The asian clam-dispersal, impacts and potential benefits

THE ASIAN CLAM: DISPERSAL, IMPACTS AND POTENTIAL BENEFITS INÊS CORREIA ROSA Tese de Doutoramento em Ciências do Mar e do Ambiente 2013 THE ASIAN CLAM: DISPERSAL, IMPACTS AND POTENTIAL BENEFITS Tese de Candidatura ao grau de Doutor em Ciências do Mar e do Ambiente Especialidade em Oceanografia e Ecossistemas Marinhos submetida ao Instituto de Ciências Biomédicas de Abel Salazar da Universidade do Porto. Programa Doutoral da Universidade do Porto (Instituto de Ciências Biomédicas de Abel Salazar e Faculdade de Ciências) e da Universidade de Aveiro. Orientador – Doutor Fernando Gonçalves Categoria – Professor Associado com Agregação Afiliação – Departamento de Biologia & Centro de Estudos do Ambiente e do Mar, Universidade de Aveiro Co-orientadora – Doutora Raquel Costa Categoria – Investigadora Auxiliar Afiliação – Centro de Investigação Engenheira dos Processos Químicos e dos Produtos da Floresta, Departamento de Engenharia Química, Universidade de Coimbra Co-orientadora – Doutora Joana Pereira Categoria – Estagiária de Pós Doutoramento Afiliação – Departamento de Biologia & Centro de Estudos do Ambiente e do Mar, Universidade de Aveiro LEGAL DETAILS In compliance with what is stated in Decree-Law nº 216/92 of October 13th, it is hereby declared that the author of this thesis participated in the creation and execution of the experimental work leading to the results here stated, as well as in their interpretation and writing of the respective manuscripts. This thesis includes two scientific papers published in international journals, one submitted article and two articles in preparation originated from part of the results obtained in the experimental work referenced as: - Rosa IC, Pereira JL, Costa R, Gonçalves F & Prezant R (2012) Effects of upper-limit water temperatures on the dispersal of the Asian clam Corbicula fluminea. PLoS ONE 7(10): e46635. doi:10.1371/journal.pone.0046635 - Rosa IC, Pereira JL., Gomes J, Saraiva PM, Gonçalves F & Costa R (2011) The Asian clam Corbicula fluminea in the European freshwater-dependent industry: A latent threat or a friendly enemy? Ecological Economics 70: 1805-1813. doi: 10.1016/j.ecolecon.2011.05.006 - Rosa IC, Costa R, Gonçalves F & Pereira JL. Bioremediation of a metal rich efluente by the invasive bivalve Corbicula fluminea. Water Research (submitted) - Rosa IC, Gomes J, Pereira ML, Pereira JL, Costa R & Gonçalves F. Dispersal of Corbicula fluminea: Factors influencing the invasive clam’s drifting behavior. Freshwater Biology (submitted). - Rosa IC, Pereira JL, Gonçalves F & Costa R. Sensivity of the invasive bivalve Corbicula fluminea to candidate control chemicals: The role of dissolved oxygen conditions (in preparation) Mais uma vez, às minhas avós… Se pelo menos pudéssemos viver duas vezes: a primeira vez, para cometer todos os inevitáveis erros; a segunda para lucrar com eles David Lawrence TABLE OF CONTENTS Acknowledgements ………………………………………………….…………………………… i Summary …………………………………………………………………………………………. iii Resumo …………………………………………………………………………………………… v Introductory note ………………………………………………………………………………... vii CHAPTER 1: Biological invasions: The general theory and the particular case of Corbicula fluminea.......................................................................................................... 1 1.1. Biological invasions as a global threat .................................................................... 3 1.2. Biology, impacts and control of the Asian clam C. fluminea .................................... 6 1.2.1. Taxonomy ........................................................................................................ 6 1.2.2. Reproduction, life cycle and population structure ............................................. 8 1.2.3. Habitat and feeding preferences .....................................................................10 1.2.4. Current distribution and vectors of dispersal ...................................................11 1.2.5. Invasion success .............................................................................................11 1.2.6. Impacts ...........................................................................................................12 1.2.7. Control ............................................................................................................14 1.3. References ............................................................................................................18 CHAPTER 2: Effects of upper-limit water temperature on the dispersal of the Asian clam Corbicula fluminea ...............................................................................................29 2.1. Abstract .................................................................................................................32 2.2. Introduction ...........................................................................................................33 2.3 Material and methods .............................................................................................35 2.3.1. Corbicula fluminea collection and maintenance ..............................................35 2.3.2. Exposure conditions ........................................................................................36 2.3.3. Histological procedures and microscopic analysis ...........................................37 2.3.4. Flotation behavior ...........................................................................................38 2.3.5. Statistical analysis ...........................................................................................38 2.4. Results ..................................................................................................................39 2.5. Discussion .............................................................................................................45 2.6. Acknowledgements ...............................................................................................49 2.7. References ............................................................................................................50 CHAPTER 3: Dispersal of Corbicula fluminea: Factors influencing the invasion clam’s drifting behavior ................................................................................................57 3.1. Abstract .................................................................................................................60 3.2. Introduction ...........................................................................................................61 __________ iv offs occurring in populations established in waterbodies across the country. The documentation of the species’ impacts in Portugal may assist official entities on the implementation of integrated management policies in countries at risk of invasion or where the pest has recently arrived. As the relevance of continuing the search for more efficient control solutions for the Asian clam was recognized, the potential of combining biocide application with depressed oxygen conditions was investigated. Preliminary results suggest that hypoxia increases the efficiency of some biocides, which establishes the grounds for future research using intermediate, more suitable, levels of dissolved oxygen combined with selected biocides. Finally, and provided the shortcomings that still exist in available control solutions for the Asian clam and the recognition that the pest may be of hard, if not impossible, eradication from fouled systems, the potential for its use as bioremediation tool was explored using a metal-bearing effluent as an experimental model. The species was able to remove a significant fraction of the effluent metals, which translated into a confirmed decrease of its environmental toxicity. The potential of C. fluminea as a bioremediator for industrial effluents opens an avenue for offsetting the damaging effects of established infestations. __________ v RESUMO As espécies invasoras são atualmente uma das maiores ameaças ambientais devido aos seus impactos negativos tanto a nível ecológico como económico. A amêijoa de água doce Corbicula fluminea, também conhecida por amêijoa asiática, está entre as espécies invasoras mais preocupantes – está atualmente presente em praticamente todo o mundo e, a juntar aos seus impactos negativos perpetrados em ecossistemas invadidos, o estabelecimento de populações tem consequências perniciosas nas indústrias dependentes de água doce devido à sua atividade de biofouling. O conhecimento sobre a gestão e controlo desta espécie tem aumentado bastante durante as últimas décadas, a par com o aumento da sua dispersão e impactos. No entanto, são várias as questões que se mantêm sem resposta e a mitigação do dano de uma forma efetiva e aceitável do ponto de vista ambiental permanece ainda como um desafio. Particularmente em Portugal, a porta de entrada de C. fluminea na Europa há 30 anos, existem lacunas na monitorização sistemática da dispersão desta invasora. A presente tese fornece informação no contexto da problemática das invasões pela amêijoa asiática, recorrendo a uma abordagem holística do processo invasor de modo a cobrir aspetos como a dispersão, os impactos e o controlo da espécie. Os estudos aqui incluídos apresentam relevância a nível local, na medida em que se centram na distribuição atual e impactos nas indústrias em Portugal. A um nível mais geral, foi também gerado novo conhecimento científico que pode ser aplicado no sentido de melhorar a gestão da invasora. Neste contexto, os mecanismos de dispersão, o melhoramento de métodos de controlo e a possibilidade de tirar proveito do invasor foram investigados. A dispersão da espécie foi estudada examinando a influência das alterações ambientais (o aumento da temperatura foi usado como modelo) no movimento de “flutuação” acima do substrato da amêijoa em estádios iniciais de vida, bem como o papel desempenhado por aspetos genéticos e pela sazonalidade na produção do muco que promove esse movimento. Os resultados sugerem que a “flutuação” é estimulada pelo aumento da temperatura. Por outro lado, os dados não permitem confirmar a ideia generalizada de que a produção do muco está relacionada com fenómenos sazonais, sendo que fenómenos de adaptação local são apontados como uma causa provável para a discrepância sinalizada. A informação sobre o movimento de “flutuação” é essencial para se caracterizar em maior detalhe a dispersão da espécie, permitindo eventualmente desenvolver estratégias de prevenção nesse sentido. Em seguida, os impactos de C. fluminea nas indústrias portuguesas dependentes de água doce e a sua atual distribuição __________ vi no país foram estudados. Apesar da amêijoa asiática estar presente em Portugal desde os anos 80, verificou-se que a sua dispersão é ainda limitada e que os impactos económicos da espécie permanecem relativamente moderados. Tal cenário poderá ser explicado pelo facto de a invasão ainda estar na fase estacionária (fase lag) que precede o rápido crescimento das populações nos locais invadidos ou pela ocorrência de fenómenos de mortalidade massivas características de C. fluminea e que ocorrem em populações já estabelecidas no país. A documentação dos impactos desta espécie em Portugal pode auxiliar entidades oficiais na implementação de políticas de gestão integrada em países que se encontrem em risco de invasão ou onde a peste chegou recentemente. Reconhecendo a relevância de continuar a procurar soluções de controlo mais eficientes para a amêijoa asiática, foi investigado o potencial da aplicação de biocidas em combinação com condições de baixo oxigénio dissolvido. Os resultados preliminares sugerem que a hipoxia aumenta a eficácia de alguns biocidas, o que proporciona caminhos futuros para a investigação, nomeadamente abordando níveis de oxigénio intermédios em combinação com biocidas. Finalmente, e tendo em conta as lacunas que ainda existem nas soluções de controlo disponíveis, assim como as dificuldades associadas à erradicação da peste de sistemas afetados, foi explorado o potencial de C. fluminea para ser usado como ferramenta de bioremediação usando um efluente rico em metais como modelo experimental. A amêijoa removeu uma fração significativa de metais do efluente, o que se traduziu na diminuição da sua toxicidade ambiental. O potencial de C. fluminea como bioremediadora de efluentes industriais abre portas para de alguma forma compensar os efeitos nocivos das infestações já estabelecidas. __________ vii INTRODUCTORY NOTE Biological invasions are a growing worldwide threat to the ecological and economic well-being of the planet. Invasion starts with the introduction of a non-indigenous species into a new habitat, which is generally promoted by the human action. The invasive process then proceeds through a serious of sequential stages until a stable population is established. During this process, invaded ecosystems and human-made structures tend to be significantly damaged, the reason why adequate management strategies have to be applied. The freshwater clam Corbicula fluminea, commonly known as the Asian clam, is amongst the most serious invasive species due to its ecological impacts and biofouling activity. The species is presently spread from its Asiatic native range across all over the world. While the body of knowledge on C. fluminea biology, impacts and management greatly enlarged over the past 40 years, many questions remain unsolved and there is still room for improving pest monitoring and control programmes. In particular, in Portugal, a gateway through which the species entered Europe 30 years ago, integrated management of potential threatens posed by the C. fluminea invasion have been somewhat neglected. In this context, this thesis had a twofold aim. First, and considering the insipiency of local (i.e. national-wide) pest management strategies targeted at the Asian clam, this thesis intends to update the information on the distribution and economic impacts of the Asian clam in Portugal. Second, this thesis intends to generate new knowledge that support the design of improved management practices, with the focus given: (i) to particular aspects of the species biology that can explain dispersal patterns; (ii) to the species tolerance to chemical and physical treatment; (iii) to the bioremediation abilities as beneficial service that the species can provide. The Asian clam problematics has thus been addressed from a holistic perspective, covering a range of pest management-related topics, including the species dispersal, potential impacts due to the invasion of in new areas, control of established populations and the possibility of taking profit from the presence of the invader when accepting it becomes unavoidable (Figure I.1). Consistently with such a perspective, the thesis is organized in seven chapters being the central five distributed by these four main topics as represented in Figure I.1. Chapter 1 defines and describes fundamental concepts within the context of biological invasions. Such background information frames the problematics of invasive species and the rationale behind the holistic perspective adopted in this thesis. Chapter 1 also presents the Asian clam as one of the world’s most important invasive species, reviewing the species’ major biological features, its dispersal, its impacts and the methods __________ viii currently in use to control the bivalve. This chapter thus provides general information supporting the subsequent chapters. Chapters 2 to 6 constitute the main body of the thesis in the sense that they present actual research results. These chapters were formatted as journal articles – some have already been published, some were submitted to peer-reviewed journals and one is awaiting submission until additional data can be integrated – and therefore some conceptualization notes, rationale description, methods detailing and literature-based discussion parts can be found repeated across them. Dispersal is a determinant step in any biological invasion process. It has been proven that a mucous-assisted flotation behavior constitutes an important mode of dispersal in C. fluminea. Understanding the factors influencing the production of such mucous and related clams’ drifting mechanism may thus provide relevant information for pest management. Chapters 2 and 3 address this topic, with Chapter 2 studying the influence of temperature in the clams’ flotation behavior, and Chapter 3 investigating whether genetic or seasonal factors affect the mucous production process. One of the main concerns related to invasive species is the impacts they are responsible for. In the case of biofoulers such as C. fluminea, not only ecological, but also economic losses due to their presence in human-made structures and the industrial environment have to be considered. Since the introduction of C. fluminea in Portugal, a wide range of ecological impacts have been reported in freshwater ecosystems. However, the damage caused by the species at the industrial level has not been systematically documented. Chapter 4 provides such documentation along with information on the bivalve’s current distribution in Portugal. As the effective and environmentally friendly mitigation of Asian clam populations remains a challenge, chapter 5 intends to contribute to the search of improved control solutions by examining the potential of combining biocide application with hypoxic conditions. Frequently, the eradication of established Asian clam populations is unachievable. The possibility of taking profit from the pest could thus offset its damaging impacts. In chapter 6, this idea is explored by assessing the use of C. fluminea as a bioremediation tool applied to metal-bearing effluent treatment. Finally, in chapter 7, concluding remarks on the different studies and on their integration, as well as future directions for the research following this thesis are presented. __________ ix Background information Species dispersal Impacts Control Taking profit from the pest Chapter 1 Biological invasions: The general theory and the particular case of Corbicula fluminea Chapter 2 Effects of upperlimit water temperatures on the dispersal of the Asian clam Corbicula fluminea Chapter 4 The Asian clam Corbiculafluminea in the European freshwaterdependent industry: A latent threat or a friendly enemy? Chapter 5 Sensivityof the invasive bivalve Corbicula fluminea to candidate control chemicals: The role of dissolved oxygen conditions Chapter 6 Bioremediation of a metal-rich effluent by the invasive bivalve Corbicula fluminea Chapter 3 Dispersalof Corbiculafluminea: Factorsinfluencing the invasiveclam’s driftingbehavior Final considerations Figure I.1: Roadmap for this dissertation. CHAPTER 1 Biological invasions: The general theory and the particular case of Corbicula fluminea Background information - Chapter 1 8 1.2.2. Reproduction, life cycle and population structure C. fluminea is a hermaphroditic and androgenetic species (Kraemer and Lott 1977, Park and Chung 2004, Pigneur et al. 2011, Rajagopal et al. 2000) and, although selffertilization has been observed, cross-fertilization seems to be the most common in this species (Kraemer and Galloway 1986, Park and Chung 2004). Contrasting with other hermaphroditic bivalve mollusks, the Asian clam is proto-oogamous and oogenesis is initiated before spermatogenesis (Britton and Morton 1982). In general, sexual maturity is reached within the first year following spawning, generally at a shell length of 10 mm (Ituarte 1985, Mouthon 2001b). In mature clams, incubation and spawning occurs in the inner demibranchs of the gills (King et al. 1986). After fertilization and early cell divisions, a trocophore is formed which evolves into a straight-hinged stage that then develops into a pediveliger stage (100-112 h after spawning) (King et al. 1986). Then, juveniles (length mean ± SD: 221 ± 10 µm) are released out of the gills into the water, already shelled and with adductor muscles, foot, statocysts, gills, and digestive system fully formed (King et al. 1986, McMahon 2002). Juveniles are well adapted to the benthic compartment and the species hence lack a planktonic stage (King et al. 1986, Phelps 1994). Juveniles are released in large quantities (up to 700 juveniles clam-1 day-1 (Aldridge and McMahon 1978)) but high mortality rates during the first three weeks are common (Britton 1982, King et al. 1986). They present a very high growth rate (shell length as large as 29 mm reached within the first year of growth (Aldridge and McMahon 1978)), which is partly due to their higher filtration and assimilation rate compared to older organisms (McMahon 2002). C. fluminea presents a wide range of intraspecific variation in life-history traits and in the population structure patterns as assessed in different sites (Table 1.2). When considering populations mostly composed by adult clams, maximum shell length ranges between 19 and 51.6 mm. Seasonal variation can be observed in population densities, with different studies indicating maximum densities ranging between 60 and 16.198 clams m-2. Life span is in general 2-3 years however, some studies reported populations with longevity of 5 years. During their life span, clams seem to reproduce once or twice a year. In the cases where only one recruitment event was reported, it occurred from early summer to early autumn depending on the population. In cases where two recruitment events were observed, they occurred in spring/early summer, and again in late summer/autumn, which means that juveniles born in the spring can contribute to the immediately following autumn reproductive event. Differences in the annual number of Background information - Chapter 1 9 Table 1.2. Summary of shell length, density, life span and recruitment events found for several C. fluminea populations in different studies. The study site location, sampling date and water temperature range are also shown. This summary result from a thorough literature search and only studies reporting data on at least 4 of the columns were considered. Study Study site Sampling date Water temperature range (ºC) SL range (mm) Clam density (clams m-2) Recruitment events Life span (years) Number Time of the year Aldridge and McMahon 1978 Lake Arlington, USA Sep 1974 – Jan 1976 12.2-32.2 0.2-40 17.7-94.6 2 Apr-Jul & Aug-Dec 2 Ituarte 1985 Punta Atalaya, Argentina Nov 1982-Apr 1985 ~11-27 ~3 - ~30 36-1132 1 September 3 McMahon and Williams 1986 Trinity River, USA Sep 1980 – Dec 1982 4.8-29 2.6- ~45 305-16198 2 Mar-Jul & AugNov 3 Hornbach 1992 Mechums River, USA Oct 1982-Oct 1983 0- ~26 0.4-19 173-1495 1 July 2-3 French and Schloesser 1996 St. Clair River, USA 1988-1990 0.5-12.5 1.8– 5.3 18-187 - - - Cataldo and Boltovskoy 1998 Paraná River Delta, Argentina Oct 1995-Oct 1996 10-29 0.2-33 379-2609 1 Oct-Nov 3 Rajagopal et al. 2000 Lek River, Netherlands Aug 1991-Jan 1993 ~2-~24 - - 2 May/Jun & Sep - Mouthon 2001a Saone River, France Sep 1986-Dec 1999 0.5-27.2 1.5- ~29 ~120-934 2 Jun/Jul & Aug/Sep 5 Mouthon 2001a Rhône River, France Sep 1996-Dec 1999 3-23.5 ~0.5 - ~29.3 ~300-5266 1 Jul-Sep 5 Morgan et al. 2003 Connecticut River, USA Aug 1993-Nov 1994 -1.7-30.6 - 52-114 1 Jun-Sep - Mouthon and Parghentanian 2004 Loire River, France Dec 2001-May 2003 [Ice]-25 0.5- ~34 88-< 4000 2 Jan-Feb & MayOct 2.5-3 Sousa et al. 2006 Lima River, Portugal Aug 2004 & Aug 2005 20.1-22.9 13.0-51.6 60 - - - Schmidlin and Baur 2007 Alrhine River, Switzerland Mar 2003-Oct 2003 7-24 1-24 83-339 1 Jun-Jul - Sousa et al. 2008c Minho River, Portugal Jan 2005Aug 2006 6.7-23.1 1.85-41.83 92-2152 - - 2-3 Franco et al. 2012 Mondego Estuary, Portugal Dec 2007-Dec 2008 10.1-25.4 0.92-37 419-6632 Continuous - - Present study Casal de São Tomé, Portugal Oct 2011-Dec 2012 11.8-20.5 6-32 1353-6352 2 Jun-Sep & Nov - Background information - Chapter 1 10 reproductive events between consecutive years at the same site were also reported (McMahon and Williams 1986). These reproductive events are accompanied by a decline in clam physiological condition consistent with the decrease in biomass caused by the release of developed juveniles (French and Schloesser 1996) The variation noticed in life-history traits when different populations are compared may relate to genetic dissimilarities, but most probably environmental conditions are the main factor determining such variation. In fact, factors such as temperature, available food resources, and contamination, were already proven to affect clam growth and physiological condition, population structure and/or spawning (Cataldo and Boltovskoy 1998, Cataldo et al. 2001, Morgan et al. 2003, Mouthon 2001b, Sousa et al. 2008c). Temperature, for example, seems to be an essential trigger for the spermatogenesis (Kraemer and Galloway 1986), spawning (Rajagopal et al. 2000), and clam growth (Cataldo and Boltovskoy 1998, Morgan et al. 2003). Some authors also concluded that food availability may be as important as thermal regimes for some life-cycle events such as recruitment (Cataldo and Boltovskoy 1998, Mouthon and Parghentanian 2004, Rajagopal et al. 2000). 