T ansc ip ion and splicing dynamics du ing ea ly D osophila
de elopmen
PEDRO PRUDÊNCIO,
1,2,5
ROSINA SAVISAAR,
1,5
KENNY REBELO,
1,4
,
5
RUI GONÇALO MARTINHO,
1,2,3
and MARIA CARMO-FONSECA
1
1
Ins i u o de Medicina Molecula João Lobo An unes, Faculdade de Medicina, Uni e sidade de Lisboa, 1649-028 Lisboa, Po ugal
2
Alga e Biomedical Cen e Resea ch Ins i u e (ABC-RI), Uni e sidade do Alga e, 8005-139 Fa o, Po ugal
3
Depa men o Medical Sciences and Ins i u e o Biomedicine (iBiMED), Uni e sidade de A ei o, 3810-193 A ei o, Po ugal
ABSTRACT
Widesp ead co ansc ip ional splicing has been demons a ed om yeas o human. Howe e , mos s udies o da e ad-
d essing he kine ics o splicing ela i e o ansc ip ion used ei he Saccha omyces ce e isiae o me azoan cul u ed cell
lines. He e, we adap ed na i e elonga ing ansc ip sequencing echnology (NET-seq) o measu e co ansc ip ional splic-
ing dynamics du ing he ea ly de elopmen al s ages o D osophila melanogas e emb yos. Ou esul s e eal he posi ion
o RNA polyme ase II (Pol II) when bo h canonical and ecu si e splicing occu . We ound he e ogenei y in splicing dynam-
ics, wi h some RNAs spliced immedia ely a e in on ansc ip ion, whe eas o o he ansc ip s no splicing was obse ed
o e he i s 100 n o he downs eam exon. In ons ha show splicing comple ion be o e PolII has eached he end o he
downs eam exon a e necessa ily in on-de ined. We s udied he splicing dynamics o bo h nascen p e-mRNAs an-
sc ibed in he ea ly emb yo, which ha e ew and sho in ons, as well as p e-mRNAs ansc ibed la e in emb yonic de el-
opmen , which con ain mul iple long in ons. As expec ed, we ound a ela ionship be ween he p opo ion o spliced
eads and in on size. Howe e , in on de ini ion was obse ed a all in on sizes. We u he obse ed ha genes an-
sc ibed in he ea ly emb yo end o be isola ed in he genome whe eas genes ansc ibed la e a e o en o e lapped by
a neighbo ing con e gen gene. In isola ed genes, ansc ip ion e mina ion occu ed soon a e he polyadenyla ion
si e, while in o e lapped genes, Pol II pe sis ed associa ed wi h he DNA empla e a e clea age and polyadenyla ion
o he nascen ansc ip . Taken oge he , ou da a un a el no el dynamic ea u es o Pol II ansc ip ion and splicing in
he de eloping D osophila emb yo.
Keywo ds: D osophila melanogas e emb yo; NET-seq; ansc ip ion e mina ion; splicing kine ics
INTRODUCTION
I is by now la gely accep ed ha splicing can happen, and
o en does happen, while ansc ip ion is s ill in p og ess
(Beye and Osheim 1988; Ca illo Oes e eich e al.
2010; Ameu e al. 2011; Khodo e al. 2011; Windhage
e al. 2012; B ugiolo e al. 2013; Nojima e al. 2015;
Alpe e al. 2017). I is also known ha he p ocesses o
splicing and ansc ip ion a e igh ly in e linked. The RNA
polyme ase II (Pol II) elonga ion a e can a ec exon inclu-
sion (de la Ma a e al. 2003; Fong e al. 2014; Aslanzadeh
e al. 2018; Maslon e al. 2019), and many o he p o eins
in ol ed in splicing associa e wi h he Pol II la ge subuni
ca boxy- e minal domain (CTD) (Mo is and G eenlea
2000; Emili e al. 2002; Da id e al. 2011; Gö nemann
e al. 2011; Hsin and Manley 2012; Nojima e al. 2018).
Con e sely, splicing may also a ec ansc ip ion, wi h
e idence sugges ing ha Pol II slows down a exons
(Alexande e al. 2010; Ca illo Oes e eich e al. 2010;
Jonke s e al. 2014; Veloso e al. 2014; Maye e al.
2015), po en ially o allow o splicing o comple e.
Se e al s udies ha e add essed he iming o in on exci-
sion ela i e o Pol II elonga ion. A nascen RNA sequencing
s udy (Ca illo Oes e eich e al. 2016) showed ha in
Saccha omyces ce e isiae, splicing could occu as soon as
he 3′splice si e had eme ged om he ansc ip ion machin-
e y, sugges ing ha splicing may be comple ed immedia ely
a e in on ansc ip ion. P e ious a emp s o de e mine he
du a ion o splicing in i o had e u ned es ima es anging
om a ew seconds o se e al minu es (Alpe e al. 2017).
The lowes o hese es ima es, such as he ew-second es i-
ma e epo ed in Ma in e al. (2013), a e consis en wi h
4
P esen add ess: Donnelly Cen e, Uni e si y o To on o, To on o,
On a io M5S 3E1, Canada
5
These au ho s con ibu ed equally o his wo k.
Co esponding au ho s: ca mo. [email protected] ,
[email p o ec ed]
A icle is online a h p://www. najou nal.o g/cgi/doi/10.1261/ na.
078933.121. F eely a ailable online h ough he RNA Open Access
op ion.
© 2022 P udêncio e al. This a icle, published in RNA, is a ailable
unde a C ea i e Commons License (A ibu ion 4.0 In e na ional), as
desc ibed a h p://c ea i ecommons.o g/licenses/by/4.0/.
RNA (2022) 28:139–161; Published by Cold Sp ing Ha bo Labo a o y P ess o he RNA Socie y 139
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
splicing being comple ed igh a e he 3′splice si e is an-
sc ibed. The mos ecen b eak h oughs in he ield ollowed
he de elopmen o long- ead nascen RNA sequencing
echnologies (D exle e al. 2020; Reime e al. 2021;
Sousa-Luís e al. 2021). Collec i ely, hese s udies pe o med
in human and D osophila cul u ed cell lines show ha al-
hough many in ons a e immedia ely excised as soon as
he downs eam exon eme ges om Pol II, a subse emains
unspliced and p og essi ely unde goes delayed splicing
while Pol II ansc ibes u he (D exle e al. 2020; Reime
e al. 2021; Sousa-Luís e al. 2021).
He e, we s udied he dynamic p ope ies o ansc ip ion
and co ansc ip ional splicing du ing he ea ly s ages o
de elopmen in D osophila melanogas e emb yos using
na i e elonga ing ansc ip sequencing (NET-seq)
(Chu chman and Weissman 2011; Nojima e al. 2015). An
ad an age o using D osophila emb yos is ha hey a e
mo e physiological han cul u ed cell lines. Mo eo e ,
compa ed o human, he D osophila genome is mo e com-
pac (G a eley e al. 2011) and hus he co e age o NET-
seq eads on in agenic egions is highe . Ano he ad an-
age o he D osophila model is ha genes ansc ibed ini-
ially in he emb yo ha e ew and sho in ons (like yeas
genes), whe eas genes ansc ibed la e con ain mul iple
long in ons (mo e simila o human genes). An addi ional
ea u e o D osophila is he p esence o many genes wi h
excep ionally long in ons ha a e subdi ided by a nonca-
nonical mechanism e med ecu si e splicing (Du e al.
2015; Joseph e al. 2018; Pai e al. 2018). Fo all hese ea-
sons, D osophila is an a ac i e model o s udy co an-
sc ip ional splicing dynamics.
D osophila ea ly de elopmen is cha ac e ized by apid
mi o ic cycles ha lack cy okinesis, esul ing in nuclea p o-
li e a ion in a syncy ial cy oplasm (Campos-O ega 1985;
La e e al. 2015). Du ing hese ini ial mi o ic di isions,
which impose signi ican cons ain s on ansc ip ion and
splicing (She moen and O’Fa ell 1991; Ro he e al.
1992; Guilgu e al. 2014; Ma inho e al. 2015; Sandle
e al. 2018; Kwasnieski e al. 2019), he emb yo la gely e-
lies on ma e nally deposi ed mRNAs. Subsequen ly, he
du a ion o he cell cycle is p og essi ely expanded, mem-
b anes o m be ween he nuclei and seg ega e hem in o
cells, and he zygo ic ansc ip ome s a s o be ully ex-
p essed (Campos-O ega 1985; Bly he and Wieschaus
2015; Yuan e al. 2016). By pe o ming dNET-seq in he
de eloping D osophila emb yo, we ha e un a eled no el
dynamic ea u es o Pol II ansc ip ion and splicing.
RESULTS
Na i e elonga ing ansc ip sequencing
in D osophila emb yos (dNET-seq)
Ou i s ask was o adap he NET-seq echnology o use
in D osophila emb yos (hence o h e e ed o as dNET-
seq). The NET-seq echnique in ol es isola ion o an-
sc ip ion complexes o med by Pol II, he DNA empla e
and he nascen RNA by immunop ecipi a ion, wi hou
c osslinking (Chu chman and Weissman 2011; Nojima
e al. 2015). A e solubiliza ion o Pol II complexes unde
na i e condi ions by ex ensi e mic ococcal nuclease
(MNase) diges ion o isola ed na i e ch oma in, elonga ion
complexes we e immunop ecipi a ed using an ibodies
ha speci ically ecognize di e en phospho yla ion s a es
o he Pol II CTD (Nojima e al. 2015).
We collec ed emb yos a 2–3 h a e e iliza ion ( e-
e ed o as ea ly emb yos) and 4–6 h a e e iliza ion ( e-
e ed o as la e emb yos) (Fig. 1A). Analysis o emb yos
s ained wi h a luo escen dye o isualize DNA (Fig. 1B) e-
ealed ha ea ly emb yos we e p edominan ly in mi o ic
cycle 14 (s age 5), which is when massi e ac i a ion o zy-
go ic ansc ip ion occu s (Campos-O ega 1985; La e
e al. 2015). The majo i y o la e emb yos we e in he la e
s age o ge m-band ex ension (s age 10; Fig. 1C), when
he emb yo unk (also known as he ge m-band) elonga es
in he an e o-pos e io axis and na ows in he do so- en-
al axis (Campos-O ega 1985; La e e al. 2015).
In adap ing mNET-seq o D osophila emb yos, we op i-
mized bu e s and washing condi ions o pu i y he ch o-
ma in ac ion om manually so ed emb yos, solubilize
he ansc ip ion complexes wi h MNase diges ion and im-
munop ecipi a e Pol II wi h an ibodies. We used abbi
polyclonal an ibodies aised agains syn he ic pep ides
o he YSPTSPS epea o he CTD o he la ges Pol II sub-
uni in Saccha omyces ce e isiae, phospho yla ed a ei he
S5 (ab5131 Abcam) o S2 (ab5095 Abcam). Bo h an ibod-
ies ha e been ex ensi ely used o ch oma in immunop e-
cipi a ion expe imen s in D osophila melanogas e (Yan
e al. 2014; Dahlbe g e al. 2015; Lee e al. 2015; Boija
e al. 2017; Vizcaya-Molina e al. 2018; Akh a e al.
2019; A za e-Mejía e al. 2020).
To enable di ec ional sequencing, he 5′hyd oxyl (OH)
gene a ed by MNase diges ion o RNA was i s con e ed
o a 5′phospha e by T4 polynucleo ide kinase (Fig. 1D).
RNA was hen pu i ied om he immunop ecipi a ed Pol
II complexes and size-selec ed using an RNA pu i ica ion
ki p ocedu e ha combines a unique bu e sys em wi h
a column echnology (see he Ma e ials and Me hods sec-
ion o mo e de ail). RNAs wi h a size abo e 60 n we e
used o subsequen liga ion o speci ic adap e s o he
5′P and 3′OH ends o each RNA agmen ollowed by
PCR-based p epa a ion o a cDNA lib a y o high-
h oughpu Illumina sequencing (Fig. 1D). A e sequenc-
ing, adap e sequences we e immed and pai ed-end
eads wi h sequence o e laps we e me ged in o a single
ead ha spans he ull leng h o he o iginal RNA agmen
(da k o ange; Fig. 1E). The esul ing single eads we e
aligned o he D osophila e e ence genome. The nucleo-
ide a he 3′end o each RNA agmen was iden i ied and
i s genomic posi ion eco ded (as e isk; Fig. 1E).
P udêncio e al.
140 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
Two o h ee dNET-seq lib a ies we e independen ly
p epa ed om ea ly and la e emb yos using S5P an ibody;
h ee addi ional lib a ies we e p epa ed om la e emb yos
using S2P an ibody. Each lib a y was sequenced o a high
co e age wi h a ead leng h o 150 bp (Supplemen al Fig.
S1; see he Ma e ials and Me hods sec ion o mo e de ail).
