scieee Science in your language
[en] (orig)

The asian clam-dispersal, impacts and potential benefits

Read accessible full text

The asian clam-dispersal, impacts and potential benefits

Author: Inês Correia Rosa
Year: 2013
DOI: 10.34626/nn6d-e406
Source: https://repositorio-aberto.up.pt/bitstream/10216/74500/2/30704.pdf
THE ASIAN CLAM: DISPERSAL, IMPACTS AND
POTENTIAL BENEFITS
INÊS CORREIA ROSA
Tese de Dou o amen o em Ciências do Ma e do Ambien e
2013
THE ASIAN CLAM: DISPERSAL, IMPACTS AND POTENTIAL
BENEFITS
Tese de Candida u a ao g au de Dou o em
Ciências do Ma e do Ambien e Especialidade
em Oceanog a ia e Ecossis emas Ma inhos
subme ida ao Ins i u o de Ciências Biomédicas
de Abel Salaza da Uni e sidade do Po o.
P og ama Dou o al da Uni e sidade do Po o
(Ins i u o de Ciências Biomédicas de Abel
Salaza e Faculdade de Ciências) e da
Uni e sidade de A ei o.
O ien ado – Dou o Fe nando Gonçal es
Ca ego ia – P o esso Associado com
Ag egação
A iliação – Depa amen o de Biologia & Cen o
de Es udos do Ambien e e do Ma , Uni e sidade
de A ei o
Co-o ien ado a – Dou o a Raquel Cos a
Ca ego ia – In es igado a Auxilia
A iliação – Cen o de In es igação Engenhei a
dos P ocessos Químicos e dos P odu os da
Flo es a, Depa amen o de Engenha ia Química,
Uni e sidade de Coimb a
Co-o ien ado a – Dou o a Joana Pe ei a
Ca ego ia – Es agiá ia de Pós Dou o amen o
A iliação – Depa amen o de Biologia & Cen o
de Es udos do Ambien e e do Ma , Uni e sidade
de A ei o
LEGAL DETAILS
In compliance wi h wha is s a ed in Dec ee-Law nº 216/92 o Oc obe 13 h, i is he eby
decla ed ha he au ho o his hesis pa icipa ed in he c ea ion and execu ion o he
expe imen al wo k leading o he esul s he e s a ed, as well as in hei in e p e a ion and
w i ing o he espec i e manusc ip s.
This hesis includes wo scien i ic pape s published in in e na ional jou nals, one
submi ed a icle and wo a icles in p epa a ion o igina ed om pa o he esul s
ob ained in he expe imen al wo k e e enced as:
- Rosa IC, Pe ei a JL, Cos a R, Gonçal es F & P ezan R (2012) E ec s o uppe -limi
wa e empe a u es on he dispe sal o he Asian clam Co bicula luminea. PLoS ONE
7(10): e46635. doi:10.1371/jou nal.pone.0046635
- Rosa IC, Pe ei a JL., Gomes J, Sa ai a PM, Gonçal es F & Cos a R (2011) The Asian
clam Co bicula luminea in he Eu opean eshwa e -dependen indus y: A la en h ea o
a iendly enemy? Ecological Economics 70: 1805-1813. doi:
10.1016/j.ecolecon.2011.05.006
- Rosa IC, Cos a R, Gonçal es F & Pe ei a JL. Bio emedia ion o a me al ich e luen e by
he in asi e bi al e Co bicula luminea. Wa e Resea ch (submi ed)
- Rosa IC, Gomes J, Pe ei a ML, Pe ei a JL, Cos a R & Gonçal es F. Dispe sal o
Co bicula luminea: Fac o s in luencing he in asi e clam’s d i ing beha io . F eshwa e
Biology (submi ed).
- Rosa IC, Pe ei a JL, Gonçal es F & Cos a R. Sensi i y o he in asi e bi al e Co bicula
luminea o candida e con ol chemicals: The ole o dissol ed oxygen condi ions (in
p epa a ion)

Mais uma ez, às minhas a ós…
Se pelo menos pudéssemos i e duas ezes:
a p imei a ez, pa a come e odos os ine i á eis e os; a segunda pa a luc a com eles
Da id Law ence
TABLE OF CONTENTS
Acknowledgemen s ………………………………………………….…………………………… i
Summa y …………………………………………………………………………………………. iii
Resumo ……………………………………………………………………………………………
In oduc o y no e ………………………………………………………………………………... ii
CHAPTER 1: Biological in asions: The gene al heo y and he pa icula case o
Co bicula luminea.......................................................................................................... 1
1.1. Biological in asions as a global h ea .................................................................... 3
1.2. Biology, impac s and con ol o he Asian clam C. luminea .................................... 6
1.2.1. Taxonomy ........................................................................................................ 6
1.2.2. Rep oduc ion, li e cycle and popula ion s uc u e ............................................. 8
1.2.3. Habi a and eeding p e e ences .....................................................................10
1.2.4. Cu en dis ibu ion and ec o s o dispe sal ...................................................11
1.2.5. In asion success .............................................................................................11
1.2.6. Impac s ...........................................................................................................12
1.2.7. Con ol ............................................................................................................14
1.3. Re e ences ............................................................................................................18
CHAPTER 2: E ec s o uppe -limi wa e empe a u e on he dispe sal o he Asian
clam Co bicula luminea ...............................................................................................29
2.1. Abs ac .................................................................................................................32
2.2. In oduc ion ...........................................................................................................33
2.3 Ma e ial and me hods .............................................................................................35
2.3.1. Co bicula luminea collec ion and main enance ..............................................35
2.3.2. Exposu e condi ions ........................................................................................36
2.3.3. His ological p ocedu es and mic oscopic analysis ...........................................37
2.3.4. Flo a ion beha io ...........................................................................................38
2.3.5. S a is ical analysis ...........................................................................................38
2.4. Resul s ..................................................................................................................39
2.5. Discussion .............................................................................................................45
2.6. Acknowledgemen s ...............................................................................................49
2.7. Re e ences ............................................................................................................50
CHAPTER 3: Dispe sal o Co bicula luminea: Fac o s in luencing he in asion
clam’s d i ing beha io ................................................................................................57
3.1. Abs ac .................................................................................................................60
3.2. In oduc ion ...........................................................................................................61
__________
i
o s occu ing in popula ions es ablished in wa e bodies ac oss he coun y. The
documen a ion o he species’ impac s in Po ugal may assis o icial en i ies on he
implemen a ion o in eg a ed managemen policies in coun ies a isk o in asion o whe e
he pes has ecen ly a i ed. As he ele ance o con inuing he sea ch o mo e e icien
con ol solu ions o he Asian clam was ecognized, he po en ial o combining biocide
applica ion wi h dep essed oxygen condi ions was in es iga ed. P elimina y esul s
sugges ha hypoxia inc eases he e iciency o some biocides, which es ablishes he
g ounds o u u e esea ch using in e media e, mo e sui able, le els o dissol ed oxygen
combined wi h selec ed biocides. Finally, and p o ided he sho comings ha s ill exis in
a ailable con ol solu ions o he Asian clam and he ecogni ion ha he pes may be o
ha d, i no impossible, e adica ion om ouled sys ems, he po en ial o i s use as
bio emedia ion ool was explo ed using a me al-bea ing e luen as an expe imen al
model. The species was able o emo e a signi ican ac ion o he e luen me als, which
ansla ed in o a con i med dec ease o i s en i onmen al oxici y. The po en ial o C.
luminea as a bio emedia o o indus ial e luen s opens an a enue o o se ing he
damaging e ec s o es ablished in es a ions.

__________
RESUMO
As espécies in aso as são a ualmen e uma das maio es ameaças ambien ais
de ido aos seus impac os nega i os an o a ní el ecológico como económico.
A amêijoa de água doce Co bicula luminea, ambém conhecida po amêijoa
asiá ica, es á en e as espécies in aso as mais p eocupan es – es á a ualmen e p esen e
em p a icamen e odo o mundo e, a jun a aos seus impac os nega i os pe pe ados em
ecossis emas in adidos, o es abelecimen o de populações em consequências
pe niciosas nas indús ias dependen es de água doce de ido à sua a i idade de
bio ouling. O conhecimen o sob e a ges ão e con olo des a espécie em aumen ado
bas an e du an e as úl imas décadas, a pa com o aumen o da sua dispe são e impac os.
No en an o, são á ias as ques ões que se man êm sem espos a e a mi igação do dano
de uma o ma e e i a e acei á el do pon o de is a ambien al pe manece ainda como um
desa io. Pa icula men e em Po ugal, a po a de en ada de C. luminea na Eu opa há 30
anos, exis em lacunas na moni o ização sis emá ica da dispe são des a in aso a.
A p esen e ese o nece in o mação no con ex o da p oblemá ica das in asões
pela amêijoa asiá ica, eco endo a uma abo dagem holís ica do p ocesso in aso de
modo a cob i aspe os como a dispe são, os impac os e o con olo da espécie. Os
es udos aqui incluídos ap esen am ele ância a ní el local, na medida em que se cen am
na dis ibuição a ual e impac os nas indús ias em Po ugal. A um ní el mais ge al, oi
ambém ge ado no o conhecimen o cien í ico que pode se aplicado no sen ido de
melho a a ges ão da in aso a. Nes e con ex o, os mecanismos de dispe são, o
melho amen o de mé odos de con olo e a possibilidade de i a p o ei o do in aso o am
in es igados.
A dispe são da espécie oi es udada examinando a in luência das al e ações
ambien ais (o aumen o da empe a u a oi usado como modelo) no mo imen o de
“ lu uação” acima do subs a o da amêijoa em es ádios iniciais de ida, bem como o papel
desempenhado po aspe os gené icos e pela sazonalidade na p odução do muco que
p omo e esse mo imen o. Os esul ados suge em que a “ lu uação” é es imulada pelo
aumen o da empe a u a. Po ou o lado, os dados não pe mi em con i ma a ideia
gene alizada de que a p odução do muco es á elacionada com enómenos sazonais,
sendo que enómenos de adap ação local são apon ados como uma causa p o á el pa a
a disc epância sinalizada. A in o mação sob e o mo imen o de “ lu uação” é essencial
pa a se ca ac e iza em maio de alhe a dispe são da espécie, pe mi indo e en ualmen e
desen ol e es a égias de p e enção nesse sen ido. Em seguida, os impac os de C.
luminea nas indús ias po uguesas dependen es de água doce e a sua a ual dis ibuição
__________
i
no país o am es udados. Apesa da amêijoa asiá ica es a p esen e em Po ugal desde
os anos 80, e i icou-se que a sua dispe são é ainda limi ada e que os impac os
económicos da espécie pe manecem ela i amen e mode ados. Tal cená io pode á se
explicado pelo ac o de a in asão ainda es a na ase es acioná ia ( ase lag) que p ecede
o ápido c escimen o das populações nos locais in adidos ou pela oco ência de
enómenos de mo alidade massi as ca ac e ís icas de C. luminea e que oco em em
populações já es abelecidas no país. A documen ação dos impac os des a espécie em
Po ugal pode auxilia en idades o iciais na implemen ação de polí icas de ges ão
in eg ada em países que se encon em em isco de in asão ou onde a pes e chegou
ecen emen e. Reconhecendo a ele ância de con inua a p ocu a soluções de con olo
mais e icien es pa a a amêijoa asiá ica, oi in es igado o po encial da aplicação de
biocidas em combinação com condições de baixo oxigénio dissol ido. Os esul ados
p elimina es suge em que a hipoxia aumen a a e icácia de alguns biocidas, o que
p opo ciona caminhos u u os pa a a in es igação, nomeadamen e abo dando ní eis de
oxigénio in e médios em combinação com biocidas. Finalmen e, e endo em con a as
lacunas que ainda exis em nas soluções de con olo disponí eis, assim como as
di iculdades associadas à e adicação da pes e de sis emas a e ados, oi explo ado o
po encial de C. luminea pa a se usado como e amen a de bio emediação usando um
e luen e ico em me ais como modelo expe imen al. A amêijoa emo eu uma ação
signi ica i a de me ais do e luen e, o que se aduziu na diminuição da sua oxicidade
ambien al. O po encial de C. luminea como bio emediado a de e luen es indus iais ab e
po as pa a de alguma o ma compensa os e ei os noci os das in es ações já
es abelecidas.
__________
ii
INTRODUCTORY NOTE
Biological in asions a e a g owing wo ldwide h ea o he ecological and economic
well-being o he plane . In asion s a s wi h he in oduc ion o a non-indigenous species
in o a new habi a , which is gene ally p omo ed by he human ac ion. The in asi e
p ocess hen p oceeds h ough a se ious o sequen ial s ages un il a s able popula ion is
es ablished. Du ing his p ocess, in aded ecosys ems and human-made s uc u es end o
be signi ican ly damaged, he eason why adequa e managemen s a egies ha e o be
applied.
The eshwa e clam Co bicula luminea, commonly known as he Asian clam, is
amongs he mos se ious in asi e species due o i s ecological impac s and bio ouling
ac i i y. The species is p esen ly sp ead om i s Asia ic na i e ange ac oss all o e he
wo ld. While he body o knowledge on C. luminea biology, impac s and managemen
g ea ly enla ged o e he pas 40 yea s, many ques ions emain unsol ed and he e is s ill
oom o imp o ing pes moni o ing and con ol p og ammes. In pa icula , in Po ugal, a
ga eway h ough which he species en e ed Eu ope 30 yea s ago, in eg a ed managemen
o po en ial h ea ens posed by he C. luminea in asion ha e been somewha neglec ed.
In his con ex , his hesis had a wo old aim. Fi s , and conside ing he insipiency o local
(i.e. na ional-wide) pes managemen s a egies a ge ed a he Asian clam, his hesis
in ends o upda e he in o ma ion on he dis ibu ion and economic impac s o he Asian
clam in Po ugal. Second, his hesis in ends o gene a e new knowledge ha suppo he
design o imp o ed managemen p ac ices, wi h he ocus gi en: (i) o pa icula aspec s
o he species biology ha can explain dispe sal pa e ns; (ii) o he species ole ance o
chemical and physical ea men ; (iii) o he bio emedia ion abili ies as bene icial se ice
ha he species can p o ide. The Asian clam p oblema ics has hus been add essed om
a holis ic pe spec i e, co e ing a ange o pes managemen - ela ed opics, including he
species dispe sal, po en ial impac s due o he in asion o in new a eas, con ol o
es ablished popula ions and he possibili y o aking p o i om he p esence o he in ade
when accep ing i becomes una oidable (Figu e I.1). Consis en ly wi h such a pe spec i e,
he hesis is o ganized in se en chap e s being he cen al i e dis ibu ed by hese ou
main opics as ep esen ed in Figu e I.1.
Chap e 1 de ines and desc ibes undamen al concep s wi hin he con ex o
biological in asions. Such backg ound in o ma ion ames he p oblema ics o in asi e
species and he a ionale behind he holis ic pe spec i e adop ed in his hesis. Chap e 1
also p esen s he Asian clam as one o he wo ld’s mos impo an in asi e species,
e iewing he species’ majo biological ea u es, i s dispe sal, i s impac s and he me hods
__________
iii
cu en ly in use o con ol he bi al e. This chap e hus p o ides gene al in o ma ion
suppo ing he subsequen chap e s. Chap e s 2 o 6 cons i u e he main body o he
hesis in he sense ha hey p esen ac ual esea ch esul s. These chap e s we e
o ma ed as jou nal a icles – some ha e al eady been published, some we e submi ed
o pee - e iewed jou nals and one is awai ing submission un il addi ional da a can be
in eg a ed – and he e o e some concep ualiza ion no es, a ionale desc ip ion, me hods
de ailing and li e a u e-based discussion pa s can be ound epea ed ac oss hem.
Dispe sal is a de e minan s ep in any biological in asion p ocess. I has been
p o en ha a mucous-assis ed lo a ion beha io cons i u es an impo an mode o
dispe sal in C. luminea. Unde s anding he ac o s in luencing he p oduc ion o such
mucous and ela ed clams’ d i ing mechanism may hus p o ide ele an in o ma ion o
pes managemen . Chap e s 2 and 3 add ess his opic, wi h Chap e 2 s udying he
in luence o empe a u e in he clams’ lo a ion beha io , and Chap e 3 in es iga ing
whe he gene ic o seasonal ac o s a ec he mucous p oduc ion p ocess.
One o he main conce ns ela ed o in asi e species is he impac s hey a e
esponsible o . In he case o bio oule s such as C. luminea, no only ecological, bu also
economic losses due o hei p esence in human-made s uc u es and he indus ial
en i onmen ha e o be conside ed. Since he in oduc ion o C. luminea in Po ugal, a
wide ange o ecological impac s ha e been epo ed in eshwa e ecosys ems. Howe e ,
he damage caused by he species a he indus ial le el has no been sys ema ically
documen ed. Chap e 4 p o ides such documen a ion along wi h in o ma ion on he
bi al e’s cu en dis ibu ion in Po ugal.
As he e ec i e and en i onmen ally iendly mi iga ion o Asian clam popula ions
emains a challenge, chap e 5 in ends o con ibu e o he sea ch o imp o ed con ol
solu ions by examining he po en ial o combining biocide applica ion wi h hypoxic
condi ions.
F equen ly, he e adica ion o es ablished Asian clam popula ions is unachie able.
The possibili y o aking p o i om he pes could hus o se i s damaging impac s. In
chap e 6, his idea is explo ed by assessing he use o C. luminea as a bio emedia ion
ool applied o me al-bea ing e luen ea men .
Finally, in chap e 7, concluding ema ks on he di e en s udies and on hei
in eg a ion, as well as u u e di ec ions o he esea ch ollowing his hesis a e p esen ed.
__________
ix
Backg ound
in o ma ion Species
dispe sal Impac s Con ol Taking p o i
om he pes
Chap e 1
Biological in asions:
The gene al heo y
and he pa icula
case o Co bicula
luminea
Chap e 2
E ec s o uppe -
limi wa e
empe a u es on he
dispe sal o he
Asian clam
Co bicula luminea
Chap e 4
The Asian clam
Co bicula luminea
in he Eu opean
eshwa e -
dependen indus y:
A la en h ea o a
iendly enemy?
Chap e 5
Sensi i yo he
in asi e bi al e
Co bicula luminea
o candida e con ol
chemicals: The ole
o dissol ed oxygen
condi ions
Chap e 6
Bio emedia ion o a
me al- ich e luen
by he in asi e
bi al e Co bicula
luminea
Chap e 3
Dispe salo
Co bicula luminea:
Fac o sin luencing
he in asi eclam’s
d i ingbeha io
Final
conside a ions
Figu e I.1: Roadmap o his disse a ion.

CHAPTER 1
Biological in asions: The gene al
heo y and he pa icula case o
Co bicula luminea
Backg ound in o ma ion - Chap e 1
8
1.2.2. Rep oduc ion, li e cycle and popula ion s uc u e
C. luminea is a he maph odi ic and and ogene ic species (K aeme and Lo 1977, Pa k
and Chung 2004, Pigneu e al. 2011, Rajagopal e al. 2000) and, al hough sel -
e iliza ion has been obse ed, c oss- e iliza ion seems o be he mos common in his
species (K aeme and Galloway 1986, Pa k and Chung 2004). Con as ing wi h o he
he maph odi ic bi al e mollusks, he Asian clam is p o o-oogamous and oogenesis is
ini ia ed be o e spe ma ogenesis (B i on and Mo on 1982).
In gene al, sexual ma u i y is eached wi hin he i s yea ollowing spawning,
gene ally a a shell leng h o 10 mm (I ua e 1985, Mou hon 2001b). In ma u e clams,
incuba ion and spawning occu s in he inne demib anchs o he gills (King e al. 1986).
A e e iliza ion and ea ly cell di isions, a ocopho e is o med which e ol es in o a
s aigh -hinged s age ha hen de elops in o a pedi elige s age (100-112 h a e
spawning) (King e al. 1986). Then, ju eniles (leng h mean ± SD: 221 ± 10 µm) a e
eleased ou o he gills in o he wa e , al eady shelled and wi h adduc o muscles, oo ,
s a ocys s, gills, and diges i e sys em ully o med (King e al. 1986, McMahon 2002).
Ju eniles a e well adap ed o he ben hic compa men and he species hence lack a
plank onic s age (King e al. 1986, Phelps 1994). Ju eniles a e eleased in la ge
quan i ies (up o 700 ju eniles clam-1 day-1 (Ald idge and McMahon 1978)) bu high
mo ali y a es du ing he i s h ee weeks a e common (B i on 1982, King e al. 1986).
They p esen a e y high g ow h a e (shell leng h as la ge as 29 mm eached wi hin he
i s yea o g ow h (Ald idge and McMahon 1978)), which is pa ly due o hei highe
il a ion and assimila ion a e compa ed o olde o ganisms (McMahon 2002).
C. luminea p esen s a wide ange o in aspeci ic a ia ion in li e-his o y ai s and
in he popula ion s uc u e pa e ns as assessed in di e en si es (Table 1.2). When
conside ing popula ions mos ly composed by adul clams, maximum shell leng h anges
be ween 19 and 51.6 mm. Seasonal a ia ion can be obse ed in popula ion densi ies,
wi h di e en s udies indica ing maximum densi ies anging be ween 60 and 16.198
clams m-2. Li e span is in gene al 2-3 yea s howe e , some s udies epo ed popula ions
wi h longe i y o 5 yea s. Du ing hei li e span, clams seem o ep oduce once o wice a
yea . In he cases whe e only one ec ui men e en was epo ed, i occu ed om ea ly
summe o ea ly au umn depending on he popula ion. In cases whe e wo ec ui men
e en s we e obse ed, hey occu ed in sp ing/ea ly summe , and again in la e
summe /au umn, which means ha ju eniles bo n in he sp ing can con ibu e o he
immedia ely ollowing au umn ep oduc i e e en . Di e ences in he annual numbe o