1.2.3. Habitat and feeding preferences Some controversy exists regarding C. fluminea classification as a freshwateror brackish water species. Some authors include the species in brackish group despite its obvious preference for freshwater (Evans et al. 1977), but the classification as a freshwater species with high tolerance to estuarine habitats has been the most commonly used (Britton 1982). This high tolerance has been explained as a result of a recent brackish water ancestral, since Corbiculidae is a family grouping mainly estuarine bivalves (Britton 1982). The Asian clam occurs both in lenthic and lotic habitats (Britton 1982). This species is rarely found in intermittent streams or temporary ponds, possibly due to its low tolerance to aerial exposure (Byrne et al. 1991), and it clearly prefers high-order tributaries (i.e. above second order streams) (Karatayev et al. 2005b, Schmidlin and Baur 2007). Water current strongly determines C. fluminea presence in a given site, not only because it affects food availability but also because it strongly defines the type of sediment, which is particularly important for infaunal bivalves such as this species (Karatayev et al. 2003, Schmidlin and Baur 2007). The preferred substrate of the Asian clam has been argued to be composed of sand and gravel, both typically found in low current water bodies (bij de Vaate and Greijdanus-Klaas 1990). C. fluminea preferentially colonizes waterbodies without considerable seasonal hydrological oscillations, ample Background information - Chapter 1 11 oxygen supply, and sediments rich in organic material, being commonly found in the limnetic portions of the ecosystems (Britton 1982, Karatayev et al. 2003, Schmidlin and Baur 2007, Sousa et al. 2008b). As already referred, organic matter in streambed is a factor that can determine the presence of C. fluminea in a given site. This clam is primarily a suspension-feeder filtering phytoplankton and detritus from the water column at very high rates (Cherry et al. 1980, Silverman et al. 1995). Besides that, the Asian clam is a pedal-feeder using the organic matter available in the sediment has a food resource (Hakenkamp and Palmer 1999). This feeding alternative can play an important role especially in oligotrophic habitats (present study, Mouthon 2001a). 1.2.4. Current distribution and vectors of dispersal C. fluminea is native from southeast China, Korea and southeast Russia but underwent a massive global range expansion over the last century (Araujo et al. 1993). Recently it has already been reported in almost all North America (reviewed in Mackie and Claudi 2010), South America (Beasley et al. 2003, Ituarte 1985), and all over Europe (e.g. Beran 2006, bij de Vaate and Greijdanus-Klaas 1990, Elliott 2008, Paunović 2007, Pérez-Bote and Fernández 2008, Rosa et al. 2011). The introduction of these invasive bivalves in non-native areas has been attributed to several causes not always related with human activities. Some suggested that the vectors of dispersal are transportation via ballast water, as bait used by fishermen, and on bird’s feet, and entangled in macrophytes (Britton 1982, Counts 1986). 1.2.5. Invasion success Several parameters may determine the distribution and occurrence of C. fluminea, in several stages of its life cycle. The Asian clam is considered a susceptible species to environmental stress when compared with sphaeriids and unionaceans (for more details see McMahon (1991)). Its range of tolerance to different environmental stressors was synthesized by Mackie and Claudi (2010) and some new information within this context can be found in the present thesis. According to Mackie and Claudi (2010), clams survive to a wide water temperatures ranging between 2 and 36 ºC and the organisms are apparently very tolerant to low dissolved oxygen levels in water (lower tolerance limit of 0.5 mg L-1). On the other hand, C. fluminea does not tolerate waters with pH below 5 and hardness below 3 mg CaCO3 L-1 (Mackie and Claudi 2010). The same authors concluded that the upper tolerance limits for conductivity and total dissolved solids are of 12,600 µS cm-1 and 8400 mg L-1, respectively. The upper tolerance limit of C. fluminea Background information - Chapter 1 12 for salinity is 8, however, in situations where acclimation is allowed or exposure occurs for short periods, the clam can tolerate salinities up to 20-22 (Evans et al. 1977, Ilarri and Sousa 2011). During the studies carried out within the context of the present thesis the Asian clam was found in oligotrophic waters with almost no chlorophyll a (mean ± standard deviation: 0.73 ± 1.01 µg/ L-1) whereas 25 µg L-1 chlorophyll a, typically found in mesotrophic systems, seems to be the upper tolerance limit of the species (Mackie and Claudi 2010). The reduced tolerance to particular environmental stressors can lead to high mortality rates as it has been reported in many studies (Cooper et al. 2005, Ilarri et al. 2011, Schmidlin and Baur 2007, Werner and Rothhaupt 2008). Other factors such as overpopulation, alteration of flow regimes, contamination, epidemics, and parasites can also act alone or in synergy promoting massive die-offs (Britton and Morton 1982, French and Schloesser 1996, Morgan et al. 2003, Vohmann et al. 2009). However, C. fluminea has a remarkable ability to rapidly recover from population crashes (often within one year (Britton 1982)), which reflects its ecological profile as a typical r-strategist . This evidences that broad physiological tolerance to a large range of environmental stressors is not mandatory for the success of invasive species, as argued by McMahon 2002. Short life span, early maturity, high fecundity, biannual juvenile release patterns, high growth rates, hermaphroditism and androgenesis, small juvenile size and extensive capacity for dispersal are rather key features of the species biology that confer important advantage in the invasion process (McMahon 2002, Pigneur et al. 2011, Sousa et al. 2006, Vohmann et al. 2009). The traits that favor the invasion success of C. fluminea are also the basis for the species ability to impair the invaded ecosystems and to promote the malfunction of infested underwater industrial structures, as detailed in the following section. 1.2.6. Impacts Table 1.3 summarizes the ecological and industrial impacts of C. fluminea that have been reported in the literature. The classification of the ecological impacts is not straightforward due to the complexity of biotic-biotic and biotic-abiotic interactions that establish ecosystems. In fact, an impact viewed as negative for a given species or group of species can be beneficial for another species or for the overall ecosystem health. For example, if the Asian clam extraordinary filtering abilities can be noxious to competitor native species, benefits to the ecosystem at a higher level can arise provided that the eutrophication process is more easily delayed or avoided. Background information - Chapter 1 13 Table 1.3. Summary of the ecologic and industrial impacts of C. fluminea. The column +/- indicates whether the ecological impacts are positive (+) or negative (-). When all the industrial impacts are considered as being negative that column was not considered. +/- Impacts Reference Ecological + Shelter and substrate for other species Strayer and Malcom 2007, Werner and Rothhaupt 2007 + Source of organic matter and inorganic nutrients in the substrate for pelagic and benthic species Cantanhêde et al. 2008, Sousa et al. 2008a, Vaughn and Hakenkamp 2001 + Decrease in eutrophication levels and turbidity Phelps 1994 - Dominance in the benthic biomass by substitution and/or reduction of the available habitat for other species Schmidlin and Baur 2007, Strayer 1999, Vaughn and Hakenkamp 2001, Williams et al. 2001 - Competition for food with other filtering and benthic species Cohen. et al. 1984, Hakenkamp and Palmer 1999, Lauritsen 1986, Strayer 1999, Williams et al. 2001 - Ingestion of sperm, glochidia, and newly metamorphosed juveniles of native bivalves Strayer 1999 - Excessive production of ammonia and oxygen depletion following massive die-off episodes Ilarri et al. 2011, Strayer 1999 - Changes in nutrient cycles Hakenkamp and Palmer 1999, Vaughn and Hakenkamp 2001 - Vectors of parasites and other pathogenic agents Chung et al. 2001 Industry Impacts Reference Industrial Electric power stations Clogging of condensers and water distribution systems in areas with a reduced perimeter and low flow Isom 1986, Johnson et al. 1986, MacPhee 1986, McMahon 1977, Page et al. 1986, Potter and Liden 1986, Rosa et al. 2011, Smithson 1986 Loss of performance and efficiency in the condensers due to high pressures and cleaning activities Potter and Liden 1986 Security failure due to deficient cooling and clogging of the fire protection systems Isom 1986, Johnson et al. 1986 Productivity losses during cleaning operations and clams removal Isom 1986, Johnson et al. 1986, MacPhee 1986, McMahon 1977, Page et al. 1986, Potter and Liden 1986, Rosa et al. 2011, Smithson 1986 Drinking water treatment plants Decrease in efficiency due to the interruption of the water flow and increase in machinery abrasion Ingram 1959, Rosa et al. 2011, Sinclair 1964 Changes in water odor and flavor Smithson 1986 Cement industries Losses in the cement quality due to the use of sand loaded with clam shells in the production Sinclair 1964 Irrigation systems Clams accumulation in low flow areas, leading to the decrease in water flow that then favors sediments deposition, which contributes additionally to the impact Ingram 1959, Prokopovich 1969, Prokopovich and Herbert 1965, Rosa et al. 2011 Clog of irrigation structures, which requires increased energy consumption to re-establish adequate flow levels Rosa et al. 2011 Waste of water during clams removal operations and increased need to repair/replace of irrigation structures McMahon 1983, Prokopovich and Herbert 1965, Rosa et al. 2011 Background information - Chapter 1 14 Industrial impacts relates to the C. fluminea biofouling activity, which is characterized by the growth and establishment of dense populations in different underwater structures, pipeline and equipment of water-dependent industries such as power stations, drinking water treatment plants, cement industries and irrigation systems (Table 1.3). The damages caused by Asian clam infestations, as well as the implementation of control measures for the pest, costs several billion dollars each year worldwide; this makes the Asian clam a species with serious economic impacts (Pimentel et al. 2005). In Europe, the problem does not seem to be as serious as in the United States (Rosa et al. 2011). However, based on the North American experience, a sudden increase of industrial losses due to this invasive species may occur (Rosa et al. 2011), hence the need to stimulate the development of adequate management practices for the pest, including improved control methods. 1.2.7. Control Given the severity of C. fluminea impacts particularly in an industrial context, the attention devoted to the development of methods to control this pest has been increasing. Physical and mechanical, chemical and biological methods have been proposed to control the Asian clam and other biofouling bivalves. Physical measures already suggested to alleviate fouling by the Asian clam entail the use of electric currents, electromagnetic fields, gamma radiation, heated water, and ultrasonic vibrations (Doherty and Cherry 1988, Mattice 1983, Mussalli et al. 1986). The most promising method seems to be the application of heated water; however, upper temperature tolerance limits of C. fluminea are very high (Mackie and Claudi 2010), thus such a control technique requires water temperatures as high that its application may require modification of the system’s design or eventually newly developed systems (Mattice 1983). Mechanical methods are generally directed towards the removing of the clams from the vulnerable structures of the industries and include the use of strainers and traps, the back flushing of clogged lines and manual removal of shells (Doherty and Cherry 1988, Isom 1986, MacPhee 1986, Mattice 1983, Rosa et al. 2011). However, some disadvantages can be ascribed to mechanical control methods, e.g., there are limitations in the use of strainers with mesh sizes small enough to prevent juveniles from entering the service water systems, and manual removal may only be possible with the plant temporary shutdown (Mattice 1983, Page et al. 1986, Rosa et al. 2011). Some authors have also suggested the combination of mechanical and chemical solutions for industrial macrofouling control (Isom 1986, Mussalli et al. 1986, Smithson 1986), but Background information - Chapter 1 15 most of the data available in the literature result from studies focused only in chemical control techniques. Chemical methods used to control C. fluminea impacts consist in the addition of biocides to the industry’s waterways or reservoirs (Doherty and Cherry 1988). Following the synthesis by Mattice (1983), table 1.4 summarizes chemical control methods that have been proposed as effective against the biofouling activity of the Asian clam. It is important to notice that the comparability of the available toxicity information for most of the biocides is limited since the test methodology was designed according to the specific objectives of each study. This is especially important when organisms that respond differently to the chemical challenges as different life stages (e.g. chlorine, bromine, TBTF, Polyquat; see table 1.4 for more details) or environmental temperatures (e.g. chlorine, bromine; see table 1.4 for more details) are tested. The main difficulty of chemical control is that the compound must be stable enough to be effective i.e. it must not react or decay becoming non-toxic before or as it is applied (Mattice 1983). On the other hand, the chemical per se or its byproducts should be non-toxic or persistent potentially affecting non-target organisms. As an example, chlorination has been historically the preferred chemical method to control a wide range of fouling organisms (e.g. bacteria, algae, fungi and invertebrates including C. fluminea (Jenner et al. 1998, Rajagopal et al. 2002)); Notwithstanding, chlorine byproducts were proven to be highly toxic to other organisms (Jenner et al. 1997, Rajamohan et al. 2007). In this context, the assessment of the environmental toxicity of candidate control chemicals is of key relevance, although little attention has been given so far to this recommendation (Waller et al. 1993). Biological control is another strategy that has been suggested to apply to C. fluminea biofouling, namely considering the predatory potential of vertebrate and invertebrate species over the clam (Cantanhêde et al. 2008, Robinson 1988). The confirmed predators of the Asian clam are mainly fish (14 species including Barbus bocagei, Platichthys flesus, Cobitis paludica, Ictalarus furcatus, Lepomis microlophus, Aplodinotus grunninens) but also muskrats (Ondatra zibenthica), ducks, raccoons, crayfish and flatworms (Brancotte and Vincent 2002, Britton 1982, Karatayev et al. 2005a, Sousa et al. 2008c). However, none of the predator species was proven to prefer C. fluminea over other food items, which limits the potential of control methods based on predation. Parasites can also be considered in the control of the pest but only two parasite species are known to be associated with the Asian clam (the oligochaete Chaetogaster limnaei and a mite), and there are no evidences of a negative effect of these parasites in clams’ abundance (Karatayev et al. 2005a). Background information - Chapter 1 16 Table 1.4. Summary of chemical solutions proposed for the control of C. fluminea. NI - no information available. J - Juveniles and A – Adults. Chemical Test conditions Main conclusions References [ ] (mg L-1) T (ºC) Exposure time Life stage Chlorine 5, 7.5 and 10 35-46 30 min J/A  Mortalities related to water temperature but not to chlorine exposure Mattice et al. 1982 0.23-0.26 14-25 28-32 days J/A  Effective (> 90% mortality) at ~0.25 mg/L after 28 days at 20-25 ºC  Effective at lower temperatures only when organisms were weakened by exposure to winter conditions  Ineffective in short-term exposure  Pretreatment of clams to lower concentrations of chlorine for 14 days does not enhance efficiency Doherty et al. 1986 0.29 7 & 23 28 days J/A  Effective (LT100) in juveniles after 17 days at 23 ºC  Lower toxicity in adult clams (66.7% mortality after 28 days)  Lower toxicity at 7 ºC (39 and 3.3% mortality after 28 days for juvenile and adult clams, respectively) Belanger et al. 1991 Slimcide 364 25, 50, 100 and 200 - 3-24 h J  Effective (90% mortality at 200 mg/L after 3h) Davis and Doherty 1985 Betz ®Slimicide C-41 5, 10, 20, 25, 50 and 100 - 1-6 days J/A  Effective (LT100) in early juveniles after 3 h at 25 mg/L  Effective (LT100) in late juveniles after 24h at 50 and 100 mg/L  Effective in adult clams (LT100) after 24h at 100 mg/L, and less effective in smaller concentrations even after 72h Davis and Lyons 1986 Bromine 1.69-1.83 moles/L 14-25 28-32 days J/A  At low temperatures, more efficient in adult clams (LT50 = 5.6 days) than in juvenile clams (LT50 = 8.8 days)  At higher temperatures the opposite pattern occurs (LT50= 22.3 and 22.4 days vs LT50=19.9 and 20.3 days) Doherty et al. 1986 TBTF-Tributyl tin fluoride 0.0001, 0.001, 0.0032, 0.010, 0.032 20 8 J/A  Effective (LC99) in juveniles at 17.4 µg/L after 4 days  Effective (LC99) in adults at 60.5 µg/L after 8 days Mussalli et al. 1986 PolyquatPoly[oxyethylene(dimet hyliminio)ethylene (dimethyliminio)ethylene dichloride] 2, 4, and 8 24 61 days J/A  Effective (LT100) in juveniles after 11 days at 2 ppm and 7 days at 8 ppm  Effective (LT100) in adults after 5 days at 2-8 ppm  Continuous application in service water systems killed previously settled juveniles and prevented further settlement by juveniles McMahon and Lutey 1988 1, 2, 4, 8 and 10 20 24-33 NI  Semicontinuous application (30 min on/90 min off) proven to be more efficient than continuous application at 1, 2 4, and 10 ppm McMahon and Chase 1997 Background information - Chapter 1 17  Semicontinous application reduced chemical concentration required when compared with continuous application ADBAC (n-alkyl dimethylbenzyl ammonium chloride) 2 25 NI NI  Effective (LT100) after 12 h Lyons et al. 1988 in Post et al. 2007 TCMTB 2- (thiocyanomethylthio)benzot hiazole 1, 2 and 4 24 7 days J/A  Effective (LT100) after 96, 35 and 24 h at increasing concentrations in the case of juvenile clams  Effective (LT100) after 160, 160 and 120 h at increasing concentrations in the case of adult clams Hollis and Lutey 1989 Monochloramine 0.25 and 0.50 30 28 days J/A  Effective (LT100) after 8 and 4 days at 0.25 and 0.5 mg/L, respectively, against juvenile clams  Effective (LT100) after 11-16 and 7-10 days a 0.25 and 0.5 mg/L, respectively, against adult clams (depending on the original site of clam collection) Belanger et al. 1991 Monochloramine plus excess of ammonia 0.25+0.54, 0.50+0.34 and 0.75+0.37 30 28 days J/A  Toxicity was enhanced by the presence of ammonia Belanger et al. 1991 Ammonia 0.14, 0.23, 0.60 and 1.60 (unionized ammonia) 30 28 days J/A  Effective (LT100) after 4-12 and 4-8 days at 0.60 and 1.60 mg/L, respectively, against juvenile clams (depending on the original site of clam collection)  Effective (LT100) after 5-12 and 5 days at 0.60 and 0.1.60 mg/L, respectively, against adult clams (depending on the original site of clam collection) Belanger et al. 1991 Bromicine 0.25, 0.50 and 0.75 30 28 days J/A  Effective (LT100) after 4 and 10 days at 0.50 and 0.75 mg/L, respectively, against juvenile clams  Effective (LT100) after 16-22 and 17 days at 0.50 and 0.75 mg/L, respectively, against adult clams (depending on the original site of clam collection) Belanger et al. 1991 Copper 0.05, 0.10, 0.20, and 0.40 20.1-28.0 30 days A  Control may be economically practical at a concentration of 0.05-0.10 mg/L  Laboratory tests overestimated clam sensitivity Belanger et al. 1991 DGH/QUATdodecylguanidinehydrochlor ide (DGH) e n-alkyl dimethylbenzyl ammonium chloride (QUAT) 3.75, 7.5, 15.0 and 20.0 15 24 Late J  Effective (LT100) after 10 days at 15.0 mg/L  Responsible for an increase in tissue water levels and a decrease in tissue glycogen Bidwell et al. 1995 Background information - Chapter 1 24 McMahon RF. 2002. Evolutionary and physiological adaptations of aquatic invasive animals: r selection versus resistance. Canadian Journal of Fisheries and Aquatic Sciences 59: 1235-1244. Morgan DE, Keser M, Swenarton JT, Foertch JF. 2003. Population dynamics of the Asiatic clam, Corbicula fluminea (Müller) in the Lower Connecticut River: Establishing a foothold in New England. Journal of Shellfish Research 22: 193-203. Mouthon J. 2001a. Life cycle and population dynamics of the Asian clam Corbicula fluminea (Bivalvia : Corbiculidae) in the Rhone River at Creys-Malville (France). Archiv Fur Hydrobiologie 151: 571-589. Mouthon J. 2001b. Life cycle and population dynamics of the Asian clam Corbicula fluminea (Bivalvia : Corbiculidae) in the Saone River at Lyon (France). Hydrobiologia 452: 109-119. Mouthon J, Parghentanian T. 2004. Comparison of the life cycle and population dynamics of two Corbicula species, C. fluminea and C. fluminalis (Bivalvia : Corbiculidae) in two French canals. Archiv Fur Hydrobiologie 161: 267-287. Mussalli YG, Duaz-Tous IA, Sickel JB. 1986. Asiatic clam control by mechanical straining and organotin toxicants in Britton JC, ed. Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2. Page T, Neitzel D, Simmons M. 1986. Biofouling of power plant service systems by Corbicula in Britton JC, ed. Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2. Park GM, Chung EY. 2004. Histological studies on hermaphroditism, gametogenesis and cyclic changes in the structures of marsupial gills of the introduced Asiatic clam, Corbicula fluminea, and the Korean clam, Corbicula leana. Journal of Shellfish Research 23: 179-184. Park JK, Kim W. 2003. Two Corbicula (Corbiculidae : Bivalvia) mitochondrial lineages are widely distributed in Asian freshwater environment. Molecular Phylogenetics and Evolution 29: 529-539. Paunović M. 2007. Distribution of Asian clams Corbicula fluminea (Müller, 1774) and C. fluminalis (Müller, 1774) in Serbia. Aquatic Invasions 2: 99-106. Pérez-Bote JL, Fernández J. 2008. First record of the Asia clam Corbicula fluminea (Müller, 1774) in the Guadiana River Basin (southwestern Iberian Peninsula). Aquatic Invasions 3: 87-90. Background information - Chapter 1 25 Perrings C. 2005. Mitigation and adaptation strategies for the control of biological invasions. Ecological Economics 52: 315-325. Pfenninger MP, Reinhardt F, Streit B. 2002. Evidence for cryptic hybridization between different evolutionary lineages of the invasive clam genus Corbicula (Veneroida, Bivalvia). Journal of Evolutionary Biology 15: 818-829. Phelps HL. 1994. The asiatic clam (Corbicula fluminea) invasion and system-level ecological change in the Potomac River estuary near Washington, DC. Estuaries 17: 614-621. Pigneur L-M, Marescaux J, Roland K, Etoundi E, Descy J-P, Van Doninck K. 2011. Phylogeny and androgenesis in the invasive Corbicula clams (Bivalvia, Corbiculidae) in Western Europe. Bmc Evolutionary Biology 11. Pimentel D, Zuniga R, Morrison D. 2005. Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics 52: 273-288. Post RM, Petrille JC, Lyons LA. 2007. A review of freshwater macrobiological control methods for the power industry. Potter J, Liden L. 1986. Corbicula control at the Potomac River Steam Electric Station Alexandria, Virginia in Britton JC, ed. Proceedings of the Second International Corbicula Symposium. American Malacological Bulletin - Special edition no.2. Prokopovich NP, Herbert DJ. 1965. Sedimentation in the Delta-Mendota Canal. Journal AWWA: 375-382. Prokopovich NP. 1969. Deposition of clastic sediments by clams. Journal of Sendimentary Petrology 39: 8901-8901. Rahel FJ, Olden JD. 2008. Assessing the effects of climate change on aquatic invasive species. Conservation Biology 22: 521-533. Rajagopal S, van der Velde G, de Vaate AB. 2000. Reproductive biology of the Asiatic clams Corbicula fluminalis and Corbicula fluminea in the river Rhine. Archiv Fur Hydrobiologie 149: 403-420. Rajagopal S, van der Velde G, Jenner HA. 2002. Effects of low-level chlorination on zebra mussel, Dreissena polymorpha. Water Research 36: 3029-3034. Background information - Chapter 1 26 Rajamohan R, Vinnitha E, Venugopalan VP, Narasimhan SV. 2007. Chlorination byproducts and their discharge from the cooling water system of a coastal electric plant. Current Science 93: 1608-1612. Renard E, Bachmann V, Cariou ML, Moreteau JC. 2000. Morphological and molecular differentiation of invasive freshwater species of the genus Corbicula (Bivalvia, Corbiculidea) suggest the presence of three taxa in French rivers. Molecular Ecology 9: 2009-2016. Ricciardi A, MacIsaac HJ. 2000. Recent mass invasion of the North American Great Lakes by Ponto-Caspian species. Trends in Ecology & Evolution 15: 62-65. Richardson DM, Pysek P, Rejmánek M, Barbour MG, Panetta FD, CJ W. 2000. Naturalization and invasion of alien plants - concepts and definitions. Diversity and Distributions 6. Robinson JV. 1988. Ecological resistance to the invasion of a freshwater clam, Corbicula fluminea: Fish predation effects. Oecologia 77: 445-452. Rosa IC, Pereira JL, Gomes J, Saraiva PM, Goncalves F, Costa R. 2011. The Asian clam Corbicula fluminea in the European freshwater-dependent industry: A latent threat or a friendly enemy? Ecological Economics 70: 1805-1813. Schmidlin S, Baur B. 2007. Distribution and substrate preference of the invasive clam Corbicula fluminea in the river Rhine in the region of Basel (Switzerland, Germany, France). Aquatic Sciences 69: 153-161. Silverman H, Achberger EC, Lynn JW, Dietz TH. 1995. Filtration and utilization of laboratory-cultured bacteria by Dreissena polymorpha, Corbicula fluminea, and Carunculina texasensis. Biological Bulletin 189: 308-319. Simberloff D, et al. 2013. Impacts of biological invasions: What’s what and the way forward. Trends in Ecology and Evolution 28: 58-66. Sinclair RM. 1964. Clam pests in Tennessee water supplies. Journal American Water Works Association: 592-599. Siripattrawan S, Park J-K, Foighil D. 2000. Two lineages of the introduced Asian freshwater clam Corbicula occur in North America. J. Molluscan Stud. 66: 423-429. Smithson J. 1986. Development of a Corbicula control treatment at the Baldwin Power Station in Britton JC, ed. Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2. Background information - Chapter 1 27 Sousa R, Antunes C, Guilhermino L. 2006. Factors influencing the occurrence and distribution of Corbicula fluminea (Müller, 1774) in the River Lima estuary. Annales De Limnologie-International Journal of Limnology 42: 165-171. Sousa R, Freire R, Rufino M, Mendez J, Gaspar M, Antunes C, Guilhermino L. 2007. Genetic and shell morphological variability of the invasive bivalve Corbicula fluminea (Müller, 1774) in two Portuguese estuaries. Estuarine, Coastal and Shelf Science 74: 166-174. Sousa R, Antunes C, Guilhermino L. 2008a. Ecology of the invasive Asian clam Corbicula fluminea (Müller, 1774) in aquatic ecosystems: An overview. Annales De Limnologie-International Journal of Limnology 44: 85-94. Sousa R, Rufino M, Gaspar M, Antunes C, Guilhermino L. 2008b. Abiotic impacts on spatial and temporal distribution of Corbicula fluminea (Müller, 1774) in the River Minho estuary, Portugal. Aquatic Conservation: Marine and Freshwater Ecosystems 18: 98-110. Sousa R, Nogueira A, Gaspar M, Antunes C, Guilhermino L. 2008c. Growth and extremely high production of the non-indigenous invasive species Corbicula fluminea (Müller, 1774): Possible implications for ecosystem functioning. Estuarine, Coastal and Shelf Science 80: 289-295. Sousa R, Novais A, Costa R, Strayer D. 2012. Invasive bivalves in fresh waters: Impacts from individuals to ecosystems and possible control strategies. Hydrobiologia. Strayer DL. 1999. Effects of alien species on freshwater mollusks in North America. Journal of the North American Benthological Society 18: 74-98. Strayer DL, Malcom HM. 2007. Shell decay rates of native and alien freshwater bivalves and implications for habitat engineering. Freshwater Biology 52: 1611-1617. Vaughn CC, Hakenkamp CC. 2001. The functional role of burrowing bivalves in freshwater ecosystems. Freshwater Biology 46: 1431-1446. Vohmann A, Borcherding J, Kureck A, bij de Vaate A, Arndt H, Weitere M. 2009. Strong body mass decrease of the invasive clam Corbicula fluminea during summer. Biological Invasions 12: 53-64. Waller DL, Rach JJ, Cope WG, Marking LL, Fisher SW, Dabrowska H. 1993. Toxicity of candidate molluscicides to zebra mussels (Dreissena polymorpha) and selected nontarget organisms. Journal of Great Lakes Research 19: 695-702. Background information - Chapter 1 28 Werner S, Rothhaupt K-O. 2007. Effects of the invasive bivalve Corbicula fluminea on settling juveniles and other benthic taxa. Journal of the North American Benthological Society 26: 673-680. Werner S, Rothhaupt K-O. 2008. Mass mortality of the invasive bivalve Corbicula fluminea induced by a severe low-water event and associated low water temperatures. Hydrobiologia 613: 143-150. Williams EH, Bunkley-Williams L, Lilyestrom CG, Ortiz-Corps EAR. 2001. A review of recent introductions of aquatic invertebrates in Puerto Rico and implications for the management of nonindigenous species. Caribbean Journal of Science 37: 246-251. Zavaleta ES, Hobbs RJ, Mooney HA. 2001. Viewing invasive species removal in a wholeecosystem context. Trends in Ecology & Evolution 16: 454-459. CHAPTER 2 Effects of upper-limit water temperatures on the dispersal of the Asian clam Corbicula fluminea Species dispersal - Chapter 2 31 Effects of Upper-limit Water Temperatures on the Dispersal of the Asian Clam Corbicula fluminea Inês Rosa1, Joana Luísa Pereira1*, Raquel Costa2, Fernando Gonçalves1, Robert Prezant3 1 Department of Biology, University of Aveiro & CESAM (Centre for Environmental and Marine Studies), Aveiro, Portugal. 2 CIEPQPF, Department of Chemical Engineering, University of Coimbra, Coimbra, Portugal. 3 College of Science and Mathematics, Montclair State University, Montclair, New Jersey, USA Rosa IC, Pereira JL, Costa R, Gonçalves F & Prezant R (2012) Effects of upper-limit water temperatures on the dispersal of the Asian clam Corbicula fluminea. PLoS ONE 7(10): e46635. doi:10.1371/journal.pone.0046635 Species dispersal - Chapter 2 32 2.1. Abstract Temperature is a determinant environmental variable in metabolic rates of organisms ultimately influencing important physiological and behavioral features. Stressful conditions such as increasing temperature, particularly within high ranges occurring in the summer, have been suggested to induce flotation behavior in Corbicula fluminea which may be important in dispersal of this invasive species. However, there has been no experimental evidence supporting this hypothesis. It was already proven that C. fluminea drift is supported by a mucilaginous drogue line produced by mucocytes present in the ctenidia. Detailed microscopic examination of changes in these cells and quantification of clam flotation following one, two and three weeks of exposure to 22, 25 and 30ºC was carried out so that the effects of increasing water temperatures in dispersal patterns could be discussed. Results show that changes in temperature triggered an acceleration of the mucocytes production and stimulated flotation behavior, especially following one week of exposure. Dilution of these effects occurred following longer exposure periods. It is possible that these bivalves perceive changing temperature as a stress and respond accordingly in the short-term, and then acclimate to the new environmental conditions. The response patterns suggest that increasing water temperatures could stimulate C. fluminea population expansion. Keywords: Corbicula fluminea; Dispersal; Temperature; Invasive species; Climate change; Mucous drogue-line Species dispersal - Chapter 2 33 2.2. Introduction Over the past decades there has been a growing interest in studying biological responses of aquatic organisms to increasing temperature. This interest is linked to attempts to envision effects of climate change with the expected increase in water temperature (e.g. Larsen and Riisgard 2009, Rahel and Olden 2008). In addition to issues related to climate change, other human activities, such as the growing investment in the construction of reservoirs and canals and the consequent change of the thermal regimes of altered systems, contribute to the interest on the effect of temperature in biological responses (Robinson and Childs 2001). Temperature is a decisive environmental variable that greatly determines metabolic rates of organisms (Allan and Castillo 2008). This is even more critical in animals exhibiting poikilothermic ectothermy, such as most invertebrates (Purves et al. 2001). In the specific case of aquatic invertebrates, it has been proven that water temperature indeed influences important biological features, including feeding and digestion (e.g. Viergutz et al. 2006) and reproduction (e.g. Galbraith and Vaughn 2009, Moyo 2011). The metabolic changes associated with temperature regimes are likely to translate into variations in population fitness and ultimately, at a macro-ecological scale, species distribution. In fact, the spatial distribution and dispersal patterns of a given species is often bound by temperature and thermal tolerance ranges and physiological optima (Muller and Baur 2011). Since thermal regimes and temperature changes can influence species distribution, a fundamental interest has been growing in correlating this information with invasive species. Understanding the physiological thermal range of an invasive species in turn can help us to understand their current and potential dispersal ranges and patterns. Such knowledge can also assist in predicting invasive potential of a new habitat and consequently support the design and implementation of preventive measures that can avoid or reduce the negative outcomes of the invader’s establishment. This perspective attains even higher relevance when applied to biofouling invaders, e.g. some freshwater bivalves. Invasive bivalves can accumulate in artificial low-flow areas (e.g. pipes and filters), adding negative economic impacts to the freshwater-dependent industry (Elliott et al. 2005, Rosa et al. 2011). In addition, some of these industries use heat treatment as a highly efficient enhancement agent in pest control either alone or in combination with chemical treatment (Jenner et al. 1998, Mackie and Claudi 2010). It is worth investigating how heated water relates to dispersal patterns adjacent (see e.g. the water temperature increase in the vicinities of thermal power plants as suggested by French and Schloesser (1996)) and within the facilities to better understand the Species dispersal - Chapter 2 40 for the other two treatments were 25 ± 0.5ºC and 30 ± 0.9ºC. Because of the noticed difference between the 20º C set temperature and the corresponding mean temperature monitored during the exposure, the lowest temperature treatment is henceforth considered to be of 22ºC. No mortality was recorded during the test period in any experimental treatment. The graphical trends in Fig. 2.1, representing the variation of ctenidial mucocytes in clams exposed to 22, 25 and 30 ºC for distinct exposure periods (one, two and three weeks of exposure), suggest that exposure time has an important role in modeling the response of ctenidial mucocytes to increasing temperature. This pattern was confirmed by the significant interaction between temperature and week found for cell number and the product between cell number and cell size (Table 2.1). Main timedependent effects were observed, with special emphasis on ctenidial mucocytes size. Significantly larger cells were found following the first week of exposure to all temperatures as compared to the records obtained following two and three weeks of exposure, with changes statistically significant for 22ºC (Fig. 2.1.a; Table 2.2.a). This pattern remained unchanged as temperature increased, which is consistent with the lack of significant differences in mucocyte size of clams exposed to different temperatures within each exposure period (Fig. 2.1.a; Table 2.2.b). Cell number was also significantly affected by the exposure duration, at 22ºC. At this temperature, significantly fewer mucous cells were found in clams following the first week of exposure as compared to the third week of the test (Fig. 2.1.b; Table 2.2.a). Cell size was multiplied by the corresponding cell number to produce a new variable for analysis. To some extent this additional variable represents normalized changes in mucocytes assisting the proper interpretation of the main variables (cell size and cell number). For example, an increase in cell number may only mean that cells divided if accompanied by the proportional reduction in cell size. The product between cell size and number following one week of exposure to 22ºC was significantly lower than that recorded following three weeks of exposure similarly to the observed pattern for the number of mucocytes (Fig. 2.1.c; Table 2.2.a). Species dispersal - Chapter 2 41 Cell size (µm) 12 14 16 18 20 22 Temperature (ºC) 10 20 25 30 Product (cell size * cell number) 0 1 2 3 4 5 6 a) c) (Field reference) B A B AB B A Number of cells per µm 0.1 0.2 0.3 0.4 1st week 2nd week 3rd week AB A B b) Fig. 2.1. Variation of ctenidial mucocytes in clams exposed for one, two, and three weeks to different temperatures. (a) Mean mucocyte size; (b) Mean mucocyte number; (c) Product between corresponding mucocyte size and number. Field reference corresponds to untreated clams and is represented by the square grey mark and dashed line. Letters placed next to points denote differences between groups of exposure period at each exposure temperature following the post-hoc Tukey test. Error bars represent standard deviation. Species dispersal - Chapter 2 42 Table 2.1. Summary of repeated measures ANOVA applied to address the effect of time and temperature in mean ctenidial mucocytes size and number, as well as corresponding product (mucocyte size x number). Significant effects (α = 0.05) are marked in bold. Cell size Cell number Product (number*size) df MS F p df MS F P Df MS F p Within-subjects Week 2 25.786 29.30 <0.001 2 0.003 5.30 0.022 2 0.172 1.772 0.212 Week*Temperature 4 0.904 1.027 0.432 4 0.002 4.49 0.019 4 0.602 6.204 0.006 Residual 12 0.880 12 0.001 12 0.097 Between-subjects Temperature 2 7.564 7.64 0.022 2 0.001 2.15 0.198 2 0.105 0.958 0.435 Residual 6 0.990 6 0.001 6 0.110 Fig. 2.1 and Table 2.1 (see cell size in particular) suggest temperaturedependent effects within exposure period. However, these were not statistically significant as main effects were analyzed even within the first week of the test, where the most consistent changes could be noticed with temperature (Table 2.2.b). Nevertheless, mucocyte size decreased consistently while the number and product increased consistently with increasing temperature following one week of exposure (Fig. 2.1.a). Other general graphical trends could not be statistically confirmed, including the record of fewer mucocytes and lower product between cell size and number with increasing temperatures following three weeks of exposure (Fig. 2.1.b and 2.1.c). An inversely proportional relationship between cell size and cell number is clear following one week of exposure to increasing temperatures, with more but smaller cells being produced (Fig. 2.1.b as compared to 2.1.a). This is supported by a significant negative correlation between the number of mucocytes cells and their size (Pearson coefficient = -0.442; p = 0.016). However, this pattern was not confirmed through time, with non-significant correlations being found following two and three weeks of exposure (Pearson coefficient = -0.201, p = 0.271; and Pearson coefficient = 0.020, p = 0.920, respectively). Furthermore, the graphical pattern of the product between cell size and number (Fig. 2.1.c) seems to resemble that shown for cell number (Fig. 2.1.a) rather than provide an intermediate picture between the potentially related endpoints. The ctenidial mucocytes were also examined immediately after clam collection from the field in order to provide a reference value for untreated organisms (Fig. 2.1; “field reference”). Although cell size in exposed clams is within the same range of that recorded for field clams, treated clams had fewer cells showing similar size to those of Species dispersal - Chapter 2 43 field clams (Fig. 2.1.b as compared to Fig. 2.1.a). The duration of exposure plays an important role on how temperature drives the changes relatively to the field reference if this is taken as a surrogate