Expe imen al ep oducibili y was demons a ed by s ong
ag eemen o uniquely aligned ead densi y be ween bio-
logical eplica es p epa ed wi h an ibodies aised agains
he CTD phospho yla ed on ei he se ine 5 (S5P) o se ine
2 (S2P) posi ions (Supplemen al Fig. S1B–E). This sugges s
ha bo h S5P and S2P an ibodies ecognize he CTD o
elonga ing Pol II in D osophila emb yos.
dNET-seq cap u es splicing in e media es
and spliceosomal snRNAs
NET-seqcap u esno only he inal(3′OHend)nucleo ideo
nascen RNA bu also he 3′OH end o RNAs ha associa e
wi h he PolII elonga ion complex (Nojima e al. 2015, 2018;
Schlackowe al.2017).No ably,inhumans,mNET-seqo Pol
II phospho yla ed on CTD se ine 5 de ec ed splicing in e -
media es o med by clea age a he 5′splice si e a e he
i s splicing eac ion. The p esence o such in e media es
mani es s as an en ichmen o eads whose 3′ends map p e-
cisely o he las nucleo ide o anexon. In bo h ea ly and la e
D osophila emb yos, we indeed obse ed la ge peaks o
dNET-seq/S5P eads mapping o he las nucleo ide o
spliced exons, as shown o he kuk gene (g een as e isk;
Fig. 2A). We also de ec ed dNET-seq/S5P peaks a he las
nucleo ide o in ons, as shown o he eEF1alpha1 gene
(pink as e isk; Fig. 2B); en ichmen o hese eads esul s
om coimmunop ecipi a ion o eleased in on la ia s a e
comple ion o he splicing eac ion (Fig. 2B). In addi ion,
we obse ed eads co esponding o ma u e snRNAs en-
gaged in co ansc ip ional spliceosome assembly, sugges -
ing ha dNET-seq was cap u ing he ee 3′OH ends o he
snRNAs (blue as e isk; Fig. 2C). We ound p ominen peaks
a he end o spliceosomal U1, U2, U4, and U5 snRNAs. As
expec ed, no peak was de ec ed mapping o he end o
he U3 snRNA, which is in ol ed in he p ocessing o p e-
RNA syn hesized by Pol I. No ewo hy, we obse ed an ac-
cumula ion o dNET-seq signal a he end o U6 snRNA
(Supplemen al Fig. S2A), con as ing wi h a lack o peak ob-
se edinmammaliancells(Nojimae al.2018).Thisisconsis-
en wi h he inding ha mos mammalian U6 snRNAs
con ain a 2′,3′-cyclic phospha e e minal g oup a he 3′
end, whe eas U6 3′ends in D osophila cells consis o ei he
acyclic2
′,3′-phospha e, a 3′-phospha e o a 2′,3′-hyd oxyl
g oup (Lund and Dahlbe g 1992).
To quan i y how many cons i u i ely spliced exons ha e
dNET-seq peaks a he end, we applied an algo i hm ha
inds nucleo ides whe e he NET-seq ead densi y is a
leas h ee s anda d de ia ions abo e he ansc ip
mean in a local egion de ined by 100 bp ups eam
and downs eam (Chu chman and Weissman 2011;
P udêncio e al. 2020). Upon analyzing eplica es o
dNET-seq/S5P and dNET-seq/S2P lib a ies, we iden i ied
o e 10,000 exons showing splicing in e media e peaks
(Fig. 2D). As peaks we e mo e equen ly de ec ed on ex-
ons o genes wi h highe ead densi y (Supplemen al Fig.
S2B), we classi ied he exons in o ou g oups (qua iles)
based on he dNET-seq ead densi y o he co espond-
ing gene and es ic ed he analysis o exons in he ou h
qua ile, ha is, om genes wi h he highes ead densi y.
E
B
A
C
D
FIGURE 1. Na i e elonga ing ansc ip sequencing in D osophila
emb yos. (A) Timeline o D osophila ea ly emb yonic de elopmen ,
which s a s wi h 13 apid syncy ial mi o ic cycles. Du ing in e phase
o cycle 14, memb anes o m be ween he nuclei loca ed a he pe-
iphe y o he emb yo (cellula iza ion). The new cells s a mo phoge-
ne ic mo emen s leading o elonga ion o he emb yo unk (ge m-
band ex ension). (B) Rep esen a i e images (s ained o DNA) o em-
b yos in mi o ic cycle 14 (s age 5) and la e ge m-band expansion
(s age 10). (C) The g aph depic s he de elopmen al s age o emb yos
so ed in o he “ea ly”and “la e”g oups. App oxima ely 30,000 ea ly
emb yos and 15,000 la e emb yos we e analyzed. (D) Ou line o he
dNET-seq expe imen al p o ocol. (E) Ou line o dNET-seq da a
analysis.
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 141
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
The esul s show ha splicing in e media e peaks a e de-
ec ed in ∼80% o all cons i u i ely spliced exons. We u -
he analyzed he so-called p e-MBT (mid-blas ula
ansi ion) genes, which a e he i s zygo ic genes o be-
come ansc ip ionally ac i e in ea ly emb yos (Chen e al.
2013), and genes exp essed in la e emb yos. We ound
simila p opo ions o splicing in e media e peaks associ-
a ed wi h p e-MBT and la e genes in he S5P and he S2P
da a se s (Fig. 2E). We hen used he same me hodology
and he same se o genes o de ec peaks a he las
in onic nucleo ide, co esponding o eleased in on
la ia s. Such peaks we e de ec ed in <10% o in ons
(Fig. 2F).
Taken oge he , hese esul s demons a e ha dNET-
seq wi h an ibodies ha ecognize he Pol II CTD phos-
pho yla ed a ei he S5 o S2 posi ions is capable o
de ec ing splicing in e media es and spliceosomal
snRNAs in D osophila emb yos, as p e iously epo ed in
mammalian cells (Nojima e al. 2015, 2018; Schlackow
e al. 2017).
dNET-seq speci ically cap u es nascen RNA
To alida e ha we we e de ec ing nascen ansc ip ion in
D osophila emb yos, we analyzed ma e nal mRNAs ha
a e ansc ibed du ing oogenesis and loaded in o
he egg (Fig. 3A). As expec ed, ma e nal ansc ip s
such as bicoid (Fig. 3B), nanos (Supplemen al Fig. S3A),
gu ken (Supplemen al Fig, S3B), and Rab32 (Supplemen-
al Fig. S3C) we e de ec ed by RNA-seq in emb yos col-
lec ed 2–3 h a e e iliza ion, bu he dNET-seq signal
o e hese genes was negligible. Howe e , a obus
dNET-seq/S5P signal was ound a he pumilio gene (Fig.
3C). Exp ession o his gene was conside ed o be exclu-
si ely ma e nal based on RNA-seq (Lo e al. 2011) and
Pol II ChIP-seq da a (Chen e al. 2013), bu a GRO-seq
s udy de ec ed pumilio nascen ansc ip s in emb yos col-
lec ed 2–2.5 h pos e iliza ion (Saunde s e al. 2013). The
de ec ion o pumilio RNA in ea ly emb yos by GRO-seq
and dNET-seq/S5P highligh s he sensi i i y o hese wo
echniques in cap u ing low-le el nascen ansc ip s.
EF
BAC
D
FIGURE 2. dNET-seq cap u es splicing in e media es and spliceosomal snRNAs. (A–C) The diag ams ou line he 3′OH ends gene a ed by
co ansc ip ional clea age a he 5′splice si e (A), he 3′splice si e (B), and he ee 3′OH end o spliceosomal snRNAs (C). Below each diag am,
dNET-seq/S5P p o iles o e he indica ed genes a e depic ed (da a om la e emb yos). The g een as e isk deno es he peak a he end o he
exon (A). The pink as e isk deno es he peak a he end o he in on (B). The blue as e isk deno es he peak a he end o he U2 snRNA gene
(C). A ows indica e he di ec ion o ansc ip ion. Exons a e ep esen ed by boxes. Thinne boxes ep esen UTRs. In ons a e ep esen ed by
lines connec ing he exons. (D) Compa ison (Venn diag ams) o exons wi h a splicing in e media e peak de ec ed in biological eplica es o
dNET-seq/S5P and dNET-seq/S2P lib a ies. (E,F) F equency o peaks co esponding o splicing in e media es (E) and eleased in on la ia s
(F) in p e-MBT genes and genes exp essed in la e emb yos. Only genes wi h he highes ead densi y ( ou h qua ile) we e conside ed.
P udêncio e al.
142 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
E
F
B
A
CD
G
HI
FIGURE 3. dNET-seq p o iles in ea ly and la e emb yos. (A) The diag am illus a es he empo al exp ession o ma e nal, p e-MBT, MBT, and pos -
MBT genes du ing D osophila emb yonic de elopmen . dNET-seq/S5P and RNA-seq p o iles o e he ma e nal genes bicoid (B) and pumilio
(pum) (C), he p e-MBT gene snail (D), and he pos -MBT gene Akap200 (E). Reads ha aligned o he posi i e s and a e in blue, and eads
ha aligned o he nega i e s and a e in ed. (F) Me a-analysis o mean dNET-seq/S5P ead densi y a ound he ansc ip ion s a si e (TSS) in ma-
e nalandp e-MBTgenes( eplica e1).(G–I) No malized me agene analysis in a bi a y uni s (A.U.). ThedNET-seq/S5P signalisdepic edalong he
no malized gene leng h (g ay backg ound), as well as 500 bp ups eam o he ansc ip ion s a si e (TSS) and 500 bp downs eam om he poly-
adenyla ion (pA) si e. (G) P e-MBT genes in ea ly emb yos. (H) T ansc ip ionally ac i e genes in la e emb yos; he signal o e genes ha ha e he 3′-
UTR o e lapped by an an isense gene is depic ed in da k ed, while he signal o e genes wi h no o he genes wi hin 500 bp is depic ed in ligh ed.
(I) T ansc ip ionallyac i egenesin la eemb yos; he signal o e genes ha ha e he 3′-UTR o e lapped by a ansc ip ionally ac i e an isense gene
is depic ed in da k ed, while he signal o e genes wi h he 3′-UTRo e lapped by a ansc ip ionally inac i e an isense geneis depic ed in ligh ed.
www. najou nal.o g 143
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om

The s age a which he emb yo swi ches om elying on
ma e nally deposi ed mRNAs and p o eins o unde going
i s own ansc ip ion is e med he mid-blas ula ansi ion
(MBT). Howe e , a ew genes (known as p e-MBT genes)
become ansc ip ionally ac i e be o e MBT (Kwasnieski
e al. 2019). A s ong dNET-seq signal was de ec ed in ea -
ly emb yos o e he bodies o p e-MBT genes such as snail
(Fig. 3D), ushi a azu (Supplemen al Fig. S3D) and odd
skipped (Supplemen al Fig. S3E). Al oge he , we exam-
ined 117 p e iously iden i ied p e-MBT genes and 35 ma-
e nal mRNAs (Fig. 3F; Supplemen al Fig. S3F). The
inding ha a obus dNET-seq/S5P signal was eco e ed
om zygo ically bu no om ma e nally exp essed an-
sc ip s indica es ha dNET-seq is speci ically a ge ing
he nascen ansc ip ome.
dNET-seq e eals di e ences in ansc ip ion
e mina ion p o iles be ween genes exp essed
in ea ly and la e emb yos
Ha ing con i med ha dNET-seq was cap u ing nascen
RNA, we nex in es iga ed he dis ibu ion o Pol II densi y
o e ansc ip egions in ea ly and la e emb yos. dNET-
seq/S5P p o iles (Fig. 3C–E; Supplemen al Fig. S3A–E)
do no show he cha ac e is ic highe ead densi y nea
he p omo e , as p e iously desc ibed in mammalian cells
(Maye e al. 2015; Nojima e al. 2015). This is mos likely
because Pol II ypically pauses ∼30–60 bp downs eam
om he ansc ip ion s a si e (TSS) (Kwak e al. 2013)
and in ou dNET-seq app oach we en ich o RNAs longe
han 60 n (Supplemen al Fig. S1F); hus, we only eco d
he posi ion o polyme ases ha ha e ansc ibed a leas
60 bp pas he TSS.
We hen u ned ou a en ion o he dNET-seq signal
a ound he polyadenyla ion (pA) si e. We ound ha in
p e-MBT genes such as snail (Fig. 3D), ailless ( ll)
(Supplemen al Fig. S4A), and nullo (Supplemen al Fig.
S4B), he dNET-seq/S5P signal ends soon a e he pA
si e. In con as , genes exp essed in la e emb yos such as
Akap200 (Fig. 3E), His3.3A (Supplemen al Fig. S3H) and
s (Supplemen al Fig. S3I), ha e a widesp ead dNET-seq/
S5P signal on in ons and egions downs eam om he
pA si e. Analysis o RNA-seq da a se s e ealed ha
mRNAs encoded by hese genes a e e icien ly spliced
and 3′-end p ocessed (Supplemen al Fig. S3H,I). Thus,
dNET-seq/S5P is cap u ing newly syn hesized ansc ip s
ha ha e no ye been spliced, as well as RNAs syn hesized
by Pol II complexes ha con inued o ansc ibe he DNA
empla e a e he mRNA was clea ed and polyadenyla ed
a he pA si e. We u he no ed ha he 3′-UTR o genes
wi h a dNET-seq signal ex ending pas he pA si e is o e -
lapped by ano he gene (gu ken,Nepl3, and In S1, espec-
i ely), which is ansc ibed in he opposi e di ec ion.