Backg ound in o ma ion - Chap e 1
9
Table 1.2. Summa y o shell leng h, densi y, li e span and ec ui men e en s ound o se e al C. luminea popula ions in di e en s udies. The
s udy si e loca ion, sampling da e and wa e empe a u e ange a e also shown. This summa y esul om a ho ough li e a u e sea ch and only
s udies epo ing da a on a leas 4 o he columns we e conside ed.
S udy
S udy si e
Sampling da e
Wa e empe a u e
ange (ºC)
SL ange
(mm)
Clam densi y
(clams m-2)
Rec ui men e en s
Li e span
(yea s)
Numbe
Time o he yea
Ald idge and
McMahon 1978
Lake A ling on, USA
Sep 1974 – Jan
1976
12.2-32.2
0.2-40
17.7-94.6
2
Ap -Jul & Aug-Dec
2
I ua e 1985
Pun a A alaya,
A gen ina
No 1982-Ap
1985
~11-27
~3 - ~30
36-1132
1
Sep embe
3
McMahon and
Williams 1986
T ini y Ri e , USA
Sep 1980 – Dec
1982
4.8-29
2.6- ~45
305-16198
2
Ma -Jul & Aug-
No
3
Ho nbach 1992
Mechums Ri e ,
USA
Oc 1982-Oc
1983
0- ~26
0.4-19
173-1495
1
July
2-3
F ench and
Schloesse 1996
S . Clai Ri e , USA
1988-1990
0.5-12.5
1.8– 5.3
18-187
-
-
-
Ca aldo and
Bol o skoy 1998
Pa aná Ri e Del a,
A gen ina
Oc 1995-Oc
1996
10-29
0.2-33
379-2609
1
Oc -No
3
Rajagopal e al.
2000
Lek Ri e ,
Ne he lands
Aug 1991-Jan
1993
~2-~24
-
-
2
May/Jun & Sep
-
Mou hon 2001a
Saone Ri e , F ance
Sep 1986-Dec
1999
0.5-27.2
1.5- ~29
~120-934
2
Jun/Jul & Aug/Sep
5
Mou hon 2001a
Rhône Ri e , F ance
Sep 1996-Dec
1999
3-23.5
~0.5 - ~29.3
~300-5266
1
Jul-Sep
5
Mo gan e al.
2003
Connec icu Ri e ,
USA
Aug 1993-No
1994
-1.7-30.6
-
52-114
1
Jun-Sep
-
Mou hon and
Pa ghen anian
2004
Loi e Ri e , F ance
Dec 2001-May
2003
[Ice]-25
0.5- ~34
88-< 4000
2
Jan-Feb & May-
Oc
2.5-3
Sousa e al. 2006
Lima Ri e , Po ugal
Aug 2004 & Aug
2005
20.1-22.9
13.0-51.6
60
-
-
-
Schmidlin and
Bau 2007
Al hine Ri e ,
Swi ze land
Ma 2003-Oc
2003
7-24
1-24
83-339
1
Jun-Jul
-
Sousa e al.
2008c
Minho Ri e ,
Po ugal
Jan 2005- Aug
2006
6.7-23.1
1.85-41.83
92-2152
-
-
2-3
F anco e al. 2012
Mondego Es ua y,
Po ugal
Dec 2007-Dec
2008
10.1-25.4
0.92-37
419-6632
Con inuous
-
-
P esen s udy
Casal de São Tomé,
Po ugal
Oc 2011-Dec
2012
11.8-20.5
6-32
1353-6352
2
Jun-Sep & No
-
Backg ound in o ma ion - Chap e 1
10
ep oduc i e e en s be ween consecu i e yea s a he same si e we e also epo ed
(McMahon and Williams 1986). These ep oduc i e e en s a e accompanied by a
decline in clam physiological condi ion consis en wi h he dec ease in biomass caused
by he elease o de eloped ju eniles (F ench and Schloesse 1996)
The a ia ion no iced in li e-his o y ai s when di e en popula ions a e compa ed
may ela e o gene ic dissimila i ies, bu mos p obably en i onmen al condi ions a e he
main ac o de e mining such a ia ion. In ac , ac o s such as empe a u e, a ailable
ood esou ces, and con amina ion, we e al eady p o en o a ec clam g ow h and
physiological condi ion, popula ion s uc u e and/o spawning (Ca aldo and Bol o skoy
1998, Ca aldo e al. 2001, Mo gan e al. 2003, Mou hon 2001b, Sousa e al. 2008c).
Tempe a u e, o example, seems o be an essen ial igge o he spe ma ogenesis
(K aeme and Galloway 1986), spawning (Rajagopal e al. 2000), and clam g ow h
(Ca aldo and Bol o skoy 1998, Mo gan e al. 2003). Some au ho s also concluded ha
ood a ailabili y may be as impo an as he mal egimes o some li e-cycle e en s such
as ec ui men (Ca aldo and Bol o skoy 1998, Mou hon and Pa ghen anian 2004,
Rajagopal e al. 2000).
1.2.3. Habi a and eeding p e e ences
Some con o e sy exis s ega ding C. luminea classi ica ion as a eshwa e - o b ackish
wa e species. Some au ho s include he species in b ackish g oup despi e i s ob ious
p e e ence o eshwa e (E ans e al. 1977), bu he classi ica ion as a eshwa e
species wi h high ole ance o es ua ine habi a s has been he mos commonly used
(B i on 1982). This high ole ance has been explained as a esul o a ecen b ackish
wa e ances al, since Co biculidae is a amily g ouping mainly es ua ine bi al es (B i on
1982).
The Asian clam occu s bo h in len hic and lo ic habi a s (B i on 1982). This
species is a ely ound in in e mi en s eams o empo a y ponds, possibly due o i s low
ole ance o ae ial exposu e (By ne e al. 1991), and i clea ly p e e s high-o de
ibu a ies (i.e. abo e second o de s eams) (Ka a aye e al. 2005b, Schmidlin and
Bau 2007). Wa e cu en s ongly de e mines C. luminea p esence in a gi en si e, no
only because i a ec s ood a ailabili y bu also because i s ongly de ines he ype o
sedimen , which is pa icula ly impo an o in aunal bi al es such as his species
(Ka a aye e al. 2003, Schmidlin and Bau 2007). The p e e ed subs a e o he Asian
clam has been a gued o be composed o sand and g a el, bo h ypically ound in low
cu en wa e bodies (bij de Vaa e and G eijdanus-Klaas 1990). C. luminea p e e en ially
colonizes wa e bodies wi hou conside able seasonal hyd ological oscilla ions, ample
Backg ound in o ma ion - Chap e 1
11
oxygen supply, and sedimen s ich in o ganic ma e ial, being commonly ound in he
limne ic po ions o he ecosys ems (B i on 1982, Ka a aye e al. 2003, Schmidlin and
Bau 2007, Sousa e al. 2008b).
As al eady e e ed, o ganic ma e in s eambed is a ac o ha can de e mine
he p esence o C. luminea in a gi en si e. This clam is p ima ily a suspension- eede
il e ing phy oplank on and de i us om he wa e column a e y high a es (Che y e
al. 1980, Sil e man e al. 1995). Besides ha , he Asian clam is a pedal- eede using he
o ganic ma e a ailable in he sedimen has a ood esou ce (Hakenkamp and Palme
1999). This eeding al e na i e can play an impo an ole especially in oligo ophic
habi a s (p esen s udy, Mou hon 2001a).
1.2.4. Cu en dis ibu ion and ec o s o dispe sal
C. luminea is na i e om sou heas China, Ko ea and sou heas Russia bu unde wen a
massi e global ange expansion o e he las cen u y (A aujo e al. 1993). Recen ly i
has al eady been epo ed in almos all No h Ame ica ( e iewed in Mackie and Claudi
2010), Sou h Ame ica (Beasley e al. 2003, I ua e 1985), and all o e Eu ope (e.g.
Be an 2006, bij de Vaa e and G eijdanus-Klaas 1990, Ellio 2008, Pauno ić 2007,
Pé ez-Bo e and Fe nández 2008, Rosa e al. 2011).
The in oduc ion o hese in asi e bi al es in non-na i e a eas has been
a ibu ed o se e al causes no always ela ed wi h human ac i i ies. Some sugges ed
ha he ec o s o dispe sal a e anspo a ion ia ballas wa e , as bai used by
ishe men, and on bi d’s ee , and en angled in mac ophy es (B i on 1982, Coun s
1986).
1.2.5. In asion success
Se e al pa ame e s may de e mine he dis ibu ion and occu ence o C. luminea, in
se e al s ages o i s li e cycle. The Asian clam is conside ed a suscep ible species o
en i onmen al s ess when compa ed wi h sphae iids and unionaceans ( o mo e de ails
see McMahon (1991)). I s ange o ole ance o di e en en i onmen al s esso s was
syn hesized by Mackie and Claudi (2010) and some new in o ma ion wi hin his con ex
can be ound in he p esen hesis. Acco ding o Mackie and Claudi (2010), clams
su i e o a wide wa e empe a u es anging be ween 2 and 36 ºC and he o ganisms
a e appa en ly e y ole an o low dissol ed oxygen le els in wa e (lowe ole ance limi
o 0.5 mg L-1). On he o he hand, C. luminea does no ole a e wa e s wi h pH below 5
and ha dness below 3 mg CaCO3 L-1 (Mackie and Claudi 2010). The same au ho s
concluded ha he uppe ole ance limi s o conduc i i y and o al dissol ed solids a e o
12,600 µS cm-1 and 8400 mg L-1, espec i ely. The uppe ole ance limi o C. luminea
Backg ound in o ma ion - Chap e 1
12
o salini y is 8, howe e , in si ua ions whe e acclima ion is allowed o exposu e occu s
o sho pe iods, he clam can ole a e salini ies up o 20-22 (E ans e al. 1977, Ila i and
Sousa 2011). Du ing he s udies ca ied ou wi hin he con ex o he p esen hesis he
Asian clam was ound in oligo ophic wa e s wi h almos no chlo ophyll a (mean ±
s anda d de ia ion: 0.73 ± 1.01 µg/ L-1) whe eas 25 µg L-1 chlo ophyll a, ypically ound in
meso ophic sys ems, seems o be he uppe ole ance limi o he species (Mackie and
Claudi 2010).
The educed ole ance o pa icula en i onmen al s esso s can lead o high
mo ali y a es as i has been epo ed in many s udies (Coope e al. 2005, Ila i e al.
2011, Schmidlin and Bau 2007, We ne and Ro hhaup 2008). O he ac o s such as
o e popula ion, al e a ion o low egimes, con amina ion, epidemics, and pa asi es can
also ac alone o in syne gy p omo ing massi e die-o s (B i on and Mo on 1982,
F ench and Schloesse 1996, Mo gan e al. 2003, Vohmann e al. 2009). Howe e , C.
luminea has a ema kable abili y o apidly eco e om popula ion c ashes (o en wi hin
one yea (B i on 1982)), which e lec s i s ecological p o ile as a ypical -s a egis . This
e idences ha b oad physiological ole ance o a la ge ange o en i onmen al s esso s
is no manda o y o he success o in asi e species, as a gued by McMahon 2002.
Sho li e span, ea ly ma u i y, high ecundi y, biannual ju enile elease pa e ns, high
g ow h a es, he maph odi ism and and ogenesis, small ju enile size and ex ensi e
capaci y o dispe sal a e a he key ea u es o he species biology ha con e impo an
ad an age in he in asion p ocess (McMahon 2002, Pigneu e al. 2011, Sousa e al.
2006, Vohmann e al. 2009).
The ai s ha a o he in asion success o C. luminea a e also he basis o he
species abili y o impai he in aded ecosys ems and o p omo e he mal unc ion o
in es ed unde wa e indus ial s uc u es, as de ailed in he ollowing sec ion.
1.2.6. Impac s
Table 1.3 summa izes he ecological and indus ial impac s o C. luminea ha ha e
been epo ed in he li e a u e. The classi ica ion o he ecological impac s is no
s aigh o wa d due o he complexi y o bio ic-bio ic and bio ic-abio ic in e ac ions ha
es ablish ecosys ems. In ac , an impac iewed as nega i e o a gi en species o g oup
o species can be bene icial o ano he species o o he o e all ecosys em heal h. Fo
example, i he Asian clam ex ao dina y il e ing abili ies can be noxious o compe i o
na i e species, bene i s o he ecosys em a a highe le el can a ise p o ided ha he
eu ophica ion p ocess is mo e easily delayed o a oided.
Backg ound in o ma ion - Chap e 1
13
Table 1.3. Summa y o he ecologic and indus ial impac s o C. luminea. The column
+/- indica es whe he he ecological impac s a e posi i e (+) o nega i e (-). When all he
indus ial impac s a e conside ed as being nega i e ha column was no conside ed.
+/-
Impac s
Re e ence
Ecological
+
Shel e and subs a e o o he species
S aye and Malcom 2007, We ne
and Ro hhaup 2007
+
Sou ce o o ganic ma e and ino ganic nu ien s
in he subs a e o pelagic and ben hic species
Can anhêde e al. 2008, Sousa e al.
2008a, Vaughn and Hakenkamp
2001
+
Dec ease in eu ophica ion le els and u bidi y
Phelps 1994
-
Dominance in he ben hic biomass by
subs i u ion and/o educ ion o he a ailable
habi a o o he species
Schmidlin and Bau 2007, S aye
1999, Vaughn and Hakenkamp 2001,
Williams e al. 2001
-
Compe i ion o ood wi h o he il e ing and
ben hic species
Cohen. e al. 1984, Hakenkamp and
Palme 1999, Lau i sen 1986, S aye
1999, Williams e al. 2001
-
Inges ion o spe m, glochidia, and newly
me amo phosed ju eniles o na i e bi al es
S aye 1999
-
Excessi e p oduc ion o ammonia and oxygen
deple ion ollowing massi e die-o episodes
Ila i e al. 2011, S aye 1999
-
Changes in nu ien cycles
Hakenkamp and Palme 1999,
Vaughn and Hakenkamp 2001
-
Vec o s o pa asi es and o he pa hogenic
agen s
Chung e al. 2001
Indus y
Impac s
Re e ence
Indus ial
Elec ic powe s a ions
Clogging o condense s and wa e dis ibu ion
sys ems in a eas wi h a educed pe ime e and
low low
Isom 1986, Johnson e al. 1986,
MacPhee 1986, McMahon 1977,
Page e al. 1986, Po e and Liden
1986, Rosa e al. 2011, Smi hson
1986
Loss o pe o mance and e iciency in he
condense s due o high p essu es and cleaning
ac i i ies
Po e and Liden 1986
Secu i y ailu e due o de icien cooling and
clogging o he i e p o ec ion sys ems
Isom 1986, Johnson e al. 1986
P oduc i i y losses du ing cleaning ope a ions
and clams emo al
Isom 1986, Johnson e al. 1986,
MacPhee 1986, McMahon 1977,
Page e al. 1986, Po e and Liden
1986, Rosa e al. 2011, Smi hson
1986
D inking
wa e
ea men
plan s
Dec ease in e iciency due o he in e up ion o
he wa e low and inc ease in machine y
ab asion
Ing am 1959, Rosa e al. 2011,
Sinclai 1964
Changes in wa e odo and la o
Smi hson 1986
Cemen
indus ies
Losses in he cemen quali y due o he use o
sand loaded wi h clam shells in he p oduc ion
Sinclai 1964
I iga ion sys ems
Clams accumula ion in low low a eas, leading o
he dec ease in wa e low ha hen a o s
sedimen s deposi ion, which con ibu es
addi ionally o he impac
Ing am 1959, P okopo ich 1969,
P okopo ich and He be 1965, Rosa
e al. 2011
Clog o i iga ion s uc u es, which equi es
inc eased ene gy consump ion o e-es ablish
adequa e low le els
Rosa e al. 2011
Was e o wa e du ing clams emo al ope a ions
and inc eased need o epai / eplace o i iga ion
s uc u es
McMahon 1983, P okopo ich and
He be 1965, Rosa e al. 2011

Backg ound in o ma ion - Chap e 1
14
Indus ial impac s ela es o he C. luminea bio ouling ac i i y, which is
cha ac e ized by he g ow h and es ablishmen o dense popula ions in di e en
unde wa e s uc u es, pipeline and equipmen o wa e -dependen indus ies such as
powe s a ions, d inking wa e ea men plan s, cemen indus ies and i iga ion sys ems
(Table 1.3). The damages caused by Asian clam in es a ions, as well as he
implemen a ion o con ol measu es o he pes , cos s se e al billion dolla s each yea
wo ldwide; his makes he Asian clam a species wi h se ious economic impac s
(Pimen el e al. 2005). In Eu ope, he p oblem does no seem o be as se ious as in he
Uni ed S a es (Rosa e al. 2011). Howe e , based on he No h Ame ican expe ience, a
sudden inc ease o indus ial losses due o his in asi e species may occu (Rosa e al.
2011), hence he need o s imula e he de elopmen o adequa e managemen p ac ices
o he pes , including imp o ed con ol me hods.
1.2.7. Con ol
Gi en he se e i y o C. luminea impac s pa icula ly in an indus ial con ex , he
a en ion de o ed o he de elopmen o me hods o con ol his pes has been
inc easing. Physical and mechanical, chemical and biological me hods ha e been
p oposed o con ol he Asian clam and o he bio ouling bi al es.
Physical measu es al eady sugges ed o alle ia e ouling by he Asian clam en ail
he use o elec ic cu en s, elec omagne ic ields, gamma adia ion, hea ed wa e , and
ul asonic ib a ions (Dohe y and Che y 1988, Ma ice 1983, Mussalli e al. 1986). The
mos p omising me hod seems o be he applica ion o hea ed wa e ; howe e , uppe
empe a u e ole ance limi s o C. luminea a e e y high (Mackie and Claudi 2010), hus
such a con ol echnique equi es wa e empe a u es as high ha i s applica ion may
equi e modi ica ion o he sys em’s design o e en ually newly de eloped sys ems
(Ma ice 1983).
Mechanical me hods a e gene ally di ec ed owa ds he emo ing o he clams
om he ulne able s uc u es o he indus ies and include he use o s aine s and
aps, he back lushing o clogged lines and manual emo al o shells (Dohe y and
Che y 1988, Isom 1986, MacPhee 1986, Ma ice 1983, Rosa e al. 2011). Howe e ,
some disad an ages can be asc ibed o mechanical con ol me hods, e.g., he e a e
limi a ions in he use o s aine s wi h mesh sizes small enough o p e en ju eniles om
en e ing he se ice wa e sys ems, and manual emo al may only be possible wi h he
plan empo a y shu down (Ma ice 1983, Page e al. 1986, Rosa e al. 2011). Some
au ho s ha e also sugges ed he combina ion o mechanical and chemical solu ions o
indus ial mac o ouling con ol (Isom 1986, Mussalli e al. 1986, Smi hson 1986), bu
Backg ound in o ma ion - Chap e 1
15
mos o he da a a ailable in he li e a u e esul om s udies ocused only in chemical
con ol echniques.
Chemical me hods used o con ol C. luminea impac s consis in he addi ion o
biocides o he indus y’s wa e ways o ese oi s (Dohe y and Che y 1988). Following
he syn hesis by Ma ice (1983), able 1.4 summa izes chemical con ol me hods ha
ha e been p oposed as e ec i e agains he bio ouling ac i i y o he Asian clam. I is
impo an o no ice ha he compa abili y o he a ailable oxici y in o ma ion o mos o
he biocides is limi ed since he es me hodology was designed acco ding o he speci ic
objec i es o each s udy. This is especially impo an when o ganisms ha espond
di e en ly o he chemical challenges as di e en li e s ages (e.g. chlo ine, b omine,
TBTF, Polyqua ; see able 1.4 o mo e de ails) o en i onmen al empe a u es (e.g.
chlo ine, b omine; see able 1.4 o mo e de ails) a e es ed. The main di icul y o
chemical con ol is ha he compound mus be s able enough o be e ec i e i.e. i mus
no eac o decay becoming non- oxic be o e o as i is applied (Ma ice 1983). On he
o he hand, he chemical pe se o i s byp oduc s should be non- oxic o pe sis en
po en ially a ec ing non- a ge o ganisms. As an example, chlo ina ion has been
his o ically he p e e ed chemical me hod o con ol a wide ange o ouling o ganisms
(e.g. bac e ia, algae, ungi and in e eb a es including C. luminea (Jenne e al. 1998,
Rajagopal e al. 2002)); No wi hs anding, chlo ine byp oduc s we e p o en o be highly
oxic o o he o ganisms (Jenne e al. 1997, Rajamohan e al. 2007). In his con ex , he
assessmen o he en i onmen al oxici y o candida e con ol chemicals is o key
ele ance, al hough li le a en ion has been gi en so a o his ecommenda ion (Walle
e al. 1993).
Biological con ol is ano he s a egy ha has been sugges ed o apply o C.
luminea bio ouling, namely conside ing he p eda o y po en ial o e eb a e and
in e eb a e species o e he clam (Can anhêde e al. 2008, Robinson 1988). The
con i med p eda o s o he Asian clam a e mainly ish (14 species including Ba bus
bocagei, Pla ich hys lesus, Cobi is paludica, Ic ala us u ca us, Lepomis mic olophus,
Aplodino us g unninens) bu also musk a s (Onda a ziben hica), ducks, accoons,
c ay ish and la wo ms (B anco e and Vincen 2002, B i on 1982, Ka a aye e al.
2005a, Sousa e al. 2008c). Howe e , none o he p eda o species was p o en o p e e
C. luminea o e o he ood i ems, which limi s he po en ial o con ol me hods based on
p eda ion. Pa asi es can also be conside ed in he con ol o he pes bu only wo
pa asi e species a e known o be associa ed wi h he Asian clam ( he oligochae e
Chae ogas e limnaei and a mi e), and he e a e no e idences o a nega i e e ec o
hese pa asi es in clams’ abundance (Ka a aye e al. 2005a).
Backg ound in o ma ion - Chap e 1
16
Table 1.4. Summa y o chemical solu ions p oposed o he con ol o C. luminea. NI - no in o ma ion a ailable. J - Ju eniles and A – Adul s.
Chemical
Tes condi ions
Main conclusions
Re e ences
[ ] (mg L-1)
T (ºC)
Exposu e
ime
Li e
s age
Chlo ine
5, 7.5 and 10
35-46
30 min
J/A
 Mo ali ies ela ed o wa e empe a u e bu no o chlo ine exposu e
Ma ice e al. 1982
0.23-0.26
14-25
28-32 days
J/A
 E ec i e (> 90% mo ali y) a ~0.25 mg/L a e 28 days a 20-25 ºC
 E ec i e a lowe empe a u es only when o ganisms we e weakened by
exposu e o win e condi ions
 Ine ec i e in sho - e m exposu e
 P e ea men o clams o lowe concen a ions o chlo ine o 14 days does no
enhance e iciency
Dohe y e al. 1986
0.29
7 & 23
28 days
J/A
 E ec i e (LT100) in ju eniles a e 17 days a 23 ºC
 Lowe oxici y in adul clams (66.7% mo ali y a e 28 days)
 Lowe oxici y a 7 ºC (39 and 3.3% mo ali y a e 28 days o ju enile and adul
clams, espec i ely)
Belange e al.
1991
Slimcide 364
25, 50, 100 and
200
-
3-24 h
J
 E ec i e (90% mo ali y a 200 mg/L a e 3h)
Da is and Dohe y
1985
Be z ®Slimicide C-41
5, 10, 20, 25, 50
and 100
-
1-6 days
J/A
 E ec i e (LT100) in ea ly ju eniles a e 3 h a 25 mg/L
 E ec i e (LT100) in la e ju eniles a e 24h a 50 and 100 mg/L
 E ec i e in adul clams (LT100) a e 24h a 100 mg/L, and less e ec i e in
smalle concen a ions e en a e 72h
Da is and Lyons
1986
B omine
1.69-1.83
moles/L
14-25
28-32 days
J/A
 A low empe a u es, mo e e icien in adul clams (LT50 = 5.6 days) han in
ju enile clams (LT50 = 8.8 days)
 A highe empe a u es he opposi e pa e n occu s (LT50= 22.3 and 22.4 days
s LT50=19.9 and 20.3 days)
Dohe y e al. 1986
TBTF-T ibu yl in luo ide
0.0001, 0.001,
0.0032, 0.010,
0.032
20
8
J/A
 E ec i e (LC99) in ju eniles a 17.4 µg/L a e 4 days
 E ec i e (LC99) in adul s a 60.5 µg/L a e 8 days
Mussalli e al. 1986
Polyqua -
Poly[oxye hylene(dime
hyliminio)e hylene
(dime hyliminio)e hylene
dichlo ide]
2, 4, and 8
24
61 days
J/A
 E ec i e (LT100) in ju eniles a e 11 days a 2 ppm and 7 days a 8 ppm
 E ec i e (LT100) in adul s a e 5 days a 2-8 ppm
 Con inuous applica ion in se ice wa e sys ems killed p e iously se led
ju eniles and p e en ed u he se lemen by ju eniles
McMahon and
Lu ey 1988
1, 2, 4, 8 and 10
20
24-33
NI
 Semicon inuous applica ion (30 min on/90 min o ) p o en o be mo e e icien
han con inuous applica ion a 1, 2 4, and 10 ppm
McMahon and
Chase 1997
Backg ound in o ma ion - Chap e 1
17
 Semicon inous applica ion educed chemical concen a ion equi ed when
compa ed wi h con inuous applica ion
ADBAC (n-alkyl
dime hylbenzyl ammonium
chlo ide)
2
25
NI
NI
 E ec i e (LT100) a e 12 h
Lyons e al. 1988 in
Pos e al. 2007
TCMTB 2-
( hiocyanome hyl hio)benzo
hiazole
1, 2 and 4
24
7 days
J/A
 E ec i e (LT100) a e 96, 35 and 24 h a inc easing concen a ions in he case
o ju enile clams
 E ec i e (LT100) a e 160, 160 and 120 h a inc easing concen a ions in he
case o adul clams
Hollis and Lu ey
1989
Monochlo amine
0.25 and 0.50
30
28 days
J/A
 E ec i e (LT100) a e 8 and 4 days a 0.25 and 0.5 mg/L, espec i ely, agains
ju enile clams
 E ec i e (LT100) a e 11-16 and 7-10 days a 0.25 and 0.5 mg/L, espec i ely,
agains adul clams (depending on he o iginal si e o clam collec ion)
Belange e al.
1991
Monochlo amine plus
excess o ammonia
0.25+0.54,
0.50+0.34 and
0.75+0.37
30
28 days
J/A
 Toxici y was enhanced by he p esence o ammonia
Belange e al.
1991
Ammonia
0.14, 0.23, 0.60
and 1.60 (un-
ionized
ammonia)
30
28 days
J/A
 E ec i e (LT100) a e 4-12 and 4-8 days a 0.60 and 1.60 mg/L, espec i ely,
agains ju enile clams (depending on he o iginal si e o clam collec ion)
 E ec i e (LT100) a e 5-12 and 5 days a 0.60 and 0.1.60 mg/L, espec i ely,
agains adul clams (depending on he o iginal si e o clam collec ion)
Belange e al.
1991
B omicine
0.25, 0.50 and
0.75
30
28 days
J/A
 E ec i e (LT100) a e 4 and 10 days a 0.50 and 0.75 mg/L, espec i ely,
agains ju enile clams
 E ec i e (LT100) a e 16-22 and 17 days a 0.50 and 0.75 mg/L, espec i ely,
agains adul clams (depending on he o iginal si e o clam collec ion)
Belange e al.
1991
Coppe
0.05, 0.10, 0.20,
and 0.40
20.1-28.0
30 days
A
 Con ol may be economically p ac ical a a concen a ion o 0.05-0.10 mg/L
 Labo a o y es s o e es ima ed clam sensi i i y
Belange e al.
1991
DGH/QUAT-
dodecylguanidinehyd ochlo
ide (DGH) e n-alkyl
dime hylbenzyl ammonium
chlo ide (QUAT)
3.75, 7.5, 15.0
and 20.0
15
24
La e J
 E ec i e (LT100) a e 10 days a 15.0 mg/L
 Responsible o an inc ease in issue wa e le els and a dec ease in issue
glycogen
Bidwell e al. 1995
Backg ound in o ma ion - Chap e 1
24
McMahon RF. 2002. E olu iona y and physiological adap a ions o aqua ic in asi e
animals: selec ion e sus esis ance. Canadian Jou nal o Fishe ies and Aqua ic
Sciences 59: 1235-1244.
Mo gan DE, Kese M, Swena on JT, Foe ch JF. 2003. Popula ion dynamics o he
Asia ic clam, Co bicula luminea (Mülle ) in he Lowe Connec icu Ri e :
Es ablishing a oo hold in New England. Jou nal o Shell ish Resea ch 22: 193-203.
Mou hon J. 2001a. Li e cycle and popula ion dynamics o he Asian clam Co bicula
luminea (Bi al ia : Co biculidae) in he Rhone Ri e a C eys-Mal ille (F ance).
A chi Fu Hyd obiologie 151: 571-589.
Mou hon J. 2001b. Li e cycle and popula ion dynamics o he Asian clam Co bicula
luminea (Bi al ia : Co biculidae) in he Saone Ri e a Lyon (F ance). Hyd obiologia
452: 109-119.
Mou hon J, Pa ghen anian T. 2004. Compa ison o he li e cycle and popula ion dynamics
o wo Co bicula species, C. luminea and C. luminalis (Bi al ia : Co biculidae) in
wo F ench canals. A chi Fu Hyd obiologie 161: 267-287.
Mussalli YG, Duaz-Tous IA, Sickel JB. 1986. Asia ic clam con ol by mechanical s aining
and o gano in oxican s in B i on JC, ed. P oceedings o he Second In e na ional
Co bicula Symposium: Ame ican Malacological Bulle in - Special edi ion no.2.
Page T, Nei zel D, Simmons M. 1986. Bio ouling o powe plan se ice sys ems by
Co bicula in B i on JC, ed. P oceedings o he Second In e na ional Co bicula
Symposium: Ame ican Malacological Bulle in - Special edi ion no.2.
Pa k GM, Chung EY. 2004. His ological s udies on he maph odi ism, game ogenesis and
cyclic changes in he s uc u es o ma supial gills o he in oduced Asia ic clam,
Co bicula luminea, and he Ko ean clam, Co bicula leana. Jou nal o Shell ish
Resea ch 23: 179-184.
Pa k JK, Kim W. 2003. Two Co bicula (Co biculidae : Bi al ia) mi ochond ial lineages a e
widely dis ibu ed in Asian eshwa e en i onmen . Molecula Phylogene ics and
E olu ion 29: 529-539.
Pauno ić M. 2007. Dis ibu ion o Asian clams Co bicula luminea (Mülle , 1774) and C.
luminalis (Mülle , 1774) in Se bia. Aqua ic In asions 2: 99-106.
Pé ez-Bo e JL, Fe nández J. 2008. Fi s eco d o he Asia clam Co bicula luminea
(Mülle , 1774) in he Guadiana Ri e Basin (sou hwes e n Ibe ian Peninsula).
Aqua ic In asions 3: 87-90.