for the basal stage of the organisms. Indeed, following one week of exposure, all endpoints tended to converge to the corresponding field record as temperature increases, while following three weeks of exposure the opposite occurred. This contrasts with an increasing distance from the unexposed reference to the records in clams exposed for three weeks as temperature rises. Table 2.2. Summary of (a) repeated measures ANOVA and (b) one-way ANOVA applied to address the main effects of time or temperature, respectively, in mean ctenidial mucocytes size and number, as well as corresponding product (mucocyte size x number). Significant effects (α = 0.017) are marked in bold. (a) 22ºC 25ºC 30ºC df MS F p df MS F p df MS F p Cell size Week 2 13.903 17.62 0.010 1.1 16.04 7.00 0.104 1 9.136 8.34 0.102 Residual 4 0.789 2.3 2.29 2 1.095 Cell number Week 2 0.007 7.00 0.010 1.4 0 0 1.000 1.2 0.001 1.00 0.337 Residual 12 0.001 12 0.001 12 0.001 Product (cell number*cell size) Week 2 1.115 11.49 0.002 1.9 0.036 0.37 0.554 1.3 0.348 3.59 0.083 Residual 12 0.097 12 0.097 12 0.097 (b) Week #1 Week #2 Week #3 df MS F p df MS F p df MS F p Cell size Temp 2 6.077 3.91 0.082 2 0.709 3.30 0.108 2 2.587 2.64 0.151 Residual 6 1.554 6 0.215 6 0.981 Cell number Temp 2 0.004 2.05 0.210 2 0.001 0.65 0.555 2 0.001 0.50 0.630 Residual 6 0.002 6 0.002 6 0.002 Product (cell number*cell size) Temp 2 0.771 1.77 0.250 2 0.166 0.381 0.699 2 0.372 0.853 0.472 Residual 6 0.436 6 0.436 6 0.436 Time was the main factor explaining the variation in the clams’ drifting behavior (Table 2.3) with the highest proportion of drift-responsive clams being observed in the Species dispersal - Chapter 2 44 Temperature (ºC) 22 24 26 28 30 Drifts/Clam 0.0 0.2 0.4 0.6 0.8 1st week 2nd week 3rd week A B B A B B first week of testing (Fig. 2.2). Following the first week of exposure there were significantly more drifts than following two and three weeks of exposure (Fig. 2.2; Table 2.4), at the higher temperature treatments of 25 and 30ºC (Fig. 2.2; Table 2.4). Following two weeks of exposure to any of the tested temperatures clam flotation behavior was very rarely observed and following three weeks of exposure clams did not drift at all. The slight differences in the drift records between these two latter timepoints were not confirmed statistically (Fig. 2.2; Table 2.4). In these experiments, temperature did not statistically affect drifting behavior (Table 2.4), although following the first week the clams flotation behavior clearly increased as the 22ºC compares to 25ºC (Fig. 2.2). The parallel experiment run with clams that were given sediment protection yielded very definitive results. No drift was observed in any of the temperature treatments regardless the exposure period considered. Correlation analysis to assess whether each of the mucocyte-related variables could be linked to drifting behavior revealed no significant associations (data not shown). Table 2.3. Repeated-measures ANOVA referring to mean clam flotation following one, two and three weeks of exposure to different temperatures. Significant effects (α = 0.05) are marked in bold. Fig. 2.2. Mean clam flotation following exposure to different temperatures for one, two and three weeks. Letters placed next to points denote differences between groups of exposure period at each exposure temperature following the post-hoc Tukey test. Error bars represent standard deviation. Source of variation df MS F P Within-subjects Week 2 0.379 51.757 <0.001 Week*Temperature 4 0.045 6.146 0.006 Error 12 0.007 Between-subjects Temperature 2 0.31 2.635 0.151 Error 6 0.12 Species dispersal - Chapter 2 45 Table 2.4. Summary of (a) repeated measures and (b) one-way and ANOVA applied to address the main effects of time and temperature, respectively, in mean clam flotation. Significant effects (α = 0.017) are marked in bold. (a) 22ºC 25ºC 30ºC df MS F p df MS F P df MS F p Week 2 0.037 5.28 0.023 1.1 0.623 89 <0.001 1 0.173 24.71 <0.001 Error 12 0.007 12 0.007 12 0.007 (b) Week#1 Week#2 df MS F p df MS F P Temperature 2 0.117 0.88 0.462 2 0.004 0.03 0.970 Error 6 0.133 6 0.133 2.5. Discussion Bivalves are able to acclimatize to cope with changing environmental conditions or minimally show variation in macrostructural or microstructural form in response to these changes, e.g. in shell morphology (Peyer et al. 2010, Trichkova et al. 2008), behavioral traits, such as predator avoidance strategies (Flynn and Smee 2010), or valve movements (Tran et al. 2011). There are studies reporting a wide-range in shell plasticity of populations of the Asian clam Corbicula fluminea inhabiting geographically adjacent habitats that show distinct environmental conditions (e.g. Prezant and Tiu 1987, Renard et al. 2000, Sousa et al. 2007). Other evidence of C. fluminea phenotypic plasticity is its proven ability to regulate body mass while facing long starvation periods as a final outcome of an efficient management of energy budgets and allocation to different body compartments (Vohmann et al. 2009). This suggests that this bivalve has a large range for physiological adjustment to cope with potentially stressful conditions. The present study provides additional evidence on the ability of the Asian clam to adjust physiology and behavior as a response to changing environmental conditions. The results show that changes in water temperature, at least at high ranges (above 20º C), affect the production of the mucous drogue line by C. fluminea and its drifting behavior, thus possibly influencing dispersal patterns with consequences on population expansion. It should be noticed here that drifting by the Asian clam may not relate at least directly to physiological changes occurring in the ctenidial mucocytes. However, it should be kept in mind that changes with temperature were recorded consistently Species dispersal - Chapter 2 46 following the first week of exposure both in mucocyte cells and in flotation behavior. Although a relationship between the physiological and behavioral parameters was not confirmed statistically with the particular design employed in this study, this latter evidence seems to point towards an association between the production of the mucous drogue line and clam’s drifting driven by temperature. Increasing water temperature, particularly to levels closer to the species upper tolerance limit (36-37º C (Karatayev et al. 2005)), can produce physiological stress. At less extreme conditions, increase in temperature generally relates to an increase in metabolic rates, particularly evident in ectotherms, with consequential changes in resources exploitation (Gillooly et al. 2001, Larsen and Riisgard 2009, Lui and Leung 2004, Vohmann et al. 2009). The data recorded on ctenidial mucocytes in clams exposed to high-range temperatures seem consistent with this metabolic shift. In fact, increasing temperature apparently triggered an acceleration of the mucocytes life cycle thus favoring higher cell division rates (Campbell 1996). As a consequence more but smaller cells were produced, especially after one week of exposure. On the other hand, the data collected on the reference sample (10ºC) did not support this hypothesis as particularly evidenced by its higher number of mucocytes as compared to treated samples. This seems to indicate distinct mucocyte cycle patterns at low-range temperatures that would be worth to explore in future studies. Indeed, the literature is not consensual as to the effect of increasing temperature in mucocyte-like cells, making it even more speculative to advance with an explanation for the phenomenon. Studies on other secretory cells that produce mucin substances support our results for high-range temperatures, e.g. Gammert et al. (1988) showed that the number of goblet cells of the nasal mucosa of rats increased with increasing temperature. Conversely, other studies demonstrate the opposite, e.g. in mucous cells of the epidermis of catfish (Quiniou et al. 1998). Along with these reported inconsistencies, the present study provides contradictory results when considering shorter (1 week) versus longer exposure periods. Specifically, the pattern of increasing cell division rates with increasing temperatures was not evident for longer exposure periods. Thus it is likely that the observed changes in mucocytes relate to an immediate response to a perceived environmental stress rather than reflecting a longer term shift in metabolic rates. Prezant and Chalermwat (Prezant and Chalermwat 1984) suggested that the production of the mucous thread and consequent drifting capability could be more readily induced when clams face stressful conditions. C. fluminea drift as quantified in the present study reflected, in particular, in the clams’ response to induced stress after one week of exposure. This is supported by the effects of temperature treatments on Species dispersal - Chapter 2 47 mucocytes size and number following the first week of exposure as compared to longer exposure periods. It is possible that the first week of increasing temperature acted as a critical stress that, in turn, induces mucocyte production that could more readily “allow” mucous drogue line and ultimately flotation behavior. As the higher temperature exposure continues, individuals might have adjusted their metabolism to the new environmental conditions thus acclimatizing to the new thermal regime. When clams were supplied with a sediment layer, no drift was recorded throughout the exposure period. Apparently, at least in this current experiment, the sediment plays an important protection, perhaps stabilizing, role that seems to compensate for the stress induced by increased temperature. Provided the infaunal habit of C. fluminea, the type of sediment has been argued to represent a relevant constraint to the species distribution in natural systems such as creeks and rivers (e.g. Bodis et al. 2012). However, the clam has also been reported to proliferate massively in underwater structures and channels of freshwater-dependent industries (Rosa et al. 2011), hence studies such as the present addressing the species dispersal abilities in systems lacking sediment should not be disregarded. Since a direct relationship between mucocyte activity and drifting behavior was initially hypothesized, the role of sediment was only assessed using drift ratios as an endpoint. Further histological studies on the effects of temperature in mucous production in test systems supplied with sediment would help clarify the extent of its protective role, and ultimately the role of temperature as an actual stress agent. It was already proven that C. fluminea mucous cells residing in the inner demibranchs produce the mucilaginous drogue line, which has an active role in the species’ dispersal ability (Prezant and Chalermwat 1984). In this way, and following the suggestions by McMahon (1983) on the eventual effect of increasing temperature as a promoter of clam’s lift-off into the water column, it seems reasonable to assume that our results indicate that increasing temperature at high-ranges could enhance the Asian clam dispersal ability through the increased production of the mucous drogue line as an immediate response. Although this seems a reasonable prediction for scenarios where the water temperatures range within those tested here (22º to 30ºC), it should be stressed out that the data obtained with the field reference (untreated clams facing 10ºC water temperature) did not corroborate it, highlighting the need for future studies that address mucous production and drift behavior under low-range temperature changes. Temperature also influences byssus production in other bivalves. For example, Young (1985) and Clarke and McMahon (1996) found that increasing temperature leads to increasing byssus thread number in Mytilus edulis and Dreissena polymorpha. While byssal thread and the mucous drogue line both play key roles in relevant species dispersal, these structures are ontogenetically, Species dispersal - Chapter 2 48 phylogenetically, and physiologically distinct: byssal threads form from a complex multiglandular byssal gland releasing a quinine tanned protein with a mucin and collagen component and emerge via a pedal ventral grove (Prezant 1990, Waite et al. 1998). Despite these differences, a behavioral parallel can be traced that suggests a link between temperature and dispersal potential in byssus-producing species and mucoid drogue line dispersing species. With water temperature alteration, other water properties such as viscosity are affected. Increasing temperature causes decreased viscosity and can contribute to decreased buoyancy of floating particles. This could have consequences on biomechanical activities such as the drifting or swimming efficiency of aquatic organisms (Larsen and Riisgard 2009, Larsen et al. 2008). Thus, decreased viscosity with increasing temperatures may eventually help explain the observed increase in flotation behavior between clams exposed to 22ºC and those exposed to higher temperatures during the first week. However, a monotonic trend for drift intensification with increasing temperature could not be recorded. Other authors have not been able to demonstrate a straight relationship between changes in temperature and viscosity-driven changes in drift. For example, Wang and Xu (1997) concluded that with decreasing temperature there is a more frequent drifting behavior in bivalve veliger larvae, and Williams (1990) found that different invertebrate species showed no consistent drifting responses as temperature changed. This suggests that clam drifting (and equivalent behavior in other organisms) results from a complex interaction of several factors including physical parameters (e.g. viscosity), inherent physiology, and environmental challenges. Knowledge on how this complexity of factors enhances or inhibits dispersal is of obvious relevance when considering invasive species such as C. fluminea. Furthermore, it contributes to the understanding of the ecological dynamics of benthic communities, which is strongly influenced by invertebrate drift and settlement, either by the continuous loss of clams into the water column that reduces population density in a given location, or by its continuous settling out with important colonizing implications (Lancaster et al. 1996, Townsend and Hildrew 1976). The temperatures tested in this study are within the tolerance limits described for the Asian clam (see Karatayev et al. 2005) and can also be found in the field especially in the vicinities of power plants using cooling waters from abutting streams and discharging thermal effluents (Cherry et al. 1980). Adding to the potential dispersal shifts induced by temperature changes that might occur in lotic and lentic habitats of Asian clam populations are the potential implications and consequences of global climate change, and the alteration of thermal regimes due to dam and canal construction. Thus, the results constitute a valuable add-on to the baseline information Species dispersal - Chapter 2 49 that is required to predict environmentally-driven changes in dispersal patterns of the Asian clam. It is also important to consider the fact that the higher efficiency in control methods relying in high water temperature applied for short periods may not be as straightforward as presumed as we consider that a concomitant stimulation of dispersal within affected areas can occur representing a drawback in the method. Further research still applies to clarify temperature-dependent effects on C. fluminea dispersal. For example, in an ongoing study, we recorded remarkable differences in the interlamellar epithelium (totally absent or incipient ctenidial mucocytes) of C. fluminea demibranchs in individuals from a population established in a Portuguese channel as compared to the Somerset, New Jersey, USA population studied in the current experiments. Genetic typing (RFLP analysis and mtCOI sequencing) revealed no clear distinction between this population and the Somerset population examined in the present study i.e. both exhibit the same haplotype. It is reasonable to hypothesize that local adaptation may constrain general conclusions on the influence of environmental change in the species dispersal patterns. Furthermore, some authors (e.g. Byrne et al. 2000, Morton 1977) suggested that the mucous produced in the demibranchs may nourish the developing embryos and/or assist the release of juveniles out of the gills. To tease apart potential issues of seasonality or geographic localities or difference induced by localized populations, further studies are being conducted addressing seasonal variation in ctenidial mucocytes and any correlation to drifting behavior. Many questions remain on how different environmental parameters constrain the dispersal of C. fluminea. Additional fundamental knowledge on how temperature regulates physiological and behavioral changes in the clams with consequences in dispersal ability has been demonstrated in the present study. The results indicate that increasing temperature at high-ranges can lead to population expansion in C. fluminea and might be a proxy that helps predict changes in dispersal patterns correlated with change in water temperature. 2.6. Acknowledgements The authors are grateful to Rebecca Shell at Montclair State University for her important assistance in this project, as well as to Bruno Branco Castro for his substantial advice in data analysis. No specific permits were required for the collection of organisms in the field at the described location. This location is not privately-owned or protected in any way. The present study regards the invasive species Corbicula fluminea, and only individuals from this species were collected in the field and used in CHAPTER 3 Dispersal of Corbicula fluminea: Factors influencing the invasive clam’s drifting behavior Species dispersal - Chapter 3 59 Dispersal of Corbicula fluminea: Factors influencing the invasive clam’s drifting behavior Inês Correia Rosa1, João Gomes2, Maria de Lourdes Gomes Pereira3, Joana Luísa Pereira1, Raquel Costa2, Fernando Gonçalves1 1 Department of Biology and CESAM (Centre for Environmental and Marine Studies), University of Aveiro, Aveiro, Portugal. 2 CIEPQPF, Department of Chemical Engineering, University of Coimbra, Coimbra, Portugal. 3 Department of Biology and CICECO (Centre for Research in Ceramics & Composite Materials), University of Aveiro, Aveiro, Portugal. Rosa IC, Gomes J, Pereira MLG, Costa R, Pereira JL, Costa R & Gonçalves F. Factors potentially affecting dispersal of Corbicula fluminea: the role played by genetics and seasonality. Annales de Limnologie – International Journal of Limnology (Accepted for publication) Species dispersal - Chapter 3 60 3.1. Abstract Corbicula fluminea, commonly known as the Asian clam, is one of the most successful invasive species in fresh and brackish waters worldwide. Dispersal is one of the most determinant steps in the invasive process, and the full understanding of the mechanisms involved in this step is critical for adequate pest management both in the wild and in industries affected by this species’ biofouling activity. A mucous drogue line produced by mucocytes packed along the inner demibranchs of the clams’ gills seem to play an important role in assisting drifting and hence dispersal. Two Asian clam populations geographically separated (one in the USA and the other in Portugal), investigated at different times of the year, were reported to differ in terms of mucous drogue line production and floating responses (these were only present for the American population). In this study, genetics and seasonality effects were hypothesized to explain the difference between the populations. To test these hypotheses, the two populations were genetically compared, and the Portuguese one was followed for 14 months to record the animals’ mucous drogue line production and flotation capabilities and locate the population reproductive periods. Our results signal a possible scenario of microevolution with consequences on the production of the clams’ mucilaginous drogue line.Although some authors advocate a link between mucous threads formation and reproduction events, such a relationship was not observed in this study. By contributing to the understanding of a physiological trait of the Asian that is important for dispersal, this study may be of practical relevance for pest monitoring and control. Keywords: Asian clam; Mucous drogue line; Flotation behavior; Life-cycle traits; Invasion Species dispersal - Chapter 3 61 3.2. Introduction Invasive species are a major worldwide threat due to the serious ecological and economic impacts they are responsible for (Barinova et al. 2010, Pimentel et al. 2005). Lakes, estuaries and rivers are particularly prone to invasion (Ricciardi and MacIsaac 2000) because of the large number and variety of transport vectors and anthropogenic disturbance agents affecting these systems (Cohen and Carlton 1998). Dispersal into a new habitat is a determinant stage in the invasion process (Davis 2010), and hence the full understanding of the mechanisms involved in this stage is a key asset to manage the pests. Amongst the most successful aquatic invaders is the freshwater bivalve Corbicula fluminea (Müller, 1774), commonly known as the Asian clam (DAISIE 2012). Several life-cycle traits contribute to its success as an invader, including high growth rates, short life spans, high fecundity rates (up to 600-700 juveniles day-1; Aldridge and McMahon 1978) and hermaphroditism sometimes associated to self-fertilization (Britton and Morton 1982, Kraemer and Galloway 1986). These traits combined with increased waterborne traffic resulted in the massive expansion of C. fluminea from its native distribution range in Southeast Asia to vast regions in Europe (Araujo et al. 1993) and North (Phelps 1994) and South America (Ituarte 1994) over the last century. A particular life-cycle trait of this species that has been considered to contribute to its dispersal abilities is the production of