Nex , we gene a ed dNET-seq me ap o iles o p e-MBT
and la e genes. Me agene analysis o he dNET-seq/S5P
signal on p e-MBT genes exp essed in ea ly emb yos con-
i med ha in his g oup o genes, he dNET-seq signal is
sha ply educed pas he pA si e (Fig. 3G). The majo i y
(65) o p e-MBT genes a e isola ed in he genome, wi h
no o he gene on ei he s and wi hin a egion o 500 bp
downs eam om he pA si e, as shown o ailless ( ll)
(Supplemen al Fig. S4A). Ano he 26 p e-MBT genes a e
embedded in la ge genes, as shown o nullo, which is lo-
ca ed wi hin a long in on o he CG12541 gene
(Supplemen al Fig. S4B). A smalle g oup o p e-MBT
genes (21) ha e neighbo ing genes loca ed on ei he
s and wi hin a egion o 500 bp downs eam om he pA
si e, as shown o Elba2 (Supplemen al Fig. S4C). We u -
he iden i ied 5 p e-MBT genes ha ha e he 3′-UTR o e -
lapped by an an isense con e gen gene, as shown o
spook (spo) (Supplemen al Fig. S4D). No ably, in hese
genes, he dNET-seq/S5P signal ex ended pas he pA
si e (Supplemen al Fig. S4C,D).
To iden i y all he genes ha a e ansc ip ionally ac i e
in la e emb yos, we used a s a egy adap ed om GRO-
seq analysis (Co e e al. 2008) ha elies on ead densi y
in gene dese egions as backg ound e e ence o ab-
sence o ansc ip ion. Ve y la ge in e genic egions
(gene dese s) we e di ided in o 50 kb windows, and
ead densi ies we e calcula ed by di iding ead coun s
in each window by he window leng h in bp
(Supplemen al Fig. S4E). Genes wi h dNET-seq signal
o e he gene body (in RPKM) abo e he 90 h pe cen ile
o ead densi y o all in e genic egions analyzed we e
conside ed o be ansc ip ionally ac i e (Supplemen al
Fig. S4F). We iden i ied ∼7000 ac i e genes, wi h simila
esul s ob ained om dNET-seq/S5P and dNET-seq/S2P
da a se s (Supplemen al Fig. S4G). This se o ac i e
genes includes o e 85% o he 3500 genes p e iously
iden i ied as ac i ely ansc ibed a e he mid-blas ula
ansi ion (MBT) based on ChIP-seq expe imen s (Chen
e al. 2013). Nex , we di ided he genes ansc ibed in
la e emb yos in o wo g oups, depending on whe he
hei 3′-UTR was o was no o e lapped by ano he con-
e gen gene. The me agene analysis shows ha when
a e aged ac oss all ansc ibed genes, a e y low dNET-
seq signal is de ec ed a he pA si e (Fig. 3H;
Supplemen al Fig. S3G), as expec ed assuming ha
when Pol II eaches his si e, he nascen ansc ip is
clea ed and polyadenyla ed and he e o e he e is no
RNA le a ached o he polyme ase o be sequenced.
Howe e , in he case o la e genes ha ha e he 3′-UTR
o e lapped by an an isense (con e gen ) gene, he
dNET-seq/S5P and dNET-seq/S2P signals inc ease again
a e he pA si e (Fig. 3H; Supplemen al Fig. S3G). Using
he me hodology desc ibed abo e o iden i y ansc ibed
genes, we ound ha he as majo i y (>80%) o o e lap-
ping con e gen genes we e ansc ip ionally ac i e and
only 219 genes we e silen . The me agene analysis shown
in Figu e 3I clea ly indica es ha he de ec ion o dNET-
P udêncio e al.
144 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
seq/S5P signal pas he pA si e is independen om an-
sc ip ion o he con e gen o e lapping gene.
In conclusion, he dis ibu ion p o iles o dNET-seq/S5P
and dNET-seq/S2P eads a ound he pA si e sugges dis-
inc pa e ns o ansc ip ion e mina ion o genes ha
a e ei he isola ed in he genome o o e lapped by ano h-
e con e gen gene. Howe e , we canno exclude he pos-
sibili y ha speci ically in isola ed genes, he lack o dNET-
seq signal esul s om loss o CTD phospho yla ion as Pol
II ansc ibes pas he pA si e.
Analysis o dNET-seq ead densi y p o iles
We nex ocused on he dis ibu ion o dNET-seq eads on
exons and in ons. The numbe o nascen RNA eads
whose 3′ends map a a pa icula genomic posi ion is p o-
po ional o he numbe o Pol II molecules a ha posi ion.
Thus, Pol II pause si es can be de ec ed as local peaks in
NET-seq ead densi y (Chu chman and Weissman 2011;
La son e al. 2014). Howe e , because we pe o med
dNET-seq wi h an ibodies ha ecognize he Pol II CTD
phospho yla ed a ei he S5 o S2 posi ions, changes in
ead densi y may e lec dynamic phospho yla ion o he
CTD a he han Pol II pausing. We excluded signal esul -
ing om splicing in e media es (i.e., eads ha map o he
e y las nucleo ide o in ons and exons we e disca ded) in
o de o analyze only eads whose 3′ends associa e wi h
he Pol II ac i e si e. We analyzed bo h S5P and S2P
da a. Howe e , wewe e pa icula ly in e es ed in explo ing
he mul iple peaks o dNET-seq/S5P signal obse ed on
bo h exons and in ons (Fig. 4A), because co ansc ip ional
splicing has been linked o S5P in humans (Nojima e al.
2015).
A di icul y when pe o ming he sys ema ic iden i ica-
ion o dNET-seq peaks is ha ansc ip s wi h highe ini i-
a ion a es will con ain mo e eads and hus peaks a e mo e
likely o be de ec ed han in mo e lowly ansc ibed genes.
To con ol o his con ound, we de eloped a peak calling
algo i hm ha de ec s egions whe e he local ead densi y
is signi ican ly highe han expec ed by chance, gi en he
o e -all ead densi y o he ansc ip (Fig. 4A; see also he
Ma e ials and Me hods sec ion). We emphasize ha o de-
ec ing eads co esponding o splicing in e media es (Fig.
2D–F), we used a peak calling me hod ha looks o signi -
ican single-nucleo ide posi ions (Chu chman and
Weissman 2011), whe eas his new me hod de ec s highe
ead egions o a iable leng h.
We hen aligned exons and in ons on he splice si es
and calcula ed he a e age peak densi y a each posi ion.
Exons ha e a highe o e -all peak densi y han in ons
(mean p opo ion o nucleo ides in peaks ∼0.022/∼0.015
o eplica e 1/ eplica e 2 in ons and ∼0.043/∼0.034 o
eplica e 1/ eplica e 2 exons; P< 2.2 × 10
−16
o bo h ep-
lica es; wo- ailed Mann–Whi ney U- es wi h he peak
densi ies o indi idual in ons/exons as da a poin s) (Fig.
4B). This is consis en wi h p e ious epo s indica ing
ha he Pol II elonga ion a e is dec eased o e exons in
mammalian (Jonke s e al. 2014; Maye e al. 2015) and
D osophila cells (Kwak e al. 2013). In addi ion, peak den-
si y is sha ply inc eased a ound he 5′splice si e (Fig. 4C).
This could indica e ei he Pol II pausing o inc eased S5
phospho yla ion associa ed wi h splice si e ecogni ion.
We also canno exclude ha misaligned splicing in e me-
dia e eads a e con ibu ing o he obse ed inc ease in
peak densi y a ound he 5′splice si e. The dNETseq/S5P
p o ile a ound he 3′splice si e shows a highe peak den-
si y egion jus a e he in on-exon bounda y, and a p o-
g essi e inc ease in a e age exonic peak densi y is u he
obse ed s a ing oughly 60 n a e he 3′splice si e (Fig.
4C). A e y simila peak densi y me ap o ile is obse ed
wi h he dNETseq/S2P da a se (Fig. 4D).
A po en ial ca ea o ead densi y analysis is ha nucle-
o ide composi ion a ies sys ema ically ac oss exons and
in ons. Fo example, exons end o ha e a highe GC con-
en han in ons (Zhu e al. 2009). This could be p oblem-
a ic as NET-seq elies on MNase diges ion o DNA and
RNA o solubilize ch oma in. MNase diges ion o DNA is
known o be sequence-biased, wi h mos no ably a p e e -
ence o clea ing jus 5′o an adenine (Dingwall e al. 1981;
Hö z and Al enbu ge 1981; Ga ney e al. 2012). An anal-
ysis o he 5′ends o ou eads e ealed simila biases o
MNase diges ion o RNA (Fig. 4D). This sequence p e e -
ence could lead o a e ac ual a ia ion in ead densi y,
wi h mo e eads being sampled om ansc ip s and an-
sc ip egions whose nucleo ide composi ion is mo e sim-
ila o MNase diges ion biases. To e i y o wha ex en ou
esul s we e a ec ed by his con ound, we pe o med a
simula ion o de e mine he expec ed dis ibu ion o eads
based on he diges ion bias alone (Supplemen al
Me hods). We concluded ha MNase biases a e unlikely
o explain ei he he en ichmen o peaks in exons o he
gene al p o ile o peak densi ies pas he 3′splice si e.
dNET-seq cap u es ecu si e splicing in e media es
Ha ing shown ha he spliceosome o ms a complex wi h
he elonga ing Pol II in D osophila emb yos, we asked
when splicing akes place ela i e o ansc ip ion. We i s
looked a ecu si e splicing o long in ons because his
p ocess in ol es he o ma ion o inhe en ly uns able in e -
media es ha a e mo e likely o be o med soon a e he
ansc ip ion o each in onic splice si e (Pai e al. 2018).
In ecu si e splicing, long in ons a e emo ed by sequen-
ial excision o adjacen sec ions in ol ing sepa a e splic-
ing eac ions, each p oducing a dis inc la ia (Ha on
e al. 1998). Recu si ely spliced in on segmen s a e
bounded a one o bo h ends by ecu si e si es o a che
poin s (Bu ne e e al. 2005), which co espond o ze o nu-
cleo ide exons consis ing o jux aposed 3′and 5′splice
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 145
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
si es a ound a cen al AG|GT mo i , whe e he e ical line
ep esen s he splice junc ion (Fig. 5A).
To cap u e ecu si e splicing in e media es using
dNET-seq, i is essen ial o ha e a good co e age o
eads co esponding o nascen ansc ip s and spanning
he splice junc ions. The o al numbe o eads esul ing
om nascen RNA in each dNET-seq da a se is depic ed
in Supplemen al Figu e S1G. By me ging he sequencing
in o ma ion o o e lapped pai ed-end eads (Fig. 1E), we
we e able o sequence on a e age ∼103 n pe nascen
RNA (Supplemen al Fig. S1F,H). Focusing on p e iously
iden i ied D osophila a che poin s (Du e al. 2015;
Joseph e al. 2018), we ound dNET-seq/S5P eads ha
span he junc ion be ween he canonical 5′splice si e
a he end o he exon and he i s a che poin (RP1) in-
e nal o he downs eam in on, as shown o he second
in on o he Megalin gene (Fig. 5B). Reads spanning he
subsequen in onic RPs we e also obse ed (Fig. 5B).
O e all, we de ec ed dNET-seq/S5P and dNET-seq/S2P
spliced eads suppo ing mos o he p e iously iden i ied
ecu si e splicing e en s (Fig. 5C; Supplemen al Fig.
S5A).
Analysis o dNET-seq p o iles a ound a RP e eals an
en ichmen o eads in a egion loca ed a ew nucleo ides
EB
AC
D
FIGURE 4. Analysis o dNET-seq ead densi y p o iles. (A)dNET-seq/S5P and RNA-seq p o iles o e he pos -MBT gene smoke ala m (smal). The
ead numbe is depic ed a wo magni ica ion le els in wo biological eplica es. Fo eplica e 1, he line “Peak Calle 1”shows peaks called using
he “la ge peaks”se ing, which is app op ia e o de ec ing la ge egions o pu a i e Pol II pausing. The line “Peak Calle 2”shows peaks called
using he “small peaks”se ing, which p o ides highe spa ial esolu ion and has been used o subsequen analyses. RNA-seq da a o he same
egions is also shown. (B) Peak densi y in he exons and in ons o ansc ip ionally ac i e genes (dNET-seq/S5P, eplica e 1). Peak densi y has been
de ined as he pe cen age o nucleo ides wi hin a gi en exon o in on ha o e lap wi h a signi ican peak. (C,D) Me agene analysis o peak den-
si y es ima ed om dNET-seq/S5P (C) and dNET-seq/S2P (D) da a om la e emb yos. To calcula e peak densi y o each posi ion, we di ided he
numbe o in ons ha o e lap wi h a peak a ha posi ion by he o al numbe o in ons. The las 50 n o exons, he i s 50 n o in ons, he las 25
n o in ons, and he i s 100 n o exons a e shown. Only in e nal and ully coding exons om ansc ip ionally ac i e genes ha a e a leas 100 n
long a e shown. Exons sho e han 150 n con ibu e o bo h he exon end and s a . Only in ons ha we e a leas 50 n long we e conside ed. (E)
Sequence logo o nucleo ide equencies wi hin a 10-n window a ound he 5′ends o NET-seq eads. The combined heigh o he bases a each
posi ion is p opo ional o he in o ma ion con en . Posi ion 6 co esponds o he 5′-mos nucleo ide o he ead. Pu a i e in e nal p iming eads,
as well as eads mapping o he las nucleo ide o exons o in ons (possible splice in e media e and in on la ia eads) we e igno ed.
P udêncio e al.