Backg ound in o ma ion - Chap e 1
25
Pe ings C. 2005. Mi iga ion and adap a ion s a egies o he con ol o biological
in asions. Ecological Economics 52: 315-325.
P enninge MP, Reinha d F, S ei B. 2002. E idence o c yp ic hyb idiza ion be ween
di e en e olu iona y lineages o he in asi e clam genus Co bicula (Vene oida,
Bi al ia). Jou nal o E olu iona y Biology 15: 818-829.
Phelps HL. 1994. The asia ic clam (Co bicula luminea) in asion and sys em-le el
ecological change in he Po omac Ri e es ua y nea Washing on, DC. Es ua ies 17:
614-621.
Pigneu L-M, Ma escaux J, Roland K, E oundi E, Descy J-P, Van Doninck K. 2011.
Phylogeny and and ogenesis in he in asi e Co bicula clams (Bi al ia,
Co biculidae) in Wes e n Eu ope. Bmc E olu iona y Biology 11.
Pimen el D, Zuniga R, Mo ison D. 2005. Upda e on he en i onmen al and economic
cos s associa ed wi h alien-in asi e species in he Uni ed S a es. Ecological
Economics 52: 273-288.
Pos RM, Pe ille JC, Lyons LA. 2007. A e iew o eshwa e mac obiological con ol
me hods o he powe indus y.
Po e J, Liden L. 1986. Co bicula con ol a he Po omac Ri e S eam Elec ic S a ion
Alexand ia, Vi ginia in B i on JC, ed. P oceedings o he Second In e na ional
Co bicula Symposium. Ame ican Malacological Bulle in - Special edi ion no.2.
P okopo ich NP, He be DJ. 1965. Sedimen a ion in he Del a-Mendo a Canal. Jou nal
AWWA: 375-382.
P okopo ich NP. 1969. Deposi ion o clas ic sedimen s by clams. Jou nal o Sendimen a y
Pe ology 39: 8901-8901.
Rahel FJ, Olden JD. 2008. Assessing he e ec s o clima e change on aqua ic in asi e
species. Conse a ion Biology 22: 521-533.
Rajagopal S, an de Velde G, de Vaa e AB. 2000. Rep oduc i e biology o he Asia ic
clams Co bicula luminalis and Co bicula luminea in he i e Rhine. A chi Fu
Hyd obiologie 149: 403-420.
Rajagopal S, an de Velde G, Jenne HA. 2002. E ec s o low-le el chlo ina ion on zeb a
mussel, D eissena polymo pha. Wa e Resea ch 36: 3029-3034.
Backg ound in o ma ion - Chap e 1
26
Rajamohan R, Vinni ha E, Venugopalan VP, Na asimhan SV. 2007. Chlo ina ion by-
p oduc s and hei discha ge om he cooling wa e sys em o a coas al elec ic
plan . Cu en Science 93: 1608-1612.
Rena d E, Bachmann V, Ca iou ML, Mo e eau JC. 2000. Mo phological and molecula
di e en ia ion o in asi e eshwa e species o he genus Co bicula (Bi al ia,
Co biculidea) sugges he p esence o h ee axa in F ench i e s. Molecula
Ecology 9: 2009-2016.
Riccia di A, MacIsaac HJ. 2000. Recen mass in asion o he No h Ame ican G ea
Lakes by Pon o-Caspian species. T ends in Ecology & E olu ion 15: 62-65.
Richa dson DM, Pysek P, Rejmánek M, Ba bou MG, Pane a FD, CJ W. 2000.
Na u aliza ion and in asion o alien plan s - concep s and de ini ions. Di e si y and
Dis ibu ions 6.
Robinson JV. 1988. Ecological esis ance o he in asion o a eshwa e clam, Co bicula
luminea: Fish p eda ion e ec s. Oecologia 77: 445-452.
Rosa IC, Pe ei a JL, Gomes J, Sa ai a PM, Goncal es F, Cos a R. 2011. The Asian clam
Co bicula luminea in he Eu opean eshwa e -dependen indus y: A la en h ea o
a iendly enemy? Ecological Economics 70: 1805-1813.
Schmidlin S, Bau B. 2007. Dis ibu ion and subs a e p e e ence o he in asi e clam
Co bicula luminea in he i e Rhine in he egion o Basel (Swi ze land, Ge many,
F ance). Aqua ic Sciences 69: 153-161.
Sil e man H, Achbe ge EC, Lynn JW, Die z TH. 1995. Fil a ion and u iliza ion o
labo a o y-cul u ed bac e ia by D eissena polymo pha, Co bicula luminea, and
Ca unculina exasensis. Biological Bulle in 189: 308-319.
Simbe lo D, e al. 2013. Impac s o biological in asions: Wha ’s wha and he way
o wa d. T ends in Ecology and E olu ion 28: 58-66.
Sinclai RM. 1964. Clam pes s in Tennessee wa e supplies. Jou nal Ame ican Wa e
Wo ks Associa ion: 592-599.
Si ipa awan S, Pa k J-K, Foighil D. 2000. Two lineages o he in oduced Asian
eshwa e clam Co bicula occu in No h Ame ica. J. Molluscan S ud. 66: 423-429.
Smi hson J. 1986. De elopmen o a Co bicula con ol ea men a he Baldwin Powe
S a ion in B i on JC, ed. P oceedings o he Second In e na ional Co bicula
Symposium: Ame ican Malacological Bulle in - Special edi ion no.2.
Backg ound in o ma ion - Chap e 1
27
Sousa R, An unes C, Guilhe mino L. 2006. Fac o s in luencing he occu ence and
dis ibu ion o Co bicula luminea (Mülle , 1774) in he Ri e Lima es ua y. Annales
De Limnologie-In e na ional Jou nal o Limnology 42: 165-171.
Sousa R, F ei e R, Ru ino M, Mendez J, Gaspa M, An unes C, Guilhe mino L. 2007.
Gene ic and shell mo phological a iabili y o he in asi e bi al e Co bicula luminea
(Mülle , 1774) in wo Po uguese es ua ies. Es ua ine, Coas al and Shel Science
74: 166-174.
Sousa R, An unes C, Guilhe mino L. 2008a. Ecology o he in asi e Asian clam Co bicula
luminea (Mülle , 1774) in aqua ic ecosys ems: An o e iew. Annales De
Limnologie-In e na ional Jou nal o Limnology 44: 85-94.
Sousa R, Ru ino M, Gaspa M, An unes C, Guilhe mino L. 2008b. Abio ic impac s on
spa ial and empo al dis ibu ion o Co bicula luminea (Mülle , 1774) in he Ri e
Minho es ua y, Po ugal. Aqua ic Conse a ion: Ma ine and F eshwa e Ecosys ems
18: 98-110.
Sousa R, Noguei a A, Gaspa M, An unes C, Guilhe mino L. 2008c. G ow h and
ex emely high p oduc ion o he non-indigenous in asi e species Co bicula
luminea (Mülle , 1774): Possible implica ions o ecosys em unc ioning. Es ua ine,
Coas al and Shel Science 80: 289-295.
Sousa R, No ais A, Cos a R, S aye D. 2012. In asi e bi al es in esh wa e s: Impac s
om indi iduals o ecosys ems and possible con ol s a egies. Hyd obiologia.
S aye DL. 1999. E ec s o alien species on eshwa e mollusks in No h Ame ica.
Jou nal o he No h Ame ican Ben hological Socie y 18: 74-98.
S aye DL, Malcom HM. 2007. Shell decay a es o na i e and alien eshwa e bi al es
and implica ions o habi a enginee ing. F eshwa e Biology 52: 1611-1617.
Vaughn CC, Hakenkamp CC. 2001. The unc ional ole o bu owing bi al es in
eshwa e ecosys ems. F eshwa e Biology 46: 1431-1446.
Vohmann A, Bo che ding J, Ku eck A, bij de Vaa e A, A nd H, Wei e e M. 2009. S ong
body mass dec ease o he in asi e clam Co bicula luminea du ing summe .
Biological In asions 12: 53-64.
Walle DL, Rach JJ, Cope WG, Ma king LL, Fishe SW, Dab owska H. 1993. Toxici y o
candida e molluscicides o zeb a mussels (D eissena polymo pha) and selec ed
non a ge o ganisms. Jou nal o G ea Lakes Resea ch 19: 695-702.
Backg ound in o ma ion - Chap e 1
28
We ne S, Ro hhaup K-O. 2007. E ec s o he in asi e bi al e Co bicula luminea on
se ling ju eniles and o he ben hic axa. Jou nal o he No h Ame ican
Ben hological Socie y 26: 673-680.
We ne S, Ro hhaup K-O. 2008. Mass mo ali y o he in asi e bi al e Co bicula luminea
induced by a se e e low-wa e e en and associa ed low wa e empe a u es.
Hyd obiologia 613: 143-150.
Williams EH, Bunkley-Williams L, Lilyes om CG, O iz-Co ps EAR. 2001. A e iew o
ecen in oduc ions o aqua ic in e eb a es in Pue o Rico and implica ions o he
managemen o nonindigenous species. Ca ibbean Jou nal o Science 37: 246-251.
Za ale a ES, Hobbs RJ, Mooney HA. 2001. Viewing in asi e species emo al in a whole-
ecosys em con ex . T ends in Ecology & E olu ion 16: 454-459.
CHAPTER 2
E ec s o uppe -limi wa e
empe a u es on he dispe sal o he
Asian clam Co bicula luminea

Species dispe sal - Chap e 2
31
E ec s o Uppe -limi Wa e Tempe a u es on he Dispe sal o
he Asian Clam Co bicula luminea
Inês Rosa1, Joana Luísa Pe ei a1*, Raquel Cos a2, Fe nando Gonçal es1, Robe
P ezan 3
1 Depa men o Biology, Uni e si y o A ei o & CESAM (Cen e o En i onmen al and Ma ine S udies),
A ei o, Po ugal.
2 CIEPQPF, Depa men o Chemical Enginee ing, Uni e si y o Coimb a, Coimb a, Po ugal.
3 College o Science and Ma hema ics, Mon clai S a e Uni e si y, Mon clai , New Je sey, USA
Rosa IC, Pe ei a JL, Cos a R, Gonçal es F & P ezan R (2012) E ec s o uppe -limi wa e
empe a u es on he dispe sal o he Asian clam Co bicula luminea. PLoS ONE 7(10): e46635.
doi:10.1371/jou nal.pone.0046635
Species dispe sal - Chap e 2
32
2.1. Abs ac
Tempe a u e is a de e minan en i onmen al a iable in me abolic a es o o ganisms
ul ima ely in luencing impo an physiological and beha io al ea u es. S ess ul
condi ions such as inc easing empe a u e, pa icula ly wi hin high anges occu ing in
he summe , ha e been sugges ed o induce lo a ion beha io in Co bicula luminea
which may be impo an in dispe sal o his in asi e species. Howe e , he e has been
no expe imen al e idence suppo ing his hypo hesis. I was al eady p o en ha C.
luminea d i is suppo ed by a mucilaginous d ogue line p oduced by mucocy es
p esen in he c enidia. De ailed mic oscopic examina ion o changes in hese cells and
quan i ica ion o clam lo a ion ollowing one, wo and h ee weeks o exposu e o 22,
25 and 30ºC was ca ied ou so ha he e ec s o inc easing wa e empe a u es in
dispe sal pa e ns could be discussed. Resul s show ha changes in empe a u e
igge ed an accele a ion o he mucocy es p oduc ion and s imula ed lo a ion
beha io , especially ollowing one week o exposu e. Dilu ion o hese e ec s occu ed
ollowing longe exposu e pe iods. I is possible ha hese bi al es pe cei e changing
empe a u e as a s ess and espond acco dingly in he sho - e m, and hen acclima e
o he new en i onmen al condi ions. The esponse pa e ns sugges ha inc easing
wa e empe a u es could s imula e C. luminea popula ion expansion.
Keywo ds: Co bicula luminea; Dispe sal; Tempe a u e; In asi e species; Clima e
change; Mucous d ogue-line
Species dispe sal - Chap e 2
33
2.2. In oduc ion
O e he pas decades he e has been a g owing in e es in s udying biological
esponses o aqua ic o ganisms o inc easing empe a u e. This in e es is linked o
a emp s o en ision e ec s o clima e change wi h he expec ed inc ease in wa e
empe a u e (e.g. La sen and Riisga d 2009, Rahel and Olden 2008). In addi ion o
issues ela ed o clima e change, o he human ac i i ies, such as he g owing
in es men in he cons uc ion o ese oi s and canals and he consequen change o
he he mal egimes o al e ed sys ems, con ibu e o he in e es on he e ec o
empe a u e in biological esponses (Robinson and Childs 2001). Tempe a u e is a
decisi e en i onmen al a iable ha g ea ly de e mines me abolic a es o o ganisms
(Allan and Cas illo 2008). This is e en mo e c i ical in animals exhibi ing poikilo he mic
ec o he my, such as mos in e eb a es (Pu es e al. 2001). In he speci ic case o
aqua ic in e eb a es, i has been p o en ha wa e empe a u e indeed in luences
impo an biological ea u es, including eeding and diges ion (e.g. Vie gu z e al. 2006)
and ep oduc ion (e.g. Galb ai h and Vaughn 2009, Moyo 2011).
The me abolic changes associa ed wi h empe a u e egimes a e likely o
ansla e in o a ia ions in popula ion i ness and ul ima ely, a a mac o-ecological
scale, species dis ibu ion. In ac , he spa ial dis ibu ion and dispe sal pa e ns o a
gi en species is o en bound by empe a u e and he mal ole ance anges and
physiological op ima (Mulle and Bau 2011). Since he mal egimes and empe a u e
changes can in luence species dis ibu ion, a undamen al in e es has been g owing in
co ela ing his in o ma ion wi h in asi e species. Unde s anding he physiological
he mal ange o an in asi e species in u n can help us o unde s and hei cu en and
po en ial dispe sal anges and pa e ns. Such knowledge can also assis in p edic ing
in asi e po en ial o a new habi a and consequen ly suppo he design and
implemen a ion o p e en i e measu es ha can a oid o educe he nega i e
ou comes o he in ade ’s es ablishmen . This pe spec i e a ains e en highe
ele ance when applied o bio ouling in ade s, e.g. some eshwa e bi al es. In asi e
bi al es can accumula e in a i icial low- low a eas (e.g. pipes and il e s), adding
nega i e economic impac s o he eshwa e -dependen indus y (Ellio e al. 2005,
Rosa e al. 2011). In addi ion, some o hese indus ies use hea ea men as a highly
e icien enhancemen agen in pes con ol ei he alone o in combina ion wi h
chemical ea men (Jenne e al. 1998, Mackie and Claudi 2010). I is wo h
in es iga ing how hea ed wa e ela es o dispe sal pa e ns adjacen (see e.g. he
wa e empe a u e inc ease in he icini ies o he mal powe plan s as sugges ed by
F ench and Schloesse (1996)) and wi hin he acili ies o be e unde s and he
Species dispe sal - Chap e 2
40
o he o he wo ea men s we e 25 ± 0.5ºC and 30 ± 0.9ºC. Because o he no iced
di e ence be ween he 20º C se empe a u e and he co esponding mean
empe a u e moni o ed du ing he exposu e, he lowes empe a u e ea men is
hence o h conside ed o be o 22ºC. No mo ali y was eco ded du ing he es pe iod
in any expe imen al ea men .
The g aphical ends in Fig. 2.1, ep esen ing he a ia ion o c enidial
mucocy es in clams exposed o 22, 25 and 30 ºC o dis inc exposu e pe iods (one,
wo and h ee weeks o exposu e), sugges ha exposu e ime has an impo an ole in
modeling he esponse o c enidial mucocy es o inc easing empe a u e. This pa e n
was con i med by he signi ican in e ac ion be ween empe a u e and week ound o
cell numbe and he p oduc be ween cell numbe and cell size (Table 2.1). Main ime-
dependen e ec s we e obse ed, wi h special emphasis on c enidial mucocy es size.
Signi ican ly la ge cells we e ound ollowing he i s week o exposu e o all
empe a u es as compa ed o he eco ds ob ained ollowing wo and h ee weeks o
exposu e, wi h changes s a is ically signi ican o 22ºC (Fig. 2.1.a; Table 2.2.a). This
pa e n emained unchanged as empe a u e inc eased, which is consis en wi h he
lack o signi ican di e ences in mucocy e size o clams exposed o di e en
empe a u es wi hin each exposu e pe iod (Fig. 2.1.a; Table 2.2.b). Cell numbe was
also signi ican ly a ec ed by he exposu e du a ion, a 22ºC. A his empe a u e,
signi ican ly ewe mucous cells we e ound in clams ollowing he i s week o
exposu e as compa ed o he hi d week o he es (Fig. 2.1.b; Table 2.2.a). Cell size
was mul iplied by he co esponding cell numbe o p oduce a new a iable o
analysis. To some ex en his addi ional a iable ep esen s no malized changes in
mucocy es assis ing he p ope in e p e a ion o he main a iables (cell size and cell
numbe ). Fo example, an inc ease in cell numbe may only mean ha cells di ided i
accompanied by he p opo ional educ ion in cell size. The p oduc be ween cell size
and numbe ollowing one week o exposu e o 22ºC was signi ican ly lowe han ha
eco ded ollowing h ee weeks o exposu e simila ly o he obse ed pa e n o he
numbe o mucocy es (Fig. 2.1.c; Table 2.2.a).