a mucilaginous drogue line by modified cells (mucocytes) packed along the inner demibranchs of the ctenidia of juvenile and young adult clams. This drogue line was proven to assist clam flotation (in clams up to 14 mm shell length) in response to water currents, thus promoting drifting into new locations and favoring the species dispersal (Prezant and Chalermwat 1984). Although mucilaginous drogue line production may play an important role in the species’ dispersal, being potentially relevant from the pest management point of view, little is known about this physiological feature. In a previous study, Rosa et al. (2011) reported marginal industrial biofouling effects and mild invasion severity by C. fluminea in Portugal even though the species entered the country more than 30 years ago (Mouthon 1981). As a possible explanation for this unexpected observation, it was hypothesized that environmental conditions could constrain the production of the mucilaginous drogue line thus affecting the species’ dispersal. In a subsequent study (Rosa et al. 2012), conducted in early spring (April), a USA population of C. fluminea was examined and temperature was shown to influence this trait. When the authors investigated the mucilaginous drogue line production and drifting behavior of a Portuguese Asian clam population later in summer (between June and August), Species dispersal - Chapter 3 62 implementing similar methodologies, neither mucocytes nor any flotation-like event were observed. Here a follow-up study is reported, with two major hypotheses being investigated to clarify the inconsistency observed amongst the two clam populations. One of the hypotheses tested was that the two populations could represent different haplotypes of C. fluminea (Hypothesis 1). Given that the Corbicula genus shows high genetic variability and significant phenotypic plasticity has been attributed to the species (Glaubrecht et al. 2003, Park and Kim 2003, Pigneur et al. 2011, Sousa et al. 2007), different haplotypes could translate into physiological differences regarding drogue line production and hence drifting abilities. To test this hypothesis, the American and Portuguese clam populations were genetically characterized and compared. In parallel, the hypothesis that mucilaginous drogue line production could vary seasonally, which would explain the different behaviors observed in spring and summer, was also investigated (Hypothesis 2). Some authors (e.g. Byrne et al. 2000, Morton 1977) suggested, although providing no clear supporting evidence, that the mucous threads in C. fluminea have an additional role in nourishing the embryos, also developing in the inner demibranchs, and/or in assisting the release of juveniles out of the gills. This being the case, an annual variation of mucous production, concomitant with the animals’ reproductive cycle, could be expected. To assess this hypothesis, the Portuguese clam population was followed for 14 months as a study model. The animals’ flotation behavior and the production of mucilaginous threads by ctenidial mucocytes were analyzed throughout the test period. The population’s reproductive period(s), potentially connected with mucous production, were also located by following the seasonal changes in the clams’ body condition (as dry tissue weight) and the population growth dynamics, complementing with morphological examination of the clams’ gills to identify the presence of incubating progeny. Because C. fluminea is a serious aquatic invader, with both ecological and industrial impacts, it is important to enlarge the body of knowledge on the species’ biology. The study of the Asian clam dispersal mechanisms, namely by characterizing possible seasonal patterns and the life-cycle traits linked to the process, may contribute to the design of more effective monitoring strategies and improved control methods for the nuisance. Species dispersal - Chapter 3 63 3.3. Materials and methods 3.3.1. Assessing Hypothesis 1: genetic typing of the two Corbicula fluminea populations The genetic characterization of both the American (see Rosa et al. 2012 for details on this population) and the Portuguese populations (see below for details on the collection site) was done through restriction fragment length polymorphism (RFLP) analysis of the mitochondrial cytochrome c oxidase subunit I gene (mtCOI) plus sequencing of the gene (Renard et al. 2000). Twenty clams (shell length above 22 mm) were collected from each population. The animals’ valves were opened by gently forcing them with a blunt needle, and each individual was placed in a vial filled with absolute ethanol PA at 4 ºC in order to preserve DNA integrity. Total DNA was extracted from approximately 30 mg of each individual using the E.Z.N.A.® Mollusc Isolation Kit as indicated by the manufacturer. A 710 bp fragment of the mtCOI gene was amplified by polymerase chain reaction (PCR) using the primers designed by (Folmer et al. 1994): LCOI490 (5’- GGTCAACAAATCATAAAGATATTGG-3‘) and HCO2198 (5’- TAAACTTCAGGGTGACCAAAA AATCA-3’). A negative control (no DNA template) was used in the reaction. Amplification of 15 ng DNA occurred in a total volume of 25 µL and the reaction mixture also included 1 µM of each primer, 0.2 mM of each dNTP, 1 mM of MgCl2, 0.025 U/µL adjusted to 1 U/sample of Taq DNA Polymerase (Fermentas, Lithuania) plus the recommended buffer. The PCR protocol consisted in an initial denaturation step of 60 s at 94 ºC, 35 annealing/elongation cycles of 60 s at 94 ºC, 60 s at 4 0ºC and 90 s at 75 ºC, and a final elongation step at 72 ºC for 5 min. The PCR product was then digested by the restriction enzyme Sac I (Takara, China): 5 µL of the PCR product with 5 U of the restriction enzyme plus the corresponding buffer as recommended by the enzyme manufacturer were incubated overnight at 37 ºC; 5 U of restriction enzyme were further added to prolong digestion for 3 h; the reaction was terminated by adding 1 µL of loading buffer to each mixture. An agarose gel (1.5 % (w/v)) electrophoresis was run in order to confirm whether all individuals could be identified as C. fluminea (one band of 710 bp or two bands of 200 and 500 bp; Renard et al. 2000). In order to further find the haplotype(s) present in the samples, the PCR product was purified (ExoSAP-IT®; Affymetrix, USA) and sequenced in a certified laboratory according to ISO 9001:2008, using the oligo LCOI490. The obtained sequences were compared with sequence data from the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov) using BLASTn homology search. Similar sequences were Species dispersal - Chapter 3 64 aligned with the clams’ sequences using CLUSTALW2 (EMBL-EBI) and the differences between the sequence of nucleotides were then assessed. 3.3.2. Assessing Hypothesis 2 3.3.2.1. Study site and clam collection details C. fluminea individuals were collected in Casal de São Tomé, Mira, Portugal (N40°25'06.90’’/W8°44'13.18’’), from a sandy muddy shallow creek, which is connected to other brooks, forming a network of small canals. Clams were collected monthly from October 2011 to December 2012 and twice a month between May and September 2012, the latter being expected to cover the breeding period. Two different sampling strategies were employed depending on the subsequent analysis. Qualitative sampling was used to obtain organisms for histological studies and analysis of drifting behavior as detailed below. Clams were collected by using a shovel to drag sediment into a bag with 1 mm mesh size, used to roughly sieve the sample. Clams with shell length in the range 9 to 14mm, corresponding to mature animals that were already proven to be able to produce a mucilaginous drogue line (Ituarte 1985, Prezant and Chalermwat 1984), were then selected. Quantitative sampling was used to address the seasonal variation of the clams’ body condition and obtain cohort frequencies (see below for details). Clams were collected with a Van Veen grab (15 x 32 x 19.5 cm) from three sampling points along a transect established in the creek. The sediment collected was dragged into a 1-mm mesh size bag to roughly sieve the sample, which was then transferred to a 20-L bucket filled with ca. 15 L of field water for transportation to the laboratory. Temperature, pH, conductivity and dissolved oxygen contents were measured in situ with a multiparameter field probe (WTW-Multi3430). Flow speed was estimated by examining the traveling time of a floating plastic cylinder. Water samples (ca. 4 L) were collected and vacuum filtered (GF/C 1.5-µm pore filters) for further determination of turbidity through the calculation of the absorption coefficient (m-1; Brower et al. 1997). The filtration residue was used to quantify the total suspended solids (mg L-1; APHA 1995) and photosynthetic pigments (µg L-1 Chl a Lorenzen 1967). Sediment was also collected to quantify the loss-on-ignition organic matter contents (% (w/w); ASTM 2000). Species dispersal - Chapter 3 65 3.3.2.2. Analysis of the seasonal changes in clams’ flotation behavior and mucilaginous drogue line production Clams’ flotation behavior was observed in situ and in the laboratory. In the field, 10 clams (shell length in the range 9 to 14 mm) were randomly drawn from the qualitative sample previously collected (see above for details) and placed into a plastic container with 35 x 25 x 6 cm. The clams were subjected to the field water flow by keeping the container fully flooded during 4-5 minutes and their flotation activity (if any) was recorded. In addition, as clams were observed to be actively siphoning, a few drops of 5 % (w/v) toluidine blue were placed near the siphons to assess whether a mucous drogue line was being produced. The clams were then transported to the laboratory in plastic containers filled with field water, which was then gradually replaced by dechlorinated municipal water for acclimation purposes. The sample was kept under continuous aeration at constant temperature (20 ± 2 ºC) and photoperiod (16hL:8hD). After 24 hours, the clams were transferred into a 15-L aquarium, containing 14 L of dechlorinated municipal water, and placed inside a submerged crystallizing dish to continue the acclimation period for another 24 h. An externally driven recirculation and filtration system was set in the aquarium to ensure the water quality. Following the approach suggested by Prezant and Chalermwat (1984) and Rosa et al. (2012), the clams were submitted to a gentle water flow and their flotation behavior (if any) was recorded over a 30-min period. Microscopic inspection of the ctenidial mucocytes distributed in the inner demibranchs of clams sampled qualitatively was performed to get additional insight into the mucilaginous drogue line production and support the interpretation of the flotation data. Ten clams (shell length ranging from 9 to 14 mm) were transported in plastic containers filled with field water to the laboratory, where they were immediately opened through gentle forcing between valves with a blunt needle. Their soft tissues (whole body) were fixed in Zenker’s fluid overnight. The fixed samples were treated as detailed by Rosa et al. (2012). Briefly, they were washed and dehydrated, and then the tissues were carefully embedded in paraffin wax (Paraffin mp 56-58 ºC, Merck KGaA) so that antero-posterior sections could be made in the organisms, corresponding to longitudinal cuts of the demibranchs. The blocs were sectioned at 5-7 µm cut thickness. The sections were stained with sodium borate buffered aqueous toluidine blue. The first eight sequential sections of the demibranchs were selected for microscopic examination to assess the presence of mucous cells (Olympus CKX41 inverted microscope). Species dispersal - Chapter 3 72 Fig. 3.5 shows the clam population density and mean shell length in the study site over the sampling period. Overall, clam density was (mean ± SD) 3247 ± 1122 clams m-2, with a maximum peak of over 6000 clams m-2 recorded in August 2012 and minimum densities of less than 1500 clams m-2 reached in April, May and December 2012 (Fig.3. 5). The highest values of mean shell length were recorded in April and May 2012 (mean ± SD: 17.59 ± 3.80 mm and 17.40 ± 3.57 mm, respectively), while on average the clams were smallest in November 2012 with a mean shell length of (mean ± SD) 14.00 ± 2.74 mm (Fig. 3.5). In June and in the beginning of August, clam’s mean shell length was also low as compared to the rest of the year (mean ± SD of 14.44 ± 3.60 mm and 14.12 ± 3.34 mm, respectively) (Fig. 3.5). Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Population density (clams m-2) 0 1000 2000 3000 4000 5000 6000 Density Mean shell length (mm) 0 10 15 20 Mean shell length 2011 2012 Fig. 3.5. Seasonal variation of the clam population density (left yy’ axis) and mean shell length (right yy’ axis) during the sampling period. Error bars represent standard deviation. Population density was represented as a single value after pooling of the three replicated samples taken at each sampling point. Fig. 3.6, where size frequency distributions are presented, further documents the dynamics of the population structure over the study period. Young adults with shell length between 11.5 and 17.5 mm tended to be the most abundant size class, dominating the population size structure. The abundance of juveniles (shell length up to 10 mm; Cataldo and Boltovskoy 1998, Ituarte 1985, Mouthon 2001) in the population was always low compared to that of adults. Juveniles noticeably increased over June 2012, decreasing in the beginning of the following month. Then, it peaked again in late Species dispersal - Chapter 3 73 July 2012, and juveniles kept being found until mid-September 2012. A final increase of juvenile abundance was observed in November 2012. Such a variation of the population size structure is consistent with multiple spawning events occurring from late spring through summer until mid-autumn. The recruitment periods identified in summer and autumn (Fig. 3.6) consistently occurred 1-2 months after decreases in the clams’ body condition indicative of spawning (Figs. 3.3 and 3.4). An earlier, less significant recruitment event seemed to happen in March 2012 (Fig. 3.6), 5 months after the previous spawn in October 2011 (Figs. 3.3 and 3.4), with the offspring released in autumn having lower growth rate over winter as compared to the individuals released in the warm months. Species dispersal - Chapter 3 74 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 Shell length (mm) 0 5 10 15 20 25 30 Frequency (clams m-2) 0 200 400 600 800 1000 1200 1400 0 5 10 15 20 25 30 0 5 10 15 20 25 30 01/Oct 2011 n=4000 02/May 2012 n=1771 13/Aug 2012 n=307 16/May 2012 n=2229 09/Dec 2011 n=3966 03/Nov 2011 n=3590 04/Jan 2012 n=3056 06/Feb 2012 n=3159 05/Mar 2012 n=4424 10/Apr 2012 n=1887 04/Jun 2012 n=4499 15/Jun 2012 n=3460 02/Jul 2012 n=2926 18/Jul 2012 n=3501 31/Jul 2012 n=6352 03/Sep 2012 n=2776 17/Sep 2012 n=3193 01/Oct 2012 n=2277 07/Nov 2012 n=3453 05/Dec 2012 n=1394 Fig. 3.6. Size frequency distribution of the clam population during the sampling period (October 2011 to December 2012). n represents the total clam density (clams m-2). Species dispersal - Chapter 3 75 3.5. Discussion Understanding the process through which the Asian clam produces a mucilaginous drogue line that promotes its flotation and drifting into new areas may contribute to more effective pest management. As this process was investigated in two Corbicula fluminea populations geographically separated (one in Sommerset, NJ, USA and the other in Portugal), at different times of the year, unexpected differences were observed – mucous threads and floating responses, reported for the American clam population (Rosa et al. 2012) were completely absent amongst the specimens collected from the Portuguese population. It was hypothesized that such differences could be due to genetic differences between the two populations and/or seasonal effects, and these two hypotheses were hence investigated in this study. The taxonomy of the Corbicula genus is generally confuses and yet unsolved because of the recognized high phenotypic variation in shell morphology, color and ornamentation, contrasting reproductive strategies and ecological differences (Glaubrecht et al. 2003, Park and Kim 2003, Pigneur et al. 2011, Sousa et al. 2007). It was shown here that there is no clear genetic distinction between the American and the Portuguese Corbicula populations, both exhibiting the same haplotype – haplotype I as described by Renard et al. (2000) in Europe, which corresponds to C. sp. (Form A) described by Lee et al. (2005) in the USA and C. leana described by Park & Kim in Asia (2003). It should be noticed that androgenesis is a common feature of the Corbicula genus (Byrne et al. 2000, Ishibashi et al. 2003, Komaru and Kawagishi 1998), which compromises analysis relying only on mitochondrial sequences as conducted in this study i.e. distinct nuclear lineages can be grouped in the same mitochondrial cluster (Hedtke et al. 2008, Park and Kim 2003, Pigneur et al. 2011). Further genetic studies, combining nuclear and mitochondrial data along with detailed morphological examination, should thus be carried out for a definite genetic comparison of the two populations of interest. Some authors (Byrne et al. 2000, Morton 1977, Williams and McMahon 1987) suggested that the mucous produced in C. fluminea demibranchs play an important role in reproduction, namely by assisting the nourishment of the developing embryos and the release of the progeny out of the parents’ gills. The mucilaginous drogue line production and associated drifting behavior could thus be expected to vary seasonally concomitantly with the species reproductive cycle. In this study, data on the animals’ body condition seasonal pattern, gills’ morphological examination and population size structure dynamics were integrated to locate the reproductive period(s) of the Portuguese clam population. These data Species dispersal - Chapter 3 76 consistently indicated that breeding occurred from late spring until mid-autumn, with multiple spawns in a more continuous-like reproductive pattern over this period. Major recruitment events in June, August-September and November were identified based on the population dynamics analysis. Reproduction of C. fluminea is known to vary greatly with location (Table 3.2), which suggests a strong influence of environmental and genetic factors in life-cycle related events. Although one recruitment episode (from early summer to early autumn) or two episodes (one in spring/early summer and one in late summer/early autumn) are most commonly reported for Asian clam populations, the pattern observed in this study is in agreement with many other works that also show recruitment occurring in mid/late Autumn (Table 3.2). Despite the reproductive patterns observed in the clam population, no mucocyte cells could generally be found in the tested animals’ gills (in the cases where mucocytes were observed, the cells were in an incipient state) over the 14-month study. This result does not definitely contradicts the link between mucous production and reproduction-related events – in populations where mucous is actually produced, mature parents’ developing embryos and progeny release from the parents’ gills may benefit from it as defended by some authors (Byrne et al. 2000, Morton 1977, Williams and McMahon 1987). However, the reported data prove that mucous production is not a necessary condition for successful clam reprodution to occur. Previous studies on mucocytes showed that the mucous threads are produced by juvenile and small adult clams (up to 14 mm shell length), and, together with other behavioral mechanisms, assist the drift of the clams through flotation in response to water currents (Prezant and Chalermwat 1984, Rosa et al. 2012). The absence of mucocytes cells in the inner demibranchs of the tested clams is thus consistent with the absence of drifting, both in the field and in the laboratory, throughout the sampling period. As the American and the Portuguese clam populations were proven to be genetically similar and season-driven effects were ruled out, the question why the two populations have different mucous production and drifting capabilities remains unanswered. It can be speculated that, while corresponding to the same species and haplotype, the two populations show distinct physiological features due to a high rate of genotypic and/or phenotypic plasticity. It is possible that the colonization of different habitats triggered microevolutive events towards local adaptation (Ashley et al. 2003, Sousa et al. 2007), which may explain the inhibition of the drogue line production and drifting behavior in the Portuguese clam population. Further studies are necessary to assess this hypothesis. Species dispersal - Chapter 3 77 Table 3.2. Summary of shell length, clam density and recruitment events for several C. fluminea populations. The study site location, sampling date and water temperature range are also shown. This summary result from a thorough literature search and only studies reporting data on at least 4 of the columns were considered. Study Study site location Sampling date Water temperature range (ºC) Shell length range (mm) Clam density range (clams m-2) Recruitment events Aldridge and McMahon 1978 Lake Arlington, USA Sep 1974 – Jan 1976 12.2-32.2 0.2-40 17.7-94.6 2 Apr-Jul & AugDec Ituarte 1985 Punta Atalaya, Argentina Nov 1982-Apr 1985 ~11-27 ~3 - ~30 36-1132 1 September McMahon and Williams 1986 Trinity River, USA Sep 1980 – Dec 1982 4.8-29 2.6- ~45 305-16198 2 Mar-Jul & AugNov Hornbach 1992 Mechums River, USA Oct 1982-Oct 1983 0- ~26 0.4-19 173-1495 1 July French and Schloesser 1996 St. Clair River, USA 1988-1990 0.5-12.5 1.8– 5.3 18-187 - - Cataldo and Boltovskoy 1998 Paraná River Delta, Argentina Oct 1995-Oct 1996 10-29 0.2-33 379-2609 1 Oct-Nov Rajagopal et al. 2000 Lek River, Netherlands Aug 1991-Jan 1993 ~2-~24 - - 2 May/Jun & Sep Mouthon 2001 Saone River, France Sep 1986-Dec 1999 0.5-27.2 1.5- ~29 ~120-934 2 Jun/Jul & Aug/Sep Mouthon 2001 Rhône River, France Sep 1996-Dec 1999 3-23.5 ~0.5 - ~29.3 ~300-5266 1 Jul-Sep Morgan et al. 2003 Connecticut River, USA Aug 1993-Nov 1994 -1.7-30.6 - 52-114 1 Jun-Sep Mouthon and Parghentanian 2004 Loire River, France Dec 2001-May 2003 [Ice]-25 0.5- ~34 88- <4000 2 Jan-Feb & MayOct Sousa et al. 2006 Lima River, Portugal Aug 2004 & Aug 2005 20.1-22.9 13.0-51.6 60 - - Schmidlin and Baur 2007 Alrhine River, Switzerland Mar 2003-Oct 2003 7-24 1-24 83-339 1 Jun-Jul Sousa et al. 2008 Minho River, Portugal Jan 2005Aug 2006 6.7-23.1 1.85-41.83 92-2152 - - Franco et al. 2012 Mondego Estuary, Portugal Dec 2007-Dec 2008 10.1-25.4 0.92-37 419 Continuous - Present study Casal de São Tomé, Portugal Oct 2011-Dec2012 11.8-20.5 6-32 1353-6352 2 Jun-Sep & Nov Overall, this study confirms that mucocytes development is directly related to Asian clam drifting behavior and indicates that microevolutionary events may condition these processes. It thus contributes to the understanding of a physiological trait of the species that is meaningful to the species dispersal efficiency and hence relevant from the pest management point of view. 3.6. Aknowledgements The authors are grateful to João Simões, Carolina Madeira and Artur Alves for their advice regarding genetic analysis, as well as to Robert Prezant for his help in interpreting histological results. Bruno Castro, Henrique Queiroga and Alexandre Caseiro provided important guidance on the analysis of the population data. We would also like to thank all colleagues that helped in the field work. Inês Correia Rosa and Joana Luisa Pereira are recipients of individual scholarships by the Portuguese Foundation for Science and Technology (FCT) (PhD scholarship SFRH/BD/33395/2008 and Post–Doctoral scholarship SFRH/BPD/44733/2008, respectively). This study was supported by the European Regional Development Fund - EDRF, through the Operational Competitiveness Programme - COMPETE, and by national funds through FCT under the scope of the project PTDC/AAC-AMB/113515/2009. 