146 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
downs eam om he RP, as shown o RP2 in he i s in-
on o he Tenascin majo gene (Fig. 5D). No ewo hy,
mos o hese eads a e al eady spliced o he p e ious
RP (Fig. 5D). A me a-analysis o dNET-seq/S5P eads
a ound 137 RPs con i ms ha many spliced eads can
be obse ed jus downs eam om RPs (Fig. 5E,F), dem-
ons a ing ha splicing occu s soon a e he ansc ip ion
o in onic ecu si e si es. The obse ed en ichmen o
dNET-seq/S5P eads a ound RPs u he sugges s ha e-
cu si e splicing and Pol II elonga ion a e may be kine i-
cally coupled. In ag eemen wi h his iew, a slow Pol II
mu an enhanced ecu si e splicing o Ubx ansc ip s in
D osophila emb yos (de la Ma a e al. 2003).
Splicing akes place as Pol II ansc ibes
pas he 3′′′′′ splice si e
Ha ing es ablished ha dNET-seq cap u es ecu si e splic-
ing, we hen asked whe he dNET-seq eads spanning ca-
nonical exon-exon junc ions we e also de ec ed (Fig. 6A).
To iden i y splicing e en s, we conside ed all in e nal and
ully coding exons ha a e a leas 100 n long in ac i ely
ansc ibed genes in ea ly and la e emb yos. Fo each splice
junc ion, we coun ed how many eads had he 3′end
mapped o he i s 100 n o he exon. Only exons wi h a
leas 10 eads mapping o his egion we e conside ed
(see he Ma e ials and Me hods sec ion o jus i ica ion o
EF
B
A
C
D
FIGURE 5. dNET-seq cap u es ecu si e splicing in e media es. (A) Schema ic illus a ing ecu si e splicing. A a che poin (RP) wi h jux aposed
accep o and dono splice si e mo i s is indica ed. (B) Visualiza ion o dNET-seq/S5P eads ha align o he second in on o he Megalin (mgl)
gene. Recu si ely spliced eads align o exon 2 (da k blue) and he in on a e RP1 (ligh blue). Unspliced eads a e depic ed in g ay. The numbe
o spliced and unspliced eads a each RP in he in on is indica ed. (C) Venn diag am compa ing RPs iden i ied in wo dNET-seq/S5P biological
eplica es and in p e iously epo ed s udies (Du e al. 2015; Joseph e al. 2018). (D) Numbe o dNET-seq/S5P eads ha ha e he 3′end
mapped a ound RP2 in he i s in on o Tenascin majo (Ten-m) gene. The op panel depic s all eads, and he bo om panel depic s only eads
ha ha e been spliced o RP1. (E,F) Me a-analysis wi h single nucleo ide esolu ion o no malized dNET-seq/S5P eads a ound RPs (n= 137) using
all eads (E) o only eads spliced o he p e ious RP o exon (F).
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 147
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
MATERIALS AND METHODS
Emb yo collec ion
D osophila melanogas e lies (O egon R [O R] s ain) we e aised
a 25°C, in polyp opylene ials con aining s anda d en iched cul-
u e medium (co nmeal, molasses, yeas , soya lou , and bee oo
sy up). Th ee-day-old lies (coun ing om pupae eclosion) we e
a ened in cul u e medium supplemen ed wi h esh yeas o 2
d. Emb yos we e collec ed in o apple juice-aga pla es supple-
men ed wi h esh yeas using app op ia e cages con aining
∼200 lies each. To a oid emale e en ion o olde emb yos,
h ee p ecollec ions o 30 min each we e made be o e he i s
collec ion o emb yos. To maximize egg laying, and a oid la ae
con amina ion, adul lies we e ans e ed o clean emb yo col-
lec ion cages e e y day o e 5 d. Fo ea ly s age emb yos (2–3
h a e egg-laying), adul emales we e allowed o lay eggs o 1
h in apple juice-aga pla es. Pla es we e subsequen ly collec ed
and emb yos we e aged a 25°C o 90 min. Du ing he ollowing
30 min, emb yos we e ha es ed om he pla es, decho iona ed
in 50% bleach solu ion o 2 min, and washed once in Phospha e
Bu e ed Saline supplemen ed wi h 0.1% Tween-20 (PBT) and
wice in deionized wa e . In o de o disca d olde emb yos (s age
6 and olde ), manual s aging o collec ed emb yos was pe o med
wi h he help o o ceps and unde a magni ie scope. Emb yos
we e hen esuspended in a solu ion con aining 120 mM NaCl
and 0.04% T i on, and washed wice wi h 120 mM NaCl solu ion.
A he end o he 3 h collec ion, he solu ion was emo ed and
emb yos we e ozen in liquid ni ogen and s o ed a −80°C.
Fo he la e s age (4–6 h), eggs we e laid o 2 h and aged a
25°C o 3.5 h. Emb yo collec ion and p ocessing was simila o
he ea ly s age emb yos, bu in his case, no manual s aging
was pe o med.
Emb yo DNA s aining
Fo each emb yo collec ion, and a e decho iona ion, a ep esen-
a i e emb yo sample was collec ed om he o al pool and ixed
in a scin illa ion lask, using a solu ion con aining one olume o
4% o maldehyde in PBT and ou olumes o hep ane, o 20
min a 100 pm. The lowe aqueous phase solu ion was subse-
quen ly emo ed, 4 mL o me hanol was added and emb yos
we e shaken igo ously o 1 min. Emb yos we e hen collec ed
om he bo om o he scin illa ion lask, washed wice wi h me h-
anol, and ozen a −20°C in me hanol. To ehyd a e he emb yos,
hey we e washed o 5 min each, wi h 3:1, 1:1, and 1:3 mix solu-
ions o me hanol:PBT. Emb yos we e subsequen ly washed wice
in PBT and incuba ed wi h 1:5000 Sy ox g een (In i ogen), sup-
plemen ed wi h 5 µg/mL RNase A (Sigma-Ald ich) in PBT o 15
min. A e washing wi h PBT, emb yos we e moun ed in luo es-
cence moun ing medium (Dako) and examined in a Zeiss
AxioZoom V16 Fluo escence S e eo Mic oscope o image acqui-
si ion and emb yo s aging. Images we e p ocessed using ImageJ
so wa e (NIH).
dNET-seq and lib a y p epa a ion
The dNET-seq p o ocol was adap ed om mNET-seq (Nojima
e al. 2016). B ie ly, 300 µL o ozen emb yos was esuspended
in 3.5 mL o Bu e B1 (15 mM HEPES-KOH, pH 7.6; 10 mM
KCl; 5 mM MgCl
2
; 1 mM DTT; 0.1 mM EDTA; 0.35 M suc ose; 4
µg/mL peps a in; 10 mM sodium ne abisul i e; 0.5 mM EGTA sup-
plemen ed wi h comple e EDTA ee p o ease inhibi o [Roche]
and PhoSTOP [Roche]). Emb yos we e homogenized in a
Dounce homogenize wi h 11× s okes using a igh pes le on
ice. The suspension was cen i uged a 7700g o 15 min a 4°C,
he supe na an was disca ded, and he whi e pelle con aining
he nuclei was esuspended in 500 µL o Bu e B1. The suspen-
sion was again homogenized in he Dounce wi h 4× s okes and
loaded wi hou mixing on he op o bu e B2 (15 mM HEPES-
KOH, pH 7.6; 10 mM KCl; 5 mM MgCl
2
; 1 mM DTT; 0.1 mM
EDTA; 0.8 M suc ose; 4 µg/mL peps a in; 10 mM sodium me abi-
sul i e; 0.5 mM EGTA supplemen ed wi h comple e EDTA ee
p o ease inhibi o [Roche] and PhosSTOP [Roche]). The suspen-
sion was cen i uged a 1310g o 30 min a 4°C, and he pelle
was esuspended wi h 125 µL o NUN1 bu e (20 mM T is-HCl
[pH 7.9]; 75 mM NaCl; 0.5 mM EDTA and 50% Glyce ol). An
amoun o 1.2 mL o Bu e NUN2 (300 mM NaCl, 7.5 mM
MgCl
2
, 1% NP-40, 1 M U ea supplemen ed wi h comple e
EDTA ee p o ease inhibi o [Roche] and PhoSTOP [Roche])
was mixed wi h he nuclei and incuba ed on ice o 15 min p e-
o ming a sho o ex e e y 3 min. Ch oma in was hen cen i-
uged a 10,000g o 10 min a 4°C, washed wi h 100 µL o 1×
MNase Bu e , and incuba ed in 100 µL o MNase eac ion mixing
(1× MNase bu e and 30 gel uni /µL MNase [New England
Biolabs]) o 3 min a 37°C wi h mixing a 1400 pm. The eac ion
was s opped wi h 10 µL o 250 mM EGTA, cen i uged a 10,000g
o 5 min a 4°C, and he supe na an con aining he solubilized
ch oma in was eco e ed. Fo he ea ly emb yos sample, 2 ×
300 µL o emb yos we e p epa ed in pa allel and pooled oge he
a e he ch oma in solubiliza ion. Immunop ecipi a ion o Pol II–
RNA complexes was pe o med using 50 µL o P o ein G
Dynabeads (The mo Fishe Scien i ic), p eincuba ed o e nigh
wi h 5 µg o he co esponden an ibody: an i-Pol II CTD S5P
(ab5131 Abcam) o an i-Pol II CTD S2P (ab5095 Abcam) in
100 µL NET2 (50 mM T is-HCl pH 7.4; 150 mM NaCl and
0.05% NP-40) and washed h ee imes wi h NET2. Beads we e
incuba ed wi h he solubilized ch oma in in 1 mL o al olume
o NET2 o 1 h a 4°C, washed se en imes wi h 500 µL o
NET2 and once wi h 100 µL o PNKT (1× PNK bu e and
0.1% ween) be o e incuba ion o 6 min in 50 µL o PNK eac-
ion mix (1× PNKT, 1 mM ATP and 0.05 U/mL T4 PNK
3′phospha ase minus [NEB] in a he momixe a 37°C and
1400 pm. A e washing he beads wi h NET2, long RNA ag-
men s we e isola ed using Quick-RNA Mic oP ep (Zymo e-
sea ch): 300 µL o RNA Lysis Bu e in 33% E OH was mixed
o he beads by pipe ing. Beads we e disca ded and he sus-
pension was loaded in o a Zymo spin column ha was cen i-
uged a 10,000g o 30 sec. The column was washed once
wi h 400 µL RNA p ep bu e and wice wi h 700 µL and 400
µL RNA wash bu e , espec i ely. RNA was hen elu ed in 15
µL o DNase/RNase- ee wa e (Zymo) and s o ed a −80°C.
An amoun o 100 ng o RNA was used o p epa e each lib a y,
ollowing he s anda d p o ocol o he T uSeq Small RNA Lib a y
P ep ki (Illumina). A e adap e liga ion and e e se ansc ip-
ion, he lib a ies we e PCR ampli ied using 16 PCR cycles,
and cDNA lib a ies we e ac iona ed in he gel be ween 130
o 300 bp. The lib a ies we e sequenced using PE-150 on he
Illumina HiSeq X pla o m by No ogene Co., L d.
P udêncio e al.
154 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om

Quan i ica ion and s a is ical analysis
dNET-seq da a p ocessing
Adap e sequences we e emo ed om all dNET-seq pai ed-end
samples using Cu adap ( e sion 1.18) (Ma in 2011) wi h he ol-
lowing pa ame e s: -a TGGAATTCTCGGGTGCCAAGG -A
GATCGTCGGACTGTAGAACTCTGAAC -m 10 -e 0.05 –ma ch-
ead-wildca ds -n 1. Pai ed-end ead me ging was pe o med us-
ing bbme ge.sh om BBMap (Bushnell e al. 2017) wi h he
“xloose”pa ame e . Me ged eads we e hen aligned o he
D osophila e e ence genome (dm6; Ensembl elease 95)
(Cunningham e al. 2019) using STAR ( e sion 2.6.0b) (Dobin
e al. 2013) wi h –chimSegmen Min se o 20. Only uniquely
mapped eads we e conside ed, ex ac ed using SAM ools ( e -
sion 1.7) (Li e al. 2009) wi h -q se o 255. Excep ionally, in
Supplemen al Figu e S2A, HiSa 2 was used, using he same
dm6 genome anno a ion ile o genome indexing and using de-
aul pa ame e s, wi h he –no-disco dan –no-mixed lags se .
PCR in e nal p iming e en s gene a ed du ing lib a y p epa a ion
we e emo ed using a cus om Py hon sc ip (P udêncio e al.
2020) wi h he ollowing pa ame e s: -a TGG.. -s pai ed. To ob ain
single-nucleo ide esolu ion, a cus om Py hon sc ip (P udêncio
e al. 2020) was used o ex ac he 5′end nucleo ide o ead 2 (a -
e imming) in each sequencing pai , wi h he di ec ionali y indi-
ca ed by ead 1 (Fig. 1E).
Publicly a ailable RNA-seq da a se s used
Publicly a ailable D osophila emb yonic ansc ip ome sequenc-
ing da a [Poly(A) RNA-seq], pe o med in de elopmen al s ages
simila o he dNET-seq ea ly and la e samples, we e used in
his s udy. RNA-seq da a se s co esponding o cycle 14B (Lo
e al. 2011) we e ob ained om he Gene Exp ession Omnibus
(GEO) (samples GSM618409, GSM618410, GSM618421, and
GSM618422 om da a se GSE25180). RNA-seq da a se s om
4–6 h old emb yos we e ob ained om modENCODE p ojec
PRJNA75285 (G a eley e al. 2011) (accessions SRR023696,
SRR023746, SRR023836, SRR035220, SRR023669, SRR035405,
SRR035406, SRR024014, and SRR023539).