Species dispe sal - Chap e 2
41
Cell size (µm)
12
14
16
18
20
22
Tempe a u e (ºC)
10 20 25 30
P oduc (cell size * cell numbe )
0
1
2
3
4
5
6
a)
c)
(Field
e e ence)
B
A
B
AB
B
A
Numbe o cells pe µm
0.1
0.2
0.3
0.4
1s week
2nd week
3 d week
AB
A
B
b)
Fig. 2.1. Va ia ion o c enidial mucocy es in clams exposed o one, wo, and h ee
weeks o di e en empe a u es. (a) Mean mucocy e size; (b) Mean mucocy e numbe ;
(c) P oduc be ween co esponding mucocy e size and numbe . Field e e ence
co esponds o un ea ed clams and is ep esen ed by he squa e g ey ma k and
dashed line. Le e s placed nex o poin s deno e di e ences be ween g oups o
exposu e pe iod a each exposu e empe a u e ollowing he pos -hoc Tukey es . E o
ba s ep esen s anda d de ia ion.
Species dispe sal - Chap e 2
42
Table 2.1. Summa y o epea ed measu es ANOVA applied o add ess he e ec o
ime and empe a u e in mean c enidial mucocy es size and numbe , as well as
co esponding p oduc (mucocy e size x numbe ). Signi ican e ec s (α = 0.05) a e
ma ked in bold.
Cell size
Cell numbe
P oduc (numbe *size)
d
MS
F
p
d
MS
F
P
D
MS
F
p
Wi hin-subjec s
Week
2
25.786
29.30
<0.001
2
0.003
5.30
0.022
2
0.172
1.772
0.212
Week*Tempe a u e
4
0.904
1.027
0.432
4
0.002
4.49
0.019
4
0.602
6.204
0.006
Residual
12
0.880
12
0.001
12
0.097
Be ween-subjec s
Tempe a u e
2
7.564
7.64
0.022
2
0.001
2.15
0.198
2
0.105
0.958
0.435
Residual
6
0.990
6
0.001
6
0.110
Fig. 2.1 and Table 2.1 (see cell size in pa icula ) sugges empe a u e-
dependen e ec s wi hin exposu e pe iod. Howe e , hese we e no s a is ically
signi ican as main e ec s we e analyzed e en wi hin he i s week o he es , whe e
he mos consis en changes could be no iced wi h empe a u e (Table 2.2.b).
Ne e heless, mucocy e size dec eased consis en ly while he numbe and p oduc
inc eased consis en ly wi h inc easing empe a u e ollowing one week o exposu e
(Fig. 2.1.a). O he gene al g aphical ends could no be s a is ically con i med,
including he eco d o ewe mucocy es and lowe p oduc be ween cell size and
numbe wi h inc easing empe a u es ollowing h ee weeks o exposu e (Fig. 2.1.b and
2.1.c).
An in e sely p opo ional ela ionship be ween cell size and cell numbe is clea
ollowing one week o exposu e o inc easing empe a u es, wi h mo e bu smalle cells
being p oduced (Fig. 2.1.b as compa ed o 2.1.a). This is suppo ed by a signi ican
nega i e co ela ion be ween he numbe o mucocy es cells and hei size (Pea son
coe icien = -0.442; p = 0.016). Howe e , his pa e n was no con i med h ough ime,
wi h non-signi ican co ela ions being ound ollowing wo and h ee weeks o exposu e
(Pea son coe icien = -0.201, p = 0.271; and Pea son coe icien = 0.020, p = 0.920,
espec i ely). Fu he mo e, he g aphical pa e n o he p oduc be ween cell size and
numbe (Fig. 2.1.c) seems o esemble ha shown o cell numbe (Fig. 2.1.a) a he
han p o ide an in e media e pic u e be ween he po en ially ela ed endpoin s.
The c enidial mucocy es we e also examined immedia ely a e clam collec ion
om he ield in o de o p o ide a e e ence alue o un ea ed o ganisms (Fig. 2.1;
“ ield e e ence”). Al hough cell size in exposed clams is wi hin he same ange o ha
eco ded o ield clams, ea ed clams had ewe cells showing simila size o hose o
Species dispe sal - Chap e 2
43
ield clams (Fig. 2.1.b as compa ed o Fig. 2.1.a). The du a ion o exposu e plays an
impo an ole on how empe a u e d i es he changes ela i ely o he ield e e ence i
his is aken as a su oga e o he basal s age o he o ganisms. Indeed, ollowing one
week o exposu e, all endpoin s ended o con e ge o he co esponding ield eco d
as empe a u e inc eases, while ollowing h ee weeks o exposu e he opposi e
occu ed. This con as s wi h an inc easing dis ance om he unexposed e e ence o
he eco ds in clams exposed o h ee weeks as empe a u e ises.
Table 2.2. Summa y o (a) epea ed measu es ANOVA and (b) one-way ANOVA
applied o add ess he main e ec s o ime o empe a u e, espec i ely, in mean
c enidial mucocy es size and numbe , as well as co esponding p oduc (mucocy e size
x numbe ). Signi ican e ec s (α = 0.017) a e ma ked in bold.
(a)
22ºC
25ºC
30ºC
d
MS
F
p
d
MS
F
p
d
MS
F
p
Cell size
Week
2
13.903
17.62
0.010
1.1
16.04
7.00
0.104
1
9.136
8.34
0.102
Residual
4
0.789
2.3
2.29
2
1.095
Cell numbe
Week
2
0.007
7.00
0.010
1.4
0
0
1.000
1.2
0.001
1.00
0.337
Residual
12
0.001
12
0.001
12
0.001
P oduc (cell numbe *cell size)
Week
2
1.115
11.49
0.002
1.9
0.036
0.37
0.554
1.3
0.348
3.59
0.083
Residual
12
0.097
12
0.097
12
0.097
(b)
Week #1
Week #2
Week #3
d
MS
F
p
d
MS
F
p
d
MS
F
p
Cell size
Temp
2
6.077
3.91
0.082
2
0.709
3.30
0.108
2
2.587
2.64
0.151
Residual
6
1.554
6
0.215
6
0.981
Cell numbe
Temp
2
0.004
2.05
0.210
2
0.001
0.65
0.555
2
0.001
0.50
0.630
Residual
6
0.002
6
0.002
6
0.002
P oduc (cell numbe *cell size)
Temp
2
0.771
1.77
0.250
2
0.166
0.381
0.699
2
0.372
0.853
0.472
Residual
6
0.436
6
0.436
6
0.436
Time was he main ac o explaining he a ia ion in he clams’ d i ing beha io
(Table 2.3) wi h he highes p opo ion o d i - esponsi e clams being obse ed in he
Species dispe sal - Chap e 2
44
Tempe a u e (ºC)
22 24 26 28 30
D i s/Clam
0.0
0.2
0.4
0.6
0.8 1s week
2nd week
3 d week
A
B
B
A
B
B
i s week o es ing (Fig. 2.2). Following he i s week o exposu e he e we e
signi ican ly mo e d i s han ollowing wo and h ee weeks o exposu e (Fig. 2.2; Table
2.4), a he highe empe a u e ea men s o 25 and 30ºC (Fig. 2.2; Table 2.4).
Following wo weeks o exposu e o any o he es ed empe a u es clam lo a ion
beha io was e y a ely obse ed and ollowing h ee weeks o exposu e clams did
no d i a all. The sligh di e ences in he d i eco ds be ween hese wo la e ime-
poin s we e no con i med s a is ically (Fig. 2.2; Table 2.4). In hese expe imen s,
empe a u e did no s a is ically a ec d i ing beha io (Table 2.4), al hough ollowing
he i s week he clams lo a ion beha io clea ly inc eased as he 22ºC compa es o
25ºC (Fig. 2.2). The pa allel expe imen un wi h clams ha we e gi en sedimen
p o ec ion yielded e y de ini i e esul s. No d i was obse ed in any o he
empe a u e ea men s ega dless he exposu e pe iod conside ed.
Co ela ion analysis o assess whe he each o he mucocy e- ela ed a iables
could be linked o d i ing beha io e ealed no signi ican associa ions (da a no
shown).
Table 2.3. Repea ed-measu es
ANOVA e e ing o mean clam
lo a ion ollowing one, wo and
h ee weeks o exposu e o
di e en empe a u es.
Signi ican e ec s (α = 0.05) a e
ma ked in bold.
Fig. 2.2. Mean clam lo a ion
ollowing exposu e o di e en
empe a u es o one, wo and h ee
weeks. Le e s placed nex o poin s
deno e di e ences be ween g oups
o exposu e pe iod a each exposu e
empe a u e ollowing he pos -hoc
Tukey es . E o ba s ep esen
s anda d de ia ion.
Sou ce o a ia ion
d
MS
F
P
Wi hin-subjec s
Week
2
0.379
51.757
<0.001
Week*Tempe a u e
4
0.045
6.146
0.006
E o
12
0.007
Be ween-subjec s
Tempe a u e
2
0.31
2.635
0.151
E o
6
0.12
Species dispe sal - Chap e 2
45
Table 2.4. Summa y o (a) epea ed measu es and (b) one-way and ANOVA
applied o add ess he main e ec s o ime and empe a u e, espec i ely, in mean
clam lo a ion. Signi ican e ec s (α = 0.017) a e ma ked in bold.
(a)
22ºC
25ºC
30ºC
d
MS
F
p
d
MS
F
P
d
MS
F
p
Week
2
0.037
5.28
0.023
1.1
0.623
89
<0.001
1
0.173
24.71
<0.001
E o
12
0.007
12
0.007
12
0.007
(b)
Week#1
Week#2
d
MS
F
p
d
MS
F
P
Tempe a u e
2
0.117
0.88
0.462
2
0.004
0.03
0.970
E o
6
0.133
6
0.133
2.5. Discussion
Bi al es a e able o acclima ize o cope wi h changing en i onmen al condi ions o
minimally show a ia ion in mac os uc u al o mic os uc u al o m in esponse o hese
changes, e.g. in shell mo phology (Peye e al. 2010, T ichko a e al. 2008), beha io al
ai s, such as p eda o a oidance s a egies (Flynn and Smee 2010), o al e
mo emen s (T an e al. 2011). The e a e s udies epo ing a wide- ange in shell
plas ici y o popula ions o he Asian clam Co bicula luminea inhabi ing geog aphically
adjacen habi a s ha show dis inc en i onmen al condi ions (e.g. P ezan and Tiu
1987, Rena d e al. 2000, Sousa e al. 2007). O he e idence o C. luminea pheno ypic
plas ici y is i s p o en abili y o egula e body mass while acing long s a a ion pe iods
as a inal ou come o an e icien managemen o ene gy budge s and alloca ion o
di e en body compa men s (Vohmann e al. 2009). This sugges s ha his bi al e has
a la ge ange o physiological adjus men o cope wi h po en ially s ess ul condi ions.
The p esen s udy p o ides addi ional e idence on he abili y o he Asian clam o
adjus physiology and beha io as a esponse o changing en i onmen al condi ions.
The esul s show ha changes in wa e empe a u e, a leas a high anges (abo e 20º
C), a ec he p oduc ion o he mucous d ogue line by C. luminea and i s d i ing
beha io , hus possibly in luencing dispe sal pa e ns wi h consequences on popula ion
expansion. I should be no iced he e ha d i ing by he Asian clam may no ela e a
leas di ec ly o physiological changes occu ing in he c enidial mucocy es. Howe e , i
should be kep in mind ha changes wi h empe a u e we e eco ded consis en ly

Species dispe sal - Chap e 2
46
ollowing he i s week o exposu e bo h in mucocy e cells and in lo a ion beha io .
Al hough a ela ionship be ween he physiological and beha io al pa ame e s was no
con i med s a is ically wi h he pa icula design employed in his s udy, his la e
e idence seems o poin owa ds an associa ion be ween he p oduc ion o he mucous
d ogue line and clam’s d i ing d i en by empe a u e.
Inc easing wa e empe a u e, pa icula ly o le els close o he species uppe
ole ance limi (36-37º C (Ka a aye e al. 2005)), can p oduce physiological s ess. A
less ex eme condi ions, inc ease in empe a u e gene ally ela es o an inc ease in
me abolic a es, pa icula ly e iden in ec o he ms, wi h consequen ial changes in
esou ces exploi a ion (Gillooly e al. 2001, La sen and Riisga d 2009, Lui and Leung
2004, Vohmann e al. 2009). The da a eco ded on c enidial mucocy es in clams
exposed o high- ange empe a u es seem consis en wi h his me abolic shi . In ac ,
inc easing empe a u e appa en ly igge ed an accele a ion o he mucocy es li e cycle
hus a o ing highe cell di ision a es (Campbell 1996). As a consequence mo e bu
smalle cells we e p oduced, especially a e one week o exposu e. On he o he hand,
he da a collec ed on he e e ence sample (10ºC) did no suppo his hypo hesis as
pa icula ly e idenced by i s highe numbe o mucocy es as compa ed o ea ed
samples. This seems o indica e dis inc mucocy e cycle pa e ns a low- ange
empe a u es ha would be wo h o explo e in u u e s udies. Indeed, he li e a u e is
no consensual as o he e ec o inc easing empe a u e in mucocy e-like cells,
making i e en mo e specula i e o ad ance wi h an explana ion o he phenomenon.
S udies on o he sec e o y cells ha p oduce mucin subs ances suppo ou esul s o
high- ange empe a u es, e.g. Gamme e al. (1988) showed ha he numbe o goble
cells o he nasal mucosa o a s inc eased wi h inc easing empe a u e. Con e sely,
o he s udies demons a e he opposi e, e.g. in mucous cells o he epide mis o ca ish
(Quiniou e al. 1998). Along wi h hese epo ed inconsis encies, he p esen s udy
p o ides con adic o y esul s when conside ing sho e (1 week) e sus longe
exposu e pe iods. Speci ically, he pa e n o inc easing cell di ision a es wi h
inc easing empe a u es was no e iden o longe exposu e pe iods. Thus i is likely
ha he obse ed changes in mucocy es ela e o an immedia e esponse o a
pe cei ed en i onmen al s ess a he han e lec ing a longe e m shi in me abolic
a es.
P ezan and Chale mwa (P ezan and Chale mwa 1984) sugges ed ha he
p oduc ion o he mucous h ead and consequen d i ing capabili y could be mo e
eadily induced when clams ace s ess ul condi ions. C. luminea d i as quan i ied in
he p esen s udy e lec ed, in pa icula , in he clams’ esponse o induced s ess a e
one week o exposu e. This is suppo ed by he e ec s o empe a u e ea men s on
Species dispe sal - Chap e 2
47
mucocy es size and numbe ollowing he i s week o exposu e as compa ed o longe
exposu e pe iods. I is possible ha he i s week o inc easing empe a u e ac ed as a
c i ical s ess ha , in u n, induces mucocy e p oduc ion ha could mo e eadily “allow”
mucous d ogue line and ul ima ely lo a ion beha io . As he highe empe a u e
exposu e con inues, indi iduals migh ha e adjus ed hei me abolism o he new
en i onmen al condi ions hus acclima izing o he new he mal egime. When clams
we e supplied wi h a sedimen laye , no d i was eco ded h oughou he exposu e
pe iod. Appa en ly, a leas in his cu en expe imen , he sedimen plays an impo an
p o ec ion, pe haps s abilizing, ole ha seems o compensa e o he s ess induced by
inc eased empe a u e. P o ided he in aunal habi o C. luminea, he ype o sedimen
has been a gued o ep esen a ele an cons ain o he species dis ibu ion in na u al
sys ems such as c eeks and i e s (e.g. Bodis e al. 2012). Howe e , he clam has also
been epo ed o p oli e a e massi ely in unde wa e s uc u es and channels o
eshwa e -dependen indus ies (Rosa e al. 2011), hence s udies such as he p esen
add essing he species dispe sal abili ies in sys ems lacking sedimen should no be
dis ega ded. Since a di ec ela ionship be ween mucocy e ac i i y and d i ing beha io
was ini ially hypo hesized, he ole o sedimen was only assessed using d i a ios as
an endpoin . Fu he his ological s udies on he e ec s o empe a u e in mucous
p oduc ion in es sys ems supplied wi h sedimen would help cla i y he ex en o i s
p o ec i e ole, and ul ima ely he ole o empe a u e as an ac ual s ess agen .
I was al eady p o en ha C. luminea mucous cells esiding in he inne
demib anchs p oduce he mucilaginous d ogue line, which has an ac i e ole in he
species’ dispe sal abili y (P ezan and Chale mwa 1984). In his way, and ollowing he
sugges ions by McMahon (1983) on he e en ual e ec o inc easing empe a u e as a
p omo e o clam’s li -o in o he wa e column, i seems easonable o assume ha
ou esul s indica e ha inc easing empe a u e a high- anges could enhance he
Asian clam dispe sal abili y h ough he inc eased p oduc ion o he mucous d ogue
line as an immedia e esponse. Al hough his seems a easonable p edic ion o
scena ios whe e he wa e empe a u es ange wi hin hose es ed he e (22º o 30ºC), i
should be s essed ou ha he da a ob ained wi h he ield e e ence (un ea ed clams
acing 10ºC wa e empe a u e) did no co obo a e i , highligh ing he need o u u e
s udies ha add ess mucous p oduc ion and d i beha io unde low- ange
empe a u e changes. Tempe a u e also in luences byssus p oduc ion in o he
bi al es. Fo example, Young (1985) and Cla ke and McMahon (1996) ound ha
inc easing empe a u e leads o inc easing byssus h ead numbe in My ilus edulis and
D eissena polymo pha. While byssal h ead and he mucous d ogue line bo h play key
oles in ele an species dispe sal, hese s uc u es a e on ogene ically,
Species dispe sal - Chap e 2
48
phylogene ically, and physiologically dis inc : byssal h eads o m om a complex
mul iglandula byssal gland eleasing a quinine anned p o ein wi h a mucin and
collagen componen and eme ge ia a pedal en al g o e (P ezan 1990, Wai e e al.
1998). Despi e hese di e ences, a beha io al pa allel can be aced ha sugges s a
link be ween empe a u e and dispe sal po en ial in byssus-p oducing species and
mucoid d ogue line dispe sing species.
Wi h wa e empe a u e al e a ion, o he wa e p ope ies such as iscosi y a e
a ec ed. Inc easing empe a u e causes dec eased iscosi y and can con ibu e o
dec eased buoyancy o loa ing pa icles. This could ha e consequences on bio-
mechanical ac i i ies such as he d i ing o swimming e iciency o aqua ic o ganisms
(La sen and Riisga d 2009, La sen e al. 2008). Thus, dec eased iscosi y wi h
inc easing empe a u es may e en ually help explain he obse ed inc ease in lo a ion
beha io be ween clams exposed o 22ºC and hose exposed o highe empe a u es
du ing he i s week. Howe e , a mono onic end o d i in ensi ica ion wi h inc easing
empe a u e could no be eco ded. O he au ho s ha e no been able o demons a e a
s aigh ela ionship be ween changes in empe a u e and iscosi y-d i en changes in
d i . Fo example, Wang and Xu (1997) concluded ha wi h dec easing empe a u e
he e is a mo e equen d i ing beha io in bi al e elige la ae, and Williams (1990)
ound ha di e en in e eb a e species showed no consis en d i ing esponses as
empe a u e changed. This sugges s ha clam d i ing (and equi alen beha io in
o he o ganisms) esul s om a complex in e ac ion o se e al ac o s including
physical pa ame e s (e.g. iscosi y), inhe en physiology, and en i onmen al
challenges. Knowledge on how his complexi y o ac o s enhances o inhibi s dispe sal
is o ob ious ele ance when conside ing in asi e species such as C. luminea.
Fu he mo e, i con ibu es o he unde s anding o he ecological dynamics o ben hic
communi ies, which is s ongly in luenced by in e eb a e d i and se lemen , ei he by
he con inuous loss o clams in o he wa e column ha educes popula ion densi y in a
gi en loca ion, o by i s con inuous se ling ou wi h impo an colonizing implica ions
(Lancas e e al. 1996, Townsend and Hild ew 1976).
The empe a u es es ed in his s udy a e wi hin he ole ance limi s desc ibed
o he Asian clam (see Ka a aye e al. 2005) and can also be ound in he ield
especially in he icini ies o powe plan s using cooling wa e s om abu ing s eams
and discha ging he mal e luen s (Che y e al. 1980). Adding o he po en ial dispe sal
shi s induced by empe a u e changes ha migh occu in lo ic and len ic habi a s o
Asian clam popula ions a e he po en ial implica ions and consequences o global
clima e change, and he al e a ion o he mal egimes due o dam and canal
cons uc ion. Thus, he esul s cons i u e a aluable add-on o he baseline in o ma ion
Species dispe sal - Chap e 2
49
ha is equi ed o p edic en i onmen ally-d i en changes in dispe sal pa e ns o he
Asian clam. I is also impo an o conside he ac ha he highe e iciency in con ol
me hods elying in high wa e empe a u e applied o sho pe iods may no be as
s aigh o wa d as p esumed as we conside ha a concomi an s imula ion o dispe sal
wi hin a ec ed a eas can occu ep esen ing a d awback in he me hod. Fu he
esea ch s ill applies o cla i y empe a u e-dependen e ec s on C. luminea dispe sal.
Fo example, in an ongoing s udy, we eco ded ema kable di e ences in he
in e lamella epi helium ( o ally absen o incipien c enidial mucocy es) o C. luminea
demib anchs in indi iduals om a popula ion es ablished in a Po uguese channel as
compa ed o he Some se , New Je sey, USA popula ion s udied in he cu en
expe imen s. Gene ic yping (RFLP analysis and m COI sequencing) e ealed no clea
dis inc ion be ween his popula ion and he Some se popula ion examined in he
p esen s udy i.e. bo h exhibi he same haplo ype. I is easonable o hypo hesize ha
local adap a ion may cons ain gene al conclusions on he in luence o en i onmen al
change in he species dispe sal pa e ns. Fu he mo e, some au ho s (e.g. By ne e al.
2000, Mo on 1977) sugges ed ha he mucous p oduced in he demib anchs may
nou ish he de eloping emb yos and/o assis he elease o ju eniles ou o he gills.
To ease apa po en ial issues o seasonali y o geog aphic locali ies o di e ence
induced by localized popula ions, u he s udies a e being conduc ed add essing
seasonal a ia ion in c enidial mucocy es and any co ela ion o d i ing beha io . Many
ques ions emain on how di e en en i onmen al pa ame e s cons ain he dispe sal o
C. luminea. Addi ional undamen al knowledge on how empe a u e egula es
physiological and beha io al changes in he clams wi h consequences in dispe sal
abili y has been demons a ed in he p esen s udy. The esul s indica e ha inc easing
empe a u e a high- anges can lead o popula ion expansion in C. luminea and migh
be a p oxy ha helps p edic changes in dispe sal pa e ns co ela ed wi h change in
wa e empe a u e.
2.6. Acknowledgemen s
The au ho s a e g a e ul o Rebecca Shell a Mon clai S a e Uni e si y o he
impo an assis ance in his p ojec , as well as o B uno B anco Cas o o his
subs an ial ad ice in da a analysis. No speci ic pe mi s we e equi ed o he collec ion
o o ganisms in he ield a he desc ibed loca ion. This loca ion is no p i a ely-owned
o p o ec ed in any way. The p esen s udy ega ds he in asi e species Co bicula
luminea, and only indi iduals om his species we e collec ed in he ield and used in

CHAPTER 3
Dispe sal o Co bicula luminea:
Fac o s in luencing he in asi e clam’s
d i ing beha io
Species dispe sal - Chap e 3
59
Dispe sal o Co bicula luminea: Fac o s in luencing he
in asi e clam’s d i ing beha io
Inês Co eia Rosa1, João Gomes2, Ma ia de Lou des Gomes Pe ei a3, Joana Luísa
Pe ei a1, Raquel Cos a2, Fe nando Gonçal es1
1 Depa men o Biology and CESAM (Cen e o En i onmen al and Ma ine S udies), Uni e si y o A ei o,
A ei o, Po ugal.
2 CIEPQPF, Depa men o Chemical Enginee ing, Uni e si y o Coimb a, Coimb a, Po ugal.
3 Depa men o Biology and CICECO (Cen e o Resea ch in Ce amics & Composi e Ma e ials),
Uni e si y o A ei o, A ei o, Po ugal.
Rosa IC, Gomes J, Pe ei a MLG, Cos a R, Pe ei a JL, Cos a R & Gonçal es F. Fac o s
po en ially a ec ing dispe sal o Co bicula luminea: he ole played by gene ics and seasonali y.
Annales de Limnologie – In e na ional Jou nal o Limnology (Accep ed o publica ion)
Species dispe sal - Chap e 3
60
3.1. Abs ac
Co bicula luminea, commonly known as he Asian clam, is one o he mos success ul
in asi e species in esh and b ackish wa e s wo ldwide. Dispe sal is one o he mos
de e minan s eps in he in asi e p ocess, and he ull unde s anding o he
mechanisms in ol ed in his s ep is c i ical o adequa e pes managemen bo h in he
wild and in indus ies a ec ed by his species’ bio ouling ac i i y. A mucous d ogue line
p oduced by mucocy es packed along he inne demib anchs o he clams’ gills seem
o play an impo an ole in assis ing d i ing and hence dispe sal. Two Asian clam
popula ions geog aphically sepa a ed (one in he USA and he o he in Po ugal),
in es iga ed a di e en imes o he yea , we e epo ed o di e in e ms o mucous
d ogue line p oduc ion and loa ing esponses ( hese we e only p esen o he
Ame ican popula ion). In his s udy, gene ics and seasonali y e ec s we e
hypo hesized o explain he di e ence be ween he popula ions. To es hese
hypo heses, he wo popula ions we e gene ically compa ed, and he Po uguese one
was ollowed o 14 mon hs o eco d he animals’ mucous d ogue line p oduc ion and
lo a ion capabili ies and loca e he popula ion ep oduc i e pe iods. Ou esul s signal
a possible scena io o mic oe olu ion wi h consequences on he p oduc ion o he
clams’ mucilaginous d ogue line.Al hough some au ho s ad oca e a link be ween
mucous h eads o ma ion and ep oduc ion e en s, such a ela ionship was no
obse ed in his s udy. By con ibu ing o he unde s anding o a physiological ai o
he Asian ha is impo an o dispe sal, his s udy may be o p ac ical ele ance o
pes moni o ing and con ol.
Keywo ds: Asian clam; Mucous d ogue line; Flo a ion beha io ; Li e-cycle ai s;
In asion
Species dispe sal - Chap e 3
61
3.2. In oduc ion
In asi e species a e a majo wo ldwide h ea due o he se ious ecological and
economic impac s hey a e esponsible o (Ba ino a e al. 2010, Pimen el e al. 2005).
Lakes, es ua ies and i e s a e pa icula ly p one o in asion (Riccia di and MacIsaac
2000) because o he la ge numbe and a ie y o anspo ec o s and an h opogenic
dis u bance agen s a ec ing hese sys ems (Cohen and Ca l on 1998). Dispe sal in o a
new habi a is a de e minan s age in he in asion p ocess (Da is 2010), and hence he
ull unde s anding o he mechanisms in ol ed in his s age is a key asse o manage
he pes s.
Amongs he mos success ul aqua ic in ade s is he eshwa e bi al e
Co bicula luminea (Mülle , 1774), commonly known as he Asian clam (DAISIE 2012).
Se e al li e-cycle ai s con ibu e o i s success as an in ade , including high g ow h
a es, sho li e spans, high ecundi y a es (up o 600-700 ju eniles day-1; Ald idge and
McMahon 1978) and he maph odi ism some imes associa ed o sel - e iliza ion (B i on
and Mo on 1982, K aeme and Galloway 1986). These ai s combined wi h inc eased
wa e bo ne a ic esul ed in he massi e expansion o C. luminea om i s na i e
dis ibu ion ange in Sou heas Asia o as egions in Eu ope (A aujo e al. 1993) and
No h (Phelps 1994) and Sou h Ame ica (I ua e 1994) o e he las cen u y.
A pa icula li e-cycle ai o his species ha has been conside ed o con ibu e
o i s dispe sal abili ies is he p oduc ion o a mucilaginous d ogue line by modi ied cells
(mucocy es) packed along he inne demib anchs o he c enidia o ju enile and young
adul clams. This d ogue line was p o en o assis clam lo a ion (in clams up o 14 mm
shell leng h) in esponse o wa e cu en s, hus p omo ing d i ing in o new loca ions
and a o ing he species dispe sal (P ezan and Chale mwa 1984).
Al hough mucilaginous d ogue line p oduc ion may play an impo an ole in he
species’ dispe sal, being po en ially ele an om he pes managemen poin o iew,
li le is known abou his physiological ea u e. In a p e ious s udy, Rosa e al. (2011)
epo ed ma ginal indus ial bio ouling e ec s and mild in asion se e i y by C. luminea
in Po ugal e en hough he species en e ed he coun y mo e han 30 yea s ago
(Mou hon 1981). As a possible explana ion o his unexpec ed obse a ion, i was
hypo hesized ha en i onmen al condi ions could cons ain he p oduc ion o he
mucilaginous d ogue line hus a ec ing he species’ dispe sal. In a subsequen s udy
(Rosa e al. 2012), conduc ed in ea ly sp ing (Ap il), a USA popula ion o C. luminea
was examined and empe a u e was shown o in luence his ai . When he au ho s
in es iga ed he mucilaginous d ogue line p oduc ion and d i ing beha io o a
Po uguese Asian clam popula ion la e in summe (be ween June and Augus ),