3.7. References Aldridge DW, McMahon RF. 1978. Growth, fecundity, and bioenergetics in a natural population of asiatic freshwater clam, Corbicula manilensis Philippi, from north central Texas. Journal of Molluscan Studies 44: 49-70. APHA APHA. 1995. Standard methods for the examination of water and wastewater. 19th ed.; 1995. Washington. Araujo R, Moreno D, Ramos MA. 1993. The Asiatic clam Corbicula fluminea (Müller, 1774) (Bivalvia: Corbiculidae) in Europe. American Malacological Bulletin 10: 39-49. Ashley MV, Willson MF, Pergams ORW, O'Dowd DJ, Gende SM, Brown JS. 2003. Evolutionarily enlightened management. Biological Conservation 111: 115-123. ASTM. 2000. Standard test methods for moisture, ash, and organic matter of peat and other organic soils. Species dispersal - Chapter 3 79 Barinova SS, Yehuda G, Nevo E. 2010. Comparative analysis of algal communities in the rivers of northern and southern Israel as bearing on ecological consequences of climate change. Journal of Arid Environments 74: 765-776. Britton JC, Morton B. 1982. A dissection guide, field and laboratory manual for the introduced bivalve Corbicula fluminea. Malacological Review Supplement 3: 1-82. Brower JE, Zar JH, von Endem CN, eds. 1997. Field and laboratory methods for general ecology. 4 ed. Boston, USA: WCB McGraw-Hill. Byrne M, Phelps H, Church T, Adair V, Selvakumaraswamy P, Potts J. 2000. Reproduction and development of the freshwater clam Corbicula australis in Southeast Australia. Hydrobiologia 418: 185-197. Cataldo D, Boltovskoy D. 1998. Population dynamics of Corbicula fluminea (Bivalvia) in the Paraná River Delta (Argentina). Hydrobiologia 380: 153-163. Cohen AN, Carlton JT. 1998. Accelerating invasion rate in a highly invaded estuary. Science 279: 555-558. DAISIE – European Invasive Alien Species Gateway. www.europe-aliens.org. Acessed 2013. Davis MA. 2010. Invasion Biology. Oxford: Oxford University Press. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular marine biology and biotechnology 3: 294-299. Franco JN, Ceia FR, Patricio J, Modesto V, Thompson J, Marques JC, Neto JM. 2012. Population dynamics of Corbicula fluminea (Müller, 1774) in mesohaline and oligohaline habitats: Invasion success in a Southern Europe estuary. Estuarine Coastal and Shelf Science 112: 31-39. French JRP, Schloesser DW. 1996. Distribution and winter survival health of Asian clams, Corbicula fluminea, in the St Clair River, Michigan. Journal of Freshwater Ecology 11: 183-192. Glaubrecht M, von Rintelen T, Korniushin AV. 2003. Toward asystematic revision of brooding freshwater corbiculidae in Southeast Asia (Bivalvia, Veneroida): On shell morphology, anatomy and molecular phylogenetics of endemic taxa from islands in Indonesia. Malacologia 45: 1-40. Species dispersal - Chapter 3 80 Hedtke SM, Stanger-Hall K, Baker RJ, Hillis DM. 2008. All-male asexuality: Origin and maintenance of androgenesis in the Asian clam Corbicula. Evolution 62: 1119-1136. Hornbach DJ. 1992. Life history traits of a riverine population of the Asian clam Corbicula fluminea. American Midland Naturalist 127: 248-257. Ishibashi R, Ookubo K, Aoki M, Utaki M, Komaru A, Kawamura K. 2003. Androgenetic reproduction in a freshwater diploid clam Corbicula fluminea (Bivalvia:Corbiculidae). Zoological Science 20: 727-732. Ituarte CF. 1985. Growth dynamics in a natural population of Corbicula fluminea (Bivalvia Sphaeriacea) at Punta Atalaya, Rio de La Plata, Argentina. Studies on Neotropical Fauna and Environment 20: 217-225. Ituarte CF. 1994. Corbicula and Neocorbicula (Bivalvia: Corbiculidae) in the Paraná, Uruguay, and Rio de la Plata Basins. The Nautilus 107: 129-135. Komaru A, Kawagishi T. 1998. Cytological evidence of spontaneous androgenesis in the freshwater clam Corbicula leana Prime. Development Genes and Evolution 208: 4650. Kraemer LR, Galloway ML. 1986. Larval development of Corbicula fluminea (Müller) (Bivalvia, Corbiculacea) - An appraisal of its heterochrony. American Malacological Bulletin 4: 61-79. Lee T, Siripattrawan S, Ituarte CF, O Foighil D. 2005. Invasion of the clonal clams: Corbicula lineages in the New World. American Malacological Bulletin 20: 113-122. Legendre P, Legendre L. 1998. Numerical Ecology. Amsterdam: Elsevier. Lorenzen CJ. 1967. Determination of chlorophyll a and phae-pigments: Spectrophotometric equations. Limnology and Oceanography 12: 343-346. McMahon RF, Williams CJ. 1986. A reassessment of growth rate, life span, life cycles and population dynamics in a natural population and field caged individuals of Corbicula fluminea (Müller) (Bivalvia: Corbiculacea). Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2. Morgan DE, Keser M, Swenarton JT, Foertch JF. 2003. Population dynamics of the Asiatic clam, Corbicula fluminea (Müller) in the Lower Connecticut River: Establishing a foothold in New England. Journal of Shellfish Research 22: 193-203. Morton B. 1977. Freshwater fouling bivalves. Pages 1-14. First International Corbicula Symposium. Fort Worth, Texas, USA: Texas Christian University. Species dispersal - Chapter 3 81 Mouthon J. 1981. Sur la présence en France et au Portugal de Corbicula (Bivalvia, Corbiculidae) originaire d' Asie. Basteria 45: 109-116. Mouthon J. 2001. Life cycle and population dynamics of the Asian clam Corbicula fluminea (Bivalvia : Corbiculidae) in the Saone River at Lyon (France). Hydrobiologia 452: 109-119. Mouthon J. 2001. Life cycle and population dynamics of the Asian clam Corbicula fluminea (Bivalvia : Corbiculidae) in the Rhone River at Creys-Malville (France). Archiv Fur Hydrobiologie 151: 571-589. Mouthon J, Parghentanian T. 2004. Comparison of the life cycle and population dynamics of two Corbicula species, C. fluminea and C. fluminalis (Bivalvia: Corbiculidae) in two French canals. Archiv Fur Hydrobiologie 161: 267-287. Park JK, Kim W. 2003. Two Corbicula (Corbiculidae : Bivalvia) mitochondrial lineages are widely distributed in Asian freshwater environment. Molecular Phylogenetics and Evolution 29: 529-539. Phelps HL. 1994. The asiatic clam (Corbicula fluminea) invasion and system-level ecological change in the Potomac River estuary near Washington, DC. Estuaries 17: 614-621. Pigneur L-M, Marescaux J, Roland K, Etoundi E, Descy J-P, Van Doninck K. 2011. Phylogeny and androgenesis in the invasive Corbicula clams (Bivalvia, Corbiculidae) in Western Europe. Bmc Evolutionary Biology 11. Pimentel D, Zuniga R, Morrison D. 2005. Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics 52: 273-288. Prezant RS, Chalermwat K. 1984. Flotation of the bivalve Corbicula fluminea as a means of dispersal. Science 225: 1491-1493. Quinn GP, Keough MJ, eds. 2002. Experimental design and data analysis for biologists New York: Cambridge University Press. Rajagopal S, van der Velde G, de Vaate AB. 2000. Reproductive biology of the Asiatic clams Corbicula fluminalis and Corbicula fluminea in the river Rhine. Archiv Fur Hydrobiologie 149: 403-420. Renard E, Bachmann V, Cariou ML, Moreteau JC. 2000. Morphological and molecular differentiation of invasive freshwater species of the genus Corbicula (Bivalvia, Impacts - Chapter 4 88 American plants, including power stations, drinking water treatment plants, sand and gravel companies and irrigation canals do exist (e.g. Ingram 1959, Johnson et al. 1986, McMahon 1977, Prokopovich and Herbert 1965, Sinclair 1964). However, a large number of these studies are not of easy access, in many cases corresponding to private internal reports (e.g. Cherry et al. 1980). Furthermore, equivalent studies addressing the problem in the European scenario are much scarcer (Jenner et al. 1998). Differences between the North American Asian clam populations and those that more recently colonised and spread across Europe may be expected in aspects such as growth rates, physiological tolerance, population densities and annual reproductive cycles (Mackie and Schloesser 1996). These features of the species biology and ecology determine to a large extent the pattern of industrial infestations, and are thus critical for the implementation of effective monitoring and control measures. Therefore, although European pest managers can obviously take advantage of the documented experience of their American counterparts, reports on C. fluminea infestation episodes and mitigation practices in European freshwater-drawing industries should constitute a more concrete working basis for them. One further issue that sometimes may confound those searching the literature for information on problems caused by the Asian clam is related to a generalisation, somewhat abusive, of the industrial impacts of the zebra mussel Dreissena polymorpha. This species is a particularly severe freshwater biofouler bivalve due to its exceptional dispersal capacity and epifaunal mode of life, and thus the literature addressing this pest is considerably vaster (Claudi and Mackie 1994, Ludyanskiy et al. 1993). Because the Asian clam also causes significant economic damage, there is sometimes a tendency to exaggerate many aspects of its biofouling activity based on an analogy with those of the zebra mussel to draw attention to the problem. Some of such generalisations are then repeated and assumed proven without practical evidence. Yet the two troublesome bivalves are different in key features of their biology and ecology (Karatayev et al. 2005), and hence the mode and the extent to which they affect industrial facilities are not exactly the same. From the above discussion, it becomes apparent that comprehensive reports of C. fluminea industrial infestations should be encouraged. They are likely to be of great use for pest managers, especially if they refer to experiences in Europe, where the species arrived more recently and possibly the invasive populations stand at a different stage compared to those in most North American habitats (Allendorf and Lundquist 2003, Sakai et al. 2001, Sousa et al. 2006). Impacts - Chapter 4 89 The main aim of this paper is thus to provide a detailed, not alarmist, though realistic picture of the current effects of C. fluminea on the Portuguese freshwaterdependent industry. The drinking water treatment, thermal power, cement, pulp and paper, and agricultural (irrigation) sectors were considered in this study. The data presented here may be useful for European industrial pest managers dealing with specific infestation risks and episodes. Moreover, the analysis provided in this paper is also relevant at a broader scale. Portugal seems to have been a gateway by which the Asian clam entered Europe around 30 years ago (Mouthon 1981). In spite of the persistent advice of the scientific community on the importance of dealing with the invasion in its early stages (Araujo et al. 1993, Pérez-Quintero 2008, Sousa et al. 2006, Sousa et al. 2008a), nor the responsible governmental agencies, at the national level, nor the industrial facilities, at their own scale, have done much over this period to minimise the spread of this pest and its impacts. In this context, such a holistic, country-scale overview may assist the official entities in countries at risk of invasion or where the species has arrived not long ago, such as Serbia (Paunović 2007), the United Kingdom (Howlett and Baker 1999) and the Czech Republic (Beran 2006), with the implementation of integrated pest management policies before the biological invasion reaches advanced stages. As a complement to the Asian clam industrial biofouling data, updated information on the species distribution in Portuguese waters is also provided in section 4.3. Such information is critically important for the national freshwater-drawing industrial plants to judge their risk of being infested. It can also be interpreted as the unrestricted spread of the pest at a country-scale within a 30-year window. 4.3. The distribution of Corbicula fluminea in Portugal C. fluminea has been present in Portugal at least since the early 1980s, when it was found in the Tejo River estuary (Mouthon 1981). Since then, the number of studies providing distribution data for the pest in the country, and in the Iberian Peninsula in general, has been increasing significantly (Pérez-Quintero 2008). However, many of them are fragmentary in the sense that they analyse the presence of the species only in specific rivers. For example, Sousa and co-workers documented the Asian clam distribution in the Lima (Sousa et al. 2006) and Minho (Sousa et al. 2008b) Rivers, while Morais et al. (2009) addressed the colonisation of the Guadiana River. In 2006, Reis (2006) provided the first integrated description of the species distribution in the Impacts - Chapter 4 90 country. Two years later, Pérez-Quintero (2008) also presented an overview, slightly less exhaustive than that of Reis, of the Asian clam distribution in Portugal. Fig. 4.1 presents the chronological and current nationwide C. fluminea distribution, based on data resulting from a comprehensive compilation of previously published literature (Araujo et al. 1993, Chainho et al. 2006, Morais et al. 2009, Mouthon 1981, Pérez-Quintero 2007, 2008, Reis 2006, Sousa et al. 2006, 2007) as well as updated records obtained throughout this study. Table 4.1 summarises information on the first records of the species for the major Portuguese watersheds. After the first appearance of C. fluminea in the country (in Tejo River), northern estuaries of Douro and Minho Rivers were also invaded within a ten-year time interval. From 2000 onwards, the Asian clam was noticed in other estuaries and inland waterways. The spread of the species in the Portuguese territory seems to have accelerated significantly over the past decade. Nowadays the pest is present in at least 11 out of the 15 major watersheds in Portugal, having not been reported yet in Ave, Cávado, Leça and Lis River basins (Table 4.1 and Fig. 4.1). Table 4.1. First records of C fluminea in the Portuguese watersheds already invaded. Watershed First record of C. fluminea References Year Location Tejo 1980 Tejo River (estuary) Mouthon 1981 Douro 1988 Douro River (estuary) Nagel 1989 Minho 1989 Minho River (estuary) Araujo et al. 1993 Guadiana 2000 Guadiana River (downstream Alqueva dam) Perez-Quintero 2007 Mondego 2000 Mondego River (estuary) Chainho et al. 2006 Lima 2002 Lima River (estuary) Sousa et al. 2006 Vouga Not known Vouga River/Corujeira Reis 2006 Ribeiras do Oeste Not known Lizandro River Reis 2006 Sado Not known Sado River Morais et al. 2009 Mira 2009 Santa Clara dam Present study Ribeiras do Algarve 2009 Bravura dam Present study Impacts - Chapter 4 91 Fig. 4.1. Distribution and industrial impacts of C. fluminea in Portugal: areas where the species has been reported and location of the freshwater-dependent industries surveyed for problems related to the pest. In the top-left corner is the map of the administrative hydrographic regions. The symbols represent the surveyed freshwaterdependent industries that both reported Asian clam infestations and have not been affected by the pest yet. In all cases, except the power industry sector, all the national facilities especially prone to infestation (i.e. drawing water from surface waterbodies) have been surveyed. See text for details. Impacts - Chapter 4 92 4.4. Methods The drinking water treatment, thermal power, cement, pulp and paper, and agricultural (irrigation) sectors were considered in the present study. These sectors, which rely on the intensive use of water, were selected due to their relevance to the Portuguese economy. General information on each sector was first collected mostly from governmental agencies and industrial associations. After listing the major 454 national facilities of the selected sectors (Table 4.2), these were contacted via email and/or telephone in order to identify the respective water source (freshwater vs sea water; surface water, groundwater vs municipal water) – only the facilities drawing from surface waterbodies were considered to be prone to infestation by the Asian clam (Table 4.2). These facilities were then enquired about the occurrence of current or past infestation episodes. Facilities where the pest was reported underwent further analysis. Such plants were visited and site managers were interviewed in loco to thoroughly document the infestation episodes and responses given to the problem. The site visits and interviews followed a common surveying guide, previously designed to ensure comprehensiveness and standardisation of data collection. Details on the quality of the raw water and treating procedures, system configuration (e.g. pumps, filter meshes, pipe diameters), type of structures affected by the pest, location of and general conditions (e.g. water flow, water quality, cleaning routines) in such structures and mitigation strategies in place were discussed in depth. Questions concerning the quantitative estimation of the infestation costs were also included in the surveying guide, and this topic was thoroughly discussed in the interviews. The exact location of all the facilities surveyed was recorded and included in the georeferenced hydrographical map of the Portuguese territory, where information on the species distribution had been previously incorporated (Fig. 4.1). Affected and unaffected industries were distinguished as different layers for spatial analysis. Impacts - Chapter 4 93 Table 4.2. Portuguese freshwater-dependent industries surveyed for problems related to C. fluminea infestations. Drinking water treatment plants Thermal power plants Cement plants Pulp and paper mills Irrigation systems Number of major water-drawing facilities in the country 420 6 6 6 16 Number of facilities especially prone to infestation and surveyed 149 6 1 3 16 Number of facilities reporting problems 3 2 0 0 4 4.5. Results 4.5.1. General picture of the effects of C. fluminea on Portuguese freshwaterdependent industry Only 175 of the 454 Portuguese water-drawing facilities considered in this study use surface freshwater, and thus are prone to Asian clam infestations (Table 4.2). The remaining ones use groundwater (as some drinking water treatment plants), municipal water (as happens with many of the cement plants and pulp and paper mills) or sea water (one thermal power plant does so), and were thus excluded from the survey. All the facilities susceptible to infestation were successfully surveyed (Table 4.2). Overall, only 5 % of the facilities susceptible to infestation reported problems caused by C. fluminea. None of the relevant cement plants or pulp and paper mills has been affected yet, whilst irrigation systems and thermal power plants seem to be the structures where the pest causes more concerns, with 25 % and 33% of the surface water-drawing systems reporting the presence of the species, respectively (Table 4.2). Out of the 149 relevant drinking water treatment plants, only three face infestation problems currently (Table 4.2). Another one, which is presently deactivated (located in Northwestern Portugal), also reported problems in the early 1990s. Interestingly, in some facilities, including one irrigation system and four drinking water treatment plants, Asian clams have been seen by operators in the surroundings, but no biofouling problems occurred so far. Impacts - Chapter 4 94 4.5.2. Effects of C. fluminea on drinking water treatment plants Fig. 5.2a presents the typical processes implemented by Portuguese waterworks that treat surface water. Raw water is pumped from the source, often a river, through metal grills and screens (mesh of about 1 cm) into reservoirs, where it is temporarily stored. The subsequent treatment steps depend on the raw water quality, which varies greatly across the country. One of the possible treatment configurations involves filtration through rapid gravity filters, followed by disinfection (typically through chlorine injection) that ensures microbiological quality of the final product. Alternatively, the treatment may involve a pre-oxidation stage, preceded by filtration through rapid gravity filters when the raw water turbidity is high. After the pre-oxidation