka o, L.M., Suda, W., A a ashi, K., Doi, Y., Tsu sui, Y., Qin, H., Honda, K., Okada, T., e al. (2014). Foxp3+ T Cells Regula e Immunoglobulin A Selec ion and Facili a e Di e si ica ion o Bac e ial Species Responsible o Immune Homeos asis. Immuni y 41, 152–165. Kelsall, B. (2008). Recen p og ess in unde s anding he pheno ype and unc ion o in es inal dend i ic cells and mac ophages. Mucosal Immunol. 1, 460–469. Khade , S.A., Ga en, S.L., and Kolls, J.K. (2009). Th17 cells a he c oss oads o inna e and adap i e immuni y agains in ec ious diseases a he mucosa. Mucosal Immunol. 2, 403–411. 118 Kozich, J.J., Wes co , S.L., Bax e , N.T., Highlande , S.K., and Schloss, P.D. (2013). De elopmen o a Dual-Index Sequencing S a egy and Cu a ion Pipeline o Analyzing Amplicon Sequence Da a on he MiSeq Illumina Sequencing Pla o m. Appl. En i on. Mic obiol. 79, 5112–5120. K onman, M.P., Zaou is, T.E., Haynes, K., Feng, R., and Co in, S.E. (2012). An ibio ic exposu e and IBD de elopmen among child en: a popula ion-based coho s udy. Pedia ics 130, e794–e803. Kullbe g, M.C., Wa d, J.M., Go elick, P.L., Caspa , P., Hieny, S., Chee e , A., Janko ic, D., and She , A. (1998). Helicobac e hepa icus igge s coli is in speci ic-pa hogen- ee in e leukin-10 (IL-10)-de icien mice h ough an IL-12- and gamma in e e on-dependen mechanism. In ec . Immun. 66, 5157–5166. Kullbe g, M.C., Janko ic, D., Go elick, P.L., Caspa , P., Le e io, J.J., Chee e , A.W., and She , A. (2002). Bac e ia- igge ed CD4 + T Regula o y Cells Supp ess Helicobac e hepa icus –induced Coli is. J. Exp. Med. 196, 505–515. Kullbe g, M.C., Ande sen, J.F., Go elick, P.L., Caspa , P., Sue baum, S., Fox, J.G., Chee e , A.W., Janko ic, D., and She , A. (2003). Induc ion o coli is by a CD4+ T cell clone speci ic o a bac e ial epi ope. P oc. Na l. Acad. Sci. U. S. A. 100, 15830–15835. Lahl, K., Loddenkempe , C., D ouin, C., F eye , J., A nason, J., Ebe l, G., Hamann, A., Wagne , H., Huehn, J., and Spa wasse , T. (2007). Selec i e deple ion o Foxp3+ egula o y T cells induces a scu y-like disease. J. Exp. Med. 204, 57–63. La h op, S.K., Bloom, S.M., Rao, S.M., Nu sch, K., Lio, C.-W., San ac uz, N., Pe e son, D. a, S appenbeck, T.S., and Hsieh, C.-S. (2011). Pe iphe al educa ion o he immune sys em by colonic commensal Re e ences 119 mic obio a. Na u e 478, 250–254. Lécuye , E., Rako obe, S., Lengliné-Ga nie , H., Leb e on, C., Pica d, M., Jus e, C., F i zen, R., Ebe l, G., McCoy, K.D., Macphe son, A.J., e al. (2014). Segmen ed ilamen ous bac e ium uses seconda y and e ia y lymphoid issues o induce gu IgA and speci ic T helpe 17 cell esponses. Immuni y 40, 608–620. Lino, A.C., Moh , E., and Demengeo , J. (2013). Na u ally sec e ed immunoglobulins limi B1 and MZ B-cell numbe s h ough a mic obio a- independen mechanism. Blood 122, 209–218. Lin e man, M. a, Pie son, W., Lee, S.K., Kallies, A., Kawamo o, S., Rayne , T.F., S i as a a, M., Di eka , D.P., Bea on, L., Hogan, J.J., e al. (2011). Foxp3+ ollicula egula o y T cells con ol he ge minal cen e esponse. Na . Med. 17, 975–982. Li ings on, R.S., Riley, L.K., Besch-Willi o d, C.L., Hook, R.R., and F anklin, C.L. (1998). T ansmission o Helicobac e hepa icus in ec ion o sen inel mice by con amina ed bedding. Lab. Anim. Sci. 48, 291–293. Lycke, N., E landsson, L., Ekman, L., Schön, K., and Leande son, T. (1999). Lack o J chain inhibi s he anspo o gu IgA and ab oga es he de elopmen o in es inal an i oxic p o ec ion. J. Immunol. 163, 913–919. Macphe son, a. J. (2000). A P imi i e T Cell-Independen Mechanism o In es inal Mucosal IgA Responses o Commensal Bac e ia. Science (80-. ). 288, 2222–2226. Macphe son, A.J., and Uh , T. (2004). Induc ion o p o ec i e IgA by in es inal dend i ic cells ca ying commensal bac e ia. Science 303, 1662– 1665. 120 Macphe son, A.J., Geuking, M.B., and McCoy, K.D. (2012). Homeland secu i y: IgA immuni y a he on ie s o he body. T ends Immunol. 33, 160–167. Maloy, K.J., Salaun, L., Cahill, R., Dougan, G., Saunde s, N.J., and Pow ie, F. (2002). CD4+CD25+ TR Cells Supp ess Inna e Immune Pa hology Th ough Cy okine-dependen Mechanisms. J. Exp. Med. 197, 111–119. Man is, N.J., Rol, N., and Co hésy, B. (2011). Sec e o y IgA’s complex oles in immuni y and mucosal homeos asis in he gu . Mucosal Immunol. 4, 603–611. Mazmanian, S.K., Round, J.L., and Kaspe , D.L. (2008). A mic obial symbiosis ac o p e en s in es inal in lamma o y disease. Na u e 453, 620–625. Me kenschlage , J., Ploquin, M.J., Eksmond, U., Anda gachew, R., Tho bo n, G., Filby, A., Peppe , M., E a old, B., and Kassio is, G. (2016). S epwise B-cell-dependen expansion o T helpe clono ypes di e si ies he T-cell esponse. Na . Commun. 7, 10281. Mi pu i, J., Rae z, M., S u ge, C.R., Wilhelm, C.L., Benson, A., Sa ani, R.C., Hoope , L. V., and Ya o insky, F. (2013). P o eobac e ia- speci ic IgA egula es ma u a ion o he in es inal mic obio a. Gu Mic obes 5, 37–41. Mo ison, P.J., Bending, D., Fouse , L. a, W igh , J.F., S ockinge , B., Cooke, a, and Kullbe g, M.C. (2013). Th17-cell plas ici y in Helicobac e hepa icus-induced in es inal in lamma ion. Mucosal Immunol. 00. Mukhe jee, S., and Hoope , L. V. (2015). An imic obial de ense o he in es ine. Immuni y 42, 28–39. Re e ences 127 inac i a ion, no deple ion, o CD4+CD25+ T egula o y cells”. J. Immunol. 177, 2036–2037; au ho eply 2037–2038. Zhang, X., De iaud, E., Jiao, X., B aun, D., Lecle c, C., and Lo-Man, R. (2007). Type I in e e ons p o ec neona es om acu e in lamma ion h ough in e leukin 10-p oducing B cells. J. Exp. Med. 204, 1107–1118.