Species dispe sal - Chap e 3
62
implemen ing simila me hodologies, nei he mucocy es no any lo a ion-like e en
we e obse ed. He e a ollow-up s udy is epo ed, wi h wo majo hypo heses being
in es iga ed o cla i y he inconsis ency obse ed amongs he wo clam popula ions.
One o he hypo heses es ed was ha he wo popula ions could ep esen
di e en haplo ypes o C. luminea (Hypo hesis 1). Gi en ha he Co bicula genus
shows high gene ic a iabili y and signi ican pheno ypic plas ici y has been a ibu ed
o he species (Glaub ech e al. 2003, Pa k and Kim 2003, Pigneu e al. 2011, Sousa
e al. 2007), di e en haplo ypes could ansla e in o physiological di e ences ega ding
d ogue line p oduc ion and hence d i ing abili ies. To es his hypo hesis, he
Ame ican and Po uguese clam popula ions we e gene ically cha ac e ized and
compa ed. In pa allel, he hypo hesis ha mucilaginous d ogue line p oduc ion could
a y seasonally, which would explain he di e en beha io s obse ed in sp ing and
summe , was also in es iga ed (Hypo hesis 2). Some au ho s (e.g. By ne e al. 2000,
Mo on 1977) sugges ed, al hough p o iding no clea suppo ing e idence, ha he
mucous h eads in C. luminea ha e an addi ional ole in nou ishing he emb yos, also
de eloping in he inne demib anchs, and/o in assis ing he elease o ju eniles ou o
he gills. This being he case, an annual a ia ion o mucous p oduc ion, concomi an
wi h he animals’ ep oduc i e cycle, could be expec ed. To assess his hypo hesis, he
Po uguese clam popula ion was ollowed o 14 mon hs as a s udy model. The
animals’ lo a ion beha io and he p oduc ion o mucilaginous h eads by c enidial
mucocy es we e analyzed h oughou he es pe iod. The popula ion’s ep oduc i e
pe iod(s), po en ially connec ed wi h mucous p oduc ion, we e also loca ed by ollowing
he seasonal changes in he clams’ body condi ion (as d y issue weigh ) and he
popula ion g ow h dynamics, complemen ing wi h mo phological examina ion o he
clams’ gills o iden i y he p esence o incuba ing p ogeny.
Because C. luminea is a se ious aqua ic in ade , wi h bo h ecological and
indus ial impac s, i is impo an o enla ge he body o knowledge on he species’
biology. The s udy o he Asian clam dispe sal mechanisms, namely by cha ac e izing
possible seasonal pa e ns and he li e-cycle ai s linked o he p ocess, may con ibu e
o he design o mo e e ec i e moni o ing s a egies and imp o ed con ol me hods o
he nuisance.
Species dispe sal - Chap e 3
63
3.3. Ma e ials and me hods
3.3.1. Assessing Hypo hesis 1: gene ic yping o he wo Co bicula luminea
popula ions
The gene ic cha ac e iza ion o bo h he Ame ican (see Rosa e al. 2012 o de ails on
his popula ion) and he Po uguese popula ions (see below o de ails on he collec ion
si e) was done h ough es ic ion agmen leng h polymo phism (RFLP) analysis o he
mi ochond ial cy och ome c oxidase subuni I gene (m COI) plus sequencing o he
gene (Rena d e al. 2000). Twen y clams (shell leng h abo e 22 mm) we e collec ed
om each popula ion. The animals’ al es we e opened by gen ly o cing hem wi h a
blun needle, and each indi idual was placed in a ial illed wi h absolu e e hanol PA a
4 ºC in o de o p ese e DNA in eg i y. To al DNA was ex ac ed om app oxima ely
30 mg o each indi idual using he E.Z.N.A.® Mollusc Isola ion Ki as indica ed by he
manu ac u e . A 710 bp agmen o he m COI gene was ampli ied by polyme ase
chain eac ion (PCR) using he p ime s designed by (Folme e al. 1994): LCOI490 (5’-
GGTCAACAAATCATAAAGATATTGG-3‘) and HCO2198 (5’-
TAAACTTCAGGGTGACCAAAA AATCA-3’). A nega i e con ol (no DNA empla e)
was used in he eac ion. Ampli ica ion o 15 ng DNA occu ed in a o al olume o 25
µL and he eac ion mix u e also included 1 µM o each p ime , 0.2 mM o each dNTP,
1 mM o MgCl2, 0.025 U/µL adjus ed o 1 U/sample o Taq DNA Polyme ase
(Fe men as, Li huania) plus he ecommended bu e . The PCR p o ocol consis ed in
an ini ial dena u a ion s ep o 60 s a 94 ºC, 35 annealing/elonga ion cycles o 60 s a
94 ºC, 60 s a 4 0ºC and 90 s a 75 ºC, and a inal elonga ion s ep a 72 ºC o 5 min.
The PCR p oduc was hen diges ed by he es ic ion enzyme Sac I (Taka a, China): 5
µL o he PCR p oduc wi h 5 U o he es ic ion enzyme plus he co esponding bu e
as ecommended by he enzyme manu ac u e we e incuba ed o e nigh a 37 ºC; 5 U
o es ic ion enzyme we e u he added o p olong diges ion o 3 h; he eac ion was
e mina ed by adding 1 µL o loading bu e o each mix u e. An aga ose gel (1.5 %
(w/ )) elec opho esis was un in o de o con i m whe he all indi iduals could be
iden i ied as C. luminea (one band o 710 bp o wo bands o 200 and 500 bp; Rena d
e al. 2000). In o de o u he ind he haplo ype(s) p esen in he samples, he PCR
p oduc was pu i ied (ExoSAP-IT®; A yme ix, USA) and sequenced in a ce i ied
labo a o y acco ding o ISO 9001:2008, using he oligo LCOI490. The ob ained
sequences we e compa ed wi h sequence da a om he NCBI nucleo ide da abase
(h p://www.ncbi.nlm.nih.go ) using BLASTn homology sea ch. Simila sequences we e
Species dispe sal - Chap e 3
64
aligned wi h he clams’ sequences using CLUSTALW2 (EMBL-EBI) and he di e ences
be ween he sequence o nucleo ides we e hen assessed.
3.3.2. Assessing Hypo hesis 2
3.3.2.1. S udy si e and clam collec ion de ails
C. luminea indi iduals we e collec ed in Casal de São Tomé, Mi a, Po ugal
(N40°25'06.90’’/W8°44'13.18’’), om a sandy muddy shallow c eek, which is connec ed
o o he b ooks, o ming a ne wo k o small canals. Clams we e collec ed mon hly om
Oc obe 2011 o Decembe 2012 and wice a mon h be ween May and Sep embe
2012, he la e being expec ed o co e he b eeding pe iod. Two di e en sampling
s a egies we e employed depending on he subsequen analysis. Quali a i e sampling
was used o ob ain o ganisms o his ological s udies and analysis o d i ing beha io
as de ailed below. Clams we e collec ed by using a sho el o d ag sedimen in o a bag
wi h 1 mm mesh size, used o oughly sie e he sample. Clams wi h shell leng h in he
ange 9 o 14mm, co esponding o ma u e animals ha we e al eady p o en o be able
o p oduce a mucilaginous d ogue line (I ua e 1985, P ezan and Chale mwa 1984),
we e hen selec ed. Quan i a i e sampling was used o add ess he seasonal a ia ion
o he clams’ body condi ion and ob ain coho equencies (see below o de ails).
Clams we e collec ed wi h a Van Veen g ab (15 x 32 x 19.5 cm) om h ee sampling
poin s along a ansec es ablished in he c eek. The sedimen collec ed was d agged
in o a 1-mm mesh size bag o oughly sie e he sample, which was hen ans e ed o
a 20-L bucke illed wi h ca. 15 L o ield wa e o anspo a ion o he labo a o y.
Tempe a u e, pH, conduc i i y and dissol ed oxygen con en s we e measu ed
in si u wi h a mul ipa ame e ield p obe (WTW-Mul i3430). Flow speed was es ima ed
by examining he a eling ime o a loa ing plas ic cylinde . Wa e samples (ca. 4 L)
we e collec ed and acuum il e ed (GF/C 1.5-µm po e il e s) o u he de e mina ion
o u bidi y h ough he calcula ion o he abso p ion coe icien (m-1; B owe e al.
1997). The il a ion esidue was used o quan i y he o al suspended solids (mg L-1;
APHA 1995) and pho osyn he ic pigmen s (µg L-1 Chl a Lo enzen 1967). Sedimen was
also collec ed o quan i y he loss-on-igni ion o ganic ma e con en s (% (w/w); ASTM
2000).
Species dispe sal - Chap e 3
65
3.3.2.2. Analysis o he seasonal changes in clams’ lo a ion beha io and mucilaginous
d ogue line p oduc ion
Clams’ lo a ion beha io was obse ed in si u and in he labo a o y. In he ield, 10
clams (shell leng h in he ange 9 o 14 mm) we e andomly d awn om he quali a i e
sample p e iously collec ed (see abo e o de ails) and placed in o a plas ic con aine
wi h 35 x 25 x 6 cm. The clams we e subjec ed o he ield wa e low by keeping he
con aine ully looded du ing 4-5 minu es and hei lo a ion ac i i y (i any) was
eco ded. In addi ion, as clams we e obse ed o be ac i ely siphoning, a ew d ops o
5 % (w/ ) oluidine blue we e placed nea he siphons o assess whe he a mucous
d ogue line was being p oduced. The clams we e hen anspo ed o he labo a o y in
plas ic con aine s illed wi h ield wa e , which was hen g adually eplaced by
dechlo ina ed municipal wa e o acclima ion pu poses. The sample was kep unde
con inuous ae a ion a cons an empe a u e (20 ± 2 ºC) and pho ope iod (16hL:8hD).
A e 24 hou s, he clams we e ans e ed in o a 15-L aqua ium, con aining 14 L o
dechlo ina ed municipal wa e , and placed inside a subme ged c ys allizing dish o
con inue he acclima ion pe iod o ano he 24 h. An ex e nally d i en eci cula ion and
il a ion sys em was se in he aqua ium o ensu e he wa e quali y. Following he
app oach sugges ed by P ezan and Chale mwa (1984) and Rosa e al. (2012), he
clams we e submi ed o a gen le wa e low and hei lo a ion beha io (i any) was
eco ded o e a 30-min pe iod.
Mic oscopic inspec ion o he c enidial mucocy es dis ibu ed in he inne
demib anchs o clams sampled quali a i ely was pe o med o ge addi ional insigh in o
he mucilaginous d ogue line p oduc ion and suppo he in e p e a ion o he lo a ion
da a. Ten clams (shell leng h anging om 9 o 14 mm) we e anspo ed in plas ic
con aine s illed wi h ield wa e o he labo a o y, whe e hey we e immedia ely opened
h ough gen le o cing be ween al es wi h a blun needle. Thei so issues (whole
body) we e ixed in Zenke ’s luid o e nigh . The ixed samples we e ea ed as de ailed
by Rosa e al. (2012). B ie ly, hey we e washed and dehyd a ed, and hen he issues
we e ca e ully embedded in pa a in wax (Pa a in mp 56-58 ºC, Me ck KGaA) so ha
an e o-pos e io sec ions could be made in he o ganisms, co esponding o
longi udinal cu s o he demib anchs. The blocs we e sec ioned a 5-7 µm cu
hickness. The sec ions we e s ained wi h sodium bo a e bu e ed aqueous oluidine
blue. The i s eigh sequen ial sec ions o he demib anchs we e selec ed o
mic oscopic examina ion o assess he p esence o mucous cells (Olympus CKX41
in e ed mic oscope).
Species dispe sal - Chap e 3
72
Fig. 3.5 shows he clam popula ion densi y and mean shell leng h in he s udy
si e o e he sampling pe iod. O e all, clam densi y was (mean ± SD) 3247 ± 1122
clams m-2, wi h a maximum peak o o e 6000 clams m-2 eco ded in Augus 2012 and
minimum densi ies o less han 1500 clams m-2 eached in Ap il, May and Decembe
2012 (Fig.3. 5). The highes alues o mean shell leng h we e eco ded in Ap il and
May 2012 (mean ± SD: 17.59 ± 3.80 mm and 17.40 ± 3.57 mm, espec i ely), while on
a e age he clams we e smalles in No embe 2012 wi h a mean shell leng h o (mean
± SD) 14.00 ± 2.74 mm (Fig. 3.5). In June and in he beginning o Augus , clam’s mean
shell leng h was also low as compa ed o he es o he yea (mean ± SD o 14.44 ±
3.60 mm and 14.12 ± 3.34 mm, espec i ely) (Fig. 3.5).
Sep
Oc
No
Dec Jan
Feb
Ma Ap
May
Jun Jul
Aug
Sep
Oc
No
Dec Jan
Popula ion densi y (clams m-2)
0
1000
2000
3000
4000
5000
6000
Densi y
Mean shell leng h (mm)
0
10
15
20
Mean shell leng h
2011 2012
Fig. 3.5. Seasonal a ia ion o he clam popula ion densi y (le yy’ axis) and mean
shell leng h ( igh yy’ axis) du ing he sampling pe iod. E o ba s ep esen s anda d
de ia ion. Popula ion densi y was ep esen ed as a single alue a e pooling o he
h ee eplica ed samples aken a each sampling poin .
Fig. 3.6, whe e size equency dis ibu ions a e p esen ed, u he documen s he
dynamics o he popula ion s uc u e o e he s udy pe iod. Young adul s wi h shell
leng h be ween 11.5 and 17.5 mm ended o be he mos abundan size class,
domina ing he popula ion size s uc u e. The abundance o ju eniles (shell leng h up o
10 mm; Ca aldo and Bol o skoy 1998, I ua e 1985, Mou hon 2001) in he popula ion
was always low compa ed o ha o adul s. Ju eniles no iceably inc eased o e June
2012, dec easing in he beginning o he ollowing mon h. Then, i peaked again in la e

Species dispe sal - Chap e 3
73
July 2012, and ju eniles kep being ound un il mid-Sep embe 2012. A inal inc ease o
ju enile abundance was obse ed in No embe 2012. Such a a ia ion o he
popula ion size s uc u e is consis en wi h mul iple spawning e en s occu ing om
la e sp ing h ough summe un il mid-au umn. The ec ui men pe iods iden i ied in
summe and au umn (Fig. 3.6) consis en ly occu ed 1-2 mon hs a e dec eases in he
clams’ body condi ion indica i e o spawning (Figs. 3.3 and 3.4). An ea lie , less
signi ican ec ui men e en seemed o happen in Ma ch 2012 (Fig. 3.6), 5 mon hs
a e he p e ious spawn in Oc obe 2011 (Figs. 3.3 and 3.4), wi h he o sp ing
eleased in au umn ha ing lowe g ow h a e o e win e as compa ed o he indi iduals
eleased in he wa m mon hs.
Species dispe sal - Chap e 3
74
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
Shell leng h (mm)
0 5 10 15 20 25 30
F equency (clams m-2)
0
200
400
600
800
1000
1200
1400
0 5 10 15 20 25 30
0 5 10 15 20 25 30
01/Oc 2011
n=4000 02/May 2012
n=1771 13/Aug 2012
n=307
16/May 2012
n=2229
09/Dec 2011
n=3966
03/No 2011
n=3590
04/Jan 2012
n=3056
06/Feb 2012
n=3159
05/Ma 2012
n=4424
10/Ap 2012
n=1887
04/Jun 2012
n=4499
15/Jun 2012
n=3460
02/Jul 2012
n=2926
18/Jul 2012
n=3501
31/Jul 2012
n=6352
03/Sep 2012
n=2776
17/Sep 2012
n=3193
01/Oc 2012
n=2277
07/No 2012
n=3453
05/Dec 2012
n=1394
Fig. 3.6. Size equency dis ibu ion o he clam popula ion du ing he sampling pe iod
(Oc obe 2011 o Decembe 2012). n ep esen s he o al clam densi y (clams m-2).
Species dispe sal - Chap e 3
75
3.5. Discussion
Unde s anding he p ocess h ough which he Asian clam p oduces a mucilaginous
d ogue line ha p omo es i s lo a ion and d i ing in o new a eas may con ibu e o
mo e e ec i e pes managemen . As his p ocess was in es iga ed in wo Co bicula
luminea popula ions geog aphically sepa a ed (one in Somme se , NJ, USA and he
o he in Po ugal), a di e en imes o he yea , unexpec ed di e ences we e obse ed
– mucous h eads and loa ing esponses, epo ed o he Ame ican clam popula ion
(Rosa e al. 2012) we e comple ely absen amongs he specimens collec ed om he
Po uguese popula ion. I was hypo hesized ha such di e ences could be due o
gene ic di e ences be ween he wo popula ions and/o seasonal e ec s, and hese
wo hypo heses we e hence in es iga ed in his s udy.
The axonomy o he Co bicula genus is gene ally con uses and ye unsol ed
because o he ecognized high pheno ypic a ia ion in shell mo phology, colo and
o namen a ion, con as ing ep oduc i e s a egies and ecological di e ences
(Glaub ech e al. 2003, Pa k and Kim 2003, Pigneu e al. 2011, Sousa e al. 2007). I
was shown he e ha he e is no clea gene ic dis inc ion be ween he Ame ican and he
Po uguese Co bicula popula ions, bo h exhibi ing he same haplo ype – haplo ype I as
desc ibed by Rena d e al. (2000) in Eu ope, which co esponds o C. sp. (Fo m A)
desc ibed by Lee e al. (2005) in he USA and C. leana desc ibed by Pa k & Kim in
Asia (2003). I should be no iced ha and ogenesis is a common ea u e o he
Co bicula genus (By ne e al. 2000, Ishibashi e al. 2003, Koma u and Kawagishi
1998), which comp omises analysis elying only on mi ochond ial sequences as
conduc ed in his s udy i.e. dis inc nuclea lineages can be g ouped in he same
mi ochond ial clus e (Hed ke e al. 2008, Pa k and Kim 2003, Pigneu e al. 2011).
Fu he gene ic s udies, combining nuclea and mi ochond ial da a along wi h de ailed
mo phological examina ion, should hus be ca ied ou o a de ini e gene ic
compa ison o he wo popula ions o in e es .
Some au ho s (By ne e al. 2000, Mo on 1977, Williams and McMahon 1987)
sugges ed ha he mucous p oduced in C. luminea demib anchs play an impo an
ole in ep oduc ion, namely by assis ing he nou ishmen o he de eloping emb yos
and he elease o he p ogeny ou o he pa en s’ gills. The mucilaginous d ogue line
p oduc ion and associa ed d i ing beha io could hus be expec ed o a y seasonally
concomi an ly wi h he species ep oduc i e cycle.
In his s udy, da a on he animals’ body condi ion seasonal pa e n, gills’
mo phological examina ion and popula ion size s uc u e dynamics we e in eg a ed o
loca e he ep oduc i e pe iod(s) o he Po uguese clam popula ion. These da a
Species dispe sal - Chap e 3
76
consis en ly indica ed ha b eeding occu ed om la e sp ing un il mid-au umn, wi h
mul iple spawns in a mo e con inuous-like ep oduc i e pa e n o e his pe iod. Majo
ec ui men e en s in June, Augus -Sep embe and No embe we e iden i ied based on
he popula ion dynamics analysis. Rep oduc ion o C. luminea is known o a y g ea ly
wi h loca ion (Table 3.2), which sugges s a s ong in luence o en i onmen al and
gene ic ac o s in li e-cycle ela ed e en s. Al hough one ec ui men episode ( om
ea ly summe o ea ly au umn) o wo episodes (one in sp ing/ea ly summe and one in
la e summe /ea ly au umn) a e mos commonly epo ed o Asian clam popula ions,
he pa e n obse ed in his s udy is in ag eemen wi h many o he wo ks ha also
show ec ui men occu ing in mid/la e Au umn (Table 3.2).
Despi e he ep oduc i e pa e ns obse ed in he clam popula ion, no mucocy e
cells could gene ally be ound in he es ed animals’ gills (in he cases whe e
mucocy es we e obse ed, he cells we e in an incipien s a e) o e he 14-mon h
s udy. This esul does no de ini ely con adic s he link be ween mucous p oduc ion
and ep oduc ion- ela ed e en s – in popula ions whe e mucous is ac ually p oduced,
ma u e pa en s’ de eloping emb yos and p ogeny elease om he pa en s’ gills may
bene i om i as de ended by some au ho s (By ne e al. 2000, Mo on 1977, Williams
and McMahon 1987). Howe e , he epo ed da a p o e ha mucous p oduc ion is no
a necessa y condi ion o success ul clam ep odu ion o occu . P e ious s udies on
mucocy es showed ha he mucous h eads a e p oduced by ju enile and small adul
clams (up o 14 mm shell leng h), and, oge he wi h o he beha io al mechanisms,
assis he d i o he clams h ough lo a ion in esponse o wa e cu en s (P ezan and
Chale mwa 1984, Rosa e al. 2012). The absence o mucocy es cells in he inne
demib anchs o he es ed clams is hus consis en wi h he absence o d i ing, bo h in
he ield and in he labo a o y, h oughou he sampling pe iod.
As he Ame ican and he Po uguese clam popula ions we e p o en o be
gene ically simila and season-d i en e ec s we e uled ou , he ques ion why he wo
popula ions ha e di e en mucous p oduc ion and d i ing capabili ies emains
unanswe ed. I can be specula ed ha , while co esponding o he same species and
haplo ype, he wo popula ions show dis inc physiological ea u es due o a high a e o
geno ypic and/o pheno ypic plas ici y. I is possible ha he coloniza ion o di e en
habi a s igge ed mic oe olu i e e en s owa ds local adap a ion (Ashley e al. 2003,
Sousa e al. 2007), which may explain he inhibi ion o he d ogue line p oduc ion and
d i ing beha io in he Po uguese clam popula ion. Fu he s udies a e necessa y o
assess his hypo hesis.
Species dispe sal - Chap e 3
77
Table 3.2. Summa y o shell leng h, clam densi y and ec ui men e en s o se e al C. luminea popula ions. The s udy si e loca ion, sampling
da e and wa e empe a u e ange a e also shown. This summa y esul om a ho ough li e a u e sea ch and only s udies epo ing da a on a
leas 4 o he columns we e conside ed.
S udy
S udy si e loca ion
Sampling da e
Wa e empe a u e
ange (ºC)
Shell leng h
ange (mm)
Clam densi y
ange (clams
m-2)
Rec ui men e en s
Ald idge and McMahon
1978
Lake A ling on, USA
Sep 1974 – Jan 1976
12.2-32.2
0.2-40
17.7-94.6
2
Ap -Jul & Aug-
Dec
I ua e 1985
Pun a A alaya,
A gen ina
No 1982-Ap 1985
~11-27
~3 - ~30
36-1132
1
Sep embe
McMahon and Williams
1986
T ini y Ri e , USA
Sep 1980 – Dec 1982
4.8-29
2.6- ~45
305-16198
2
Ma -Jul & Aug-
No
Ho nbach 1992
Mechums Ri e ,
USA
Oc 1982-Oc 1983
0- ~26
0.4-19
173-1495
1
July
F ench and Schloesse
1996
S . Clai Ri e , USA
1988-1990
0.5-12.5
1.8– 5.3
18-187
-
-
Ca aldo and Bol o skoy
1998
Pa aná Ri e Del a,
A gen ina
Oc 1995-Oc 1996
10-29
0.2-33
379-2609
1
Oc -No
Rajagopal e al. 2000
Lek Ri e ,
Ne he lands
Aug 1991-Jan 1993
~2-~24
-
-
2
May/Jun & Sep
Mou hon 2001
Saone Ri e ,
F ance
Sep 1986-Dec 1999
0.5-27.2
1.5- ~29
~120-934
2
Jun/Jul & Aug/Sep
Mou hon 2001
Rhône Ri e ,
F ance
Sep 1996-Dec 1999
3-23.5
~0.5 - ~29.3
~300-5266
1
Jul-Sep
Mo gan e al. 2003
Connec icu Ri e ,
USA
Aug 1993-No 1994
-1.7-30.6
-
52-114
1
Jun-Sep
Mou hon and
Pa ghen anian 2004
Loi e Ri e , F ance
Dec 2001-May 2003
[Ice]-25
0.5- ~34
88- <4000
2
Jan-Feb & May-
Oc
Sousa e al. 2006
Lima Ri e ,
Po ugal
Aug 2004 & Aug 2005
20.1-22.9
13.0-51.6
60
-
-
Schmidlin and Bau
2007
Al hine Ri e ,
Swi ze land
Ma 2003-Oc 2003
7-24
1-24
83-339
1
Jun-Jul
Sousa e al. 2008
Minho Ri e ,
Po ugal
Jan 2005- Aug 2006
6.7-23.1
1.85-41.83
92-2152
-
-
F anco e al. 2012
Mondego Es ua y,
Po ugal
Dec 2007-Dec 2008
10.1-25.4
0.92-37
419
Con inuous
-
P esen s udy
Casal de São
Tomé, Po ugal
Oc 2011-Dec2012
11.8-20.5
6-32
1353-6352
2
Jun-Sep & No