RNA-seq da a p ocessing
Adap e s we e emo ed om all da a se s using T im Galo e ( e -
sion 0.4.4) (h p://www.bioin o ma ics.bab aham.ac.uk/p ojec s/
im_galo e/; las accessed 26 Ap il 2020). Da a se s om
modENCODE and GEO we e aligned o he dm6 D osophila e -
e ence genome (Ensembl elease 95) (Cunningham e al. 2019)
using STAR ( e sion 2.6.0b) (Dobin e al. 2013) wi h
–chimSegmen Min se o 20. S ing ie ( e sion 1.3.3b) (Pe ea
e al. 2015) was used o quan i y no malized gene exp ession as
T ansc ip s Pe Kilobase Million (TPM) alues wi h he ollowing
pa ame e s: -a 5 -e. In addi ion, he iso o m lis was p o ided o-
ge he wi h he -G pa ame e co esponding o he dm6 (Ensembl
elease 95) GTF ile. Genes wi h TPM alues abo e 2 we e consid-
e ed o be exp essed.
Selec ion o genes and iso o ms o analysis
Simila o a p e ious GRO-seq analysis (Co e e al. 2008), we used
he ead densi y o e y la ge in e genic egions (gene dese e-
gions) o de ine he e e ence o absence o ansc ip ion. Gene
dese s we e di ided in o 50kb windows, and dNET-seq ead
densi ies we e calcula ed by di iding he ead coun s in each win-
dow by he window leng h (in bp). Read coun s pe window we e
ob ained wi h bed ools genome co e age ( e sion 2.27.1-1-
gb87c465) (Quinlan and Hall 2010), and an a bi a y densi y
h eshold was de ined as he 90 h pe cen ile o he ead densi y
dis ibu ion (Supplemen al Fig. S4A). T ansc ip s whose gene
body dNETseq ead densi y exceeded his h eshold we e con-
side ed o be ansc ip ionally ac i e (Supplemen al Fig. S4B).
Fo all o he analyses pe o med on la e genes, only ansc ip ion-
ally ac i e genes we e conside ed. In addi ion, only one iso o m
pe gene was conside ed o all analysis, selec ed as he iso o m
wi h he highes RPKM alue in he RNA-seq da a se o he co -
esponding de elopmen al s age.
The coo dina es o p e iously iden i ied p e-MBT genes we e
ob ained om Chen e al. (2013) and con e ed o dm6 coo di-
na es using he li O e ool (h ps://genome.ucsc.edu/cgi-bin/
hgLi O e ). The mos ep esen a i e iso o m o each gene was
manually selec ed h ough isualiza ion o indi idual p o iles.
Splicing in e media e and la ia de ec ion
Exons con aining splicing in e media es o in ons con aining la -
ia s we e iden i ied using a peak inde algo i hm (NET_sn Peak-
Finde ) (Chu chman and Weissman 2011; P udêncio e al. 2020)
ha de ec s he p esence o a peak in he las nucleo ide o an
exon (splicing in e media e) o an in on (la ia ), by compa ing
he accumula ion o 3′end eads mapping a ha posi ion wi h
he mean ead densi y o he lanking 200 n . A peak is called
when he ead densi y a he peak is supe io o he mean o his
su ounding egion plus 3 s anda d de ia ions (Chu chman and
Weissman 2011). Since gene ead densi y in luences peak de ec-
ion, he exons we e di ided in o qua iles based on he dNET-seq
ead densi y o he co esponding gene. Only exons om he
highes qua ile (i.e., om genes wi h he highes ead densi y)
we e conside ed in Figu e 2 o dNET-seq La e analysis.
Analysis o ead densi y and peak calling
RPKM alues o he me ged dNET-seq da a se s we e calcula ed
in he ollowing manne :
RPKM ( ansc ip ) =
eads ×104×106
( o al uniquely mapped eads) ×(gene leng h in bp) ,
whe e 10
4
no malizes o gene leng h and 10
6
no malizes o se-
quencing dep h. Que ies o gene 3′UTR o e laps (Fig. 3) be ween
genes we e pe o med wi h bed ools in e sec ( e sion 2.27.1-1-
gb87c465) (Quinlan and Hall 2010).
To de ec splicing in e media e and in on la ia peaks, he al-
go i hm om Chu chman and Weissman (2011) was adap ed as
desc ibed in P udêncio e al. (2020). To be able o call la ge e-
gions as peaks, a cus om algo i hm was de eloped and imple-
men ed in Py hon 3.7. No e ha like o all o he cus om
Py hon code epo ed he e, he e is hea y eliance on bed ools
2.29.0 (Quinlan and Hall 2010) o ope a ions on coo dina e in-
e als. In addi ion, NumPy 1.17.2 (Ha is e al. 2020) and SciPy
1.4.0 (Vi anen e al. 2020) we e used. Ou peak calle de ec s
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 155
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
egions whe e he local ead densi y is signi ican ly highe han
expec ed by chance gi en he o e all ead densi y o he an-
sc ip . Almos all o he nume ical pa ame e s used by he peak
calle can be adjus ed. In Figu e 4A, esul s ob ained wi h wo pa -
icula pa ame e iza ions a e shown. Peak Calle 1 (“la ge peaks”)
is adap ed o de ec ing la ge peaks and p o ides esul s ha a e
mo e in ui i e o a human obse e . Peak Calle 2 (“small peaks”)
p o ides a ine spa ial esolu ion, and co esponds o he se ings
used in all o he analyses in his s udy. The peak calle akes as
inpu a BED ile wi h he 3′ends o eads (single-nucleo ide eso-
lu ion), as well as a GTF ile wi h ansc ip and exon anno a ions
and a lis o ansc ip s o analyze. I unc ions by calcula ing a slid-
ing a e age o ead densi y wi hin each ansc ip (window size 5/
21 o small/la ge; only eads mapping o he same s and as he
anno a ed ansc ip a e conside ed). I hen andomly shu les he
posi ions o he eads wi hin he ansc ip and ecalcula es he
sliding a e ages o de e mine he andom expec a ion. This can
be epea ed se e al imes ( i e in his s udy) o mo e obus ness.
Windows ob ained wi h he ue ead dis ibu ion a e called as
signi ican i hei ead densi y is highe han he 99 h pe cen ile
o he simula ed windows. No e ha in his s udy, we used a se -
ing whe eby his h eshold is calcula ed sepa a ely o each exon
(and i s ups eam in on, o exons o he han he i s ), by exclud-
ing he in on-exon pai o in e es and eads o e lapping i du ing
he simula ion s ep. This is necessa y so ha when calling peaks
wi hin a gi en exon (and i s ups eam in on), he h eshold se
would no be a ec ed by he eads wi hin ha pa icula exon
and i s ups eam in on. This way, o ins ance, he calling o a
peak in he beginning o he exon is no a ec ed by he calling
o a peak in he middle o he same exon (excep h ough po en-
ial me ging, see below). A e he ini ial peaks a e called, hey a e
il e ed o emo e peaks whe e mo e han 90% o he eads come
om a single nucleo ide (p obable PCR duplica es), ha a e sho -
e han 5 n , o ha o e lap wi h ewe eads han a speci ied
h eshold (10/5 o la ge/small). Finally, peaks ha a e wi hin a
speci ied dis ance o each-o he (21/5 n o la ge/small) a e
me ged oge he .
Indi idual gene p o iles
Indi idual dNET-seq gene p o iles we e gene a ed by sepa a ing
eads by s and using SAM ools ( e sion 1.7) (Li e al. 2009).
S and-sepa a ed ead da a was con e ed o bedG aph o ma
using bed ools genomeco wi h he -bg lag ( e sion 2.27.1-1-
gb87c465) (Quinlan and Hall 2010). Co e age alues we e no -
malized pe nucleo ide accoun ing o he o al numbe o
uniquely aligned eads and wi h he scale se o eads pe 10
8
se-
quences. The ou come was con e ed o bigwig iles h ough he
bedG aphToBigWig ool (Ken e al. 2010) and uploaded o he
UCSC Genome B owse (James Ken e al. 2002).
Me agene analysis
The ead densi y me agene plo s in Figu e 3F–I and Figu e 5E,F
we e c ea ed wi h deepTools ( e sion 3.0.2) (Ramí ez e al.
2016). Me agenes wi h no malized gene size (Fig. 3) ha e bins
o 10 bp while all o he me agene plo s in his s udy ha e single
nucleo ide esolu ion. No malized gene and in on leng hs (Fig.
3F–I) we e ob ained h ough he scale- egions op ion. Exon-in-
on junc ions wi hou no malized leng hs we e ob ained using
he e e ence-op ion se o he 3′SS o he 5′SS. Fo no maliza-
ion, we di ided he numbe o eads a each nucleo ide (o bin)
by he o al numbe o eads in he en i e genomic egion unde
analysis. These alues we e hen used o calcula e he mean o
each nucleo ide, and he esul s we e plo ed in a bi a y uni s
(A.U.) anging om 0 o 1.
The peak o ead densi y me agene plo s in Figu es 3D, 4B and
7D, and Supplemen al Figu es S3G, S7A–G, and S7E–Jwe e p e-
pa ed using cus om Py hon and R sc ip s (h ps://gi hub.com/
osinaSa /dNETseq_code). The peak densi y alue ep esen s
he p opo ion o in ons/exons ha o e lap wi h a peak a ha
posi ion. Only in e nal ully coding exons ha we e a leas 100
n long we e included. In addi ion, he in on jus ups eam o
he exon had o be a leas 50 n long. Fo Figu e 7D,
Supplemen al Figu es S7A–G and S7E–H, u he il e ing based
on ead co e age was pe o med (see below). No e ha exons
sho e han 150 nucleo ides con ibu e bo h o he ups eam
and downs eam exonic p opo ion o he plo .
Immedia e splicing analysis
The immedia e splicing analysis was pe o med solely on he S5P
da a se s. Only he 117 p e iously anno a ed p e-MBT genes
(Chen e al. 2013) we e analyzed o ea ly da a se s. Reads we e
conside ed as spliced i hey con ained “N”s in he CIGAR s ing,
in a posi ion co esponding o an anno a ed in on. Reads ha
o e lapped bo h he (unspliced) in on and he downs eam
exon we e conside ed as unspliced. In bo h cases, only eads
whe e he 3′end was loca ed a leas 5 n downs eam om he
3′ss we e included, o a oid analyzing misaligned eads whose
3′end should ha e mapped o he end o he ups eam exon in-
s ead. Spliced eads ha had he 5′end mapped o he ups eam
exon and he 3′end mapped o he in on we e conside ed indic-
a i e o ecu si e splicing i he i s nucleo ide o he downs eam
end (indica i e o he a che poin posi ion) ma ched he second
G in he AGGT canonical splicing mo i . I he las nucleo ide o a
ead ma ched he las nucleo ide o an exon, i was conside ed a
splicing in e media e ead and no ep esen a i e o nascen
RNA. A splicing a io was calcula ed by di iding he numbe o na-
scen RNA spliced eads by he sum o he numbe o spliced and
unspliced nascen RNA eads, only including eads whose 3′ends
mapped o he i s 100 n o he downs eam exon. Only ully
coding in e nal exons a leas 100 n long we e conside ed (ex-
cep ionally, in Fig. 6E and K and Supplemen al Fig. S6O–Q, he
3′mos coding exon was also analyzed). Finally, we pe o med il-
e ing o emo e exons whe e he ead co e age was oo low o
allow o obus es ima ion o he splicing a io. The ele an
h eshold was calcula ed o each da a se sepa a ely. We calcu-
la ed he o al p opo ion o spliced eads ou o all spliced/
unspliced eads o he da a se o ob ain he expec ed splicing
a io. We hen pe o med a binomial es o know he p obabili y
o sampling only spliced/unspliced eads by chance unde he
null ha he ue splicing a io equaled his expec a ion. We se
he h eshold as he lowes numbe o eads ha had o be sam-
pled o he p obabili y o be below 0.01. Th ough his p ocedu e,
he h eshold was se a ≥10 eads o eplica e 1 and 2 o he la e
da a se (no e minal coding exons), a ≥11/10 eads o eplica e
1/2 o he la e da a se including e minal coding exons, and a
≥14/9 eads o eplica e 1/2 o he ea ly da a se ( e minal coding
exons always included).
P udêncio e al.
156 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
Gene a chi ec u e and nucleo ide composi ion analysis
Gene a chi ec u e and nucleo ide composi ion pa ame e s we e
calcula ed using cus om Py hon and R sc ip s based on
Ensembl anno a ions o dm6.18 (Cunningham e al. 2019).
Splice si e s eng h sco es we e calcula ed using MaxEn Scan
(Yeo and Bu ge 2004) wi h de aul pa ame e s. Signi icance es -
ing was pe o med using K uskal–Wallis es s wi h a Bon e oni
co ec ion o mul iple compa isons, wi h he co ec ion applied
sepa a ely o ei he eplica e. Fo p edic o s whe e he co ec ed
P- alue was <0.05, Dunn’s es was pe o med on he pai wise
compa isons using Rpackage dunn. es (Dinno 2017). The se-
quence logo in Figu e 4E was gene a ed using he seqLogo pack-
age e sion 1.52.0 in R (Bembom 2019).