step, flocculation, decantation, filtration and final disinfection follow. C. fluminea appears to be present in Portuguese drinking water treatment facilities since the early 1990s. It was reported in a plant located in the Douro River basin shortly before its deactivation in 1992. About 1.4 tonnes of clams were removed from the bottom of the storage reservoir in that facility (Fig. 4.2a). Currently, the species was found to infest three waterworks (Table 4.2), located in Douro River, Tejo River and Ribeiras do Algarve basins (Fig. 4.1), which reported the first occurrence of the species in 2000, 2008 and 2008, respectively. The main structures affected by the pest differ amongst the facilities. In the Douro River basin plant (Fig. 4.1), over 4 tonnes of clams have been removed during scheduled cleaning procedures (which take place every two years). Clogging of the intake screens occurred as well as accumulation in the storage reservoir and in the ozone injection tanks (Fig. 4.2a), but without major damage to the structures. In 2004 a new pretreatment unit (multilayer sand filter) was installed downstream the raw water reservoir in order to face increased water turbidity. This unit apparently promoted a significant reduction in the amount of clams found downstream. In the Tejo River basin plant (Fig. 4.1), clams have been found on the upper layers of sand filters (Fig. 4.2a). As a result, filter maintenance cycles had to be shortened, and sand has now to be replaced more frequently than before. The last cleaning event involved the discharge of 108 tonnes of sand. In the Ribeiras do Algarve basin plant (Fig. 4.1), clams were only found in a 1.80meter diameter intake pipeline during a periodic cleaning operation. In the three plants, no operation problems related to C. fluminea other than increased complexity and frequency of periodic cleaning and maintenance procedures were mentioned. In particular, alterations in the water odour and taste have not been detected, nor the efficiency of the plant seems to have been significantly affected so far. None of the affected plants implements any specific monitoring programme or control measures to Impacts - Chapter 4 95 deal with the pest. Consistently with this picture, at present, the cost associated with Asian clam infestations in Portuguese waterworks, mainly related to system cleaning and maintenance as well as clams disposal (in landfills), are still negligible, corresponding to, on average, less than 0.01% of a plant’s operation costs (Table 4.3). Impacts - Chapter 4 96 Fig. 4.2. Layout of the typical water systems in Portuguese (a) drinking water treatment plants (b) thermal power plants, and (c) irrigation systems fed by surface waterbodies. Table 4.3. Summary of the current impacts of C. fluminea in the Portuguese freshwaterdependent industry. Drinking water treatment plants Thermal power plants Cement plants Pulp and paper mills Irrigation systems First industrial infestation reported (date and location) Early 1990s, Douro River basin Late 1980s, Tejo River basin - - 2005, Mondego River basin Fraction of the national facilities especially prone to infestation that have already been affected 2 % 33% 0 % 0 % 25 % Severity of the industrial infestation Very low Low - - Moderate Annual economic losses in the sector due to the pest (€) 1 500 40 000 - - 150 000 4.5.3. Effects of C. fluminea on thermal power plants In thermal power plants, aimed at electric power generation, massive volumes of water circulate in the cooling systems, required to complete the steam cycle. For economic reasons, the water running in such systems is untreated or barely treated. A simplified layout of typical cooling systems in Portuguese power stations is presented in Fig. 5.2b. Water, drawn from a nearby waterbody, passes through intake screens to a storage reservoir. From here, it goes to the fire extinction system and, most commonly, to the condensers, from which it is then discharged back into the water source. In some cases, a closed refrigeration system exists, with water running between the condensers and cooling towers. Two of the power stations surveyed, both operating in the Tejo River basin (Fig. 4.1), reported the presence of C. fluminea (Table 4.2). One of them experienced an isolated invasion episode in the late 1980s, which was detected during scheduled cleaning procedures (at the time occurring every 4 years). Clams entered the facility and accumulated in a reduced flow rate 1.80-meter width bypass channel. Almost 800 kg of bivalves were washed out and mechanically removed from the channel. Shells were also found in the cooling system pumps as well as in one of the five condensers (Fig. 4.2b), although significant clogging of these structures had not been noticed. Following this infestation episode, metal monitoring boxes were installed in the bypass channel, and the more critical fire protection water system became inspected on a more regular basis. Impacts - Chapter 4 104 marginally contribute to the infestation because the water residence time tends to be such that the veligers they produce pass through the system much before reaching the settling stage. In the case of the Asian clam, the planktonic development stage after release from the progenitors is much shorter (on the scale of hours) (Ackerman et al. 1994, King et al. 1986, Kraemer and Galloway 1986), meaning that populations that are established closer upstream the facility should constitute an important infestation source. Moreover, contrary to zebra mussels, Asian clams settle to take up an infaunal existence, and it is thus plausible that unattached young individuals in the immediate surroundings of the intake points are more easily sucked into the system. Also, in view of the infaunal character of C. fluminea, it is not completely clear whether the individuals born in the plant may contribute to the population established there. While a planktonic development stage is identified in the species life cycle, the process through which settlement occurs does not seem to be fully understood, and it is possible that newly-born individuals are able to remain inside the plant (McMahon 1983). The role played by and the relative contribution of individuals originated from moderately distant parent populations, very young juveniles sucked into the system and the population established in the plant itself as an infestation source is worth investigating. One major direct implication of the differences discussed above in the mitigation of the two pests is concerned with chemical control strategies. Basically, there are two major types of such strategies: reactive and proactive treatments (Claudi and Mackie 1994). Reactive strategies are targeted at adults already established in the facility, being suitable for systems that can tolerate some degree of biofouling. Proactive strategies are designed to prevent the settlement of the bivalves in the plant. In the case of zebra mussel infestations, reactive chemical treatment is applied to facilitate the removal of the firmly attached adults as well as preventing large individuals, which increase clogging of small cross section structures, to grow in the system. Taking into account that the Asian clam do not attach strongly to surfaces, proactive chemical dosage prior to clams removal does not result in much benefit in terms of the complexity of the cleaning procedure. However, it still prevents the adults to grow large, and may prove to be further advantageous if one can confirm that the resident populations play a significant role as an infestation source. 4.7. Conclusions The study presented here revealed that, somewhat surprisingly, the impacts of the biofouler C. fluminea in the Portuguese freshwater-dependent industry are relatively mild, although the species has been reported in the country since the early 1980s. While, in Impacts - Chapter 4 105 general, the effects of the pest do not justify control measures (e.g. chemical control or the physical alteration of the water systems) other than periodic cleaning for the moment, the sensible advice is that information on the species characteristics and behaviour should be widely disseminated amongst the national plants and systematic monitoring strategies should be implemented. Based on the North American experience, a sudden increase of losses due to the pest in industrial environments may occur. Amongst all the sectors surveyed, irrigation systems are currently the most affected structures, experiencing increasing annual losses that already sum up to 2 % of the overall operating costs. The respective managers are thus very keen to implement more effective pest mitigation programmes. Controlling invasive bivalves in irrigation systems is not an easy task, mainly due to their configuration, the massive volumes of water processed and the need to guarantee plants survival and development, but it is certainly a challenge that is worth being addressed by the scientific community. As no specific measures have been implemented so far in order to minimise the dispersal of the Asian clam in Portugal and its biofouling activity, the results presented here provide a holistic picture of the unrestricted industrial infestation process within a 30year window. They may thus assist official entities in countries at risk of invasion or where the C. fluminea has recently arrived with the implementation of integrated pest management policies. A repeated survey of the impacts of the species on national freshwater-dependent plants within a reasonable length of time and comparison with the present study may contribute to an understanding of the progression of the species in industrial environments. The control of this aquatic pest will certainly benefit from an ample understanding of the infestation process. In this context, studies relating populations’ recruitment rates in industrial facilities to the clams settlement and dispersal, focussing in particular the role played by the mucilaginous byssal thread formed in the early life stages, are welcome. 4.8. Acknowledgements Special thanks are due to all the entities and people that provided important information and assistance for this study, namely Instituto da Água, IP; Instituto da Conservação da Natureza e da Biodiversidade; Associação de Beneficiários do Mira; Associação de Beneficiários da Lezíria Grande de Vila Franca de Xira; Associação de Beneficiários do Plano de Rega do Sotavento Algarvio; Câmara Municipal de Abrantes; Águas do Douro e Paiva, SA; Portucel-Soporcel Group; Energias de Portugal; Pegop - Energia Eléctrica, SA; Célia Alves and Micaela Bento Castro. Financial support from the Portuguese Foundation Impacts - Chapter 4 106 for Science and Technology (PhD scholarship SFRH/BD/33395/2008, Post–Doctoral scholarship SFRH/BPD/44733/2008 and research grant PTDC/AAC-AMB/113515/2009) and CIIMAR/CESAM are gratefully acknowledged. 4.9. References Ackerman JD, Sim B, Nichols SJ, Claudi R. 1994. Review of the early-life history of zebra mussels (Dreissena polymorpha) - comparisons with marine bivalves. Canadian Journal of Zoology-Revue Canadienne De Zoologie 72: 1169-1179. Allendorf FW, Lundquist LL. 2003. Introduction: Population biology, evolution, and control of invasive species. Conservation Biology 17: 24-30. Araujo R, Moreno D, Ramos MA. 1993. The Asiatic clam Corbicula fluminea (Müller, 1774) (Bivalvia: Corbiculidae) in Europe. American Malacological Bulletin 10: 39-49. Beasley CR, Tagliaro CH, Figueiredo WB. 2003. The occurrence of the Asian clam Corbicula fluminea in the lower Amazon Basin. Acta Amazonica 33: 317-324. Beran L. 2006. Spreading expansion of Corbicula fluminea (Mollusca: Bivalvia) in the Czech Republic. Heldia 6: 187/192. Bidwell JR, Farris JL, Cherry DS. 1995. Comparative response of the zebra mussel, Dreissena polymorpha, and the asian clam, Corbicula fluminea, to DGH/QUAT, a nonoxidizing molluscicide. Aquatic Toxicology 33: 183-200. Byers JE, et al. 2002. Directing research to reduce the impacts of nonindigenous species. Conservation Biology 16: 630-640. Chainho P, Costa JL, Chaves ML, Lane MF, Dauer DM, Costa MJ. 2006. Seasonal and spatial patterns of distribution of subtidal benthic invertebrate communities in the Mondego River, Portugal – A poikilohaline estuary. Hydrobiologia 555: 59-74. Cherry DS, Rodgers Jr. JH, Graney RL, Cairns Jr. J. 1980. Dynamics and control of the Asiatic clam in the New River, Virginia. Virginia: Virginia Water Research Center, Virginia Polytechnic Institute and State University. Claudi R, Mackie GL. 1994. Practical manual for zebra mussel monitoring and montrol. Boca Raton: Lewis Publishers. Cooper NL, Bidwell JR, Cherry DS. 2005. Potential effects of Asian clam (Corbicula fluminea) die-offs on native freshwater mussels (Unionidae) II: Porewater ammonia. Journal of the North American Benthological Society 24: 381-394. Impacts - Chapter 4 107 Counts CL. 1986. The zoogeography and history of the invasion of the United States by Corbicula fluminea (Bivalvia: Corbiculidae). Proceedings of the Second International Corbicula Symposium, American Malacological Bulletin - Special edition no.2. DAISIE – European Invasive Alien Species Gateway. www.europe-aliens.org. Acessed 2008. Elliott P, Aldridge DC, Moggridge GD, Chipps M. 2005. The increasing effects of zebra mussels on water installations in England. Water and Environment Journal 19: 367375. Elton C. 1958. The ecology of invasions by animals and plants. USA: The University of Chicago Press. French JRP, Schloesser DW. 1996. Distribution and winter survival health of Asian clams, Corbicula fluminea, in the St Clair River, Michigan. Journal of Freshwater Ecology 11: 183-192. Howlett D, Baker R. 1999. Corbicula fluminea (Müller): New to U.K. Journal of Conchology 36: Only abstract. Ilarri MI, Antunes C, Guilhermino L, Sousa R. 2011. Massive mortality of the Asian clam Corbicula fluminea in a highly invaded area. Biological Invasions 13: 277-280. Ingram WM. 1959. Asiatic clams as potential pests in California water supplies. Journal American Water Works Association: 363-370. Isom B. 1986. Historical review of Asiatic clam (Corbicula) invasion and biofouling of waters and industries in the Americas in Britton J, ed. Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2. Jenner HA, Whitehouse JW, Taylor CJL, Khalanski M. 1998. Cooling water management in European power stations Biology and control of fouling. Hydroécologie Appliquée 10: 1-225. Johnson KI, Henager CH, Page TL, Hayes PF. 1986. Engineering factors influencing Corbicula fouling in nuclear service water systems. American Malacological Bulletin special edition nr.2: 47-52. Karatayev AY, Burlakova LE, Padilla DK. 2005. Contrasting distribution and impacts of two freshwater exotic suspension feeders, Dreissena polymorpha and Corbicula fluminea. Pages 239-262 in Dame RF, Olenin S, eds. The Comparative Roles of Impacts - Chapter 4 108 Suspension-Feeders in Ecosystems, vol. IV. Earth and Environmental Sciences. Dordrecht, The Netherlands: Springer. King CA, Langdon CJ, Counts CL. 1986. Spawning and early development of Corbicula fluminea (Bivalvia, Corbiculidae) in laboratory culture. American Malacological Bulletin 4: 81-88. Kraemer LR, Galloway ML. 1986. Larval development of Corbicula fluminea (Müller) (Bivalvia, Corbiculacea) - An appraisal of its heterochrony. American Malacological Bulletin 4: 61-79. LePage WL. 1993. The impact of Dreissena polymorpha on waterworks operations at Monroe, Michigan: a case history. Pages 333-358 in Nalepa TF, Schloesser DW, eds. Zebra mussels: biology, impacts and control. Boca Raton: Lewis Publishers. Leung B, Lodge DM, Finnoff D, Shogren JF, Lewis MA, Lamberti G. 2002. An ounce of prevention or a pound of cure: bioeconomic risk analysis of invasive species. Proceedings of the Royal Society of London Series B-Biological Sciences 269: 2407-2413. Lovell SJ, Stone SF. 2005. The economic impacts of aquatic invasive species: A review of the literature. NCEE Working Paper Series 05-02. Ludyanskiy ML, McDonald D, Macneill D. 1993. Impact of the zebra mussel, a bivalve invader - Dreissena polymorpha is rapidly colonizing hard surfaces throughout waterways of the United States and Canada. Bioscience 43: 533-544. Mackie GL, Schloesser DW. 1996. Comparative biology of zebra mussels in Europe and North America: An overview. American Zoologist 36: 244-258. McMahon RF. 1977. Shell size frequency distributions of Corbicula manilensis Philippi from a clam fouled steam condenser. McMahon RF. 1983. Ecology of an invasive pest bivalve, Corbicula in Russel-Hunter WD, ed. The Mollusca, vol. 6. London: Academic Press, Inc. Minchin D, Lucy F, Sullivan M. 2002. Zebra mussel: impacts and spread. Pages 135-148 in Leppäkoski E, Gollasch S, Olenin S, eds. Invasive aquatic species of Europe: distribution, impacts and management. Dordrecht: Kluwer Academic Publishers. Morais P, Teodósio J, Reis J, Chícharo MA, Chícharo L. 2009. The Asian clam Corbicula fluminea (Müller, 1774) in the Guadiana River Basin (Southwestern Iberian Peninsula): Setting the record straight. Aquatic Invasions 4: 681.684. Impacts - Chapter 4 109 Mouthon J. 1981. Sur la présence en France et au Portugal de Corbicula (Bivalvia, Corbiculidae) originaire d' Asie. Basteria 45: 109-116. Paunović M. 2007. Distribution of Asian clams Corbicula fluminea (Müller, 1774) and C. fluminalis (Müller, 1774) in Serbia. Aquatic Invasions 2: 99-106. Pérez-Quintero JC. 2007. Diversity, habitat use and conservation of freshwater molluscs in the lower Guadiana River basin (SW Iberian Peninsula). Aquatic Conservation: Marine and Freshwater Ecosystems 17: 485-501. Pérez-Quintero JC. 2008. Revision of the distribution of Corbicula fluminea (Müller 1744) in the Iberian Peninsula. Aquatic Invasions 3: 355-358. Phelps HL. 1994. The asiatic clam (Corbicula fluminea) invasion and system-level ecological change in the Potomac River estuary near Washington, DC. Estuaries 17: 614-621. Pimentel D, Zuniga R, Morrison D. 2005. Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics 52: 273-288. Prezant RS, Chalermwat K. 1984. Flotation of the bivalve Corbicula fluminea as a means of dispersal. Science 225: 1491-1493. Prokopovich NP, Herbert DJ. 1965. Sedimentation in the Delta-Mendota Canal. Journal AWWA: 375-382. Reis J. 2006. Atlas dos bivalves de água doce de Portugal Continental. Lisboa: ICN. Sakai AK, et al. 2001. The population biology of invasive species. Annual Review of Ecology, Evolution and Systematics 32. Scheller JL. 1997. The effect of die-offs of asian clams (Corbicula fluminea) on native freshwater mussels (Unionidae). Faculty of the Virginia Polytechnic Institute and State University of Blacksburg, Blacksburg. Shigesada N, Kawasaki K. 1997. Biological Invasions - Theory and Practice. Oxford: Oxford University Press. Sickel JB. 1986. Corbicula population mortalities: factors influencing population control in Prezant RS, ed. Proceedings of the Second International Corbicula Symposium, American Malacological Bulletin - Special edition no.2. Sinclair RM. 1964. Clam pests in Tennessee water supplies. Journal American Water Works Association: 592-599. Impacts - Chapter 4 110 Sousa R, Antunes C, Guilhermino L. 2006. Factors influencing the occurrence and distribution of Corbicula fluminea (Müller, 1774) in the River Lima estuary. Annales De Limnologie-International Journal of Limnology 42: 165-171. Sousa R, Antunes C, Guilhermino L. 2007. Species composition and monthly variation of the Molluscan fauna in the freshwater subtidal area of the River Minho estuary. Estuarine, Coastal and Shelf Science 75: 90-100. Sousa R, Nogueira A, Gaspar M, Antunes C, Guilhermino L. 2008a. Growth and extremely high production of the non-indigenous invasive species Corbicula fluminea (Müller, 1774): Possible implications for ecosystem functioning. Estuarine, Coastal and Shelf Science 80: 289-295. Sousa R, Rufino M, Gaspar M, Antunes C, Guilhermino L. 2008b. Abiotic impacts on spatial and temporal distribution of Corbicula fluminea (Müller, 1774) in the River Minho estuary, Portugal. Aquatic Conservation: Marine and Freshwater Ecosystems 18: 98-110. Sprecher SL, Getsinger KD. 2000. Zebra mussel chemical control guide. Vicksburg: Environmental Laboratory. Vitousek PM, Dantonio CM, Loope LL, R. W. 1996. Biological invasions as global environmental change. American Scientist 84: 468-478. Voelz NJ, McArthur JV, Rader RB. 1998. Upstream mobility of the Asiatic clam Corbicula fluminea: Identifying potential dispersal agents. Journal of Freshwater Ecology 13: 39-45. Vohmann A, Borcherding J, Kureck A, bij de Vaate A, Arndt H, Weitere M. 2009. Strong body mass decrease of the invasive clam Corbicula fluminea during summer. Biological Invasions 12: 53-64. Williams CJ, McMahon RF. 1986. Power station entrainment of Corbicula fluminea (Müller) in relation to population dynamics, reproductive cycle and biotic and abiotic variables. Pages 99-111 in Britton JC, ed. Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2. CHAPTER 5 Sensivity of the invasive bivalve Corbicula fluminea to candidate control chemicals: The role of dissolved oxygen conditions Control - Chapter 5 113 Sensivity of the invasive bivalve Corbicula fluminea to candidate control chemicals: The role of dissolved oxygen conditions Inês C. Rosaa, Joana L. Pereirab, Fernando Gonçalvesb, Raquel Costab,* aDepartment of Biology & CESAM – Centre for Environmental and Marine Studies, University of Aveiro, Campus de Santiago, 3810-193 Aveiro, Portugal. Telephone: +351234 370 350. Fax: +351234 372 587. bCIEPQPF-Research Centre for Chemical Process Engineering and Forest Products, Department of Chemical Engineering, University of Coimbra, Pólo II, Rua Sílvio Lima, 3030-790 Coimbra, Portugal. Telephone: +351239798700. Fax: +351239798703. *Corresponding author: [email protected]. - Rosa IC, Pereira JL, Gonçalves F & Costa R. Sensivity of the invasive bivalve Corbicula fluminea to candidate control chemicals: The role of dissolved oxygen conditions (in preparation) Control - Chapter 5 120 clams to oxygen deprivation as the response of organisms collected before and after the storms were compared. Statistical comparison between hypoxia control treatments of tests made before and after the storm confirms that mortality of juveniles was significantly lower before the storm (Fisher’s exact test: p < 0.01) while there seems to exist no significant difference in the sensitivity of adult clams to hypoxic conditions (Fisher’s exact test: p = 0.314). Based on this analysis, results will be presented and discussed considering two separate groups of chemicals: (i) niclosamide and polyDADMAC, which were tested before the storm, and (ii) copper sulfate and ammonium nitrate, which were tested after the storm. The concentration-response curves were found to generally fit the probit model (Chi2: p > 0.05) and the curves under hypoxia and normoxia within each chemical mostly present similar shape (Fig. 5.1), which suggests reduced interaction between oxygen level and chemical concentration on the yielded effect. This pattern was corroborated by the statistics (Table 5.1): significant interactions were only found when ammonium nitrate was tested and when niclosamide was tested against adult clams. Although a significant interaction between factors was not frequently noticed, both the concentration and the oxygen level consistently affected clam mortality for all chemicals tested and both clam life stages - note the exception of polyDADMAC tested against adults, where oxygen level did not significantly impair clam survival. Despite the general lack of significant interactive effect between oxygen level and chemical concentration (Table 5.1), both juveniles and adults were more sensitive to the chemicals under hypoxia compared to normoxia as indicated by the graphical comparison of concentration-curves in Fig. 5.1. This is particularly evident in the response of juvenile clams to copper sulphate and less evident but still noticeable in the response of both juvenile and adult clams to niclosamide (Fig. 5.1). Some specific patterns are worth mentioning as Fig. 5.1 is scrutinized. For example, oxygen level had a relevant role in defining juvenile and adult clam mortality under low ammonium nitrate concentrations, but as the concentration increases the difference between the responses under different oxygen levels decreases. A similar data profile was found for the exposure of adult clams to copper sulphate. Data on juvenile clam mortality exposed to niclosamide seem to indicate the opposite pattern, hence indicating a growing effect of the oxygen level as concentrations increase; the same seems to apply to adults exposed to polyDADMAC although the full concentration-response curve (currently the maximum effect recorded is below 80% mortality) is necessary to confirm the pattern. Juveniles were significantly less susceptible to niclosamide than adults both under normoxia and hypoxia while the opposite was recorded following exposure to polyDADMAC under hypoxia (Fig. 5.1, Table Control - Chapter 5 121 5.2). Juveniles were significantly more susceptible to copper sulphate under normoxia and to ammonium nitrate under both dissolved oxygen conditions (Fig. 5.1, Table 5.2). ADULTS JUVENILES Niclosamide 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Clam mortality (%) 0 20 40 60 80 100 0.0 0.5 1.0 1.5 2.0 2.5 3.0 ** * * * NH4NO3 Concentration (mg L-1) 040 80 120 160 200 240 280 320 Clam mortality (%) 0 20 40 60 80 100 040 80 120 160 200 240 280 320 ***** * **** * ** 0 2 4 6 8 10 12 14 16 18 20 22 CuSO4 0 2 4 6 8 10 12 14 16 18 20 22 Clam mortality (%) 0 20 40 60 80 100 ** ** * * 0 5 10 15 20 25 30 35 40 Hypoxia Normoxia Hypoxia probit model Normoxia probit model PolyDADMAC 0 5 10 15 20 25 30 35 40 Clam mortality (%) 0 20 40 60 80 100 * * * Fig. 5.1. Mortality (%) of juvenile (left-hand panel) and adult (right-hand panel) C. fluminea after 96-h exposure to niclosamide, polyDADMAC, copper sulfate and ammonium nitrate under normoxic and hypoxic conditions. The points refer to experimental data (mean ± SD) and the dashed lines represent the probit model adjusted to each dataset. Asterisks (*) mark the chemical treatments where mortality records significantly differ from the corresponding control as indicated by the Dunnet test following one-way ANOVA (p < 0.05; Table 2). Control - Chapter 5 122 Table 5.1. Summary of two-way ANOVAs applied to address the effect of oxygen level (normoxia and hypoxia) and chemical concentration in C. fluminea juvenile and adult mortality after 96-h exposure to niclosamide, polyDADMAC, copper sulfate, and ammonium nitrate. Significant effects (significance level = 0.05) are marked in bold. Juveniles Adults Chemical Source df MS F P MS F p Niclosamide Oxygen level 1 2844.4 12.34 0.002 30044.4 235.13 < 0.001 Concentration 5 906.7 3.93 0.010 269.1 21.06 < 0.001 Interaction 5 277.8 1.20 0.337 71708 5.62 0.001 Residual 24 230.6 127.8 PolyDADMAC Oxygen level 1 3211.1 25.69 < 0.001 1002.8 3.28 0.083 Concentration 5 751.1 6.01 0.001 1631.7 5.34 0.002 Interaction 5 84.4 0.68 0.646 596.1 1.95 0.123 Residual 24 125.0 305.6 Copper Sulfate Oxygen level 1 4444.4 17.98 < 0.001 27777.8 185.19 < 0.001 Concentration 5 2997.8 12.13 < 0.001 651.1 4.34 0.006 Interaction 5 511.1 2.07 0.105 117.8 0.79 0.570 Residual 24 247.2 150.0 Ammonium Nitrate Oxygen level 1 5136.1 88.05 < 0.001 5625.0 29.35 < 0.001 Concentration 5 3362.8 57.65 < 0.001 1636.1 8.54 < 0.001 Interaction 5 469.4 8.05 < 0.001 671.7 3.50 0.016 Residual 24 58.3 191.7 The variation in clam sensitivity to the different chemicals tested under hypoxia relatively to normoxia generally followed a consistent tendency regardless the focus is on juveniles or adults (Fig. 5.2): at low chemical concentrations, depressed oxygen conditions seem to define the response of the clams; however, as chemical concentration becomes higher, the increase of clam sensitivity under hypoxia relatively to normoxia tended to zero, indicating increased relevance of the chemical rather than oxygen level in determining the effect. For tests with niclosamide (adults), polyDADMAC (juveniles), copper sulfate (juveniles and adults) and ammonium nitrate (adults) there was an accentuated decrease in the increment of clam mortality under hypoxia relatively to normoxia as concentrations increase until reaching a first threshold. Control - Chapter 5 123 Table 2: Summary of one-way ANOVAs applied to address the main effects of chemical concentration within each oxygen level, in C. fluminea juvenile and adult mortality after 96h exposure to niclosamide, polyDADMAC, copper sulfate, and ammonium nitrate. Significant effects (significance level = 0.05) are marked in bold. Juveniles Adults Chemical Source df F p df F p Hypoxia Niclosamide Concentration 5 4.15 0.02 5 6.22 < 0.001 Residual 12 24 PolyDADMAC Concentration 5 3.51 0.035 5 2.10 0.136 Residual 12 12 Copper Sulfate Concentration 5 2.72 0.072 5 3.89 0.025 Residual 12 12 Ammonium nitrate Concentration 5 13.13 < 0.001 5 1.23 0.326 Residual 24 24 Normoxia Niclosamide Concentration 5 0.87 0.532 5 20.45 < 0.001 Residual 12 24 PolyDADMAC Concentration 5 3.06 0.052 5 7.25 0.002 Residual 12 12 Copper Sulfate Concentration 5 12.22 < 0.001 5 1.65 0.221 Residual 12 12 Ammonium nitrate Concentration 5 52.60 < 0.001 5 10.81 < 0.001 Residual 24 24 Then, the curves evidence a lower slope and finally, as higher concentrations are reached, the tendency to null slopes can be observed denoting very little sensitivity increment under hypoxia relatively to normoxia. A slight variation in this pattern was observed for niclosamide and ammonium nitrate tested against juvenile clams. As polyDADMAC was tested against adult clams, dissolved oxygen level seems to have an almost irrelevant role in promoting adult clam mortality, being chemical concentration the factor that seems to constrain the effect across the whole range, which is consistent with the statistics (Table 5.1). Control - Chapter 5 124 Concentration Niclosamide (mg L-1) 1 2 3 4 5 6 7 8 9 Niclosamide Concentration PolyDADMAC (mg/L) 1e+4 2e+4 3e+4 4e+4 5e+4 6e+4 PolyDADMAC JUVENILES ADULTS 2 4 6 8 10 12 14 16 Ratio 0 1 2 3 20 40 60 80 100 120 140 160 180 2.0e+4 4.0e+4 6.0e+4 8.0e+4 1.0e+5 1.2e+5 Ratio 0 1 2 3 5e+4 1e+5 2e+5 2e+5 3e+5 3e+5 Concentration CuSO4 (mg/L) 100 200 300 400 500 600 700 800 CuSO4 Concentration NH4NO3 (mg L-1) 50 100 150 200 250 300 NH4NO3 Fig. 5.2. Curves representing the increment in chemical-driven mortality of juvenile (lefthand panel) and adult (right-hand panel) C. fluminea. The curves were given by the ratio (H-N)/N, where H and N represents clam mortality under hypoxia and normoxia, respectively (see “Data analysis” for details). The figure groups comparable chemicals considering the organism’s collection period (see text for details): niclosamide with polyDADMAC (upper panels) and copper sulfate with ammonium nitrate (lower panels). Control - Chapter 5 125 5.5. Discussion Several chemicals have been observed to have greater efficacy to control biofoulers at higher ambient temperatures (Mackie and Claudi 2010). Higher sensitivity to some contaminants under hypoxia has also been proven to occur for some macrofouler species including C. fluminea (Tran et al. 2001, Tran et al. 2008). In sites (particularly in lenthic systems) where natural Asian clam populations establish, scenarios of oxygen deprivation together with chemical contamination are likely to occur and tend to be common given the actual context of global climate change and increased man-driven contamination pressuring freshwater ecosystems worldwide (Cloern and Jassby 2012, Diaz 2001). On the other hand, in particular industrial environments, hypoxia can be used to increase chemical efficiency contributing to the improvement of biofouling control measures, although given the costs involved only specific systems would probably consider the use of such a demanding solution. In this context, the present study provides systematic information which allows concluding on the ability of hypoxia conditions to change C. fluminea sensitivity to candidate control chemicals with different modes of action. This baseline information allows to infer on whether intermediate levels of dissolved oxygen, which are more common in natural invaded systems or less costly to achieve in infested industrial systems when compared with anoxia, are worth investigating in the future. The results of the present study indicate that, in general, oxygen depletion increases the efficiency of biocides against the Asian clam, considering the mortality of juvenile and adult laboratory populations under short-term exposure conditions. Both niclosamide and polyDADMAC have been assumed to exert toxicity in biological matrices through the impairment of cellular respiration: niclosamide was proven to affect the respiratory metabolism of snail pests possibly by induction of mitochondria fragmentation (Park et al. 2011, WHO 2002) whereas polyDADMAC is expected to cause disruption of membrane transfer mechanisms which may influence cellular gas exchange processes (Post et al. 1997). Despite the similarities in the chemical’s mechanism of toxicity, oxygen level seems to influence their efficiency against the Asian clam at different scales. In fact, the results indicate that hypoxia levels contributed more to the efficiency of niclosamide than to the efficiency of polyDADMAC regardless the concentrations focused. Niclosamide is a molluscicide designed to act over a very specific physiological target while polyDADMAC is a flocculant that is expected to impair the respiratory metabolism by generally constraining gas exchange across biological membranes. The differences in the specificity of the biocides target within the organism may explain the variation in the efficiency of depressed oxygen levels in promoting the biocide effects. Both candidate biocides have great potential to be used integrated in management practices targeted at Control - Chapter 5 126 the Asian clam. Niclosamide is short-lived in water (WHO 2002) which constitutes a major stimulus to its use; polyDADMAC is already used in the water treatment industry as a flocculant (Ariffin et al. 2012) and thus advantages may arise from its use as a multiple function chemical. However, one should recognise that only high concentrations of polyDADMAC deliver the relevant efficiency levels, even when hypoxia conditions are set in parallel to chemical dosage (concentrations as high as 3000 mg L-1 and 4000 mg L-1 resulted in less than 40 and 80% mortality for juveniles and adults, respectively, in the present study). According to former data on the environmental selectivity of this flocculant (Gomes et al., submitted), polyDADMAC elicits negative effects in standard indicator species (Pseudokirchneriella subcapitata and Daphnia magna) at lower concentrations, thus indicating its hazardous potential. Although both copper sulphate and ammonium nitrate showed increased efficiency under deprived oxygen conditions, the former was effective at concentrations one order of magnitude lower than the latter. The chemical’s mechanism of toxicity may also have played its role in distinguishing the chemicals as to their efficiency increase under hypoxia conditions (particularly evident as the response of adult clams is compared). Both copper and hypoxia are inducers of oxidative stress with the following structural, pathological and functional damage occurring frequently (Livingstone 2001, Lushchak 2011). In organisms lacking haemoglobin, which seems to be the case of C. fluminea (Tran et al. 2000), the mechanism of toxicity of ammonium nitrate should be coincident with the mechanism of toxicity of unionized ammonia, i.e., damage in the gill epithelium, stimulation of glycolisis, suppression of Krebs cycle, and uncoupling oxidative phosphorylation (Camargo and Alonso 2006). These effects link to the oxygen metabolism but eventually not as directly as the interference in reactive oxygen species balance does, hence the lower efficiency of the treatment with ammonium nitrate compared to copper sulphate. Copper has a very long history of use as an antifoulant and its dosage is still considered one of the most effective and practical methods of preventing fouling in submerged structures (e.g. by its use as antifouling ink) (Piola et al. 2009). Its high toxicity to the Asian clam has already been registered (Mattice 1983) and testing of its potential as a chemical control method for this biofouler has already been carried out (Ingram 1959). LC50 values calculated with the results of the present study (data not shown) and recorded in other studies (Mattice 1983) reveal that concentrations between 0.94 mg L-1 and 6.77 mg L-1 are effective against adult clams following 96 h of exposure. However, Ingram (1959), refers that, in the field, much higher concentrations (750 mg L-1) are necessary to control C. fluminea populations. Therefore, although copper sulfate seems a good candidate to integrate control programs for the Asian clam, further studies Control - Chapter 5 127 considering larger-scale assessment and accounting to the chemical environmental selectivity should be envisaged. Despite its apparently lower efficiency against the Asian clam, advantages may also come from the use of ammonium nitrate as a biocide particularly in open waters already contaminated with this chemical due to it is use in agricultural activities (Mackie and Claudi 2010) Because the complete dataset of this study could not be presented here (see the Introduction section), only the clam’s responses to chemicals exerting toxicity over the respiratory metabolism can be discussed. Although the effects result from the chemical’s action in targets of different physiological specificity, all refer to the same general metabolic pathway, which prevents deeper analysis on whether distinct mechanisms of toxicity play a role in defining the way oxygen conditions affect the responses to the chemical challenges. Differences between individuals of different life-stages in chemical tolerance have been reported by some studies considering the Asian clam (e.g. Belanger et al. 1991, McMahon and Lutey 1988). Our results were in accordance, with differential sensitivity to the test conditions juveniles/young adults and older clams being consistently found. Different systems may be impacted by different C. fluminea life-stages, e.g. industrial strainers only allow the entrance of juvenile clams. In these cases, and facing the differences in sensibility to test conditions, stakeholders must prioritize information on juvenile clams rather than on adults. Hypoxia in natural waters can be of spontaneous origin (e.g. seasonal stratification), but most of the times it results from human activities (Hattink et al. 2005). When considering industrial environments, oxygen deprivation may be accomplished by adding an oxygen-scavenging chemical into a closed system (e.g. Smithson 1986) or by keeping a static system (e.g. pipeline) for a sufficient time period (Mackie and Claudi 2010). However, industrial methods to achieve hypoxia are not always feasible, may require very long application times, and poor oxygen levels often result in a dramatic increase of sulfate-reducing bacteria which in turn causes corrosion of the materials (Johnson and McMahon 1998, Mackie and Claudi 2010). Therefore, stakeholders must carefully evaluate if the costs and impairments of employing oxygen deprivation compensate the benefits in pest management in each particular case. When dealing with chemical application, other concerns must be taken into account particularly in natural environments or when treated water is to be discharged into neighboring waterways (Mackie and Claudi 2010): chemicals and/or their by-products can be highly toxic to nontarget organisms damaging the ecosystem. Environmental safety should hence be always an additional factor to the equation when managing invasive species. Some rules that Control - Chapter 5 128 apply for the safer use of chemical control include its use in limited settings (i.e. closed systems or under static conditions) and/or conjugated with specific remediation strategies (e.g. application of bentonite clay to transform the active ingredient, thereby rendering it nontoxic) before discharging into the waterways (Fisher et al. 1991 , Mackie and Claudi 2010). 5.6. References Anderson KB, Thompson CM, Sparks RE, Paparo AA. 1976. Effects of potassium on adult Asiatic clams, Corbicula manilensis. Biological Notes. Illinois Natural History Survey 98: 3-7. Araujo R, Moreno D, Ramos MA. 1993. The Asiatic clam Corbicula fluminea (Müller, 1774) (Bivalvia: Corbiculidae) in Europe. American Malacological Bulletin 10: 39-49. Ariffin A, Razali MAA, Ahmad Z. 2012. PolyDADMAC and polyacrylamide as a hybrid flocculation system in the treatment of pulp and paper mills waste water. Chemical Engineering Journal 179: 107-111. Barinova SS, Yehuda G, Nevo E. 2010. Comparative analysis of algal communities in the rivers of northern and southern Israel as bearing on ecological consequences of climate change. Journal of Arid Environments 74: 765-776. Beasley CR, Tagliaro CH, Figueiredo WB. 2003. The occurrence of the Asian clam Corbicula fluminea in the lower Amazon Basin. Acta Amazonica 33: 317-324. Belanger SE, Cherry DS, Farris JL, Sappington KG, Cairns J. 1991. Sensitivity of the asiatic clam to various biocidal control agents. Journal American Water Works Association 83: 79-87. Beltran KS, Pocsidio GN. 2009. Acetylcholinesterase activity in Corbicula fluminea Müller, as a biomarker of organophosphate pesticide pollution in Pinacanauan River, Philippines. Environmental Monitoring and Assessment 165: 331-340. Camargo JA, Alonso A. 2006. Ecological and toxicological effects of inorganic nitrogen pollution in aquatic ecosystems: A global assessment. Environment International 32: 831-849. Daum KA, Newland LW, Britton JC, Champagne L, Hagen J. 1977. Responses of Corbicula to potassium. First International Corbicula Symposium. Fort Worth, Texas, USA: Texas Christian University. Control - Chapter 5 129 Diaz RJ. 2001. Overview of hypoxia around the world. Journal of Environmental Quality 30: 275-281. Doherty FG, Farris JL, Cherry DS, Cairns Jr. J. 1986. Control of the Freshwater Fouling Bivalve Corbicula fluminea by Halogenation. Archives of Environmental Contamination and Toxicology 15: 535-542. Doherty FG, Cherry DS. 1988. Tolerance of the asiatic clam Corbicula spp. to lethal levels of toxic stressors - a review. Environmental Pollution 51: 269-313. Finney D. 1971. Probit Analysis. Cambridge, UK: Cambridge University Press. Fisher SW, Bernard DO. 1991. Methods for evaluating zebra mussel control products in laboratory and field studies. Journal of Shellfish Research 10: 367-371. Hakenkamp CC, Palmer MA. 1999. Introduced bivalves in freshwater ecosystems: the impact of Corbicula on organic matter dynamics in a sandy stream. Oecologia 119: 445-451. Johnson PD, McMahon RF. 1998. Effects of temperature and chronic hypoxia on survivorship of the zebra mussel (Dreissena polymorpha) and Asian clam (Corbicula fluminea). Canadian Journal of Fisheries and Aquatic Sciences 55: 1564-1572. Lushchak VI. 2011. Environmentally induced oxidative stress in aquatic animals. Aquatic Toxicology 101: 13-30. Mackie GL, Claudi R. 2010. Monitoring and control of macrofouling mollusks in fresh water systems. Boca Raton, FL: CRC Press. Matthews MA, McMahon RF. 1999. Effects of temperature and temperature acclimation on survival of zebra mussels (Dreissena polymorpha) and Asian clams (Corbicula fluminea) under extreme hypoxia. Journal of Molluscan Studies 65: 317-325. Mattice JS. 1983. Freshwater macrofouling and control with emphasis on Corbicula. Pages 1-30 in Diaz-Tous IA, Miller MJ, Mussalli IG, eds. Symposium on Condenser Macrofouling Control Technologies: The State of the Art. California, USA: Electric Power Research Institute. Page T, Neitzel D, Simmons M. 1986. Biofouling of power plant service systems by Corbicula in Britton JC, ed. Proceedings of the Second International Corbicula Symposium: American Malacological Bulletin - Special edition no.2.