O e all, his s udy con i ms ha mucocy es de elopmen is di ec ly ela ed o Asian clam
d i ing beha io and indica es ha mic oe olu iona y e en s may condi ion hese
p ocesses. I hus con ibu es o he unde s anding o a physiological ai o he species
ha is meaning ul o he species dispe sal e iciency and hence ele an om he pes
managemen poin o iew.
3.6. Aknowledgemen s
The au ho s a e g a e ul o João Simões, Ca olina Madei a and A u Al es o hei
ad ice ega ding gene ic analysis, as well as o Robe P ezan o his help in in e p e ing
his ological esul s. B uno Cas o, Hen ique Quei oga and Alexand e Casei o p o ided
impo an guidance on he analysis o he popula ion da a. We would also like o hank all
colleagues ha helped in he ield wo k. Inês Co eia Rosa and Joana Luisa Pe ei a a e
ecipien s o indi idual schola ships by he Po uguese Founda ion o Science and
Technology (FCT) (PhD schola ship SFRH/BD/33395/2008 and Pos –Doc o al
schola ship SFRH/BPD/44733/2008, espec i ely). This s udy was suppo ed by he
Eu opean Regional De elopmen Fund - EDRF, h ough he Ope a ional Compe i i eness
P og amme - COMPETE, and by na ional unds h ough FCT unde he scope o he
p ojec PTDC/AAC-AMB/113515/2009.
3.7. Re e ences
Ald idge DW, McMahon RF. 1978. G ow h, ecundi y, and bioene ge ics in a na u al
popula ion o asia ic eshwa e clam, Co bicula manilensis Philippi, om no h
cen al Texas. Jou nal o Molluscan S udies 44: 49-70.
APHA APHA. 1995. S anda d me hods o he examina ion o wa e and was ewa e . 19 h
ed.; 1995. Washing on.
A aujo R, Mo eno D, Ramos MA. 1993. The Asia ic clam Co bicula luminea (Mülle ,
1774) (Bi al ia: Co biculidae) in Eu ope. Ame ican Malacological Bulle in 10: 39-49.
Ashley MV, Willson MF, Pe gams ORW, O'Dowd DJ, Gende SM, B own JS. 2003.
E olu iona ily enligh ened managemen . Biological Conse a ion 111: 115-123.
ASTM. 2000. S anda d es me hods o mois u e, ash, and o ganic ma e o pea and
o he o ganic soils.
Species dispe sal - Chap e 3
79
Ba ino a SS, Yehuda G, Ne o E. 2010. Compa a i e analysis o algal communi ies in he
i e s o no he n and sou he n Is ael as bea ing on ecological consequences o
clima e change. Jou nal o A id En i onmen s 74: 765-776.
B i on JC, Mo on B. 1982. A dissec ion guide, ield and labo a o y manual o he
in oduced bi al e Co bicula luminea. Malacological Re iew Supplemen 3: 1-82.
B owe JE, Za JH, on Endem CN, eds. 1997. Field and labo a o y me hods o gene al
ecology. 4 ed. Bos on, USA: WCB McG aw-Hill.
By ne M, Phelps H, Chu ch T, Adai V, Sel akuma aswamy P, Po s J. 2000.
Rep oduc ion and de elopmen o he eshwa e clam Co bicula aus alis in
Sou heas Aus alia. Hyd obiologia 418: 185-197.
Ca aldo D, Bol o skoy D. 1998. Popula ion dynamics o Co bicula luminea (Bi al ia) in
he Pa aná Ri e Del a (A gen ina). Hyd obiologia 380: 153-163.
Cohen AN, Ca l on JT. 1998. Accele a ing in asion a e in a highly in aded es ua y.
Science 279: 555-558.
DAISIE – Eu opean In asi e Alien Species Ga eway. www.eu ope-aliens.o g. Acessed
2013.
Da is MA. 2010. In asion Biology. Ox o d: Ox o d Uni e si y P ess.
Folme O, Black M, Hoeh W, Lu z R, V ijenhoek R. 1994. DNA p ime s o ampli ica ion o
mi ochond ial cy och ome c oxidase subuni I om di e se me azoan in e eb a es.
Molecula ma ine biology and bio echnology 3: 294-299.
F anco JN, Ceia FR, Pa icio J, Modes o V, Thompson J, Ma ques JC, Ne o JM. 2012.
Popula ion dynamics o Co bicula luminea (Mülle , 1774) in mesohaline and
oligohaline habi a s: In asion success in a Sou he n Eu ope es ua y. Es ua ine
Coas al and Shel Science 112: 31-39.
F ench JRP, Schloesse DW. 1996. Dis ibu ion and win e su i al heal h o Asian clams,
Co bicula luminea, in he S Clai Ri e , Michigan. Jou nal o F eshwa e Ecology
11: 183-192.
Glaub ech M, on Rin elen T, Ko niushin AV. 2003. Towa d asys ema ic e ision o
b ooding eshwa e co biculidae in Sou heas Asia (Bi al ia, Vene oida): On shell
mo phology, ana omy and molecula phylogene ics o endemic axa om islands in
Indonesia. Malacologia 45: 1-40.
Species dispe sal - Chap e 3
80
Hed ke SM, S ange -Hall K, Bake RJ, Hillis DM. 2008. All-male asexuali y: O igin and
main enance o and ogenesis in he Asian clam Co bicula. E olu ion 62: 1119-1136.
Ho nbach DJ. 1992. Li e his o y ai s o a i e ine popula ion o he Asian clam Co bicula
luminea. Ame ican Midland Na u alis 127: 248-257.
Ishibashi R, Ookubo K, Aoki M, U aki M, Koma u A, Kawamu a K. 2003. And ogene ic
ep oduc ion in a eshwa e diploid clam Co bicula luminea (Bi al ia:Co biculidae).
Zoological Science 20: 727-732.
I ua e CF. 1985. G ow h dynamics in a na u al popula ion o Co bicula luminea (Bi al ia
Sphae iacea) a Pun a A alaya, Rio de La Pla a, A gen ina. S udies on Neo opical
Fauna and En i onmen 20: 217-225.
I ua e CF. 1994. Co bicula and Neoco bicula (Bi al ia: Co biculidae) in he Pa aná,
U uguay, and Rio de la Pla a Basins. The Nau ilus 107: 129-135.
Koma u A, Kawagishi T. 1998. Cy ological e idence o spon aneous and ogenesis in he
eshwa e clam Co bicula leana P ime. De elopmen Genes and E olu ion 208: 46-
50.
K aeme LR, Galloway ML. 1986. La al de elopmen o Co bicula luminea (Mülle )
(Bi al ia, Co biculacea) - An app aisal o i s he e och ony. Ame ican Malacological
Bulle in 4: 61-79.
Lee T, Si ipa awan S, I ua e CF, O Foighil D. 2005. In asion o he clonal clams:
Co bicula lineages in he New Wo ld. Ame ican Malacological Bulle in 20: 113-122.
Legend e P, Legend e L. 1998. Nume ical Ecology. Ams e dam: Else ie .
Lo enzen CJ. 1967. De e mina ion o chlo ophyll a and phae-pigmen s:
Spec opho ome ic equa ions. Limnology and Oceanog aphy 12: 343-346.
McMahon RF, Williams CJ. 1986. A eassessmen o g ow h a e, li e span, li e cycles and
popula ion dynamics in a na u al popula ion and ield caged indi iduals o Co bicula
luminea (Mülle ) (Bi al ia: Co biculacea). P oceedings o he Second In e na ional
Co bicula Symposium: Ame ican Malacological Bulle in - Special edi ion no.2.
Mo gan DE, Kese M, Swena on JT, Foe ch JF. 2003. Popula ion dynamics o he
Asia ic clam, Co bicula luminea (Mülle ) in he Lowe Connec icu Ri e :
Es ablishing a oo hold in New England. Jou nal o Shell ish Resea ch 22: 193-203.
Mo on B. 1977. F eshwa e ouling bi al es. Pages 1-14. Fi s In e na ional Co bicula
Symposium. Fo Wo h, Texas, USA: Texas Ch is ian Uni e si y.
Species dispe sal - Chap e 3
81
Mou hon J. 1981. Su la p ésence en F ance e au Po ugal de Co bicula (Bi al ia,
Co biculidae) o iginai e d' Asie. Bas e ia 45: 109-116.
Mou hon J. 2001. Li e cycle and popula ion dynamics o he Asian clam Co bicula
luminea (Bi al ia : Co biculidae) in he Saone Ri e a Lyon (F ance). Hyd obiologia
452: 109-119.
Mou hon J. 2001. Li e cycle and popula ion dynamics o he Asian clam Co bicula
luminea (Bi al ia : Co biculidae) in he Rhone Ri e a C eys-Mal ille (F ance).
A chi Fu Hyd obiologie 151: 571-589.
Mou hon J, Pa ghen anian T. 2004. Compa ison o he li e cycle and popula ion dynamics
o wo Co bicula species, C. luminea and C. luminalis (Bi al ia: Co biculidae) in
wo F ench canals. A chi Fu Hyd obiologie 161: 267-287.
Pa k JK, Kim W. 2003. Two Co bicula (Co biculidae : Bi al ia) mi ochond ial lineages a e
widely dis ibu ed in Asian eshwa e en i onmen . Molecula Phylogene ics and
E olu ion 29: 529-539.
Phelps HL. 1994. The asia ic clam (Co bicula luminea) in asion and sys em-le el
ecological change in he Po omac Ri e es ua y nea Washing on, DC. Es ua ies 17:
614-621.
Pigneu L-M, Ma escaux J, Roland K, E oundi E, Descy J-P, Van Doninck K. 2011.
Phylogeny and and ogenesis in he in asi e Co bicula clams (Bi al ia,
Co biculidae) in Wes e n Eu ope. Bmc E olu iona y Biology 11.
Pimen el D, Zuniga R, Mo ison D. 2005. Upda e on he en i onmen al and economic
cos s associa ed wi h alien-in asi e species in he Uni ed S a es. Ecological
Economics 52: 273-288.
P ezan RS, Chale mwa K. 1984. Flo a ion o he bi al e Co bicula luminea as a means
o dispe sal. Science 225: 1491-1493.
Quinn GP, Keough MJ, eds. 2002. Expe imen al design and da a analysis o biologis s
New Yo k: Camb idge Uni e si y P ess.
Rajagopal S, an de Velde G, de Vaa e AB. 2000. Rep oduc i e biology o he Asia ic
clams Co bicula luminalis and Co bicula luminea in he i e Rhine. A chi Fu
Hyd obiologie 149: 403-420.
Rena d E, Bachmann V, Ca iou ML, Mo e eau JC. 2000. Mo phological and molecula
di e en ia ion o in asi e eshwa e species o he genus Co bicula (Bi al ia,
Impac s - Chap e 4
88
Ame ican plan s, including powe s a ions, d inking wa e ea men plan s, sand and
g a el companies and i iga ion canals do exis (e.g. Ing am 1959, Johnson e al. 1986,
McMahon 1977, P okopo ich and He be 1965, Sinclai 1964). Howe e , a la ge
numbe o hese s udies a e no o easy access, in many cases co esponding o
p i a e in e nal epo s (e.g. Che y e al. 1980). Fu he mo e, equi alen s udies
add essing he p oblem in he Eu opean scena io a e much sca ce (Jenne e al.
1998). Di e ences be ween he No h Ame ican Asian clam popula ions and hose ha
mo e ecen ly colonised and sp ead ac oss Eu ope may be expec ed in aspec s such
as g ow h a es, physiological ole ance, popula ion densi ies and annual ep oduc i e
cycles (Mackie and Schloesse 1996). These ea u es o he species biology and
ecology de e mine o a la ge ex en he pa e n o indus ial in es a ions, and a e hus
c i ical o he implemen a ion o e ec i e moni o ing and con ol measu es. The e o e,
al hough Eu opean pes manage s can ob iously ake ad an age o he documen ed
expe ience o hei Ame ican coun e pa s, epo s on C. luminea in es a ion episodes
and mi iga ion p ac ices in Eu opean eshwa e -d awing indus ies should cons i u e a
mo e conc e e wo king basis o hem.
One u he issue ha some imes may con ound hose sea ching he li e a u e
o in o ma ion on p oblems caused by he Asian clam is ela ed o a gene alisa ion,
somewha abusi e, o he indus ial impac s o he zeb a mussel D eissena
polymo pha. This species is a pa icula ly se e e eshwa e bio oule bi al e due o i s
excep ional dispe sal capaci y and epi aunal mode o li e, and hus he li e a u e
add essing his pes is conside ably as e (Claudi and Mackie 1994, Ludyanskiy e al.
1993). Because he Asian clam also causes signi ican economic damage, he e is
some imes a endency o exagge a e many aspec s o i s bio ouling ac i i y based on
an analogy wi h hose o he zeb a mussel o d aw a en ion o he p oblem. Some o
such gene alisa ions a e hen epea ed and assumed p o en wi hou p ac ical
e idence. Ye he wo oublesome bi al es a e di e en in key ea u es o hei biology
and ecology (Ka a aye e al. 2005), and hence he mode and he ex en o which hey
a ec indus ial acili ies a e no exac ly he same.
F om he abo e discussion, i becomes appa en ha comp ehensi e epo s o
C. luminea indus ial in es a ions should be encou aged. They a e likely o be o g ea
use o pes manage s, especially i hey e e o expe iences in Eu ope, whe e he
species a i ed mo e ecen ly and possibly he in asi e popula ions s and a a di e en
s age compa ed o hose in mos No h Ame ican habi a s (Allendo and Lundquis
2003, Sakai e al. 2001, Sousa e al. 2006).

Impac s - Chap e 4
89
The main aim o his pape is hus o p o ide a de ailed, no ala mis , hough
ealis ic pic u e o he cu en e ec s o C. luminea on he Po uguese eshwa e -
dependen indus y. The d inking wa e ea men , he mal powe , cemen , pulp and
pape , and ag icul u al (i iga ion) sec o s we e conside ed in his s udy. The da a
p esen ed he e may be use ul o Eu opean indus ial pes manage s dealing wi h
speci ic in es a ion isks and episodes. Mo eo e , he analysis p o ided in his pape is
also ele an a a b oade scale. Po ugal seems o ha e been a ga eway by which he
Asian clam en e ed Eu ope a ound 30 yea s ago (Mou hon 1981). In spi e o he
pe sis en ad ice o he scien i ic communi y on he impo ance o dealing wi h he
in asion in i s ea ly s ages (A aujo e al. 1993, Pé ez-Quin e o 2008, Sousa e al. 2006,
Sousa e al. 2008a), no he esponsible go e nmen al agencies, a he na ional le el,
no he indus ial acili ies, a hei own scale, ha e done much o e his pe iod o
minimise he sp ead o his pes and i s impac s. In his con ex , such a holis ic,
coun y-scale o e iew may assis he o icial en i ies in coun ies a isk o in asion o
whe e he species has a i ed no long ago, such as Se bia (Pauno ić 2007), he
Uni ed Kingdom (Howle and Bake 1999) and he Czech Republic (Be an 2006), wi h
he implemen a ion o in eg a ed pes managemen policies be o e he biological
in asion eaches ad anced s ages.
As a complemen o he Asian clam indus ial bio ouling da a, upda ed
in o ma ion on he species dis ibu ion in Po uguese wa e s is also p o ided in sec ion
4.3. Such in o ma ion is c i ically impo an o he na ional eshwa e -d awing
indus ial plan s o judge hei isk o being in es ed. I can also be in e p e ed as he
un es ic ed sp ead o he pes a a coun y-scale wi hin a 30-yea window.
4.3. The dis ibu ion o Co bicula luminea in Po ugal
C. luminea has been p esen in Po ugal a leas since he ea ly 1980s, when i was
ound in he Tejo Ri e es ua y (Mou hon 1981). Since hen, he numbe o s udies
p o iding dis ibu ion da a o he pes in he coun y, and in he Ibe ian Peninsula in
gene al, has been inc easing signi ican ly (Pé ez-Quin e o 2008). Howe e , many o
hem a e agmen a y in he sense ha hey analyse he p esence o he species only
in speci ic i e s. Fo example, Sousa and co-wo ke s documen ed he Asian clam
dis ibu ion in he Lima (Sousa e al. 2006) and Minho (Sousa e al. 2008b) Ri e s,
while Mo ais e al. (2009) add essed he colonisa ion o he Guadiana Ri e . In 2006,
Reis (2006) p o ided he i s in eg a ed desc ip ion o he species dis ibu ion in he
Impac s - Chap e 4
90
coun y. Two yea s la e , Pé ez-Quin e o (2008) also p esen ed an o e iew, sligh ly
less exhaus i e han ha o Reis, o he Asian clam dis ibu ion in Po ugal.
Fig. 4.1 p esen s he ch onological and cu en na ionwide C. luminea
dis ibu ion, based on da a esul ing om a comp ehensi e compila ion o p e iously
published li e a u e (A aujo e al. 1993, Chainho e al. 2006, Mo ais e al. 2009,
Mou hon 1981, Pé ez-Quin e o 2007, 2008, Reis 2006, Sousa e al. 2006, 2007) as
well as upda ed eco ds ob ained h oughou his s udy. Table 4.1 summa ises
in o ma ion on he i s eco ds o he species o he majo Po uguese wa e sheds.
A e he i s appea ance o C. luminea in he coun y (in Tejo Ri e ), no he n
es ua ies o Dou o and Minho Ri e s we e also in aded wi hin a en-yea ime in e al.
F om 2000 onwa ds, he Asian clam was no iced in o he es ua ies and inland
wa e ways. The sp ead o he species in he Po uguese e i o y seems o ha e
accele a ed signi ican ly o e he pas decade. Nowadays he pes is p esen in a leas
11 ou o he 15 majo wa e sheds in Po ugal, ha ing no been epo ed ye in A e,
Cá ado, Leça and Lis Ri e basins (Table 4.1 and Fig. 4.1).
Table 4.1. Fi s eco ds o C luminea in he Po uguese wa e sheds al eady in aded.
Wa e shed
Fi s eco d o C. luminea
Re e ences
Yea
Loca ion
Tejo
1980
Tejo Ri e (es ua y)
Mou hon 1981
Dou o
1988
Dou o Ri e (es ua y)
Nagel 1989
Minho
1989
Minho Ri e (es ua y)
A aujo e al. 1993
Guadiana
2000
Guadiana Ri e (downs eam Alque a
dam)
Pe ez-Quin e o 2007
Mondego
2000
Mondego Ri e (es ua y)
Chainho e al. 2006
Lima
2002
Lima Ri e (es ua y)
Sousa e al. 2006
Vouga
No known
Vouga Ri e /Co ujei a
Reis 2006
Ribei as do Oes e
No known
Lizand o Ri e
Reis 2006
Sado
No known
Sado Ri e
Mo ais e al. 2009
Mi a
2009
San a Cla a dam
P esen s udy
Ribei as do
Alga e
2009
B a u a dam
P esen s udy
Impac s - Chap e 4
91
Fig. 4.1. Dis ibu ion and indus ial impac s o C. luminea in Po ugal: a eas whe e he
species has been epo ed and loca ion o he eshwa e -dependen indus ies
su eyed o p oblems ela ed o he pes . In he op-le co ne is he map o he
adminis a i e hyd og aphic egions. The symbols ep esen he su eyed eshwa e -
dependen indus ies ha bo h epo ed Asian clam in es a ions and ha e no been
a ec ed by he pes ye . In all cases, excep he powe indus y sec o , all he na ional
acili ies especially p one o in es a ion (i.e. d awing wa e om su ace wa e bodies)
ha e been su eyed. See ex o de ails.
Impac s - Chap e 4
92
4.4. Me hods
The d inking wa e ea men , he mal powe , cemen , pulp and pape , and ag icul u al
(i iga ion) sec o s we e conside ed in he p esen s udy. These sec o s, which ely on
he in ensi e use o wa e , we e selec ed due o hei ele ance o he Po uguese
economy.
Gene al in o ma ion on each sec o was i s collec ed mos ly om
go e nmen al agencies and indus ial associa ions. A e lis ing he majo 454 na ional
acili ies o he selec ed sec o s (Table 4.2), hese we e con ac ed ia email and/o
elephone in o de o iden i y he espec i e wa e sou ce ( eshwa e s sea wa e ;
su ace wa e , g oundwa e s municipal wa e ) – only he acili ies d awing om
su ace wa e bodies we e conside ed o be p one o in es a ion by he Asian clam
(Table 4.2). These acili ies we e hen enqui ed abou he occu ence o cu en o pas
in es a ion episodes. Facili ies whe e he pes was epo ed unde wen u he analysis.
Such plan s we e isi ed and si e manage s we e in e iewed in loco o ho oughly
documen he in es a ion episodes and esponses gi en o he p oblem. The si e isi s
and in e iews ollowed a common su eying guide, p e iously designed o ensu e
comp ehensi eness and s anda disa ion o da a collec ion. De ails on he quali y o he
aw wa e and ea ing p ocedu es, sys em con igu a ion (e.g. pumps, il e meshes,
pipe diame e s), ype o s uc u es a ec ed by he pes , loca ion o and gene al
condi ions (e.g. wa e low, wa e quali y, cleaning ou ines) in such s uc u es and
mi iga ion s a egies in place we e discussed in dep h. Ques ions conce ning he
quan i a i e es ima ion o he in es a ion cos s we e also included in he su eying
guide, and his opic was ho oughly discussed in he in e iews.
The exac loca ion o all he acili ies su eyed was eco ded and included in he
geo e e enced hyd og aphical map o he Po uguese e i o y, whe e in o ma ion on
he species dis ibu ion had been p e iously inco po a ed (Fig. 4.1). A ec ed and
una ec ed indus ies we e dis inguished as di e en laye s o spa ial analysis.
Impac s - Chap e 4
93
Table 4.2. Po uguese eshwa e -dependen indus ies su eyed o p oblems ela ed
o C. luminea in es a ions.
D inking
wa e
ea men
plan s
The mal
powe
plan s
Cemen
plan s
Pulp and
pape
mills
I iga ion
sys ems
Numbe o majo wa e -d awing acili ies
in he coun y
420
6
6
6
16
Numbe o acili ies especially p one o
in es a ion and su eyed
149
6
1
3
16
Numbe o acili ies epo ing p oblems
3
2
0
0
4
4.5. Resul s
4.5.1. Gene al pic u e o he e ec s o C. luminea on Po uguese eshwa e -
dependen indus y
Only 175 o he 454 Po uguese wa e -d awing acili ies conside ed in his s udy use
su ace eshwa e , and hus a e p one o Asian clam in es a ions (Table 4.2). The
emaining ones use g oundwa e (as some d inking wa e ea men plan s), municipal
wa e (as happens wi h many o he cemen plan s and pulp and pape mills) o sea
wa e (one he mal powe plan does so), and we e hus excluded om he su ey. All
he acili ies suscep ible o in es a ion we e success ully su eyed (Table 4.2).
O e all, only 5 % o he acili ies suscep ible o in es a ion epo ed p oblems
caused by C. luminea. None o he ele an cemen plan s o pulp and pape mills has
been a ec ed ye , whils i iga ion sys ems and he mal powe plan s seem o be he
s uc u es whe e he pes causes mo e conce ns, wi h 25 % and 33% o he su ace
wa e -d awing sys ems epo ing he p esence o he species, espec i ely (Table 4.2).
Ou o he 149 ele an d inking wa e ea men plan s, only h ee ace in es a ion
p oblems cu en ly (Table 4.2). Ano he one, which is p esen ly deac i a ed (loca ed in
No hwes e n Po ugal), also epo ed p oblems in he ea ly 1990s. In e es ingly, in
some acili ies, including one i iga ion sys em and ou d inking wa e ea men plan s,
Asian clams ha e been seen by ope a o s in he su oundings, bu no bio ouling
p oblems occu ed so a .