DATA DEPOSITION
All aw and p ocessed sequencing da a gene a ed in his s udy
ha e been submi ed o he NCBI Gene Exp ession Omnibus
(GEO; h ps://www.ncbi.nlm.nih.go /geo/) unde accession num-
be GSE152585. The Py hon code used is a ailable a h ps://
gi hub.com/ osinaSa /dNETseq_code and h ps://gi hub.com/
kenny ebelo.
SUPPLEMENTAL MATERIAL
Supplemen al ma e ial is a ailable o his a icle.
ACKNOWLEDGMENTS
We hank Takayuki Nojima and Nicholas P oud oo (Uni e si y o
Ox o d, UK) o c i ical discussions. This wo k was suppo ed by
unding o M.C.-F. (Fundação pa a a Ciência e Tecnologia,
FCT/Minis é io da Ciência, Tecnologia e Ensino Supe io -
Fundos do O çamen o de Es ado [UIDB/50005/2020], and FCT/
FEDER/POR Lisboa 2020, P og ama Ope acional Regional de
Lisboa PORTUGAL 2020, g an LISBOA-01-0145-FEDER-
016394) and o R.G.M (FCT g an PTDC/BIA-BID/28441/2017).
P.P. was a ecipien o an FCT ellowship (SFRH/BD/109689/
2015). R.S. was a ecipien o an EMBO Long-Te m Fellowship
(EMBO ALTF 101-2019). This p ojec has ecei ed unding om
he Eu opean Union’s Ho izon 2020 esea ch and inno a ion p o-
g amme unde g an ag eemen s no. 842695 (Ma ie Skłodowska-
Cu ie Ac ions) and no. 857119 (RiboMed).
Au ho con ibu ions: P.P. pe o med all molecula biology ex-
pe imen s. R.S. pe o med he majo i y o splicing kine ics analy-
ses and de eloped he peak calle o de ec ing pu a i e pause
si es. K.R. pe o med addi ional bioin o ma ics analyses. P.P., R.
S., R.G.M., and M.C.-F concei ed he s udy and w o e he pape .
Recei ed July 26, 2021; accep ed Sep embe 23, 2021.
REFERENCES
Akh a J, K eim N, Ma ini F, Mohana G, B üne D, Binde H, Roignan J-
Y. 2019. P omo e -p oximal pausing media ed by he exon junc-
ion complex egula es splicing. Na Commun 10: 521. doi:10
.1038/s41467-019-08381-0
Alexande RD, Innocen e SA, Ba ass JD, Beggs JD. 2010. Splicing-
dependen RNA polyme ase pausing in yeas . Mol Cell 40: 582–
593. doi:10.1016/j.molcel.2010.11.005
Alpe T, He zel L, Neugebaue KM. 2017. Pe ec iming: splicing and
ansc ip ion a es in li ing cells. WIREs RNA 8: e1401. doi:10
.1002/w na.1401
Ameu A, Zaghlool A, Hal a dson J, We e bom A, Gyllens en U,
Ca elie L, Feuk L. 2011. To al RNA sequencing e eals nascen an-
sc ip ion and widesp ead co- ansc ip ional splicing in he human
b ain. Na S uc Mol Biol 18: 1435–1440. doi:10.1038/nsmb.2143
A ie i CG, F ase HB. 2014. T ansc ip leng h media es de elopmen-
al iming o gene exp ession ac oss D osophila.Mol Biol E ol 31:
2879–2889. doi:10.1093/molbe /msu226
A za e-Mejía RG, Josué Ce ecedo-Cas illo A, Gue e o G, Fu lan-
Maga il M, Recillas-Ta ga F. 2020. In si u dissec ion o domain bound-
a ies a ec genome opology and gene ansc ip ion in D osophila.
Na Commun 11: 894. doi:10.1038/s41467-020-14651-z
Aslanzadeh V, Huang Y, Sanguine i G, Beggs JD. 2018. T ansc ip ion
a e s ongly a ec s splicing ideli y and co ansc ip ionali y in
budding yeas . Genome Res 28: 203–213. doi:10.1101/g
.225615.117
Ba sché E, Yani M, Mucha d C. 2006. The human SWI/SNF subuni
B m is a egula o o al e na i e splicing. Na S uc Mol Biol 13:
22–29. doi:10.1038/nsmb1030
Bembom O. 2019. seqLogo: sequence logos o DNA sequence
alignmen s. R package e sion 1.52.0.
Be ge SM. 1995. Exon ecogni ion in e eb a e splicing. J Biol Chem
270: 2411–2414. doi:10.1074/jbc.270.6.2411
Beye AL, Osheim YN. 1988. Splice si e selec ion, a e o splicing, and
al e na i e splicing on nascen ansc ip s. Genes De 2: 754–765.
doi:10.1101/gad.2.6.754
Bly he SA, Wieschaus EF. 2015. Coo dina ing cell cycle emodeling
wi h ansc ip ional ac i a ion a he D osophila MBT. Cu Top
De Biol 113: 113–148. doi: 10.1016/bs.c db.2015.06.002
Bly he SA, Wieschaus EF. 2016. Es ablishmen and main enance o
he i able ch oma in s uc u e du ing ea ly D osophila emb yogen-
esis. Eli e 5: e20148. doi:10.7554/eLi e.20148
Boija A, Maha DB, Za e A, Holmq is P-H, Philip P, Meye s DJ,
Cole PA, Lis JT, S enbe g P, Manne ik M. 2017. CBP egula es e-
c ui men and elease o p omo e -p oximal RNA polyme ase II.
Mol Cell 68: 491–503.e5. doi:10.1016/j.molcel.2017.09.031
B ugiolo M, He zel L, Neugebaue KM. 2013. Coun ing on co- an-
sc ip ional splicing. F1000P ime Rep 5: 9. doi:10.12703/P5-9
Bu ne e JM, Miyamo o-Sa o E, Schaub MA, Conklin J, Lopez AJ.
2005. Subdi ision o la ge in ons in D osophila by ecu si e splic-
ing a nonexonic elemen s. Gene ics 170: 661–674. doi:10.1534/
gene ics.104.039701
Bushnell B, Rood J, Singe E. 2017. BBMe ge: accu a e pai ed sho -
gun ead me ging ia o e lap. PLoS One 12: e0185056. doi:10
.1371/jou nal.pone.0185056
Campos-O ega JA. 1985. Gene ics o ea ly neu ogenesis in
D osophila melanogas e .T ends Neu osci 8: 245–250. doi:10
.1016/0166-2236(85)90097-9
Ca illo Oes e eich F, P eibisch S, Neugebaue KM. 2010. Global
analysis o nascen RNA e eals ansc ip ional pausing in e minal
exons. Mol Cell 40: 571–581. doi:10.1016/j.molcel.2010.11.004
Ca illo Oes e eich F, He zel L, S aube K, Huje K, Howa d J,
Neugebaue KM. 2016. Splicing o nascen RNA coincides wi h in-
on exi om RNA polyme ase II. Cell 165: 372–381. doi:10.1016/
j.cell.2016.02.045
Cha ho h KT, Ba ass JD, Webb S, Beggs JD. 2014. A splicing-depen-
den ansc ip ional checkpoin associa ed wi h p espliceosome o -
ma ion. Mol Cell 53: 779–790. doi:10.1016/j.molcel.2014.01.017
Chen K, Johns on J, Shao W, Meie S, S abe C, Zei linge J. 2013. A
global change in RNA polyme ase II pausing du ing he
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 157
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
D osophila midblas ula ansi ion. Eli e 2: e00861. doi:10.7554/
eLi e.00861
Chu chman LS, Weissman JS. 2011. Nascen ansc ip sequencing
isualizes ansc ip ion a nucleo ide esolu ion. Na u e 469:
368–373. doi:10.1038/na u e09652
Co e LJ, Wa e all JJ, Lis JT. 2008. Nascen RNA sequencing e eals
widesp ead pausing and di e gen ini ia ion. Science 322:
1845–1849. doi:10.1126/science.1162228
Cunningham F, Achu han P, Akanni W, Allen J, Amode MR, A mean IM,
Benne R, Bhai J, Billis K, Boddu S, e al. 2019. Ensembl 2019.
Nucleic Acids Res 47: D745–D751. doi:10.1093/na /gky1113
Dahlbe g O, Shilko a O, Tang M, Holmq is P-H, Manne ik M. 2015.
P-TEFb, he supe elonga ion complex and media o egula e a
subse o non-paused genes du ing ea ly D osophila emb yo de-
elopmen . PLoS Gene 11: e1004971. doi:10.1371/jou nal
.pgen.1004971
Da id CJ, Boyne AR, Millhouse SR, Manley JL. 2011. The RNA poly-
me ase II C- e minal domain p omo es splicing ac i a ion h ough
ec ui men o a U2AF65–P p19 complex. Genes De 25: 972–
982. doi:10.1101/gad.2038011
de Almeida SF, Ca mo-Fonseca M. 2008. The CTD ole in co ansc ip-
ional RNA p ocessing and su eillance. FEBS Le 582: 1971–
1976. doi:10.1016/j. ebsle .2008.04.019
De Con i L, Ba alle M, Bu a i E. 2013. Exon and in on de ini ion in
p e-mRNA splicing. Wiley In e discip Re RNA 4: 49–60. doi:10
.1002/w na.1140
de la Ma a M, Alonso CR, Kadene S, Fededa JP, Blaus ein M,
Pelisch F, C ame P, Ben ley D, Ko nblih AR. 2003. A slow RNA
polyme ase II a ec s al e na i e splicing in i o. Mol Cell 12:
525–532. doi:10.1016/j.molcel.2003.08.001
Dingwall C, Lomonosso GP, Laskey RA. 1981. High sequence speci-
ici y o mic ococcal nuclease. Nucleic Acids Res 9: 2659–2674.
doi:10.1093/na /9.12.2659
Dinno A. 2017. dunn. es : Dunn’s es o mul iple compa isons using
ank sums. R package e sion 1.3.5. h ps://c an. -p ojec .o g/
web/packages/dunn. es /index.h ml
DobinA,Da isCA,Schlesinge F,D enkowJ,ZaleskiC,JhaS,Ba u P,
Chaisson M, Ginge as TR. 2013. STAR: ul a as uni e sal RNA-seq
aligne . Bioin o ma ics 29: 15–21. doi:10.1093/bioin o ma ics/b s635
D exle HL, Choque K, Chu chman LS. 2020. Splicing kine ics and co-
o dina ion e ealed by di ec nascen RNA sequencing h ough
nanopo es. Mol Cell 77: 985–998.e8. doi:10.1016/j.molcel.2019
.11.017
Du MO, Olson S, Wei X, Ga e SC, Osman A, Bolise y M, Plocik A,
Celnike SE, G a eley BR. 2015. Genome-wide iden i ica ion o
ze o nucleo ide ecu si e splicing in D osophila.Na u e 521:
376–379. doi:10.1038/na u e14475
Emili A, Shales M, McC acken S, Xie W, Tucke PW, Kobayashi R,
Blencowe BJ, Ingles CJ. 2002. Splicing and ansc ip ion-associa -
ed p o eins PSF and p54
n b
/NonO bind o he RNA polyme ase II
CTD. RNA 8: 1102–1111. doi:10.1017/S1355838202025037
E ickson JW, Cline TW. 1993. A bZIP p o ein, sis e less-a, collabo a es
wi h bHLH ansc ip ion ac o s ea ly in D osophila de elopmen o
de e mine sex. Genes De 7: 1688–1702. doi:10.1101/gad.7.9.1688
Fong N, Kim H, Zhou Y, Ji X, Qiu J, Saldi T, Diene K, Jones K, Fu XD,
Ben ley DL. 2014. P e-mRNA splicing is acili a ed by an op imal
RNA polyme ase II elonga ion a e. Genes De 28: 2663–2676.
doi:10.1101/gad.252106.114
Fox-Walsh KL, Dou Y, Lam BJ, Hung SP, Baldi PF, He el KJ. 2005. The
a chi ec u e o p e-mRNAs a ec s mechanisms o splice-si e pai -
ing. P oc Na l Acad Sci 102: 16176–16181. doi:10.1073/pnas
.0508489102
Fukaya T, Lim B, Le ine M. 2017. Rapid a es o Pol II elonga ion in he
D osophila emb yo. Cu Biol 27: 1387–1391. doi:10.1016/j.cub
.2017.03.069
Ga ney DJ, McVicke G, Pai AA, Fondu e-Mi endo YN, Lewellen N,
Michelini K, Widom J, Gilad Y, P i cha d JK. 2012. Con ols o nu-
cleosome posi ioning in he human genome. PLoS Gene 8:
e1003036. doi:10.1371/jou nal.pgen.1003036
Gel man S, Cohen N, Yea im A, As G. 2013. DNA-me hyla ion e ec
on co ansc ip ional splicing is dependen on GC a chi ec u e o
he exon-in on s uc u e. Genome Res 23: 789–799. doi:10
.1101/g .143503.112
Gö nemann J, Ba andon C, Huje K, Ru z B, Rigau G, Ko o ic KM,
Faux C, Neugebaue KM, Sé aphin B. 2011. Co ansc ip ional spli-
ceosome assembly and splicing a e independen o he P p40p
WW domain. RNA 17: 2119–2129. doi:10.1261/ na.02646811
G a eley BR, B ooks AN, Ca lson JW, Du MO, Landolin JM, Yang L,
A ie i CG, Van Ba en MJ, Boley N, Boo h BW, e al. 2011. The
de elopmen al ansc ip ome o D osophila melanogas e .