Impac s - Chap e 4
94
4.5.2. E ec s o C. luminea on d inking wa e ea men plan s
Fig. 5.2a p esen s he ypical p ocesses implemen ed by Po uguese wa e wo ks ha
ea su ace wa e . Raw wa e is pumped om he sou ce, o en a i e , h ough me al
g ills and sc eens (mesh o abou 1 cm) in o ese oi s, whe e i is empo a ily s o ed.
The subsequen ea men s eps depend on he aw wa e quali y, which a ies g ea ly
ac oss he coun y. One o he possible ea men con igu a ions in ol es il a ion
h ough apid g a i y il e s, ollowed by disin ec ion ( ypically h ough chlo ine injec ion)
ha ensu es mic obiological quali y o he inal p oduc . Al e na i ely, he ea men
may in ol e a p e-oxida ion s age, p eceded by il a ion h ough apid g a i y il e s
when he aw wa e u bidi y is high. A e he p e-oxida ion s ep, loccula ion,
decan a ion, il a ion and inal disin ec ion ollow.
C. luminea appea s o be p esen in Po uguese d inking wa e ea men
acili ies since he ea ly 1990s. I was epo ed in a plan loca ed in he Dou o Ri e
basin sho ly be o e i s deac i a ion in 1992. Abou 1.4 onnes o clams we e emo ed
om he bo om o he s o age ese oi in ha acili y (Fig. 4.2a).
Cu en ly, he species was ound o in es h ee wa e wo ks (Table 4.2), loca ed
in Dou o Ri e , Tejo Ri e and Ribei as do Alga e basins (Fig. 4.1), which epo ed
he i s occu ence o he species in 2000, 2008 and 2008, espec i ely. The main
s uc u es a ec ed by he pes di e amongs he acili ies. In he Dou o Ri e basin
plan (Fig. 4.1), o e 4 onnes o clams ha e been emo ed du ing scheduled cleaning
p ocedu es (which ake place e e y wo yea s). Clogging o he in ake sc eens
occu ed as well as accumula ion in he s o age ese oi and in he ozone injec ion
anks (Fig. 4.2a), bu wi hou majo damage o he s uc u es. In 2004 a new p e-
ea men uni (mul ilaye sand il e ) was ins alled downs eam he aw wa e ese oi
in o de o ace inc eased wa e u bidi y. This uni appa en ly p omo ed a signi ican
educ ion in he amoun o clams ound downs eam. In he Tejo Ri e basin plan (Fig.
4.1), clams ha e been ound on he uppe laye s o sand il e s (Fig. 4.2a). As a esul ,
il e main enance cycles had o be sho ened, and sand has now o be eplaced mo e
equen ly han be o e. The las cleaning e en in ol ed he discha ge o 108 onnes o
sand. In he Ribei as do Alga e basin plan (Fig. 4.1), clams we e only ound in a 1.80-
me e diame e in ake pipeline du ing a pe iodic cleaning ope a ion. In he h ee plan s,
no ope a ion p oblems ela ed o C. luminea o he han inc eased complexi y and
equency o pe iodic cleaning and main enance p ocedu es we e men ioned. In
pa icula , al e a ions in he wa e odou and as e ha e no been de ec ed, no he
e iciency o he plan seems o ha e been signi ican ly a ec ed so a . None o he
a ec ed plan s implemen s any speci ic moni o ing p og amme o con ol measu es o
Impac s - Chap e 4
95
deal wi h he pes . Consis en ly wi h his pic u e, a p esen , he cos associa ed wi h
Asian clam in es a ions in Po uguese wa e wo ks, mainly ela ed o sys em cleaning
and main enance as well as clams disposal (in land ills), a e s ill negligible,
co esponding o, on a e age, less han 0.01% o a plan ’s ope a ion cos s (Table 4.3).
Impac s - Chap e 4
96
Fig. 4.2. Layou o he ypical wa e sys ems in Po uguese (a) d inking wa e ea men plan s (b) he mal powe plan s, and (c) i iga ion
sys ems ed by su ace wa e bodies.
Table 4.3. Summa y o he cu en impac s o C. luminea in he Po uguese eshwa e -
dependen indus y.
D inking
wa e
ea men
plan s
The mal
powe
plan s
Cemen
plan s
Pulp and
pape
mills
I iga ion
sys ems
Fi s indus ial in es a ion epo ed
(da e and loca ion)
Ea ly 1990s,
Dou o Ri e
basin
La e
1980s,
Tejo Ri e
basin
-
-
2005,
Mondego
Ri e basin
F ac ion o he na ional acili ies
especially p one o in es a ion ha
ha e al eady been a ec ed
2 %
33%
0 %
0 %
25 %
Se e i y o he indus ial in es a ion
Ve y low
Low
-
-
Mode a e
Annual economic losses in he
sec o due o he pes (€)
1 500
40 000
-
-
150 000
4.5.3. E ec s o C. luminea on he mal powe plan s
In he mal powe plan s, aimed a elec ic powe gene a ion, massi e olumes o wa e
ci cula e in he cooling sys ems, equi ed o comple e he s eam cycle. Fo economic
easons, he wa e unning in such sys ems is un ea ed o ba ely ea ed. A simpli ied
layou o ypical cooling sys ems in Po uguese powe s a ions is p esen ed in Fig. 5.2b.
Wa e , d awn om a nea by wa e body, passes h ough in ake sc eens o a s o age
ese oi . F om he e, i goes o he i e ex inc ion sys em and, mos commonly, o he
condense s, om which i is hen discha ged back in o he wa e sou ce. In some cases, a
closed e ige a ion sys em exis s, wi h wa e unning be ween he condense s and
cooling owe s.
Two o he powe s a ions su eyed, bo h ope a ing in he Tejo Ri e basin (Fig.
4.1), epo ed he p esence o C. luminea (Table 4.2). One o hem expe ienced an
isola ed in asion episode in he la e 1980s, which was de ec ed du ing scheduled
cleaning p ocedu es (a he ime occu ing e e y 4 yea s). Clams en e ed he acili y and
accumula ed in a educed low a e 1.80-me e wid h bypass channel. Almos 800 kg o
bi al es we e washed ou and mechanically emo ed om he channel. Shells we e also
ound in he cooling sys em pumps as well as in one o he i e condense s (Fig. 4.2b),
al hough signi ican clogging o hese s uc u es had no been no iced. Following his
in es a ion episode, me al moni o ing boxes we e ins alled in he bypass channel, and he
mo e c i ical i e p o ec ion wa e sys em became inspec ed on a mo e egula basis.
Impac s - Chap e 4
104
ma ginally con ibu e o he in es a ion because he wa e esidence ime ends o be such
ha he elige s hey p oduce pass h ough he sys em much be o e eaching he se ling
s age. In he case o he Asian clam, he plank onic de elopmen s age a e elease om
he p ogeni o s is much sho e (on he scale o hou s) (Acke man e al. 1994, King e al.
1986, K aeme and Galloway 1986), meaning ha popula ions ha a e es ablished close
ups eam he acili y should cons i u e an impo an in es a ion sou ce. Mo eo e , con a y
o zeb a mussels, Asian clams se le o ake up an in aunal exis ence, and i is hus
plausible ha una ached young indi iduals in he immedia e su oundings o he in ake
poin s a e mo e easily sucked in o he sys em. Also, in iew o he in aunal cha ac e o C.
luminea, i is no comple ely clea whe he he indi iduals bo n in he plan may con ibu e
o he popula ion es ablished he e. While a plank onic de elopmen s age is iden i ied in
he species li e cycle, he p ocess h ough which se lemen occu s does no seem o be
ully unde s ood, and i is possible ha newly-bo n indi iduals a e able o emain inside
he plan (McMahon 1983). The ole played by and he ela i e con ibu ion o indi iduals
o igina ed om mode a ely dis an pa en popula ions, e y young ju eniles sucked in o
he sys em and he popula ion es ablished in he plan i sel as an in es a ion sou ce is
wo h in es iga ing.
One majo di ec implica ion o he di e ences discussed abo e in he mi iga ion o
he wo pes s is conce ned wi h chemical con ol s a egies. Basically, he e a e wo majo
ypes o such s a egies: eac i e and p oac i e ea men s (Claudi and Mackie 1994).
Reac i e s a egies a e a ge ed a adul s al eady es ablished in he acili y, being sui able
o sys ems ha can ole a e some deg ee o bio ouling. P oac i e s a egies a e designed
o p e en he se lemen o he bi al es in he plan . In he case o zeb a mussel
in es a ions, eac i e chemical ea men is applied o acili a e he emo al o he i mly
a ached adul s as well as p e en ing la ge indi iduals, which inc ease clogging o small
c oss sec ion s uc u es, o g ow in he sys em. Taking in o accoun ha he Asian clam do
no a ach s ongly o su aces, p oac i e chemical dosage p io o clams emo al does
no esul in much bene i in e ms o he complexi y o he cleaning p ocedu e. Howe e , i
s ill p e en s he adul s o g ow la ge, and may p o e o be u he ad an ageous i one
can con i m ha he esiden popula ions play a signi ican ole as an in es a ion sou ce.
4.7. Conclusions
The s udy p esen ed he e e ealed ha , somewha su p isingly, he impac s o he
bio oule C. luminea in he Po uguese eshwa e -dependen indus y a e ela i ely mild,
al hough he species has been epo ed in he coun y since he ea ly 1980s. While, in

Impac s - Chap e 4
105
gene al, he e ec s o he pes do no jus i y con ol measu es (e.g. chemical con ol o he
physical al e a ion o he wa e sys ems) o he han pe iodic cleaning o he momen , he
sensible ad ice is ha in o ma ion on he species cha ac e is ics and beha iou should be
widely dissemina ed amongs he na ional plan s and sys ema ic moni o ing s a egies
should be implemen ed. Based on he No h Ame ican expe ience, a sudden inc ease o
losses due o he pes in indus ial en i onmen s may occu .
Amongs all he sec o s su eyed, i iga ion sys ems a e cu en ly he mos
a ec ed s uc u es, expe iencing inc easing annual losses ha al eady sum up o 2 % o
he o e all ope a ing cos s. The espec i e manage s a e hus e y keen o implemen
mo e e ec i e pes mi iga ion p og ammes. Con olling in asi e bi al es in i iga ion
sys ems is no an easy ask, mainly due o hei con igu a ion, he massi e olumes o
wa e p ocessed and he need o gua an ee plan s su i al and de elopmen , bu i is
ce ainly a challenge ha is wo h being add essed by he scien i ic communi y.
As no speci ic measu es ha e been implemen ed so a in o de o minimise he
dispe sal o he Asian clam in Po ugal and i s bio ouling ac i i y, he esul s p esen ed
he e p o ide a holis ic pic u e o he un es ic ed indus ial in es a ion p ocess wi hin a 30-
yea window. They may hus assis o icial en i ies in coun ies a isk o in asion o whe e
he C. luminea has ecen ly a i ed wi h he implemen a ion o in eg a ed pes
managemen policies. A epea ed su ey o he impac s o he species on na ional
eshwa e -dependen plan s wi hin a easonable leng h o ime and compa ison wi h he
p esen s udy may con ibu e o an unde s anding o he p og ession o he species in
indus ial en i onmen s.
The con ol o his aqua ic pes will ce ainly bene i om an ample unde s anding
o he in es a ion p ocess. In his con ex , s udies ela ing popula ions’ ec ui men a es in
indus ial acili ies o he clams se lemen and dispe sal, ocussing in pa icula he ole
played by he mucilaginous byssal h ead o med in he ea ly li e s ages, a e welcome.
4.8. Acknowledgemen s
Special hanks a e due o all he en i ies and people ha p o ided impo an in o ma ion
and assis ance o his s udy, namely Ins i u o da Água, IP; Ins i u o da Conse ação da
Na u eza e da Biodi e sidade; Associação de Bene iciá ios do Mi a; Associação de
Bene iciá ios da Lezí ia G ande de Vila F anca de Xi a; Associação de Bene iciá ios do
Plano de Rega do So a en o Alga io; Câma a Municipal de Ab an es; Águas do Dou o e
Pai a, SA; Po ucel-Sopo cel G oup; Ene gias de Po ugal; Pegop - Ene gia Eléc ica, SA;
Célia Al es and Micaela Ben o Cas o. Financial suppo om he Po uguese Founda ion
Impac s - Chap e 4
106
o Science and Technology (PhD schola ship SFRH/BD/33395/2008, Pos –Doc o al
schola ship SFRH/BPD/44733/2008 and esea ch g an PTDC/AAC-AMB/113515/2009)
and CIIMAR/CESAM a e g a e ully acknowledged.
4.9. Re e ences
Acke man JD, Sim B, Nichols SJ, Claudi R. 1994. Re iew o he ea ly-li e his o y o zeb a
mussels (D eissena polymo pha) - compa isons wi h ma ine bi al es. Canadian
Jou nal o Zoology-Re ue Canadienne De Zoologie 72: 1169-1179.
Allendo FW, Lundquis LL. 2003. In oduc ion: Popula ion biology, e olu ion, and con ol
o in asi e species. Conse a ion Biology 17: 24-30.
A aujo R, Mo eno D, Ramos MA. 1993. The Asia ic clam Co bicula luminea (Mülle ,
1774) (Bi al ia: Co biculidae) in Eu ope. Ame ican Malacological Bulle in 10: 39-49.
Beasley CR, Taglia o CH, Figuei edo WB. 2003. The occu ence o he Asian clam
Co bicula luminea in he lowe Amazon Basin. Ac a Amazonica 33: 317-324.
Be an L. 2006. Sp eading expansion o Co bicula luminea (Mollusca: Bi al ia) in he
Czech Republic. Heldia 6: 187/192.
Bidwell JR, Fa is JL, Che y DS. 1995. Compa a i e esponse o he zeb a mussel,
D eissena polymo pha, and he asian clam, Co bicula luminea, o DGH/QUAT, a
nonoxidizing molluscicide. Aqua ic Toxicology 33: 183-200.
Bye s JE, e al. 2002. Di ec ing esea ch o educe he impac s o nonindigenous species.
Conse a ion Biology 16: 630-640.
Chainho P, Cos a JL, Cha es ML, Lane MF, Daue DM, Cos a MJ. 2006. Seasonal and
spa ial pa e ns o dis ibu ion o sub idal ben hic in e eb a e communi ies in he
Mondego Ri e , Po ugal – A poikilohaline es ua y. Hyd obiologia 555: 59-74.
Che y DS, Rodge s J . JH, G aney RL, Cai ns J . J. 1980. Dynamics and con ol o he
Asia ic clam in he New Ri e , Vi ginia. Vi ginia: Vi ginia Wa e Resea ch Cen e ,
Vi ginia Poly echnic Ins i u e and S a e Uni e si y.
Claudi R, Mackie GL. 1994. P ac ical manual o zeb a mussel moni o ing and mon ol.
Boca Ra on: Lewis Publishe s.
Coope NL, Bidwell JR, Che y DS. 2005. Po en ial e ec s o Asian clam (Co bicula
luminea) die-o s on na i e eshwa e mussels (Unionidae) II: Po ewa e ammonia.
Jou nal o he No h Ame ican Ben hological Socie y 24: 381-394.
Impac s - Chap e 4
107
Coun s CL. 1986. The zoogeog aphy and his o y o he in asion o he Uni ed S a es by
Co bicula luminea (Bi al ia: Co biculidae). P oceedings o he Second In e na ional
Co bicula Symposium, Ame ican Malacological Bulle in - Special edi ion no.2.
DAISIE – Eu opean In asi e Alien Species Ga eway. www.eu ope-aliens.o g. Acessed
2008.
Ellio P, Ald idge DC, Mogg idge GD, Chipps M. 2005. The inc easing e ec s o zeb a
mussels on wa e ins alla ions in England. Wa e and En i onmen Jou nal 19: 367-
375.
El on C. 1958. The ecology o in asions by animals and plan s. USA: The Uni e si y o
Chicago P ess.
F ench JRP, Schloesse DW. 1996. Dis ibu ion and win e su i al heal h o Asian clams,
Co bicula luminea, in he S Clai Ri e , Michigan. Jou nal o F eshwa e Ecology
11: 183-192.
Howle D, Bake R. 1999. Co bicula luminea (Mülle ): New o U.K. Jou nal o Conchology
36: Only abs ac .
Ila i MI, An unes C, Guilhe mino L, Sousa R. 2011. Massi e mo ali y o he Asian clam
Co bicula luminea in a highly in aded a ea. Biological In asions 13: 277-280.
Ing am WM. 1959. Asia ic clams as po en ial pes s in Cali o nia wa e supplies. Jou nal
Ame ican Wa e Wo ks Associa ion: 363-370.
Isom B. 1986. His o ical e iew o Asia ic clam (Co bicula) in asion and bio ouling o
wa e s and indus ies in he Ame icas in B i on J, ed. P oceedings o he Second
In e na ional Co bicula Symposium: Ame ican Malacological Bulle in - Special
edi ion no.2.
Jenne HA, Whi ehouse JW, Taylo CJL, Khalanski M. 1998. Cooling wa e managemen
in Eu opean powe s a ions Biology and con ol o ouling. Hyd oécologie Appliquée
10: 1-225.
Johnson KI, Henage CH, Page TL, Hayes PF. 1986. Enginee ing ac o s in luencing
Co bicula ouling in nuclea se ice wa e sys ems. Ame ican Malacological Bulle in
special edi ion n .2: 47-52.
Ka a aye AY, Bu lako a LE, Padilla DK. 2005. Con as ing dis ibu ion and impac s o
wo eshwa e exo ic suspension eede s, D eissena polymo pha and Co bicula
luminea. Pages 239-262 in Dame RF, Olenin S, eds. The Compa a i e Roles o
Impac s - Chap e 4
108
Suspension-Feede s in Ecosys ems, ol. IV. Ea h and En i onmen al Sciences.
Do d ech , The Ne he lands: Sp inge .
King CA, Langdon CJ, Coun s CL. 1986. Spawning and ea ly de elopmen o Co bicula
luminea (Bi al ia, Co biculidae) in labo a o y cul u e. Ame ican Malacological
Bulle in 4: 81-88.
K aeme LR, Galloway ML. 1986. La al de elopmen o Co bicula luminea (Mülle )
(Bi al ia, Co biculacea) - An app aisal o i s he e och ony. Ame ican Malacological
Bulle in 4: 61-79.
LePage WL. 1993. The impac o D eissena polymo pha on wa e wo ks ope a ions a
Mon oe, Michigan: a case his o y. Pages 333-358 in Nalepa TF, Schloesse DW,
eds. Zeb a mussels: biology, impac s and con ol. Boca Ra on: Lewis Publishe s.
Leung B, Lodge DM, Finno D, Shog en JF, Lewis MA, Lambe i G. 2002. An ounce o
p e en ion o a pound o cu e: bioeconomic isk analysis o in asi e species.
P oceedings o he Royal Socie y o London Se ies B-Biological Sciences 269:
2407-2413.
Lo ell SJ, S one SF. 2005. The economic impac s o aqua ic in asi e species: A e iew o
he li e a u e. NCEE Wo king Pape Se ies 05-02.
Ludyanskiy ML, McDonald D, Macneill D. 1993. Impac o he zeb a mussel, a bi al e
in ade - D eissena polymo pha is apidly colonizing ha d su aces h oughou
wa e ways o he Uni ed S a es and Canada. Bioscience 43: 533-544.
Mackie GL, Schloesse DW. 1996. Compa a i e biology o zeb a mussels in Eu ope and
No h Ame ica: An o e iew. Ame ican Zoologis 36: 244-258.
McMahon RF. 1977. Shell size equency dis ibu ions o Co bicula manilensis Philippi
om a clam ouled s eam condense .
McMahon RF. 1983. Ecology o an in asi e pes bi al e, Co bicula in Russel-Hun e WD,
ed. The Mollusca, ol. 6. London: Academic P ess, Inc.
Minchin D, Lucy F, Sulli an M. 2002. Zeb a mussel: impac s and sp ead. Pages 135-148
in Leppäkoski E, Gollasch S, Olenin S, eds. In asi e aqua ic species o Eu ope:
dis ibu ion, impac s and managemen . Do d ech : Kluwe Academic Publishe s.
Mo ais P, Teodósio J, Reis J, Chícha o MA, Chícha o L. 2009. The Asian clam Co bicula
luminea (Mülle , 1774) in he Guadiana Ri e Basin (Sou hwes e n Ibe ian
Peninsula): Se ing he eco d s aigh . Aqua ic In asions 4: 681.684.
Impac s - Chap e 4
109
Mou hon J. 1981. Su la p ésence en F ance e au Po ugal de Co bicula (Bi al ia,
Co biculidae) o iginai e d' Asie. Bas e ia 45: 109-116.
Pauno ić M. 2007. Dis ibu ion o Asian clams Co bicula luminea (Mülle , 1774) and C.
luminalis (Mülle , 1774) in Se bia. Aqua ic In asions 2: 99-106.
Pé ez-Quin e o JC. 2007. Di e si y, habi a use and conse a ion o eshwa e molluscs
in he lowe Guadiana Ri e basin (SW Ibe ian Peninsula). Aqua ic Conse a ion:
Ma ine and F eshwa e Ecosys ems 17: 485-501.
Pé ez-Quin e o JC. 2008. Re ision o he dis ibu ion o Co bicula luminea (Mülle 1744)
in he Ibe ian Peninsula. Aqua ic In asions 3: 355-358.
Phelps HL. 1994. The asia ic clam (Co bicula luminea) in asion and sys em-le el
ecological change in he Po omac Ri e es ua y nea Washing on, DC. Es ua ies 17:
614-621.
Pimen el D, Zuniga R, Mo ison D. 2005. Upda e on he en i onmen al and economic
cos s associa ed wi h alien-in asi e species in he Uni ed S a es. Ecological
Economics 52: 273-288.
P ezan RS, Chale mwa K. 1984. Flo a ion o he bi al e Co bicula luminea as a means
o dispe sal. Science 225: 1491-1493.
P okopo ich NP, He be DJ. 1965. Sedimen a ion in he Del a-Mendo a Canal. Jou nal
AWWA: 375-382.
Reis J. 2006. A las dos bi al es de água doce de Po ugal Con inen al. Lisboa: ICN.
Sakai AK, e al. 2001. The popula ion biology o in asi e species. Annual Re iew o
Ecology, E olu ion and Sys ema ics 32.
Schelle JL. 1997. The e ec o die-o s o asian clams (Co bicula luminea) on na i e
eshwa e mussels (Unionidae). Facul y o he Vi ginia Poly echnic Ins i u e and
S a e Uni e si y o Blacksbu g, Blacksbu g.
Shigesada N, Kawasaki K. 1997. Biological In asions - Theo y and P ac ice. Ox o d:
Ox o d Uni e si y P ess.
Sickel JB. 1986. Co bicula popula ion mo ali ies: ac o s in luencing popula ion con ol in
P ezan RS, ed. P oceedings o he Second In e na ional Co bicula Symposium,
Ame ican Malacological Bulle in - Special edi ion no.2.
Sinclai RM. 1964. Clam pes s in Tennessee wa e supplies. Jou nal Ame ican Wa e
Wo ks Associa ion: 592-599.

Impac s - Chap e 4
110
Sousa R, An unes C, Guilhe mino L. 2006. Fac o s in luencing he occu ence and
dis ibu ion o Co bicula luminea (Mülle , 1774) in he Ri e Lima es ua y. Annales
De Limnologie-In e na ional Jou nal o Limnology 42: 165-171.
Sousa R, An unes C, Guilhe mino L. 2007. Species composi ion and mon hly a ia ion o
he Molluscan auna in he eshwa e sub idal a ea o he Ri e Minho es ua y.
Es ua ine, Coas al and Shel Science 75: 90-100.
Sousa R, Noguei a A, Gaspa M, An unes C, Guilhe mino L. 2008a. G ow h and
ex emely high p oduc ion o he non-indigenous in asi e species Co bicula
luminea (Mülle , 1774): Possible implica ions o ecosys em unc ioning. Es ua ine,
Coas al and Shel Science 80: 289-295.
Sousa R, Ru ino M, Gaspa M, An unes C, Guilhe mino L. 2008b. Abio ic impac s on
spa ial and empo al dis ibu ion o Co bicula luminea (Mülle , 1774) in he Ri e
Minho es ua y, Po ugal. Aqua ic Conse a ion: Ma ine and F eshwa e Ecosys ems
18: 98-110.
Sp eche SL, Ge singe KD. 2000. Zeb a mussel chemical con ol guide. Vicksbu g:
En i onmen al Labo a o y.
Vi ousek PM, Dan onio CM, Loope LL, R. W. 1996. Biological in asions as global
en i onmen al change. Ame ican Scien is 84: 468-478.
Voelz NJ, McA hu JV, Rade RB. 1998. Ups eam mobili y o he Asia ic clam Co bicula
luminea: Iden i ying po en ial dispe sal agen s. Jou nal o F eshwa e Ecology 13:
39-45.
Vohmann A, Bo che ding J, Ku eck A, bij de Vaa e A, A nd H, Wei e e M. 2009. S ong
body mass dec ease o he in asi e clam Co bicula luminea du ing summe .
Biological In asions 12: 53-64.
Williams CJ, McMahon RF. 1986. Powe s a ion en ainmen o Co bicula luminea
(Mülle ) in ela ion o popula ion dynamics, ep oduc i e cycle and bio ic and abio ic
a iables. Pages 99-111 in B i on JC, ed. P oceedings o he Second In e na ional
Co bicula Symposium: Ame ican Malacological Bulle in - Special edi ion no.2.
CHAPTER 5
Sensi i y o he in asi e bi al e
Co bicula luminea o candida e
con ol chemicals: The ole o
dissol ed oxygen condi ions
Con ol - Chap e 5
113
Sensi i y o he in asi e bi al e Co bicula luminea o candida e con ol chemicals:
The ole o dissol ed oxygen condi ions
Inês C. Rosaa, Joana L. Pe ei ab, Fe nando Gonçal esb, Raquel Cos ab,*
aDepa men o Biology & CESAM – Cen e o En i onmen al and Ma ine S udies, Uni e si y o A ei o,
Campus de San iago, 3810-193 A ei o, Po ugal. Telephone: +351234 370 350. Fax: +351234 372 587.
bCIEPQPF-Resea ch Cen e o Chemical P ocess Enginee ing and Fo es P oduc s, Depa men o Chemical
Enginee ing, Uni e si y o Coimb a, Pólo II, Rua Síl io Lima, 3030-790 Coimb a, Po ugal. Telephone:
+351239798700. Fax: +351239798703.
*Co esponding au ho : [email p o ec ed].
- Rosa IC, Pe ei a JL, Gonçal es F & Cos a R. Sensi i y o he in asi e bi al e Co bicula luminea
o candida e con ol chemicals: The ole o dissol ed oxygen condi ions (in p epa a ion)
Con ol - Chap e 5
120
clams o oxygen dep i a ion as he esponse o o ganisms collec ed be o e and a e he
s o ms we e compa ed. S a is ical compa ison be ween hypoxia con ol ea men s o
es s made be o e and a e he s o m con i ms ha mo ali y o ju eniles was signi ican ly
lowe be o e he s o m (Fishe ’s exac es : p < 0.01) while he e seems o exis no
signi ican di e ence in he sensi i i y o adul clams o hypoxic condi ions (Fishe ’s exac
es : p = 0.314). Based on his analysis, esul s will be p esen ed and discussed
conside ing wo sepa a e g oups o chemicals: (i) niclosamide and polyDADMAC, which
we e es ed be o e he s o m, and (ii) coppe sul a e and ammonium ni a e, which we e
es ed a e he s o m.
The concen a ion- esponse cu es we e ound o gene ally i he p obi model
(Chi2: p > 0.05) and he cu es unde hypoxia and no moxia wi hin each chemical mos ly
p esen simila shape (Fig. 5.1), which sugges s educed in e ac ion be ween oxygen le el
and chemical concen a ion on he yielded e ec . This pa e n was co obo a ed by he
s a is ics (Table 5.1): signi ican in e ac ions we e only ound when ammonium ni a e was
es ed and when niclosamide was es ed agains adul clams. Al hough a signi ican
in e ac ion be ween ac o s was no equen ly no iced, bo h he concen a ion and he
oxygen le el consis en ly a ec ed clam mo ali y o all chemicals es ed and bo h clam li e
s ages - no e he excep ion o polyDADMAC es ed agains adul s, whe e oxygen le el did
no signi ican ly impai clam su i al.
Despi e he gene al lack o signi ican in e ac i e e ec be ween oxygen le el and
chemical concen a ion (Table 5.1), bo h ju eniles and adul s we e mo e sensi i e o he
chemicals unde hypoxia compa ed o no moxia as indica ed by he g aphical compa ison
o concen a ion-cu es in Fig. 5.1. This is pa icula ly e iden in he esponse o ju enile
clams o coppe sulpha e and less e iden bu s ill no iceable in he esponse o bo h
ju enile and adul clams o niclosamide (Fig. 5.1). Some speci ic pa e ns a e wo h
men ioning as Fig. 5.1 is sc u inized. Fo example, oxygen le el had a ele an ole in
de ining ju enile and adul clam mo ali y unde low ammonium ni a e concen a ions, bu
as he concen a ion inc eases he di e ence be ween he esponses unde di e en
oxygen le els dec eases. A simila da a p o ile was ound o he exposu e o adul clams
o coppe sulpha e. Da a on ju enile clam mo ali y exposed o niclosamide seem o
indica e he opposi e pa e n, hence indica ing a g owing e ec o he oxygen le el as
concen a ions inc ease; he same seems o apply o adul s exposed o polyDADMAC
al hough he ull concen a ion- esponse cu e (cu en ly he maximum e ec eco ded is
below 80% mo ali y) is necessa y o con i m he pa e n. Ju eniles we e signi ican ly less
suscep ible o niclosamide han adul s bo h unde no moxia and hypoxia while he
opposi e was eco ded ollowing exposu e o polyDADMAC unde hypoxia (Fig. 5.1, Table