Na u e 471: 473–479. doi:10.1038/na u e09715
Guilgu LG, P udêncio P, Sob al D, Liszeko a D, Rosa A, Ma inho RG.
2014. Requi emen o highly e icien p e-mRNA splicing du ing
D osophila ea ly emb yonic de elopmen . Eli e 3: e02181.
doi:10.7554/eLi e.02181
Ha len KM, Chu chman LS. 2017. The code and beyond: ansc ip ion
egula ion by he RNA polyme ase II ca boxy- e minal domain.
Na Re Mol Cell Biol 18: 263–273. doi:10.1038/n m.2017.10
Ha is CR, Millman KJ, an de Wal SJ, Gomme s R, Vi anen P,
Cou napeau D, Wiese E, Taylo J, Be g S, Smi h NJ, e al. 2020.
A ay p og amming wi h NumPy. Na u e 585: 357–362. doi:10
.1038/s41586-020-2649-2
Ha on AR, Sub amaniam V, Lopez AJ. 1998. Gene a ion o al e na i e
Ul abi ho ax iso o ms and s epwise emo al o a la ge in on by
esplicing a exon-exon junc ions. Mol Cell 2: 787–796. doi:10
.1016/S1097-2765(00)80293-2
He zel L, S aube K, Neugebaue KM. 2018. Long- ead sequencing o
nascen RNA e eals coupling among RNA p ocessing e en s.
Genome Res 28: 1008–1019. doi:10.1101/g .232025.117
Hö z W, Al enbu ge W. 1981. Sequence speci ic clea age o DNA by
mic ococcal nuclease. Nucleic Acids Res 9: 2643–2658. doi:10
.1093/na /9.12.2643
HoskinsRA,LandolinJM,B ownJB,Sandle JE,TakahashiH,
Lassmann T, Boo h BW, Zhang D, Wan KH, Yang L, e al. 2011.
Genome-wide analysis o p omo e a chi ec u e in D osophila mela-
nogas e .Genome Res 21: 182–192. doi:10.1101/g .112466.110
Hsin JP, Manley JL. 2012. The RNA polyme ase II CTD coo dina es
ansc ip ion and RNA p ocessing. Genes De 26: 2119–2137.
doi:10.1101/gad.200303.112
James Ken W, Sugne CW, Fu ey TS, Roskin KM, P ingle TH,
Zahle AM, Haussle D. 2002. The human genome b owse a
UCSC. Genome Res 12: 996–1006. doi:10.1101/g .229102
Ji J-Y, Squi ell JM, Schubige G. 2004. Bo h Cyclin B le els and DNA-
eplica ion checkpoin con ol he ea ly emb yonic mi oses in
D osophila Jun-Yuan. De elopmen 131: 401–411. doi:10.1242/
de .00944
Jonke s I, Kwak H, Lis JT. 2014. Genome-wide dynamics o Pol II elon-
ga ion and i s in e play wi h p omo e p oximal pausing, ch oma-
in, and exons. Eli e 3: e02407. doi:10.7554/eLi e.02407
Joseph B, Kondo S, Lai EC. 2018. Sho c yp ic exons media e ecu -
si e splicing in D osophila.Na S uc Mol Biol 25: 365–371. doi:10
.1038/s41594-018-0052-6
Ken WJ, Zweig AS, Ba be G, Hin ichs AS, Ka olchik D. 2010. BigWig
and BigBed: enabling b owsing o la ge dis ibu ed da ase s.
Bioin o ma ics 26: 2204–2207. doi:10.1093/bioin o ma ics/b q351
Ke en H, Le -Mao G, As G. 2010. Al e na i e splicing and e olu ion:
di e si ica ion, exon de ini ion and unc ion. Na Re Gene 11:
345–355. doi:10.1038/n g2776
Khodo YL, Rod iguez J, Ab uzzi KC, Tang CHA, Ma MT, Rosbash M.
2011. Nascen -seq indica es widesp ead co ansc ip ional p e-
P udêncio e al.
158 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
mRNA splicing in D osophila.Genes De 25: 2502–2512. doi:10
.1101/gad.178962.111
Khodo YL, Mene JS, Tolan M, Rosbash M. 2012. Co ansc ip ional
splicing e iciency di e s d ama ically be ween D osophila and
mouse. RNA 18: 2174–2186. doi:10.1261/ na.034090.112
Kwak H, Fuda NJ, Co e LJ, Lis JT. 2013. P ecise maps o RNA polyme -
ase e eal how p omo e s di ec ini ia ion and pausing. Science
339: 950–953. doi:10.1126/science.1229386
Kwasnieski JC, O -Wea e TL, Ba el DP. 2019. Ea ly genome ac i a-
ion in D osophila is ex ensi e wi h an ini ial endency o abo ed
ansc ip s and e ained in ons. Genome Res 29: 1188–1197.
doi:10.1101/g .242164.118
La son MH, Mooney RA, Pe e s JM, Windgassen T, Nayak D,
G oss CA, Block SM, G eenlea WJ, Landick R, Weissman JS.
2014. A pause sequence en iched a ansla ion s a si es d i es
ansc ip ion dynamics in i o. Science 344: 1042–1047. doi:10
.1126/science.1251871
La e JD, Ma solais AJ, Smibe CA, Lipshi z HD. 2015. Regula ion
and unc ion o ma e nal gene p oduc s du ing he ma e nal- o-zy-
go ic ansi ion in D osophila.Cu Top De Biol.113: 4384. 10
.1016/bs.c db.2015.06.007
Lee JEA, Mi chell NC, Zay se a O, Chahal A, Mendis P, Ca ie -
Michaud A, Pa sons LM, Poo inga G, Le ens DL, Hannan RD,
e al. 2015. De ec i e H p-dependen ansc ip ional ep ession
o dMYC is undamen al o issue o e g ow h in D osophila XPB
models. Na Commun 6: 7404. doi:10.1038/ncomms8404
Li H, Handsake B, Wysoke A, Fennell T, Ruan J, Home N, Ma h G,
Abecasis G, Du bin R. 2009. The Sequence Alignmen /Map o -
ma and SAM ools. Bioin o ma ics 25: 2078–2079. doi:10.1093/
bioin o ma ics/b p352
Lo SE, Villal a JE, Sch o h GP, Luo S, Tonkin LA, Eisen MB. 2011.
Noncanonical compensa ion o zygo ic x ansc ip ion in ea ly D oso-
phila melanogas e de elopmen e ealed h ough single-emb yo
RNA-seq. PLoS Biol 9: e1000590. doi:10.1371/jou nal.pbio.1000590
Lund E, Dahlbe g JE. 1992. Cyclic 2′,3
′-phospha es and non em-
pla ed nucleo ides a he 3′end o spliceosomal U6 small nuclea
RNAs. Science 255: 327–330. doi:10.1126/science.1549778
Ma in M. 2011. Cu adap emo es adap e sequences om high-
h oughpu sequencing eads. EMBne .J 17: 10–12. doi:10.14806/
ej.17.1.200
Ma in RM, Rino J, Ca alho C, Ki chhausen T, Ca mo-Fonseca M.
2013. Li e-cell isualiza ion o p e-mRNA splicing wi h single-mol-
ecule sensi i i y. Cell Rep 4: 1144–1155. doi:10.1016/j.cel ep
.2013.08.013
Ma inho RG, Guilgu LG, P udêncio P. 2015. How gene exp ession in
as -p oli e a ing cells keeps pace. Bioessays 37: 514–524. doi:10
.1002/bies.201400195
Maslon MM, B aunschweig U, Ai ken S, Mann AR, Kilanowski F,
Hun e CJ, Blencowe BJ, Ko nblih AR, Adams IR, Cáce es JF.
2019. A slow ansc ip ion a e causes emb yonic le hali y and pe -
u bs kine ic coupling o neu onal genes. EMBO J 38: e101244.
doi:10.15252/embj.2018101244
Maye A, Di Iulio J, Male i S, Ese U, Vie s a J, Reynolds A,
Sands om R, S ama oyannopoulos JA, Chu chman LS. 2015.
Na i e elonga ing ansc ip sequencing e eals human ansc ip-
ional ac i i y a nucleo ide esolu ion. Cell 161: 541–554. doi:10
.1016/j.cell.2015.03.010
Mo is DP, G eenlea AL. 2000. The splicing ac o , P p40, binds he
phospho yla ed ca boxyl- e minal domain o RNA polyme ase II.
J Biol Chem 275: 39935–39943. doi:10.1074/jbc.M004118200
Nojima T, Gomes T, G osso ARF, Kimu a H, Dye MJ, Dhi S, Ca mo-
Fonseca M, P oud oo NJ. 2015. Mammalian NET-seq e eals ge-
nome-wide nascen ansc ip ion coupled o RNA p ocessing. Cell
161: 526–540. doi:10.1016/j.cell.2015.03.027
Nojima T, Gomes T, Ca mo-Fonseca M, P oud oo NJ. 2016.
Mammalian NET-seq analysis de ines nascen RNA p o iles and as-
socia ed RNA p ocessing genome-wide. Na P o oc 11: 413–428.
doi:10.1038/np o .2016.012
Nojima T, Rebelo K, Gomes T, G osso AR, P oud oo NJ, Ca mo-
Fonseca M. 2018. RNA polyme ase II phospho yla ed on CTD se -
ine 5 in e ac s wi h he spliceosome du ing co- ansc ip ional splic-
ing. Mol Cell 72: 369–379.e4. doi:10.1016/j.molcel.2018.09.004
Pai AA, Hen iques T, McCue K, Bu kholde A, Adelman K, Bu ge CB.
2017. The kine ics o p e-mRNA splicing in he D osophila ge-
nome and he in luence o gene a chi ec u e. Eli e 6: e32537.
doi:10.7554/eLi e.32537
Pai AA, Paggi JM, Yan P, Adelman K, Bu ge CB. 2018. Nume ous e-
cu si e si es con ibu e o accu acy o splicing in long in ons in
lies. PLoS Gene 14: e1007588. doi:10.1371/jou nal.pgen
.1007588
Pe ea M, Pe ea GM, An onescu CM, Chang TC, Mendell JT,
Salzbe g SL. 2015. S ingTie enables imp o ed econs uc ion o
a ansc ip ome om RNA-seq eads. Na Bio echnol 33: 290–
295. doi:10.1038/nb .3122
P i cha d DK, Schubige G. 1996. Ac i a ion o ansc ip ion in
D osophila emb yos is a g adual p ocess media ed by he nucleo-
cy oplasmic a io. Genes De 10: 1131–1142. doi:10.1101/gad.10
.9.1131
P oud oo NJ. 2016. T ansc ip ional e mina ion in mammals: s op-
ping he RNA polyme ase II jugge nau . Science 352: aad9926.
doi:10.1126/science.aad9926
P udêncio P, Rebelo K, G osso AR, Ma inho RG, Ca mo- onseca M.
2020. Analysis o mammalian na i e elonga ing ansc ip se-
quencing (mNET-seq) high- h oughpu da a. Me hods 178: 89–
95. doi:10.1016/j.yme h.2019.09.003
Quinlan AR, Hall IM. 2010. BEDTools: a lexible sui e o u ili ies o
compa ing genomic ea u es. Bioin o ma ics 26: 841–842.
doi:10.1093/bioin o ma ics/b q033
Ramí ez F, Ryan DP, G üning B, Bha dwaj V, Kilpe F, Rich e AS,
Heyne S, Dünda F, Manke T. 2016. deepTools2: a nex gene a ion
web se e o deep-sequencing da a analysis. Nucleic Acids Res
44: W160–W165. doi:10.1093/na /gkw257
Reime KA, Mimoso CA, Adelman K, Neugebaue KM. 2021. Co- an-
sc ip ional splicing egula es 3′end clea age du ing mammalian
e y h opoiesis. Mol Cell 81: 998–1012.e7. doi:10.1016/j.molcel
.2020.12.018
Robbe son BL, Co e GJ, Be ge SM. 1990. Exon de ini ion may acil-
i a e splice si e selec ion in RNAs wi h mul iple exons. Mol Cell Biol
10: 84–94. doi:10.1128/MCB.10.1.84
Ro he M, Pehl M, Taube H, Jäckle H. 1992. Loss o gene unc ion
h ough apid mi o ic cycles in he D osophila emb yo. Na u e
359: 156–159. doi:10.1038/359156a0
Sandle JE, I iza y J, S epanik V, Dunipace L, Am hein H,
S a hopoulos A. 2018. A de elopmen al p og am unca es long
ansc ip s o empo ally egula e cell signaling. De Cell 47:
773–784.e6. doi:10.1016/j.de cel.2018.11.019
Saunde s A, Co e LJ, Su cli e C, Lis JT, Ashe HL. 2013. Ex ensi e po-
lyme ase pausing du ing D osophila axis pa e ning enables high-
le el and pliable ansc ip ion. Genes De 27: 1146–1158. doi:10
.1101/gad.215459.113
Schlackow M, Nojima T, Gomes T, Dhi A, Ca mo-Fonseca M,
P oud oo NJ. 2017. Dis inc i e pa e ns o ansc ip ion and
RNA p ocessing o human lincRNAs. Mol Cell 65: 25–38. doi:10
.1016/j.molcel.2016.11.029
Schulz KN, Bond a ER, Moshe A, Villal a JE, Lieb JD, Kaplan T,
McKay DJ, Ha ison MM. 2015. Zelda is di e en ially equi ed
o ch oma in accessibili y, ansc ip ion ac o binding, and gene
exp ession in he ea ly D osophila emb yo. Genome Res 25:
1715–1726. doi:10.1101/g .192682.115
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 159
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om

She idan RM, Fong N, D’Alessand o A, Ben ley DL. 2019. Widesp ead
back acking by RNA Pol II is a majo e ec o o gene ac i a ion, 5′
pause elease, e mina ion, and ansc ip ion elonga ion a e. Mol
Cell 73: 107–118.e4. doi:10.1016/j.molcel.2018.10.031
She moen AW, O’Fa ell PH. 1991. P og ession o he cell cycle
h ough mi osis leads o abo ion o nascen ansc ip s. Cell 67:
303–310. doi:10.1016/0092-8674(91)90182-X
Sousa-Luís R, Duja din G, Zukhe I, Kimu a H, Weldon C, Ca mo-
Fonseca M, P oud oo NJ, Nojima T. 2021. POINT echnology illumi-
na es he p ocessing o polyme ase-associa ed in ac nascen an-
sc ip s. Mol Cell 81: 1935–1950.e6. doi:10.1016/j.molcel.2021.02.034
S e ne DA, Ca lo T, Be ge SM. 1996. A chi ec u al limi s on spli genes.
P oc Na l Acad Sci 93: 15081–15085. doi:10.1073/pnas.93.26.15081
Veloso A, Ki kconnell KS, Magnuson B, Biewen B, Paulsen MT,
Wilson TE, Ljungman M. 2014. Ra e o elonga ion by RNA polyme -
ase II is associa ed wi h speci ic gene ea u es and epigene ic mod-
i ica ions. Genome Res 24: 896–905. doi:10.1101/g .171405.113
Vi anen P, Gomme s R, Oliphan TE, Habe land M, Reddy T,
Cou napeau D, Bu o ski E, Pe e son P, Weckesse W, B igh J, e al.
2020. SciPy 1.0: undamen al algo i hms o scien i ic compu ing in
Py hon. Na Me hods 17: 261–272. doi:10.1038/s41592-019-0686-2
Vizcaya-Molina E, Klein CC, Se as F, Mish a RK, Guigó R, Co ominas M.
2018. Damage- esponsi e elemen s in D osophila egene a ion.
Genome Res 28: 1852–1866. doi:10.1101/g .233098.117
Wan Y, Anas asakis DG, Rod iguez J, Palanga M, Gudla P, Zaki G,
Tandon M, Pego a o G, Chow CC, Ha ne M, e al. 2021.
Dynamic imaging o nascen RNA e eals gene al p inciples o
ansc ip ion dynamics and s ochas ic splice si e selec ion. Cell
184: 2878–2895.e20. doi:10.1016/j.cell.2021.04.012
Windhage L, Bon e T, Bu ge K, Ruzsics Z, K ebs S, Kau mann S,
Mal e e G, L’He naul A, Schilhabel M, Sch eibe S, e al. 2012.
Ul asho and p og essi e 4sU- agging e eals key cha ac e is ics
o RNA p ocessing a nucleo ide esolu ion. Genome Res 22:
2031–2042. doi:10.1101/g .131847.111
Yan D, Neumülle RA, Buckne M, Aye s K, Li H, Hu Y, Yang-Zhou D,
Pan L, Wang X, Kelley C, e al. 2014. A egula o y ne wo k o
D osophila ge mline s em cell sel - enewal. De Cell 28: 459–
473. doi:10.1016/j.de cel.2014.01.020
Yeo G, Bu ge CB. 2004. Maximum en opy modeling o sho se-
quence mo i s wi h applica ions o RNA splicing signals. J
Compu Biol 11: 377–394. doi:10.1089/1066527041410418
Yuan K, Selle CA, She moen AW, Fa ell PHO. 2016. Timing he
D osophila mid-blas ula ansi ion: a cell cycle-cen e ed iew.
T ends Gene 32: 496–507. doi:10.1016/j. ig.2016.05.006
Zhu L, Zhang Y, Zhang W, Yang S, Chen J-Q, Tian D. 2009.
Pa e ns o exon-in on a chi ec u e a ia ion o genes in euka y-
o ic genomes. BMC Genomics 10: 47. doi:10.1186/1471-2164-
10-47
MEET THE FIRST AUTHORS
Ped o P udêncio Rosina Sa isaa
Kenny Rebelo
Mee he Fi s Au ho (s) is a newedi o ial ea u ewi hinRNA,in
which he i s au ho (s) o esea ch-based pape s in each issue
ha e he oppo uni y o in oduce hemsel es and hei wo k o
eade s o RNA and he RNA esea ch communi y. Ped o
P udêncio, Rosina Sa isaa , and Kenny Rebelo a e co- i s au-
ho s o his pape , “T ansc ip ion and splicing dynamics du ing
ea ly D osophila de elopmen .”Ped o is a pos doc o al ellow
a he Ins i u e o Molecula Medicine, Lisbon in he lab o
D . Ca mo-Fonseca, wi h a ocus on he in e play be ween an-
sc ip ion and splicing. Rosina is also a pos doc o al ellow in he
Ca mo-Fonsecag oup, wi hanin e es in hekine icso splicing
and how i is linked o he e olu ion o splicing egula o y in o -
ma ion. Kenny is a molecula gene ics g adua e s uden a he
Uni e si y o To on o in he lab o Benjamin Blencowe, wi h an
in e es in unde s anding how nuclea p o ein complexes p o-
cess RNA o enable cellula unc ion.
Wha a e he majo esul s desc ibed in you pape
and how do hey impac his b anch o he ield?
In his pape , we b ough he NET-seq me hod ou o he cell dish
and in o whole D osophila emb yos (dNETseq), allowing us o ex-
plo e se e al aspec s o RNA biology in his model. We s udied
ansc ip ion e mina ion and ound e idence ha his p ocess
may exhibi mechanis ic di e ences depending on whe he he
ansc ip ion uni is isola ed o o e laps a con e gen gene. As
genes exp essed ea lie in emb yonic de elopmen a e mo e likely
o be isola ed, his means ha p e e ed mechanisms o ansc ip-
ion e mina ion may e ol e as de elopmen p og esses. We also
add essed p oblems o splicing kine ics. We obse ed ha many
in ons a e spliced immedia ely a e ansc ip ion, including e y
la ge in ons, sugges ing ha splicing ia in on de ini ion is no
limi ed o small in ons.
Con inued
P udêncio e al.
160 RNA (2022) Vol. 28, No. 2
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
Wha led you o s udy RNA o his aspec o RNA science?
PP: My desi e is o unde s and he complex egula ion o gene ex-
p ession. I s a ed my scien i ic ca ee wo king in D osophila em-
b yogenesis in Rui Ma inho’s lab, whe e we came ac oss an
obse a ion ha led o ques ions ha we didn’ ha e he ools o
answe . Luckily, and in collabo a ion wi h he Ca mo-Fonseca
lab, I had he oppo uni y o lea n his inc edible echnique and
o adap i o D osophila emb yos, and wi h his, ha e he chance
o look a gene exp ession om a pe spec i e ne e done be o e
in his sys em.
RS: Splicing is inc edibly complex and inc edibly con using o
s udy, and his is wha always a ac ed me o he ield. Fo my
PhD, I wo ked on he molecula e olu ion o splicing signals.
Se e al g oups, including he Ca mo-Fonseca lab, we e making
ascina ing no el indings ega ding he kine ics o splicing. I
became cu ious as o how he dynamic na u e o splicing was a -
ec ing hese e olu iona y p ocesses, and hence decided o ocus
on splicing kine ics o my pos doc o al wo k.
KR: Fascina ion o e how simila o ganized and egula ed biolog-
ical p ocesses can be o assembly lines in a ac o y. I joined he
Ca mo-Fonseca lab du ing my M.Sc. whe e I was able o explo e
his in e es when analyzing da a ha opened he cell’s“ ac o y
doo ” o s udy ansc ip ion and splicing.
Du ing he cou se o hese expe imen s, we e he e
any su p ising esul s o pa icula di icul ies ha al e ed
you hinking and subsequen ocus?
RS: AdNETseq expe imen gi es ise o a bo omless easu e
o e o in o ma ion. Howe e , he analysis equi ed o con e
ha in o ma ion in o insigh is complex and w ough wi h pe ils.
Fo ins ance, an inc ease in he ansc ip ion ini ia ion a e, a
dec ease in he elonga ion a e, and a phospho yla ion ho spo
can all lead o simila signa u es in he sequencing da a, and one
mus be e y ca e ul o keep all o hese al e na i es in mind
when pe o ming he analysis. Being con on ed wi h he complex-
i y o his da a has made me ealize how much mo e insigh I could
gain i I had a la ge oolki o my analyses. I ha e hus sough ou
aining in mo e ad anced s a is ical modeling echniques, some-
hing ha I may ha e ne e done i I had no encoun e ed
dNETseq da a.
PP: Explo ing he ea u es o nascen RNA wi h dNETseq equi es
a signi ican amoun o biological sample. This made he analysis
o ea lie D osophila de elopmen al s ages as planned ex emely
di icul . We he e o e ocused on la e s ages o de elopmen .
Howe e , NET-seq da a is so ull o in o ma ion ha we s ill ended
up e ealing se e al exci ing new ea u es o RNA ansc ip ion
and p ocessing.
Wha a e some o he landma k momen s ha
p o oked you in e es in science o you de elopmen
as a scien is ?
KR: I was imp essed, in mo e han one unique momen , by my col-
leagues’ eadiness o adap and p oduce solu ions when con on -
ed wi h unexpec ed o con ounding esul s. By cons an ly
challenging mysel and keeping an open mind, I aspi e o ma ch
his p oblem-sol ing abili y, which is co e o spea heading you
own esea ch.
I you we e able o gi e one piece o ad ice o you younge
sel , wha would ha be?
KR: De elop a p o essional and e icien communica ion me hod. I
belie e his is one o he mos pe inen skill se s o es ablish ea ly
on because i can wo k o p oac i ely a oid misunde s andings.
Fo example, when p esen ing an idea o a colleague o you
supe iso be su e o no imply ha you idea is be e and ins ead
explain he esul s/e idence o guide he o he pe son o connec
he same do s ha you did.
Wha a e you subsequen nea - o long- e m
ca ee plans?
RS: I am cu en ly looking o ways o keep on doing he kinds o
hings ha scien is s do, bu as a eelance , away om he classical
academic ca ee pa h. This is so as o ha e mo e lexibili y wi h
ega d o whe e in he wo ld I can li e bu also o be able o
ake on mo e di e se p ojec s. My p ima y in e es a he momen
is in me hods o eaching s a is ics, and I am in he p ocess o o -
ganizing a ga gan uan s a is ics cou se a my ins i u e. Exci ing
imes!
PP: The ield has exci ing open ques ions, and al hough echnol-
ogy is de eloping exponen ially, di e en echniques a e s ill
poin ing in di e en di ec ions. This means ha he e is s ill wo k
o be done in he ield o unde s and how hese inc edible and
complex mac omolecules ha syn hesize and modi y RNA a e eg-
ula ed. Taking ad an age o he la es echnology o analyze hese
p ocesses, I expec o use he nex yea s o my pos doc o explo e
hese ea u es in mo e de ail and speci ically in he con ex o a
mul icellula o ganism.
Wha we e he s onges aspec s o you collabo a ion
as co- i s au ho s?
This was an amazing collabo a ion, p ima ily because ou back-
g ounds a e so complemen a y. Each o us was lea ning new
hings in e e y con e sa ion ha we had.
T ansc ip ion and splicing dynamics in D osophila
www. najou nal.o g 161
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om
10.1261/ na.078933.121Access he mos ecen e sion a doi:
2022 28: 139-161 o iginally published online Oc obe 19, 2021RNA
Ped o P udêncio, Rosina Sa isaa , Kenny Rebelo, e al.
de elopmen D osophilaT ansc ip ion and splicing dynamics du ing ea ly
Ma e ial
Supplemen al h p:// najou nal.cshlp.o g/con en /suppl/2021/10/19/ na.078933.121.DC1
Re e ences
h p:// najou nal.cshlp.o g/con en /28/2/139. ull.h ml# e -lis -1
This a icle ci es 103 a icles, 30 o which can be accessed ee a :
Open Access Open Access op ion.RNAF eely a ailable online h ough he
License
Commons
C ea i e
.h p://c ea i ecommons.o g/licenses/by/4.0/
(A ibu ion 4.0 In e na ional), as desc ibed a
, is a ailable unde a C ea i e Commons LicenseRNAThis a icle, published in
Se ice
Email Ale ing
click he e. op igh co ne o he a icle o
Recei e ee email ale s when new a icles ci e his a icle - sign up in he box a he
h p:// najou nal.cshlp.o g/subsc ip ions
go o: RNATo subsc ibe o
© 2022 P udêncio e al.; Published by Cold Sp ing Ha bo Labo a o y P ess o he RNA Socie y
Cold Sp ing Ha bo Labo a o y P ess on No embe 11, 2022 - Published by najou nal.cshlp.o gDownloaded om