Con ol - Chap e 5
121
5.2). Ju eniles we e signi ican ly mo e suscep ible o coppe sulpha e unde no moxia and
o ammonium ni a e unde bo h dissol ed oxygen condi ions (Fig. 5.1, Table 5.2).
ADULTS
JUVENILES
Niclosamide
0.0 0.5 1.0 1.5 2.0 2.5 3.0
Clam mo ali y (%)
0
20
40
60
80
100
0.0 0.5 1.0 1.5 2.0 2.5 3.0
**
*
*
*
NH4NO3
Concen a ion (mg L-1)
040 80 120 160 200 240 280 320
Clam mo ali y (%)
0
20
40
60
80
100
040 80 120 160 200 240 280 320
*****
*
****
*
**
0 2 4 6 8 10 12 14 16 18 20 22
CuSO4
0 2 4 6 8 10 12 14 16 18 20 22
Clam mo ali y (%)
0
20
40
60
80
100
**
**
*
*
0 5 10 15 20 25 30 35 40
Hypoxia
No moxia
Hypoxia p obi model
No moxia p obi model
PolyDADMAC
0 5 10 15 20 25 30 35 40
Clam mo ali y (%)
0
20
40
60
80
100
* * *
Fig. 5.1. Mo ali y (%) o ju enile (le -hand panel) and adul ( igh -hand panel) C. luminea
a e 96-h exposu e o niclosamide, polyDADMAC, coppe sul a e and ammonium ni a e
unde no moxic and hypoxic condi ions. The poin s e e o expe imen al da a (mean ±
SD) and he dashed lines ep esen he p obi model adjus ed o each da ase . As e isks
(*) ma k he chemical ea men s whe e mo ali y eco ds signi ican ly di e om he
co esponding con ol as indica ed by he Dunne es ollowing one-way ANOVA (p <
0.05; Table 2).
Con ol - Chap e 5
122
Table 5.1. Summa y o wo-way ANOVAs applied o add ess he e ec o oxygen le el
(no moxia and hypoxia) and chemical concen a ion in C. luminea ju enile and adul
mo ali y a e 96-h exposu e o niclosamide, polyDADMAC, coppe sul a e, and
ammonium ni a e. Signi ican e ec s (signi icance le el = 0.05) a e ma ked in bold.
Ju eniles
Adul s
Chemical
Sou ce
d
MS
F
P
MS
F
p
Niclosamide
Oxygen le el
1
2844.4
12.34
0.002
30044.4
235.13
< 0.001
Concen a ion
5
906.7
3.93
0.010
269.1
21.06
< 0.001
In e ac ion
5
277.8
1.20
0.337
71708
5.62
0.001
Residual
24
230.6
127.8
PolyDADMAC
Oxygen le el
1
3211.1
25.69
< 0.001
1002.8
3.28
0.083
Concen a ion
5
751.1
6.01
0.001
1631.7
5.34
0.002
In e ac ion
5
84.4
0.68
0.646
596.1
1.95
0.123
Residual
24
125.0
305.6
Coppe Sul a e
Oxygen le el
1
4444.4
17.98
< 0.001
27777.8
185.19
< 0.001
Concen a ion
5
2997.8
12.13
< 0.001
651.1
4.34
0.006
In e ac ion
5
511.1
2.07
0.105
117.8
0.79
0.570
Residual
24
247.2
150.0
Ammonium
Ni a e
Oxygen le el
1
5136.1
88.05
< 0.001
5625.0
29.35
< 0.001
Concen a ion
5
3362.8
57.65
< 0.001
1636.1
8.54
< 0.001
In e ac ion
5
469.4
8.05
< 0.001
671.7
3.50
0.016
Residual
24
58.3
191.7
The a ia ion in clam sensi i i y o he di e en chemicals es ed unde hypoxia
ela i ely o no moxia gene ally ollowed a consis en endency ega dless he ocus is on
ju eniles o adul s (Fig. 5.2): a low chemical concen a ions, dep essed oxygen
condi ions seem o de ine he esponse o he clams; howe e , as chemical concen a ion
becomes highe , he inc ease o clam sensi i i y unde hypoxia ela i ely o no moxia
ended o ze o, indica ing inc eased ele ance o he chemical a he han oxygen le el in
de e mining he e ec . Fo es s wi h niclosamide (adul s), polyDADMAC (ju eniles),
coppe sul a e (ju eniles and adul s) and ammonium ni a e (adul s) he e was an
accen ua ed dec ease in he inc emen o clam mo ali y unde hypoxia ela i ely o
no moxia as concen a ions inc ease un il eaching a i s h eshold.
Con ol - Chap e 5
123
Table 2: Summa y o one-way ANOVAs applied o add ess he main e ec s o chemical
concen a ion wi hin each oxygen le el, in C. luminea ju enile and adul mo ali y a e 96-
h exposu e o niclosamide, polyDADMAC, coppe sul a e, and ammonium ni a e.
Signi ican e ec s (signi icance le el = 0.05) a e ma ked in bold.
Ju eniles
Adul s
Chemical
Sou ce
d
F
p
d
F
p
Hypoxia
Niclosamide
Concen a ion
5
4.15
0.02
5
6.22
< 0.001
Residual
12
24
PolyDADMAC
Concen a ion
5
3.51
0.035
5
2.10
0.136
Residual
12
12
Coppe Sul a e
Concen a ion
5
2.72
0.072
5
3.89
0.025
Residual
12
12
Ammonium
ni a e
Concen a ion
5
13.13
< 0.001
5
1.23
0.326
Residual
24
24
No moxia
Niclosamide
Concen a ion
5
0.87
0.532
5
20.45
< 0.001
Residual
12
24
PolyDADMAC
Concen a ion
5
3.06
0.052
5
7.25
0.002
Residual
12
12
Coppe Sul a e
Concen a ion
5
12.22
< 0.001
5
1.65
0.221
Residual
12
12
Ammonium
ni a e
Concen a ion
5
52.60
< 0.001
5
10.81
< 0.001
Residual
24
24
Then, he cu es e idence a lowe slope and inally, as highe concen a ions a e
eached, he endency o null slopes can be obse ed deno ing e y li le sensi i i y
inc emen unde hypoxia ela i ely o no moxia. A sligh a ia ion in his pa e n was
obse ed o niclosamide and ammonium ni a e es ed agains ju enile clams. As
polyDADMAC was es ed agains adul clams, dissol ed oxygen le el seems o ha e an
almos i ele an ole in p omo ing adul clam mo ali y, being chemical concen a ion he
ac o ha seems o cons ain he e ec ac oss he whole ange, which is consis en wi h
he s a is ics (Table 5.1).
Con ol - Chap e 5
124
Concen a ion Niclosamide (mg L-1)
1 2 3 4 5 6 7 8 9
Niclosamide
Concen a ion PolyDADMAC (mg/L)
1e+4 2e+4 3e+4 4e+4 5e+4 6e+4
PolyDADMAC
JUVENILES ADULTS
2 4 6 8 10 12 14 16
Ra io
0
1
2
3
20 40 60 80 100 120 140 160 180
2.0e+4 4.0e+4 6.0e+4 8.0e+4 1.0e+5 1.2e+5
Ra io
0
1
2
3
5e+4 1e+5 2e+5 2e+5 3e+5 3e+5
Concen a ion CuSO4 (mg/L)
100 200 300 400 500 600 700 800
CuSO4
Concen a ion NH4NO3 (mg L-1)
50 100 150 200 250 300
NH4NO3
Fig. 5.2. Cu es ep esen ing he inc emen in chemical-d i en mo ali y o ju enile (le -
hand panel) and adul ( igh -hand panel) C. luminea. The cu es we e gi en by he a io
(H-N)/N, whe e H and N ep esen s clam mo ali y unde hypoxia and no moxia,
espec i ely (see “Da a analysis” o de ails). The igu e g oups compa able chemicals
conside ing he o ganism’s collec ion pe iod (see ex o de ails): niclosamide wi h
polyDADMAC (uppe panels) and coppe sul a e wi h ammonium ni a e (lowe panels).
Con ol - Chap e 5
125
5.5. Discussion
Se e al chemicals ha e been obse ed o ha e g ea e e icacy o con ol bio oule s a
highe ambien empe a u es (Mackie and Claudi 2010). Highe sensi i i y o some
con aminan s unde hypoxia has also been p o en o occu o some mac o oule species
including C. luminea (T an e al. 2001, T an e al. 2008). In si es (pa icula ly in len hic
sys ems) whe e na u al Asian clam popula ions es ablish, scena ios o oxygen dep i a ion
oge he wi h chemical con amina ion a e likely o occu and end o be common gi en he
ac ual con ex o global clima e change and inc eased man-d i en con amina ion
p essu ing eshwa e ecosys ems wo ldwide (Cloe n and Jassby 2012, Diaz 2001). On
he o he hand, in pa icula indus ial en i onmen s, hypoxia can be used o inc ease
chemical e iciency con ibu ing o he imp o emen o bio ouling con ol measu es,
al hough gi en he cos s in ol ed only speci ic sys ems would p obably conside he use
o such a demanding solu ion. In his con ex , he p esen s udy p o ides sys ema ic
in o ma ion which allows concluding on he abili y o hypoxia condi ions o change C.
luminea sensi i i y o candida e con ol chemicals wi h di e en modes o ac ion. This
baseline in o ma ion allows o in e on whe he in e media e le els o dissol ed oxygen,
which a e mo e common in na u al in aded sys ems o less cos ly o achie e in in es ed
indus ial sys ems when compa ed wi h anoxia, a e wo h in es iga ing in he u u e. The
esul s o he p esen s udy indica e ha , in gene al, oxygen deple ion inc eases he
e iciency o biocides agains he Asian clam, conside ing he mo ali y o ju enile and
adul labo a o y popula ions unde sho - e m exposu e condi ions.
Bo h niclosamide and polyDADMAC ha e been assumed o exe oxici y in
biological ma ices h ough he impai men o cellula espi a ion: niclosamide was p o en
o a ec he espi a o y me abolism o snail pes s possibly by induc ion o mi ochond ia
agmen a ion (Pa k e al. 2011, WHO 2002) whe eas polyDADMAC is expec ed o cause
dis up ion o memb ane ans e mechanisms which may in luence cellula gas exchange
p ocesses (Pos e al. 1997). Despi e he simila i ies in he chemical’s mechanism o
oxici y, oxygen le el seems o in luence hei e iciency agains he Asian clam a di e en
scales. In ac , he esul s indica e ha hypoxia le els con ibu ed mo e o he e iciency o
niclosamide han o he e iciency o polyDADMAC ega dless he concen a ions ocused.
Niclosamide is a molluscicide designed o ac o e a e y speci ic physiological a ge
while polyDADMAC is a locculan ha is expec ed o impai he espi a o y me abolism by
gene ally cons aining gas exchange ac oss biological memb anes. The di e ences in he
speci ici y o he biocides a ge wi hin he o ganism may explain he a ia ion in he
e iciency o dep essed oxygen le els in p omo ing he biocide e ec s. Bo h candida e
biocides ha e g ea po en ial o be used in eg a ed in managemen p ac ices a ge ed a

Con ol - Chap e 5
126
he Asian clam. Niclosamide is sho -li ed in wa e (WHO 2002) which cons i u es a majo
s imulus o i s use; polyDADMAC is al eady used in he wa e ea men indus y as a
locculan (A i in e al. 2012) and hus ad an ages may a ise om i s use as a mul iple
unc ion chemical. Howe e , one should ecognise ha only high concen a ions o
polyDADMAC deli e he ele an e iciency le els, e en when hypoxia condi ions a e se
in pa allel o chemical dosage (concen a ions as high as 3000 mg L-1 and 4000 mg L-1
esul ed in less han 40 and 80% mo ali y o ju eniles and adul s, espec i ely, in he
p esen s udy). Acco ding o o me da a on he en i onmen al selec i i y o his locculan
(Gomes e al., submi ed), polyDADMAC elici s nega i e e ec s in s anda d indica o
species (Pseudoki chne iella subcapi a a and Daphnia magna) a lowe concen a ions,
hus indica ing i s haza dous po en ial.
Al hough bo h coppe sulpha e and ammonium ni a e showed inc eased e iciency
unde dep i ed oxygen condi ions, he o me was e ec i e a concen a ions one o de o
magni ude lowe han he la e . The chemical’s mechanism o oxici y may also ha e
played i s ole in dis inguishing he chemicals as o hei e iciency inc ease unde hypoxia
condi ions (pa icula ly e iden as he esponse o adul clams is compa ed). Bo h coppe
and hypoxia a e induce s o oxida i e s ess wi h he ollowing s uc u al, pa hological and
unc ional damage occu ing equen ly (Li ings one 2001, Lushchak 2011). In o ganisms
lacking haemoglobin, which seems o be he case o C. luminea (T an e al. 2000), he
mechanism o oxici y o ammonium ni a e should be coinciden wi h he mechanism o
oxici y o unionized ammonia, i.e., damage in he gill epi helium, s imula ion o glycolisis,
supp ession o K ebs cycle, and uncoupling oxida i e phospho yla ion (Cama go and
Alonso 2006). These e ec s link o he oxygen me abolism bu e en ually no as di ec ly
as he in e e ence in eac i e oxygen species balance does, hence he lowe e iciency o
he ea men wi h ammonium ni a e compa ed o coppe sulpha e.
Coppe has a e y long his o y o use as an an i oulan and i s dosage is s ill
conside ed one o he mos e ec i e and p ac ical me hods o p e en ing ouling in
subme ged s uc u es (e.g. by i s use as an i ouling ink) (Piola e al. 2009). I s high oxici y
o he Asian clam has al eady been egis e ed (Ma ice 1983) and es ing o i s po en ial
as a chemical con ol me hod o his bio oule has al eady been ca ied ou (Ing am
1959). LC50 alues calcula ed wi h he esul s o he p esen s udy (da a no shown) and
eco ded in o he s udies (Ma ice 1983) e eal ha concen a ions be ween 0.94 mg L-1
and 6.77 mg L-1 a e e ec i e agains adul clams ollowing 96 h o exposu e. Howe e ,
Ing am (1959), e e s ha , in he ield, much highe concen a ions (750 mg L-1) a e
necessa y o con ol C. luminea popula ions. The e o e, al hough coppe sul a e seems a
good candida e o in eg a e con ol p og ams o he Asian clam, u he s udies
Con ol - Chap e 5
127
conside ing la ge -scale assessmen and accoun ing o he chemical en i onmen al
selec i i y should be en isaged. Despi e i s appa en ly lowe e iciency agains he Asian
clam, ad an ages may also come om he use o ammonium ni a e as a biocide
pa icula ly in open wa e s al eady con amina ed wi h his chemical due o i is use in
ag icul u al ac i i ies (Mackie and Claudi 2010)
Because he comple e da ase o his s udy could no be p esen ed he e (see he
In oduc ion sec ion), only he clam’s esponses o chemicals exe ing oxici y o e he
espi a o y me abolism can be discussed. Al hough he e ec s esul om he chemical’s
ac ion in a ge s o di e en physiological speci ici y, all e e o he same gene al
me abolic pa hway, which p e en s deepe analysis on whe he dis inc mechanisms o
oxici y play a ole in de ining he way oxygen condi ions a ec he esponses o he
chemical challenges.
Di e ences be ween indi iduals o di e en li e-s ages in chemical ole ance ha e
been epo ed by some s udies conside ing he Asian clam (e.g. Belange e al. 1991,
McMahon and Lu ey 1988). Ou esul s we e in acco dance, wi h di e en ial sensi i i y o
he es condi ions ju eniles/young adul s and olde clams being consis en ly ound.
Di e en sys ems may be impac ed by di e en C. luminea li e-s ages, e.g. indus ial
s aine s only allow he en ance o ju enile clams. In hese cases, and acing he
di e ences in sensibili y o es condi ions, s akeholde s mus p io i ize in o ma ion on
ju enile clams a he han on adul s.
Hypoxia in na u al wa e s can be o spon aneous o igin (e.g. seasonal
s a i ica ion), bu mos o he imes i esul s om human ac i i ies (Ha ink e al. 2005).
When conside ing indus ial en i onmen s, oxygen dep i a ion may be accomplished by
adding an oxygen-sca enging chemical in o a closed sys em (e.g. Smi hson 1986) o by
keeping a s a ic sys em (e.g. pipeline) o a su icien ime pe iod (Mackie and Claudi
2010). Howe e , indus ial me hods o achie e hypoxia a e no always easible, may
equi e e y long applica ion imes, and poo oxygen le els o en esul in a d ama ic
inc ease o sul a e- educing bac e ia which in u n causes co osion o he ma e ials
(Johnson and McMahon 1998, Mackie and Claudi 2010). The e o e, s akeholde s mus
ca e ully e alua e i he cos s and impai men s o employing oxygen dep i a ion
compensa e he bene i s in pes managemen in each pa icula case. When dealing wi h
chemical applica ion, o he conce ns mus be aken in o accoun pa icula ly in na u al
en i onmen s o when ea ed wa e is o be discha ged in o neighbo ing wa e ways
(Mackie and Claudi 2010): chemicals and/o hei by-p oduc s can be highly oxic o non-
a ge o ganisms damaging he ecosys em. En i onmen al sa e y should hence be always
an addi ional ac o o he equa ion when managing in asi e species. Some ules ha
Con ol - Chap e 5
128
apply o he sa e use o chemical con ol include i s use in limi ed se ings (i.e. closed
sys ems o unde s a ic condi ions) and/o conjuga ed wi h speci ic emedia ion s a egies
(e.g. applica ion o ben oni e clay o ans o m he ac i e ing edien , he eby ende ing i
non oxic) be o e discha ging in o he wa e ways (Fishe e al. 1991 , Mackie and Claudi
2010).
5.6. Re e ences
Ande son KB, Thompson CM, Spa ks RE, Papa o AA. 1976. E ec s o po assium on adul
Asia ic clams, Co bicula manilensis. Biological No es. Illinois Na u al His o y Su ey
98: 3-7.
A aujo R, Mo eno D, Ramos MA. 1993. The Asia ic clam Co bicula luminea (Mülle ,
1774) (Bi al ia: Co biculidae) in Eu ope. Ame ican Malacological Bulle in 10: 39-49.
A i in A, Razali MAA, Ahmad Z. 2012. PolyDADMAC and polyac ylamide as a hyb id
loccula ion sys em in he ea men o pulp and pape mills was e wa e . Chemical
Enginee ing Jou nal 179: 107-111.
Ba ino a SS, Yehuda G, Ne o E. 2010. Compa a i e analysis o algal communi ies in he
i e s o no he n and sou he n Is ael as bea ing on ecological consequences o
clima e change. Jou nal o A id En i onmen s 74: 765-776.
Beasley CR, Taglia o CH, Figuei edo WB. 2003. The occu ence o he Asian clam
Co bicula luminea in he lowe Amazon Basin. Ac a Amazonica 33: 317-324.
Belange SE, Che y DS, Fa is JL, Sapping on KG, Cai ns J. 1991. Sensi i i y o he
asia ic clam o a ious biocidal con ol agen s. Jou nal Ame ican Wa e Wo ks
Associa ion 83: 79-87.
Bel an KS, Pocsidio GN. 2009. Ace ylcholines e ase ac i i y in Co bicula luminea Mülle ,
as a bioma ke o o ganophospha e pes icide pollu ion in Pinacanauan Ri e ,
Philippines. En i onmen al Moni o ing and Assessmen 165: 331-340.
Cama go JA, Alonso A. 2006. Ecological and oxicological e ec s o ino ganic ni ogen
pollu ion in aqua ic ecosys ems: A global assessmen . En i onmen In e na ional 32:
831-849.
Daum KA, Newland LW, B i on JC, Champagne L, Hagen J. 1977. Responses o
Co bicula o po assium. Fi s In e na ional Co bicula Symposium. Fo Wo h, Texas,
USA: Texas Ch is ian Uni e si y.
Con ol - Chap e 5
129
Diaz RJ. 2001. O e iew o hypoxia a ound he wo ld. Jou nal o En i onmen al Quali y
30: 275-281.
Dohe y FG, Fa is JL, Che y DS, Cai ns J . J. 1986. Con ol o he F eshwa e Fouling
Bi al e Co bicula luminea by Halogena ion. A chi es o En i onmen al
Con amina ion and Toxicology 15: 535-542.
Dohe y FG, Che y DS. 1988. Tole ance o he asia ic clam Co bicula spp. o le hal le els
o oxic s esso s - a e iew. En i onmen al Pollu ion 51: 269-313.
Finney D. 1971. P obi Analysis. Camb idge, UK: Camb idge Uni e si y P ess.
Fishe SW, Be na d DO. 1991. Me hods o e alua ing zeb a mussel con ol p oduc s in
labo a o y and ield s udies. Jou nal o Shell ish Resea ch 10: 367-371.
Hakenkamp CC, Palme MA. 1999. In oduced bi al es in eshwa e ecosys ems: he
impac o Co bicula on o ganic ma e dynamics in a sandy s eam. Oecologia 119:
445-451.
Johnson PD, McMahon RF. 1998. E ec s o empe a u e and ch onic hypoxia on
su i o ship o he zeb a mussel (D eissena polymo pha) and Asian clam (Co bicula
luminea). Canadian Jou nal o Fishe ies and Aqua ic Sciences 55: 1564-1572.
Lushchak VI. 2011. En i onmen ally induced oxida i e s ess in aqua ic animals. Aqua ic
Toxicology 101: 13-30.
Mackie GL, Claudi R. 2010. Moni o ing and con ol o mac o ouling mollusks in esh
wa e sys ems. Boca Ra on, FL: CRC P ess.
Ma hews MA, McMahon RF. 1999. E ec s o empe a u e and empe a u e acclima ion
on su i al o zeb a mussels (D eissena polymo pha) and Asian clams (Co bicula
luminea) unde ex eme hypoxia. Jou nal o Molluscan S udies 65: 317-325.
Ma ice JS. 1983. F eshwa e mac o ouling and con ol wi h emphasis on Co bicula.
Pages 1-30 in Diaz-Tous IA, Mille MJ, Mussalli IG, eds. Symposium on Condense
Mac o ouling Con ol Technologies: The S a e o he A . Cali o nia, USA: Elec ic
Powe Resea ch Ins i u e.
Page T, Nei zel D, Simmons M. 1986. Bio ouling o powe plan se ice sys ems by
Co bicula in B i on JC, ed. P oceedings o he Second In e na ional Co bicula
Symposium: Ame ican Malacological Bulle in - Special edi ion no.2.